ANTITUMOR VIRUS

Abstract

Disclosed is a virus inhibiting Wnt signaling and a method for Wnt signaling using the virus. Also disclosed is a method for treating tumors using the virus.

Claims

1-3. (canceled)

4. A method for treating a tumor comprising administering an enterovirus using KRM1 as a receptor to a subject in need thereof.

5. The method according to claim 4, wherein the virus is engineered.

6. The method according to claim 5, wherein the genome of the engineered virus further comprises a nucleotide sequence encoding an additional tumor therapeutic agent.

7. The method according to claim 4, wherein the virus is administered to the subject by digestive tract route and/or by injection route, for example by a route selected from the group consisting of oral administration, intratumoral injection, paracancerous injection, intramuscular injection and intravenous injection.

8. The method according to claim 4, further comprising administering to the subject an additional anti-tumor therapy.

9. The method according to claim 8, wherein the additional anti-tumor therapy is selected from the group consisting of chemotherapy, radiotherapy, targeted therapy and immunotherapy.

10-13. (canceled)

14. A pharmaceutical composition comprising an enterovirus using KRM1 as a receptor, for use in inhibiting the growth of a tumor cell or treating a tumor.

15. The pharmaceutical composition according to claim 14, wherein the virus is selected from the group consisting of CV-A2, CV-A3, CV-A4, CV-A5, CV-A6, CV-A10 and CV-A12.

16. The pharmaceutical composition according to claim 15, wherein the us is CV-A10.

17. The pharmaceutical composition according to claim 14, wherein the virus is engineered.

18. The pharmaceutical composition according to claim 14, wherein the genome of the virus further comprises a nucleotide sequence encoding an additional tumor therapeutic agent.

19. The pharmaceutical composition according to claim 14, wherein the virus was deposited in the China General Microbiological Culture Collection Center on Jan. 19, 2020 with an accession number of CGMCC NO. 19294.

20. The method according to claim 4, wherein the virus is selected from the group consisting of CV-A2, CV-A3, CV-A4, CV-A5, CV-A6, CV-A10 and CV-A12.

21. The method according to claim 4, wherein the virus is CV-A10.

22. The method according to claim 4, wherein the tumor cell is a cell derived from the group consisting of colon cancer, melanoma, prostate cancer, lung cancer, liver cancer, hepatocellular carcinoma, cervical cancer, uterine cancer, pancreatic cancer, gastric cancer, esophageal carcinoma, brain cancer, nail matrix cell cancer and breast cancer.

23. The method according to claim 4, wherein the virus is selected from the group consisting of CV-A2, CV-A3, CV-A4, CV-A5, CV-A6, CV-A10 and CV-A12.

24. The method according to claim 4, wherein the virus is CV-A10.

25. The method according to claim 4, wherein the tumor is selected from the group consisting of colon cancer, melanoma, prostate cancer, lung cancer such as non-small cell lung cancer, liver cancer, hepatocellular carcinoma, cervical cancer, uterine cancer, pancreatic cancer, gastric cancer, esophageal carcinoma, brain cancer, nail matrix cell cancer and breast cancer.

26. The method according to claim 25, wherein the tumor is colon cancer, melanoma, prostate cancer or lung cancer.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0031] FIG. 1 shows a transmission electron microscope (TEM) image of CV-A10. Scale bar: 100 nm.

[0032] FIG. 2 shows that CV-A10 inhibited the growth of human colon cancer RKO cells in vitro, and this inhibitory effect was positively correlated with virus titer and gradually increased with time (A); EV-A71 infected RKO cells as a control (B).

[0033] FIG. 3 shows tumor growth before and after injection of CV-A10 virus in NCG mice inoculated with colon cancer RKO cells. (A) Statistical results of intratumoral injection of CV-A10 virus, (B) schematic diagram of tumor size after intratumoral injection, (C) statistical results of intravenous injection of CV-A10 virus, and (D) schematic diagram of tumor size after intravenous injection.

[0034] FIG. 4 shows the purification and SDS-PAGE identification of recombinant KRM1 protein.

[0035] FIG. 5 shows the structure of KRM1 and CV-A10 complex (A), binding site of KRM1 and CV-A10 (B), and binding site of KRM1 and DKK1 (C).

[0036] FIG. 6 shows the relative expression levels of reporter genes in virus-infected cells. CV-A10 inhibited the expression of downstream genes of Wnt/β-catenin signaling pathway in RD cells (A, B) and 293T cells (C, D), while the control EV-71 did not show a significant inhibitory effect, and DKK1 exhibited an inhibitory effect close to that of CV-A10.

[0037] FIG. 7 shows that CV-A10 led to the degradation of β-catenin in RKO cells, and this effect was positively correlated with viral load and enhanced with increasing viral load.

[0038] FIG. 8 shows the expression profiling of KRM1 in different stages of cancer (A) and different tumors (B).

[0039] FIG. 9 shows increased KRM1 expression in RKO cells after CV-A10 infection.

[0040] FIG. 10 shows that CV-A10 inhibited the growth of human lung cancer cell lines MRCS, PC3, Calu-1 and NCI-h1299, and the inhibitory effect was positively correlated with virus titer and gradually increased with time.

DETAILED DESCRIPTION

Definitions

[0041] Unless otherwise specified, terms used herein have the meanings commonly understood by those skilled in the art. Definitions of some terms used herein are provided below, and in the event of other interpretations of these terms, the definitions given herein shall prevail.

[0042] As used herein, the term “virus”, such as “enterovirus”, includes wild-type virus strains isolated directly from the environment or from diseased individuals, as well as various virus variants derived from such wild-type viruses. On the other hand, in addition to viral particles produced by conventional infection, the term “virus” also includes viral particles and virus-like particles (VLPs) produced by human intervention in one or more processes of viral replication, assembly, and the like.

[0043] The term “engineered virus” as used herein refers to a virus or a variant thereof, different from a wild-type virus, which has been genetically engineered for the purposes described herein or for other purposes.

[0044] As used herein, the term “treat”, “treating” or “treatment” refers to any procedure that is beneficial to the health condition of the target subject, such as preventing the occurrence of disease, reducing the risk of developing disease, slowing or impeding the progression of disease, inhibiting or arresting the growth of disease-related cells or entities (such as tumor cells or tumors entities), killing disease-related cells (such as tumor cells), shrinking disease-related entities (such as tumor entities), reducing or eliminating disease-related symptoms, preventing or slowing the occurrence or development of disease-related complications, inhibiting or slowing metastasis of disease, and improving the survival rate of a diseased subject.

[0045] The term “anti-tumor therapy” as used herein refers to any treatment that contributes to preventing or delaying the occurrence of tumor, reducing the risk of developing tumor, slowing or impeding the progression of tumor, inhibiting or arresting the growth of tumor cells or tumors entities, killing tumor cells, arresting the growth of or shrinking tumor entities, reducing or eliminating tumor-related symptoms (such as tumor pain), preventing or slowing the occurrence or development of tumor-related complications, inhibiting or slowing tumor metastasis, or improving the survival rate of a diseased subject. Anti-tumor therapy can be, for example, one or more of surgical resection, chemotherapy, radiotherapy, targeted therapy, and immunotherapy. In medical practice, in order to alleviate or eliminate the unhealthy state of a diseased subject, medical professionals often select one or more applicable tumor treatments.

[0046] The terms “Wnt pathway”, “Wnt/β-catenin pathway” as used herein refer to the signaling process mediated via Wnt and its receptor. The Wnt pathway is an important pathway for intracellular signal transmission and widely involved in a variety of physiological and pathological processes. The term “inhibiting Wnt signaling pathway” refers to causing the Wnt signaling pathway that mediates a physiological process to change in the opposite direction to the physiological process, and is sometimes referred to as negatively regulating Wnt signaling pathway.

[0047] The term “selected from” as used herein refers to selecting from a plurality of candidates. When applicable, the “selected from” may be the selection of one or more candidates from a plurality of candidates, unless otherwise stated.

EXAMPLES

[0048] The embodiments of the present disclosure will be described in detail below in conjunction with the examples. Those skilled in the art will understand that the following examples are only for illustrating the present disclosure and should not be construed as limiting the scope of the present disclosure. If the specific conditions are not indicated in the examples, it is carried out according to the conventional conditions or the conditions suggested by the manufacturer. The reagents or instruments used without indicating the manufacturer are conventional products that can be purchased from the market.

Example 1: Amplification and Purification of CV-A10 Virus

[0049] Coxsackievirus A10 (CV-A10) HB09-035 strain was isolated in Hebei Province in 2009. The virus strain was deposited in the China General Microbiological Culture Collection Center (No. 3, No. 1, West Beichen Road, Chaoyang District, Beijing, China) on Jan. 19, 2020 with an accession number of CGMCC NO. 19294. Human rhabdomyosarcoma cells (RD cells, ATCC CCL-136) were cultured in DMEM medium containing 10% fetal bovine serum. 5×10.sup.7 cells were seeded in a 15 cm dish and incubated at 37° C., 5% CO.sub.2 for 24 hours. The medium was discarded, and CV-A10 virus seed, diluted with DMEM medium, was added to the dish according to the multiplicity of infection (MOI)=0.1 and cultured for 36 hours. When 90% cytopathic effect (CPE) was observed under microscope, the supernatant was collected for concentrating the virus and cell pieces were removed by using KrosFlo® TFF systems 300 kD. Then ultracentrifugation was carried out at 140,000 g for 2 hours and the supernatant was discarded. The virus pellet was slowly resuspended in PBS (pH 7.4) and transferred into a microcentrifuge tube. The virus resuspension was centrifuged at 140,000 g for 4 hours in a 15%-45% sucrose density gradient. Each 200 μl (as one layer) was collected in separate tubes, and an equal volume of PBS was added to reduce the osmotic pressure of the solution. The samples with OD260/280 greater than 1.5 were examined by transmission electron microscope, and the samples with relatively more mature virus particles were reserved (as shown in FIG. 1). The virus was stored in PBS solution for later use, and the concentration and titer were measured.

Example 2: CV-A10 Inhibits the Growth of Human Colon Cancer RKO Cells

[0050] The colon cancer cell line RKO (ATCC CRL-2577) was cultured, and 2×10.sup.4 cells were transferred into a 96-well plate and cultured for 8 h. The culture medium was changed to serum-free DMEM medium. Cells were infected with virus at different titers (MOI=0.001-10) and cultured at 37° C., and cell viability was determined at different time points. Viability assay was performed using the CellTiter-Glo Luminescent Cell Viability Assay kit (Promega) according to the user manual. The results are shown in FIG. 2A. After 12 h of infection with high titer virus (MOI=10), the cell viability began to decline, and almost all cells died at 48 h. Lower titer virus (MOI=1) also caused almost all cancer cells to die after 60 h. Viruses of other titers produced gradients of inhibitory effect at different times. The virus of the lowest titer (MOI=0.001) also showed inhibition on cell growth at 72 h. These results indicated that CV-A10 inhibited the growth of colon cancer RKO cells in vitro, and the effect was positively correlated with virus titer and infection time. Experiments with EV-A71 under the same conditions showed that EV-A71 had no significant inhibitory effect on the growth of human colon cancer RKO cells until 48 h (FIG. 2B), indicating that the effect of CV-A10 was specific.

Example 3: Intratumoral or Intravenous Injection of CV-A10 Inhibits Growth of Solid Tumor in Mice

[0051] A total of fifteen 4-week-old NCG mice (17-19 g) were selected and injected with 5×10.sup.6 RKO cells/mouse on the back. After inoculation, the tumor formation on the back was observed after feeding for 5 days. When the tumors grew to 120 mm.sup.3, mice were treated once every 3 days, that is, intratumoral injection or intravenous injection of CV-A10 virus was performed on Day 5, 8, 11, 14, and 17. A Control groups were set up, with 5 animals in each group. Among them, mice in the intratumoral injection group were given intratumoral injection at multiple positions, and mice in the intravenous injection group were given single injection via tail vein, and the therapeutic dose was 1×10.sup.7 virions/time. In the control group, multiple intratumoral injections of PBS were performed to exclude manipulation errors in the corresponding treatment groups. Every two days, the body weight of the mice was recorded and the long and short diameters of the tumors were measured with vernier calipers and recorded for 20 consecutive days. Mice were sacrificed 20 days after tumor cell inoculation, and tumors were removed and measured for volume. From the tumor volume data, it can be seen that the tumor sizes were significantly different on Day 11 (after 2 treatments, 6 days after treatment) in the intratumoral injection group and on Day 13 (after 3 treatments, 8 days after treatment) in the intravenous injection group. The results demonstrated that either intratumoral injection (FIGS. 3A-3B) or intravenous injection (FIGS. 3C-3D) of CV-A10 could inhibit tumor growth.

Example 4: Expression and Purification of KRM1 Receptor Protein

[0052] The DNA sequence (Genbank No. AAH63787) encoding the extracellular region (amino acids 23-373) of human Kremen 1 (KRM1) was ligated into the pCMV3 vector (Beijing Sino Biological, Inc.) through restriction sites HindIII and BamHI. The sequence of KRM1 protein was added with human type II interferon signal peptide at the 5′ end and the coding sequence of the 10 histidine affinity tag (His10-tag) and a stop codon at the 3′ end (the inserted sequence is shown in SEQ ID NO. 1), and plasmid pCMV3-KRM1-ectodomain was obtained. 1×10.sup.7 293 T cells were seeded and cultured in a 15 cm cell culture dish containing 20 ml of DMEM medium. After the cells reached 70% confluence, transfection of plasmid was performed. 50 μg plasmid and 150 μl transfection reagent PEI (1 mg/ml) were prepared in buffer HBS (20 mM HEPES, 150 mM NaCl, pH 7.4). A total of 2 ml of the transfection system was mixed at room temperature for 30 min and added to the 15 cm culture dish in which 293T cells were cultured. After 6 hours of transfection, the supernatant was discarded, and the medium was changed to DMEM medium without serum and transfection reagent to culture for another 3 days. After 3 days, the culture supernatant was collected, purified by nickel ion affinity chromatography (HisTrap™ HP (GE)) and gel filtration chromatography (Superdex™ 200 increase 10/300 GL (GE)) to obtain soluble human KRM1 extracellular region protein. The protein purity was identified by SDS-PAGE (as shown in FIG. 4). After identification, a high-purity KRM1 protein with a size of about 70 kDa was obtained.

[0053] The sequence encoding the extracellular region of recombinant human KRM1 is as follows:

TABLE-US-00001 (SEQ ID NO. 1) AAGCTTGCCACCATGGGCATTCTGCCCAGCCCCGGCATGCCCGCTCTGCT GTCTCTGGTGTCTCTGCTGAGCGTGCTGCTGATGGGCTGCGTGGCTGAGA CCGGAGCTCCTTCCCCCGGACTGGGACCCGGACCCGAGTGCTTTACCGCC AACGGCGCCGACTACAGAGGAACACAGAATTGGACCGCTCTGCAAGGAGG AAAGCCTTGTCTGTTCTGGAACGAGACATTCCAACACCCCTACAACACCC TCAAGTACCCCAACGGAGAGGGAGGACTGGGAGAACACAACTACTGCAGA AACCCCGACGGCGATGTGAGCCCTTGGTGCTACGTCGCCGAACACGAGGA CGGAGTCTACTGGAAGTACTGCGAAATCCCCGCTTGCCAAATGCCCGGCA ATCTGGGCTGCTACAAGGATCACGGAAACCCCCCTCCCCTCACCGGCACC TCCAAGACCTCCAACAAGCTCACCATCCAGACATGCATCAGCTTCTGCAG ATCCCAGAGGTTTAAGTTCGCCGGCATGGAGTCCGGCTATGCTTGCTTCT GCGGCAACAACCCCGACTATTGGAAGTACGGCGAAGCTGCCAGCACCGAG TGCAATTCCGTGTGCTTCGGCGATCACACCCAGCCTTGCGGAGGAGACGG AAGAATCATTCTGTTTGACACACTGGTGGGCGCTTGCGGCGGAAACTACT CCGCCATGAGCAGCGTGGTGTACAGCCCCGACTTCCCCGACACCTACGCC ACCGGCAGAGTGTGTTACTGGACCATTAGAGTGCCCGGCGCCAGCCACAT CCACTTTAGCTTCCCTCTGTTCGACATTAGAGATAGCGCTGACATGGTCG AGCTGCTGGATGGATACACCCATAGGGTGCTGGCTAGATTCCACGGAAGG AGCAGACCTCCTCTGTCCTTCAACGTCTCTCTGGACTTCGTGATTCTGTA CTTCTTCAGCGATAGAATCAACCAAGCCCAAGGCTTCGCCGTCCTCTATC AAGCCGTGAAAGAGGAGGGCAGCGAGAACCTCTACTTTCAAGGCGGATCT CTGCCCCAAGAGAGACCCGCCGTCAACCAAACAGTGGCCGAGGTGATTAC AGAGCAAGCCAATCTGAGCGTGTCCGCTGCTAGAAGCTCCAAGGTGCTGT ATGTGATCACCACCTCCCCTAGCCATCCCCCCCAGACAGTGCCCGGCACA CACCACCACCACCATCACCACCATCATCACTGAGGATCC.

Example 5: The Binding Pattern and Interaction Process of KRM1 and CV-A10 are Similar to Those of KRM1 and DKK1

[0054] The purified CV-A10 and the KRM1 protein in Examples 1 and 4 were incubated in vitro. The purified CV-A10 virus (2 mg/ml) was incubated with an excess of KRM1 (0.2 mg/ml) for 5 minutes, and then the obtained complex was adsorbed on copper grids coated with ultrathin carbon film (Lacey carbon, Electron Microscopy China). After 1 minute of adsorption, the extra virus on the surface of the copper grids was removed with filter paper, quickly inserted into liquid ethane with the aid of the Vitrobot Mark IV (FEI), a freezing sample preparation machine, and then transferred to liquid nitrogen to preserve the samples. Data collection was done using a 200 kV Arctica (FEI) electron microscope equipped with a Gatan K2 direct electron detector. All the original electron microscope photos were drift-corrected by the MotionCor2 program. The contrast transfer function (CTF) correction was calculated by CTFFIND4, and the particles were automatically selected by EMAN2. Finally, the CV-A10/KRM1 complex structure at a resolution of 3.0 Å was obtained by Relion calculation. The final resolution was estimated from the Fourier shell correlation (FSC) curve. By simulating the neutral environment of extracellular pH 7.4 under physiological conditions, it is confirmed that KRM1 binds to CV-A10 virus through its Kringle (KR) and WSC domains, and the binding pattern was basically the same as that of KRM1 and DKK1 in the Wnt/β-catenin signaling pathway. As shown in FIG. 5, by comparing the binding pattern of KRM1 with DKK1 (PDB code: 5FWW), it is showed that CV-A10 could mimic DKK1 to inhibit the Wnt/β-catenin signaling pathway.

Example 6: CV-A10 Inhibits Wnt/β-Catenin Signaling Pathway

[0055] In this example, EV-A71 virus, as a control group, was purified by a method similar to the amplification and purification of CV-A10 in Example 1. The plasmid encoding full-length KRM1 was constructed with reference to the similar method of Example 4, that is, the amino acids 1-473 coding sequence (Genbank number: AAH63787) was ligated into the vector pLVX-DsRed-Monomer-N1 (Clontech) through 5′Xhol and 3′NotI restriction sites, and a Flag tag and stop codon was added at the 3′ end. Cells were transfected to exogenously overexpress KRM1.

[0056] The 293T or RD cells were cultured in a 24-well cell culture plate, and the reporter gene plasmid Top-Flash (Beyotime, D2501) and the internal reference control pRenilla-TK plasmid were transfected into the cells. One group of which was also added with the plasmid overexpressing full-length KRM1. The transfection system was as follows: 3 replicate wells in each group, 90 μl HBS solution, 70 μl PEI (0.1 mg/ml) and 2 μg plasmid. DMEM medium was changed 6 hours after transfection. After 12 hours of transfection, Wnt3a (R&D, 1324-WN-500/CF) was added to the culture medium, and cells were infected with CV-A10 or EV-A71 virus (MOI=1), respectively. After 24 hours of treatment, cells were lysed for luciferase activity detection. As shown in FIG. 6, CV-A10 had a significant inhibitory effect on the Wnt/β-catenin signaling pathway, and this effect was enhanced when KRM1 was overexpressed (FIGS. 6B and 6D), basically blocking the activation effect of Wnt3a on signaling. While the EV-A71 virus had no effect on the expression of the reporter gene (FIGS. 6A and 6B). Therefore, CV-A10 can act as a Wnt/β-catenin pathway inhibitor. In addition, when DKK1 protein (50 ng/ml, purchased from Beijing Sino Biological, Inc.) was added to the 293T group, both DKK1 and CV-A10 showed inhibitory effects on the Wnt/β-catenin signaling pathway, and the inhibitory effects were not multiplied upon simultaneous addition of DKK1 and CV-A10 (FIGS. 6C and 6D). The results confirmed again that CV-A10 inhibited the Wnt/β-catenin signaling pathway through the viral receptor KRM1. The binding epitope of CV-A10 to KRM1 was similar to that of DKK1, and these two competed for binding with KRM1.

Example 7: CV-A10 Leads to the Degradation of β-Catenin and Thereby Inhibits the Wnt/β-Catenin Pathway

[0057] RKO colon cancer cells were cultured in 6-well plates at 1×10.sup.6. After 12 h, when the cells confluence reached 90%, the cells were infected with CV-A10 (MOI=1) and viruses of different titers (MOI=0.001-10), and continued to culture at 37° C. RKO cells infected with CV-A10 (MOI=1) were washed twice with PBS at 36 h, and lysed with IP lysis buffer for Western blot detection. Cells infected with different titers of virus (MOI=0.001-10) were washed twice with PBS at 12h, 24 h, 36h, 48h, 60h, and 72h, respectively, and lysed with 200 μl of IP lysis buffer for Western blot detection. As shown in FIG. 7, the expression of β-catenin in RKO cells decreased with the increase of infection time (FIG. 7A); under the same infection time, β-catenin decreased with the increase of the amount of virus added (FIG. 7B). This indicated that CV-A10 inhibited the Wnt/β-catenin pathway by degrading β-catenin. Similar results were obtained with 293T cells infected with CV-A10 (FIG. 7C).

Example 8: Tissue Expression Profile of KRM1, a Key Receptor of CV-A10 Invasion

[0058] Analysis with The Cancer Genome Atlas (TCGA) database found that there was no significant difference in the expression level of KRM1 at different stages of cancer (FIG. 8A). However, it is worth noting that the expression of KRM1 varied greatly in different tumors, and the expression was higher in some tumors such as chromophobe renal cell carcinoma (KICH), lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC) and renal clear cell carcinoma (KIRC), and especially in colon cancer, in which the expression level was significantly higher than that in normal tissues (FIG. 8B). This suggests that CV-A10 may have a more significant therapeutic effect on these tumors.

[0059] It was further found by in vitro immunofluorescence experiments that the expression of KRM1 in RKO cells increased after infection with CV-A10 (FIG. 9). This result indicates that cells infected with CV-A10 cause the increase of KRM1 expression in cells, making the cells to be infected by more viruses, playing a positive feedback role.

Example 9: CV-A10 Reduces Survival of Lung Cancer Cells

[0060] MRCS (ATCC, CCL-171), PC3 (ATCC, CRL-1435), Calu-1 (ATCC, HTB-54) and NCI-h1299 (ATCC, CRL-5083) lung cancer cell lines were cultured respectively, and 2×10.sup.4 cells were plated in 96-well plates. After 8 h of culture, the medium was changed to serum-free DMEM medium, and cells were infected with virus of different titers (MOI=0.001-10) to continue the culture at 37° C. Cell viability was determined at various time points using the CellTiter-Glo™ Luminescent Cell Viability Assay assays kit (Promega). As shown in FIG. 10 (A-D), after 12 h, in the 4 lung cancer cells infected with high titers of virus (MOI=10), the cell viability began to decline, and almost all cells died at 48 h. Virus having a titer of MOI=1 also caused almost all cancer cells to die after 60 h. Viruses of other titers produced gradients of inhibitory effect at different times. The lowest titer (MOI=0.001) also showed inhibition of cell growth at 72 h. These results indicated that CV-A10 could lead to a decrease in the survival rate of lung cancer cells, and the effect was positively correlated with virus titer and infection time.