CONSTRUCTION OF HIGH-FIDELITY CRISPR/ASCPF1 MUTANT AND USES THEREOF

Abstract

A high-fidelity AsCpf1 mutant is obtained by performing a mutation on arginine at position 951 and/or 955 of a AsCpf1 protein amino acid sequence and replacing the same with an amino acid free of forming a hydrogen bond with DNA of a target site; and the amino acid sequence thereof is shown in SEQ ID NOS: 1-3. The encoding gene of the AsCpf1 mutant has a nucleotide sequence as shown in SEQ ID NO: 4 and can be used in the construction of a CRISPR/AsCpf1 gene editing system. A CRISPR/AsCpf1 gene editing system includes a gene encoding a AsCpf1 protein, and the AsCpf1 protein is the AsCpf1 mutant mentioned above. The CRISPR/AsCpf1 gene editing system can be used in lowering an off-target effect of gene editing. The novel AsCpf1 mutant not only retains the gene editing efficiency of wild-type AsCpf1, but also has a higher specificity than the wild-type AsCpf1.

Claims

1. An AsCpf1 mutant, wherein the AsCpf1 mutant is obtained by mutating arginine at position 951 of an amino acid sequence of AsCpf1 protein and replacing the arginine at the position 951 with a specific amino acid, and the specific amino acid does not form a hydrogen bond with DNA of a target site; or the AsCpf1 mutant is obtained by mutating arginine at position 955 of the amino acid sequence of the AsCpf1 protein and replacing the arginine at the position 955 with the specific amino acid; or an AsCpf1 mutant is obtained by mutating the arginine at the position 951 and the arginine at the position 955 of the amino acid sequence of the AsCpf1 protein and replacing the arginine at the position 951 and the arginine at the position 955 with the specific amino acid.

2. The AsCpf1 mutant according to claim 1, wherein the AsCpf1 mutant is obtained by mutating the arginine at the position 951 and the arginine at the position 955 of the amino acid sequence of the AsCpf1 protein and replacing the arginine at the position 951 and the arginine at the position 955 with the specific amino acid.

3. The AsCpf1 mutant according to claim 1, wherein the AsCpf1 mutant is obtained by mutating the arginine at the position 951 of the amino acid sequence of the AsCpf1 protein into lysine; and the AsCpf1 mutant has an amino acid sequence as shown in SEQ ID NO: 1; or the AsCpf1 mutant is obtained by mutating the arginine at the position 955 of the amino acid sequence of the AsCpf1 protein into alanine; and the AsCpf1 mutant has an amino acid sequence as shown in SEQ ID NO: 2; or the AsCpf1 mutant is obtained by mutating the arginine at the position 951 of the amino acid sequence of the AsCpf1 protein into lysine and the arginine at the position 955 of the amino acid sequence of the AsCpf1 protein into alanine; and the AsCpf1 mutant has an amino acid sequence as shown in SEQ ID NO: 3.

4. The AsCpf1 mutant according to claim 3, wherein the AsCpf1 mutant is obtained by mutating the arginine at the position 951 of the amino acid sequence of the AsCpf1 protein into lysine and the arginine at the position 955 of the amino acid sequence of the AsCpf1 protein into alanine; and the AsCpf1 mutant has the amino acid sequence as shown in SEQ ID NO: 3.

5. An encoding gene of the AsCpf1 mutant according to claim 1.

6. The encoding gene according to claim 5, wherein a nucleotide sequence of the encoding gene is shown in SEQ ID NO: 4.

7. A method of constructing a CRISPR/AsCpf1 gene editing system, comprising a step of using the encoding gene of claim 5.

8. A CRISPR/AsCpf1 gene editing system, comprising a gene encoding an AsCpf1 protein, wherein the AsCpf1 protein is the AsCpf1 mutant of claim 1.

9. The CRISPR/AsCpf1 gene editing system according to claim 8, wherein the CRISPR/AsCpf1 gene editing system further comprises a U6 promoter used for initiating an sgRNA expression of an encoding gene of the AsCpf1 mutant, a necessary element CrRNA for AsCpf1 gene editing, a eukaryotic promoter used for initiating an expression of the encoding gene of the AsCpf1 mutant and a splicing peptide sequence P2A.

10. A method of reducing off-target effect of gene editing, comprising a step of using the CRISPR/AsCpf1 gene editing system according to claim 8 for the gene editing.

11. The encoding gene according to claim 5, wherein the AsCpf1 mutant is obtained by mutating the arginine at the position 951 and the arginine at the position 955 of the amino acid sequence of the AsCpf1 protein and replacing the arginine at the position 951 and the arginine at the position 955 with the specific amino acid.

12. The encoding gene according to claim 5, wherein the AsCpf1 mutant is obtained by mutating the arginine at the position 951 of the amino acid sequence of the AsCpf1 protein into lysine; and the AsCpf1 mutant has an amino acid sequence as shown in SEQ ID NO: 1; or the AsCpf1 mutant is obtained by mutating the arginine at the position 955 of the amino acid sequence of the AsCpf1 protein into alanine; and the AsCpf1 mutant has an amino acid sequence as shown in SEQ ID NO: 2; or the AsCpf1 mutant is obtained by mutating the arginine at the position 951 of the amino acid sequence of the AsCpf1 protein into lysine and the arginine at the position 955 of the amino acid sequence of the AsCpf1 protein into alanine; and the AsCpf1 mutant has an amino acid sequence as shown in SEQ ID NO: 3.

13. The encoding gene according to claim 12, wherein the AsCpf1 mutant is obtained by mutating the arginine at the position 951 of the amino acid sequence of the AsCpf1 protein into lysine and the arginine at the position 955 of the amino acid sequence of the AsCpf1 protein into alanine; and the AsCpf1 mutant has the amino acid sequence as shown in SEQ ID NO: 3.

14. The method according to claim 7, wherein a nucleotide sequence of the encoding gene is shown in SEQ ID NO: 4.

15. The CRISPR/AsCpf1 gene editing system according to claim 8, wherein the AsCpf1 mutant is obtained by mutating the arginine at the position 951 and the arginine at the position 955 of the amino acid sequence of the AsCpf1 protein and replacing the arginine at the position 951 and the arginine at the position 955 with the specific amino acid.

16. The CRISPR/AsCpf1 gene editing system according to claim 8, wherein the AsCpf1 mutant is obtained by mutating the arginine at the position 951 of the amino acid sequence of the AsCpf1 protein into lysine; and the AsCpf1 mutant has an amino acid sequence as shown in SEQ ID NO: 1; or the AsCpf1 mutant is obtained by mutating the arginine at the position 955 of the amino acid sequence of the AsCpf1 protein into alanine; and the AsCpf1 mutant has an amino acid sequence as shown in SEQ ID NO: 2; or the AsCpf1 mutant is obtained by mutating the arginine at the position 951 of the amino acid sequence of the AsCpf1 protein into lysine and the arginine at the position 955 of the amino acid sequence of the AsCpf1 protein into alanine; and the AsCpf1 mutant has an amino acid sequence as shown in SEQ ID NO: 3.

17. The CRISPR/AsCpf1 gene editing system according to claim 16, wherein the AsCpf1 mutant is obtained by mutating the arginine at the position 951 of the amino acid sequence of the AsCpf1 protein into lysine and the arginine at the position 955 of the amino acid sequence of the AsCpf1 protein into alanine; and the AsCpf1 mutant has the amino acid sequence as shown in SEQ ID NO: 3.

18. The method according to claim 10, wherein the CRISPR/AsCpf1 gene editing system further comprises a U6 promoter used for initiating an sgRNA expression of an encoding gene of the AsCpf1 mutant, a necessary element CrRNA for AsCpf1 gene editing, a eukaryotic promoter used for initiating an expression of the encoding gene of the AsCpf1 mutant and a splicing peptide sequence P2A.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0029] FIG. 1 shows a plasmid profile of a pU6-CAG-AsCpf1-mCherry wild-type AsCpf1.

[0030] FIG. 2 shows a plasmid profile of a pU6-CAG-AsCpf1-KA-mCherry mutant AsCpf1-KA.

[0031] FIG. 3 shows a PAGE gel diagram of the targeted gRNA and mismatched gRNA of the wild-type AsCpf1 (AsCpf1-WT) and AsCpf1-KA (namely, AsCpf1 mutant) at DNMT1-site3.

[0032] FIG. 4 shows a PAGE gel diagram of the targeted gRNA and 2 off-target sites of the wild-type AsCpf1 and AsCpf1 mutant at Match-site6, where, Blank represents blank control, WT represents the wild-type AsCpf1 and KA represents the AsCpf1-KA mutant.

[0033] FIG. 5 shows a T7E1 gel diagram of the targeted gRNA and 2 off-target sites of the wild-type AsCpf1 and AsCpf1 mutant at Match-site6, wherein, Blank represents blank control, WT represents the wild-type AsCpf1 and KA represents the AsCpf1-KA mutant. (Left: cell line HEK293T, right: cell line MCF7; the black arrows represent the off-target cleavage conditions)

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0034] The prevent invention will be further described in combination with the detailed examples, but the prevent invention is not limited to the following examples. Unless otherwise specified, the technologies used in the following examples are conventional technologies known by a person skilled in the art; the instrument and equipment, reagents and the like used are obtained by a person skilled in the art via public approaches, e.g., commercial purchase.

EXAMPLE 1

Construction of a Recombinant Expression Plasmid

[0035] The pU6-CAG-AsCpf1-mCherry sequence is shown in SEQ ID NO: 5.

[0036] The wild-type pU6-CAG-AsCpf1-mCherry (FIG. 1) served as a vector (the nucleotide sequence thereof is shown in SEQ ID NO: 5), and the Gibson Assembly principle and technology was used to design the corresponding mutation primers for PCR, and finally ligation was performed to obtain pU6-CAG-AsCpf1-KA-mCherry (FIG. 2). Specific steps were as follows:

[0037] The pU6-CAG-AsCpf1-mCherry vector was firstly subjected to PmI I and BamHI enzyme digestion to obtain a backbone vector. The pU6-CAG-AsCpf1-mCherry served as a template and PCR amplification was performed respectively to obtain fragments containing mutation bases. The PCR primer sequences are as follows:

TABLE-US-00001 AsCpf1-Pml I-F: (SEQ ID NO: 6) 5′-ACCAGCGACAAGTTCTTTTTCCACGTGCCTATCA-3′; AsCpf1-KA-R: (SEQ ID NO: 7) 5′-CACAGACCAGGCCTGAGCGGCCGCCACCTTCTCCTTCTCCCTGTTG- 3′; AsCpf1-KA-F: (SEQ ID NO: 8) 5′-GAAGGAGAAGGTGGCGGCCGCTCAGGCCTGGTCTGTGGTGGGC-3′; AsCpf1-BamH I-R: (SEQ ID NO: 9) 5′-AAGCGTAATCTGGAACATCGTATGGGTAGGATCC-3′.

[0038] A plasmid pU6-CAG-AsCpf1-mCherry served as a template and NEB Q5 enzyme was used for PCR (50 μl system was as follows: 10 μl 5×reaction buffer; 10 μl 5×enhance GC buffer; 4 μl dNTP Mix 2.5 μm each; 2+2 μl F+R; Template: 2 ng DNA; water: up to 50 μl. Reaction conditions were as follows: the reaction was performed for 15 s at 98° C., and 35 cycles were performed (10 s at 98° C., 30 s at 58° C. and 1 kb/s at 72° C.), 10 min at 72° C., and hold at 4° C.), then electrophoresis was performed to obtain a single product, and a PCR purification kit was used for purification.

[0039] AsCpf1-Pml I-F and AsCpf1-KA-R were subjected to PCR; the product was named PCR-fragment 1;

[0040] AsCpf1-KA-F and AsCpf1-Bam H I-R were subjected to PCR; the product was named PCR-fragment 2;

[0041] The PCR fragment 1, PCR fragment 2 and a backbone vector fragment 3 which was obtained by performing double enzyme digestion on the pU6-CAG-AsCpf1-mCherry vector with restriction enzymes PmI I and BamHI were subjected to Gibson Assembly reaction with a Gibson Assembly kit, thus obtaining a target plasmid pU6-CAG-AsCpf1-KA-mCherry (FIG. 2). The plasmid was only used to mutate arginine R at position 951 on the amino acid sequence of the AsCpf1 protein in the pU6-CAG-AsCpf1-mCherry vector into lysine K (951R->K), and to mutate arginine R at position 955 thereof into alanine A (955R->A); and the mutated AsCpf1 mutant has an amino acid sequence as shown in SEQ ID NO: 3.

EXAMPLE 2

Specific Verification

[0042] To verify the better fidelity of the obtained mutant AsCpf1-KA (namely, AsCpf1 mutant) than the wild-type AsCpf1, the following experiment was designed for specificity verification:

[0043] (1) It has been reported in the literature (B P Kleinstiver, et al. Genome-wide specificities of CRISPR-Cas Cpf1 nucleases in human cells, Nature. 2016) that the wild-type AsCpf1 can also perform cleavage on some incompletely matched gRNA, in particular to positions 1, 2, 8, 9, 19, 20, 21, 22, and 23. That is, some gRNA base mismatches are allowed by the wild-type AsCpf1, namely, the specificity is ordinary. Therefore, by reference to the literature, gRNA directed to such a site of DNMT1-site3 was designed for verification, including gRNA at positions, such as the completely matched target site (ON), mismatched 1 (mm1), mismatched 8 (mm8), mismatched 9 (mm9), mismatched 19 (mm19), mismatched 20 (mm20). The specific sequence is as follows:

TABLE-US-00002 AsCpf1-gRNA-DNMT1-3-ON:  (SEQ ID NO: 10) CTGATGGTCCATGTCTGTTACTC; AsCpf1-gRNA-DNMT1-3-mm1:  (SEQ ID NO: 11) GTGATGGTCCATGTCTGTTACTC  (the underline represents  the mismatched position); AsCpf1-gRNA-DNMT1-3-mm8:  (SEQ ID NO: 12) CTGATGGACCATGTCTGTTACTC  (the underline represents  the mismatched position) ; AsCpf1-gRNA-DNMT1-3-mm9:  (SEQ ID NO: 13) CTGATGGTGCATGTCTGTTACTC  (the underline represents  the mismatched position);  AsCpf1-gRNA-DNMT1-3-mml9:  (SEQ ID NO: 14) CTGATGGTCCATGTCTGTAACTC  (the underline represents  the mismatched position); AsCpf1-gRNA-DNMT1-3-mm20:  (SEQ ID NO: 15) CTGATGGTCCATGTCTGTTTCTC  (the underline represents  the mismatched position).

[0044] pU6-pCAG-AsCpf1-mCherry and pU6-pCAG-AsCpf1-KA-mCherry respectively served as vectors, and BaeI enzyme digestion was performed to obtain a 9452 bp vector, thus synthesizing the corresponding gRNA-oligo-F and R; then the gRNA-oligo-F and R were annealed to obtain DNA sequences of gRNA; the vectors were linked to the completely matched or mismatched gRNA with a T4 ligase kit, thereby obtaining the plasmid:

[0045] pU6-CAG-AsCpf1-mCherry-ON (namely, pU6-CAG-AsCpf1-mCherry was linked to AsCpf1-gRNA-DNMT1-3-ON, and so on), pU6-CAG-AsCpf1-mCherry-mm1, pU6-CAG-AsCpf1-mCherry-mm8, pU6-CAG-AsCpf1-mCherry-mm9, pU6-CAG-AsCpf1-mCherry-mm19, pU6-CAG-AsCpf1-mCherry-mm20; pU6-CAG-AsCpf1-KA-mCherry-ON, pU6-CAG-AsCpf1-KA-mCherry-mm1, pU6-CAG-AsCpf1-KA-mCherry-mm8, pU6-CAG-AsCpf1-KA-mCherry-mm9, pU6-CAG-AsCpf1-KA-mCherry-mm19, and pU6-CAG-AsCpf1-KA-mCherry-mm20;

[0046] the above constructed 12 expression plasmids were transfected into HEK293T with a transfection reagent PEI, 48 h later, cells were digested, and genome DNA was extracted by a SDS pyrolysis method; then the genome DNA served as a template for PCR amplification. The primers are as follows:

TABLE-US-00003 DNMT1-3-PAGE-F: (SEQ ID NO: 16) 5′-CAAGTGCTTAGAGCAGGCGT-3′; DNMT1-3-PAGE-R:  (SEQ ID NO: 17) 5′-GTGACGGGAGGGCAGAACTA-3′.

[0047] The PCR reaction system was as follows:

[0048] gDNA: 50 ng; F+R primer: 0.5 μl; 2× PCR mix: 5 μl; water: up to 10 μl.

[0049] The reaction conditions were as follows: the reaction was performed for 5 min at 95° C., 40 cycles were performed (30 s at 95° C., 30 s at 58° C. and 20 s at 72° C.), 10 min at 72° C. and 5 min at 95° C.; then natural cooling was performed to room temperature.

[0050] 1) 2 μl PCR product was taken for sampling, then PAGE electrophoresis was performed at a constant current of 12 m Ah, when bromophenol blue bands moved to a position in front of about 1 cm away from the gel, the electrophoresis was stopped;

[0051] 2) after reaching the time point, the PAGE gel was slightly striped from the glass plate, and then put to a GelRed-containing solution for soaking for 3 min, and the soaked PAGE gel was photographed under ultraviolet light and observed;

[0052] 3) the PAGE gel was subjected to genotype identification to observe the editing efficiency and specificity conditions. The results are shown in FIG. 3. The results indicate that for the wild-type AsCpf1, an obvious cleavage effect (obvious hybrid bands appeared; particularly, the mismatch at position 20 displayed 28% editing efficiency basically the same with the matched gRNA) can be also detected by using the mismatched gRNA (positions 1, 8, 9, 19 and 20); while for the modified AsCpf1-KA, the cleavage effect detected by the mismatched gRNA (positions 1, 8, 9, 19 and 20) is obviously lower than that of the wild-type, and basically keeps below 10% and meanwhile maintains the efficiency almost the same with the wild-type (28%), being up to 24% editing efficiency.

[0053] (2) Moreover, it is reported in the literature that the wild-type AsCpf1 has obvious off-target sites on Match-site6. Therefore, the applicant picked out 2 of them for verification. Positions and sequences of the targeted gRNA and 2 off-target gRNA are as follows:

TABLE-US-00004 Chr3: Match-site6-ON: (SEQ ID NO: 18) GGGTGATCAGACCCAACAGCAGG; Chr2: Match-site6-OT1:  (SEQ ID NO: 19) GGGTGATCAGACCCAACACCAGG  (the underline represents  the mismatched position);

[0054] Chr8: Match-site6-OT2: GGGTGATCAGACCCAACACCAGG (the underline represents the mismatched position) (SEQ ID NO: 20).

[0055] Similarly, pU6-pCAG-AsCpf1-mCherry and pU6-pCAG-AsCpf1-KA-mCherry respectively served as vectors, and BaeI enzyme digestion was performed to obtain a 9452 bp vector, thus synthesizing the targeted gRNA-oligo-F and R; then the targeted gRNA-oligo-F and R were annealed to obtain DNA sequences of site6-ON-gRNA; the vectors were linked to the DNA sequences of gRNA with a T4 ligase kit, thereby obtaining the plasmid:

[0056] pU6-CAG-AsCpf1-mCherry-site6-ON

[0057] pU6-CAG-AsCpf1-KA-mCherry-site6-ON

[0058] The above constructed 2 expression plasmids were transfected into HEK293T or MCF7 with a transfection reagent PEI, 48 h later, cells were digested, and genome DNA was extracted by a SDS pyrolysis method; then the genome DNA served as a template for PCR amplification, and T7E1 and PAGE gels were applied for editing efficiency and specificity analysis. The primers used are as follows:

TABLE-US-00005 Site6-ON-F:   (SEQ ID NO: 21) 5′-CCACATCCTCACCACCTGTT-3′; Site6-ON-R:   (SEQ ID NO: 22) 5′-CCCACAGCCATCCAGCTC-3′; Site6-OT1-PAGE-F:   (SEQ ID NO: 23) 5′-ACACTACGATGGTCCCTGGTGC-3′; Site6-OT1-PAGE-R:   (SEQ ID NO: 24) 5′-TGGATGCTGGATGGCGTCACAT-3′; Site6-OT1-T7E1-F:  (SEQ ID NO: 25) 5′-AGCCAATATTATTACATTGCCGTT-3′; Site6-OT1-T7E1-R:  (SEQ ID NO: 26) 5′-TGGCGTCACATTAGTGCCAT-3′; Site6-OT2-PAGE-F:  (SEQ ID NO: 27) 5′-GACTTGGCTAGCTTGGGGAC-3′; Site6-OT2-PAGE-R:   (SEQ ID NO: 28) 5′-GCTGTGAGAAACCCCATGTT-3′; Site6-OT2-T7E1-F:  (SEQ ID NO: 29) 5′-GACAGTTCAGACCCTTGGGG-3′; Site6-OT2-T7E1-R:   (SEQ ID NO: 30) 5′-TGCTGTGAGAAACCCCATGTT-3′.

[0059] The specific T7E1 identification method is as follows:

[0060] 1) cell genome DNA was extracted;

[0061] 2) 50 ng gDNA was taken as a template for PCR amplification; and the system was as follows: gDNA: 50 ng; F+R primer: 2 μl; 2× PCR mix: 15 μl; water: up to 30;

[0062] the reaction conditions were as follows: the reaction was performed for 5 min at 95° C., 38 cycles were performed (30 s at 95° C., 30 s at 58° C. and 20 s at 72° C.), 10 min at 72° C. and Hold at 4° C.;

[0063] 3) the PCR product was purified, and then 300 ng DNA was taken for annealing;

[0064] DNA purification: 300 ng; NEB buffer 2: 2 ul; water: up to 20 μl;

[0065] the reaction conditions were as follows: the reaction was performed for 5 min at 95° C., then natural cooling was performed to room temperature, then 0.3 μl T7E1 incision enzyme was added for reacting for 4 h at 37° C., and electrophoresis was performed, then photographing and observation were performed under ultraviolet light.

[0066] The specific PAGE gel identification method is as follows:

[0067] 1) cell genome DNA was extracted;

[0068] 2) 50 ng gDNA was taken as a template for PCR amplification; and the system was as follows: gDNA: 50 ng; PAGE-F+R primer: 0.5 μl; 2× PCR mix: 5 μl; water: up to 10;

[0069] The reaction conditions were as follows: the reaction was performed for 5 min at 95° C., 40 cycles were performed (30 s at 95° C., 30 s at 58° C. and 20 s at 72° C.), 10 min at 72° C. and 5 min at 95° C.; then natural cooling to room temperature;

[0070] 3) 2 μl PCR product was taken for loading, and PAGE electrophoresis was performed at a constant current of 12 m Ah, when bromophenol blue bands moved to a position in front of about 1 cm away from the gel, the electrophoresis was stopped;

[0071] 4) after reaching the time point, the PAGE gel was slightly striped from the glass plate, and then put to a GelRed-containing solution for soaking for 3 min, and the soaked PAGE gel was photographed under ultraviolet light and observed.

[0072] The editing efficiency and specificity conditions displayed by the PAGE gel and T7E1 are shown in FIGS. 4 and 5. The results are consistent with the expected value, that is, the gene editing off-target efficiency of the mutant AsCpf1-KA is far below that of the wild-type AsCpf1. PAGE and T7E1 results show that the cleavage (off-target cleavage) efficiency is far below that of the wild-type either at a DNMT1-Site3 where gRNA is incompletely matched to the target site or at a completely matched Match-site6. Moreover, it can be obviously observed that the mutant AsCpf1-KA has better fidelity and may reduce 2 known off-target sites of the Match-site6 below the limit of detection in different cell lines (293T or MCF7 cell line), shown by the black arrows. All of these results indicate that the AsCpf1-KA mutant not only has better targeted cleavage activity, but also has better specificity than the wild-type AsCpf1 and thus, is a high-fidelity CRISPR nuclease.

[0073] What is described above are merely preferred embodiments of the present invention. It should be indicated that the above preferred embodiments should be not construed as limiting the prevent invention; and the protection scope of the prevent invention should be subject to the scope defined by the claims. A person skilled in the art may further make several improvements and embellishments within the spirit and scope of the present invention, and these improvements and embellishments shall fall within the protection scope of the present invention.