Multiplexed Assay Using Differential Fragment Size to Identify Cancer Specific Cell-Free DNA
20230054587 · 2023-02-23
Inventors
- Sudhir Sinha (Metairie, LA)
- Gary SPITZER (Greenville, SC, US)
- Hiromi BROWN (Baton Rouge, LA, US)
- Patrick HALL (Edmond, OK, US)
Cpc classification
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
Abstract
A retrotransposable element-based multiplexed quantitative polymerase chain reaction (qPCR) assay system to quantitate and distinguish cell free DNA integrity and concentration in blood, plasma, and serum as a measure of minimum residual disease, therapeutic effectiveness, neoadjuvant effectiveness in a patient having stage I, stage II, stage III, or stage IV cancer, and disease progression, thereby improving patient outcomes.
Claims
1. A method to quantitate the integrity of circulating cell free human DNA and implement a treatment of a patient, said method comprising: (a) providing a first and second sample of serum, plasma, urine, or other biological fluid from a subject wherein the first and second samples are obtained at least one week apart, at least 2 weeks apart, at least 3 weeks apart or at least 4 weeks apart, the first and second samples comprising cell free human DNA (cfDNA), the cfDNA comprising (i) a first and second short retrotransposable interspersed element (RE) target sequence having a length of between about 60 base pairs to about 135 base pairs and (ii) a long RE target sequence having a length of between 200 bp and 300 bp, wherein the first and second short targets differ in length; (b) quantitating each of the short and long RE targets in the first and second samples using a quantitative polymerase chain reaction (qPCR) method; (c) obtaining for each of the quantitated RE targets in the first and second samples a threshold cycle number; (d) comparing the threshold cycle number of each quantitated RE target with a standard curve to determine an amount of each of the quantitated RE targets that were present in the samples, wherein the amount of short RE targets in the second samples is indicative of the integrity of the circulating cell free DNA; (e) determining an increase in the amount of short RE targets in the second sample as compared to the first sample above a threshold level, and (f) implement a treatment of a patient having an increase in the amount of short RE targets in the second sample as compared to the first sample above a threshold level.
2. The method of claim 1 wherein the sample is a plasma sample.
3. The method of claim 1 wherein the first sample is obtained from the subject prior to administration of a neoadjuvant and the second sample is obtained from the subject after the neoadjuvant is administered and before another therapy is administered.
4. The method of claim 3, wherein the subject has a stage I, stage II or stage III cancer.
5. The method of claim 1 wherein the first sample is obtained from the subject prior to administration of a cycle of therapy and the second sample is obtained from the subject after the cycle of therapy is administered and before a next cycle of therapy is administered.
6. The method of claim 1, wherein steps (a) through (f) are repeated through multiple cycles of therapy.
7. The method of claim 6, wherein an increase in the amount of short RE targets in the second sample as compared to the first sample above a threshold level identifies the therapy as ineffective.
8. The method of claim 1, wherein an increase in the amount of short RE targets in the second sample as compared to the first sample above a threshold level identifies the patient as having progressive disease.
9. The method of claim 1, wherein an increase in the amount of short RE targets in the second sample as compared to the first sample above a threshold level identifies the patient as having minimum residual disease (MRD).
10. The method of claim 1, wherein the retrotransposable interspersed element is an ALU, SVA, or LINE element.
11. The method of claim 1, wherein the retrotransposable interspersed element has a copy number in excess of 1000 copies per genome.
12. The method of claim 1 wherein the short RE targets has a length from 70 bp to about 130 bp, or from 60 bp to 120 bp.
13. The method of claim 1 wherein the first short RE targets has a length between 70 and 80 bp, and the second short RE target has a length between 105 and 120 bp.
14. The method of claim 1 wherein the qPCR method uses primer pairs set forth in Table 2A, 2B or 2C.
15. The method of claim 1, wherein the forward primer and reverse primer pair for amplifying the short target sequence are selected from the following forward and reverse primer pairs, TABLE-US-00005 Fragment Primer SEQ ID name Size Type Primer Sequence NO Yb8-80bp 80bp Forward GGAAGCGGAGCTTGCAGTGA 1 Reverse AGACGGAGTCTCGCTCTGTCGC 2 Yb8-71bp 71bp Forward CTTGCAGTGAGCCGAGATT 4 Reverse GAGACGGAGTCTCGCTCTGTC 5 Yb8-97bp 97bp Forward GTGGCTCACGCCTGTAAT 7 Reverse GTGGCTCACGCCTGTAAT 7 Yb8-105bp 105bp Forward AGGCAGGAGAATGGCGTGAACC 10 Reverse AGACGGAGTCTCGCTCTGTCGC 11 Yb8-120bp 120bp Forward TGGATCATGAGGTCAGGAGAT 15 Reverse CCGAGTAGCTGGGACTACA 16 SVA-100bp 100bp Forward AATGGCGGCTTTGTGGAATA 20 Reverse GTCTCCCATGTCTACTTCTTTCTAC 21 SVA-101bp 101bp Forward AACCCTGTGCTCTCTGAAAC 23 Reverse ACGCTGCCTTCAAGCAT 24 SVA-103bp 103bp Forward GCCCAACAGCTCATTGAGAA 25 Reverse ACGGCAACCATCCGATTT 26 SVA-104bp 104bp Forward TGTCCACTCAGGGTTAAATGG 27 Reverse GATTAGGGATTGGTGATAACTCTTA 28 SVA-106bp 106bp Forward TGTGTCCACTCAGGGTTAAAT 30 Reverse GATTAGGGATTGGTGATGACTCT 31 SVA-106bp-v2 106bp Forward TGTGCCCAACAGCTCATT 33 Reverse ACGGCAACCATCCGATTT 34 SVA-116bp 116bp Forward CTGTGTCCACTCAGGGTTAAATG 35 Reverse ATTACTTGAGATTAGGGATTGGTGATG 36 SVA-116bp-v2 116bp Forward CCCAACAGCTCATTGAGAACG 38 Reverse CTTTCTACACAGACACGGCAA 39 SVA-118bp 118bp Forward CTCTCTGAAACATGTGCTGTGT 40 Reverse GGGATTGGTGATGACTCTTAACG 41 SVA-118bp-v2 118bp Forward CTGTGTCCACTCAGGGTTAAAT 43 Reverse TGATTACTTGAGATTAGGGATTGGT 44 SVA-126bp 126bp Forward CTGTGTCCACTCAGGGTTAAAT 46 Reverse TGTGTCCCTGATTACTTGAGATTAG 47 SVA-126bp- 126bp Forward CCTGTTGATCTGTGACCTTACC 48 V2 Reverse ACGCTGCCTTCAAGCAT 49 SVA-128bp 128bp Forward GTTGCCGTGTCTGTGTAGAA 51 Reverse TTTCAGAGAGCACAGGGTTG 52 SVA-132bp 132bp Forward AACCCTGTGCTCTCTGAAAC 54 Reverse GATTAGGGATTGGTGATAACTCTTA 55 and the forward primer and reverse primer pairs for amplifying the long target sequence are selected from the following forward and reverse primer pairs, TABLE-US-00006 Primer SEQ Name Size Type Primer Sequence ID NO Yb8-105bp 105bp Forward AGGCAGGAGAATGGCGTGAACC 10 Reverse AGACGGAGTCTCGCTCTGTCGC 11 Yb8-120bp 120bp Forward TGGATCATGAGGTCAGGAGAT 15 Reverse CCGAGTAGCTGGGACTACA 16 SVA-257bp 257bp Forward CCTGTGCTCTCTGAAACATGTGCT 60 Reverse GATTTGGCAGGGTCATGGGACAAT 61 SVA-265bp 265bp Forward ATGTGCTGTGTCCACTCAGGGTTA 63 Reverse ATTCTTGGGTGTTTCTCACAGAGG 64 Line1-252bp 252bp Forward CACAATAGCAAAGACTTGGAACC 77 Reverse CCCTTCCTGTGTCCATGTG 78 Probe CCTTTGTAGGGACATGGATGAAAGTGGA 79 Line1-257bp 257bp Forward GACTTGGAACCAACCCAAATG 80 Reverse CCCAGAGTGTGACGTTCC 81 Probe AGTGAGAACACATGGACACAGGAAGG 82 Line1-262bp 262bp Forward GTGGCACATATACACCATGGAA 83 Reverse CGTTAGGTATATCTCCCAATGCTATC 84 Probe TGAGAACACATGGACACAGGAAGGG 85 Line1-266bp 266bp Forward ACTTGGAACCAACCCAAATG 86 Reverse CACAACAGTCCCCAGAGTG 87 Probe TGAGAACACATGGACACAGGAAGGG 88 Line1-267bp 267bp Forward CATGGAATACTATGCAGCCATAAA 89 Reverse CCCACTAACTCGTCATCTAGC 90 Probe TGAGAACACATGGACACAGGAAGGG 91
16. The method of claim 1, further comprising a step of adding a synthetic DNA sequence as an internal positive control prior to step (b), quantitating the internal positive control in step (b), and utilizing the quantitative internal positive control result in the comparing step to improve the accuracy and reliability of the comparing step.
17. The method of claim 16, the use of the internal positive control enabling a determination of a concentration of cell free DNA in the sample.
18. The method of claim 1, the providing and using steps being carried out in a single tube or well.
19. The method of claim 1, the providing step further comprising providing a hybridization probe that hybridizes to the RE target.
20. The method of claim 10, the probe including an observable label.
21. The method of claim 11, the observable label being a fluorescent label.
22. The method of claim 10, wherein the observable label is detected with a microfluidic device.
23. The method of claim 1, wherein the amount of the short and long RE targets in the first and second samples amplified in the quantitative polymerase chain reaction (qPCR) method are measured using an electrical biosensor.
24. The method of claim 1, wherein the patient is suffering from cancer, is in remission from cancer, is at high risk for developing cancer, is categorized as having a complete response (“CR”), is categorized as having stable disease (“SD”), is categorized as having partial response (“PR”), is categorized as having progressive disease (“PD”), is characterized as having a stage I, stage II, stage III or stage IV cancer, has had surgery to remove a tumor, has undergone a targeted therapy to treat a cancer has undergone chemotherapy to treat a cancer, has undergone immunotherapy to treat a cancer, or has undergone radiotherapy to treat a cancer or the patient has a minimum residual disease diagnosis.
25. The method of claim 1, wherein the quantitated short RE target amount represents one cancer cell in 500,000 total cells or greater, 1,000,000 total cells or greater or 1,500,000 cells or greater in the patient.
26. The method of claim 1, wherein the treatment of the patient is a neoadjuvant, a targeted therapy, a cancer chemotherapy, immunotherapy or radiotherapy.
27. The method of claim 26, wherein the treatment is selected from the group including antineoplastic agents, alkylating agents, topoisomerase inhibitors, mitotic inhibitors, methotrexate, vinca alkaloids, antimetabolites, antifolates, pyrimidine antagonists, purine analogs, purine antagonists, proteasome inhibitors, tyrosine kinase inhibitors, nitrogen mustards, immunotherapy, or another cancer therapy.
28. A multiplexed system for identifying an ineffective neoadjuvant or cancer treatment, or for characterizing cancer or MRD in humans, the system comprising: a. a sample of serum, plasma, urine, or other biological fluid from a human, the sample comprising cell free DNA, the cell free DNA comprising two short RE targets and a long RE target, the short RE targets having a length between 60 bp and 135 bp with the proviso that the two short RE targets differ in size sufficiently to distinguish their amplicons, the long RE target having a length between 200 and 300 bp, between 207 bp and 270 bp, or between 260 and 265 bp, the short RE targets and the long RE target being independent of each other, the sample further comprising an internal positive control comprising synthetic DNA; b. a TaqMan® probe corresponding to each of the short RE targets, the long RE target and the IPC, each probe comprising a detectable label that is distinct from the labels incorporated into the other probes; c. a forward primer and a reverse primer for amplifying each of the short RE target, the long RE target and the IPC; d. a DNA standard for generating standard curves for RE targets; e. a qPCR system for simultaneously amplifying the short RE targets, the long RE target and the IPC and for producing a threshold cycle number for each target; and f. a qPCR data analysis system for producing DNA quantitation values for each RE target by interpolation using threshold cycle numbers and standard curves and for using the DNA quantitation values to produce an indication of the integrity of the cell free DNA.
29. The method of claim 28 wherein the two short RE targets differ in length by at least 10 bp, 15 bp, 20 bp, or 25 bp.
30. The multiplexed method of claim 28, wherein the primers for amplifying the targets are set forth in Table 2A, 2B and 2C.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0048]
[0049]
[0050]
[0051]
DETAILED DESCRIPTION OF THE INVENTION
[0052] There is a clear need in cancer management, and colorectal cancer (CRC) treatment specifically, for a standardized and validated blood test to sensitively and robustly quantitate cfDNA integrity and concentration. The present application addresses this need by creating a multiplex qPCR assay for quantitating cfDNA integrity and concentration based on retrotransposable element targets to identify, characterize and/or appropriately treat the patient having cancer, e.g., progressive disease, or MRD. The assays are also useful in indentifying a cancer therapy's effectiveness or ineffectiveness.
[0053] The most commonly employed method conducted by others in the field of cfDNA integrity and concentration assessment for cancer detection and monitoring is qPCR using the ALU 247/115 index. The methods described herein for assessing integrity and concentration of cfDNA and ctDNA quantitates “short” retrotransposable element targets having lengths between 60 bp and 135 bp, 70 bp to 130 bp, or between 60 bp and 120 bp to reliably indicate therapy effectiveness or ineffectiveness. The ranges between 60 bp and 135 bp, between 70 to about 130 bp, e.g., 71 bp to 132 bp, or between 60 bp and 120 bp ranges of ALU, SVA and LINE1 retrotransposable elements targets are also useful for discriminating between normal (non-cancer) human and humans with cancer, particularly progressive disease, or the presence of MRD. Preferably the retrotransposable elements are ALU, e.g., Yb-8 ALU, SVA, or LINE1.
[0054] MRD refers to the small number of malignant cancer cells that remain in the body during or after treatment (see NCI Dictionary of Cancer Terms, https://www.cancer.gov/publications/dictionaries/cancer-terms/def/797386). Even when a patient is in remission from cancer and the solid tumor has shrunk beyond detection, the patient may still have MRD. The MRD assessment is used to determine if additional treatment is necessary, if a treatment already administered has been effective in reducing tumor load, or to select and administer a particular treatment of the subject. MRD assessment is mainly used in blood cancers (leukemia, lymphoma and myeloma), but is being studied in other solid cancers. MRD assessment has been used in guiding the treatment of cancer patients in cases of, e.g., resected hepatoma, resection of mastectomy, esophageal cancer, rectal cancer, anal cancer, head and neck cancer, colon cancer, lung cancer, breast cancer, neu metastatic breast cancer.
[0055] Cancer patients in remission must undergo quarterly imaging (e.g. MRI, x-ray, CT scan, or other radiology studies) to determine whether the cancer has returned. However, some patients in remission may not have a solid tumor that is detectable by imaging studies, but may still have MRD. The methods described herein for quantitating the integrity and concentration of cfDNA by using short retrotrasposable elements target(s) having a length between 60 bp and 135 bp, 70 bp to 130 bp, or 60 to 120 bp, may be used to characterize cancer or MRD. The change in the amount of the quantitated short RE target sequence between 60 bp and 135 bp, 70 bp to 130 bp or 60 bp to 120 bp over time may be used alone or in conjunction with standard assays to reliably identify subjects who have MRD or cancer progression or evaluate the ineffectiveness of a cancer therapy. Based upon a determination that the subject has MRD or progressive cancer, or the ineffectiveness of a therapy, additional rounds of therapy or another therapy may be administered to the subject. We demonstrate herein that cfDNA comprising elevated or increasing amounts of short ALU Yb8 targets of 60 base pair to 135 base pair, about 70 bp to about 130 bp, or 60 bp to about 120 bp sequence as compared to the amount of long RE targets, e.g., SVA or LINE targets, between 200 bp and about 300 bp, or between 207 bp and about 270 bp, between 260 bp and 265 bp, e.g., 265 bp or 267 to be highly effective in discriminating between normal humans (non-cancer) and humans with cancer (see e.g.,
[0056] The methods described herein for assessing cfDNA integrity and concentration, using a sample from a subject, e.g., a plasma or serum sample or another bodily fluid sample, and RE targets, are useful in detecting, measuring, or monitoring cancer and are an additional parameter for use in the assessment of tumor load, cancer progression, therapy ineffectiveness and or MRD such that an appropriate treatment is administered to the subject. The methods described herein allow for detection of cancer cells in patients who have a nearly undetectable level as determined by standard clinical tests, such as imaging assays, e.g., CT scans or Xrays, or detection of cancer cells in a blood or tissue sample. The patients may be a patient suspected of having or treated for hepatoma, esophageal cancer, rectal cancer, anal cancer, head and neck cancer, colon cancer, colorectal cancer (CRC), lung cancer, e.g., non-small cell lung cancer (NSCLC), small cell lung cancer (SCLC) breast cancer, and blood cancers, e.g., leukemia. Thus, the methods described herein are an improvement over existing methods because they reduce patients' exposure to radiation from imaging studies.
[0057] Patients diagnosed with cancer, including patients receiving a cancer therapy, may be categorized based on their disease progression, e.g., following a cycle of chemotherapy or immunotherapy or other therapeutic regime. A “complete response” (“CR”) patient is one where there is no evidence of the disease due to a disappearance of all target lesions as determined by standard methods, e.g., such as CT scans or detection of cancer cells in a blood or tissue sample. A “stable disease” (“SD”) patient is one where there is neither sufficient shrinkage of cancer lesion size to qualify for partial response (“PR”) nor sufficient increase in lesion size to qualify for “progressive disease” (“PD”) using as a reference the smallest sum of diameter of target lesions. A PR patient is one who demonstrates at least a 30% decrease in the sum of the diameters of target lesions vs. the baseline sum of the diameters of the target lesions. Additionally, the sum of the diameters of the target lesions must demonstrate an absolute increase of at least 5 mm or one or more new lesions have been detected to be considered PR. A PD patient is one where there is at least a 20% increase in the sum of the diameters of the target lesions vs. the smallest sum of target lesions, which may be the baseline sum.
[0058] The present invention is non-invasive and may also be used for screening high risk patients for onset of cancer, e.g., hepatoma, esophageal cancer, rectal cancer, anal cancer, head and neck cancer, colon cancer, colorectal cancer, lung cancer, breast cancer, neu metastatic breast cancer and blood cancers, e.g., leukemia. Patients may be considered “high risk” for a variety of reasons including past family history of cancer, environmental exposure, and lifestyle. However, it is not feasible, highly wasteful, and harmful for patients to be exposed to radiological scans to screen them for cancer.
[0059] The present invention may be used to distinguish between therapy ineffectiveness or futility and therapies that are partially ineffective. Current methods make it burdensome, costly, and inefficient to determine whether a therapy is ineffective in a patient or the patient experience a partial response to a therapy. The present invention allows clinical providers to detect noninvasively and quickly whether the therapy is entirely ineffective or partially ineffective. This allows providers to make quicker and better informed clinical decisions about patient therapy and administer an appropriate therapy.
[0060] One drawback of many currently available methods is the inability to identify cell necrosis. One method for identifying cell necrosis is the DII. DII is a ratio of long fragments quantities to short fragment quantities. DII indicates a level of cfDNA fragmentation. When the DII using the ratio of 265 bp to 80 bp targets is calculated and determined to be lower than 0.4, it indicates the major source of cfDNA is from apoptotic cells. When the DII using the ratio of 265 bp to 80 bp targets is calculated and determined to be above 0.4, cfDNA are also generated through necrosis. This DII may be used in the methods of this invention to assess cell necrosis.
[0061] Described herein are methods and systems for quantitating the integrity of circulating cell free human DNA and implementing a treatment of a patient. An embodiment of this invention is a method for quantitating the integrity of circulating cell free human DNA and implementing a treatment of a patient comprising: [0062] (a) providing a sample of a bodily fluid comprising cell free human DNA, the cell free human DNA comprising an RE target of between 60 base pairs to 135 base pairs, about 70 to about 130bp, or 60 to about 120 bp in length; [0063] (b) using a quantitative polymerase chain reaction (qPCR) method to quantitate the RE target; [0064] (c) obtaining for the quantitated RE target a threshold cycle number; [0065] (d) comparing the threshold cycle number with a standard curve to determine a quantity of the RE target that was present in the sample; and [0066] (e) determining the quantitated RE target amount in the patient sample is higher than present in a control subject, and concluding the patient is in need of a treatment, and implementing the treatment of the patient. The method may be singleplex wherein a single RE target is amplified in a single qPCR reaction well or the method may be multiplex wherein multiple RE targets are amplified in a single qPCR reaction well.
[0067] The bodily fluid samples used in the methods of this invention should be treated so as to remove cells. Suitable bodily fluids include, e.g., serum, plasma, urine, saliva, tears or other biological fluid. Preferably the sample used in the methods and system of this invention is a plasma sample.
[0068] In the methods of this invention a single short retrotransposable element target of between 60 to 135 bp, about 70 to about 130 bp or 60 bp to about 120 bp, may be subjected to quantitative polymerase chain reaction (qPCR) method to quantitate the single target. Alternatively, a multiple retrotransposable element targets, e.g., two or more short RE targets, and/or a long RE target of between 200 bp and 300 bp or 207 bp to about 300 bp, and 265-267 bp, may be subjected to the quantitative polymerase chain reaction (qPCR) method to quantitate the targets.
[0069] The methods of this invention may further comprise a step of adding a synthetic DNA sequence to the sample as an internal positive control (IPC) and quantitating the retrotransposable element targets and the IPC, and utilizing the quantitative IPC result in the step of comparing the qPCR threshold cycle numbers to a standard curve to improve the accuracy and reliability of the comparing step. The IPC also enables a determination of a concentration of cell free DNA in the sample when quantitating the RE targets by qPCR in a single tube.
[0070] The methods of this invention may further comprise a step of adding a hybridization probe that hybridizes to the RE targets to detect the targets. The probe may be added to the sample before the target(s) are subject to q-PCR or thereafter. The probe may include an observable label. Any observable label routinely used in the art for labeling nucleic acid probes could be used to label the probe, e.g., a fluorescent label. Suitable fluorescent probes include, e.g., FAM, Cy5, Hex, or Cy3). The observable label may be detected using a microfluidic device.
[0071] The retrotransposable elements of the methods of this invention include e.g., an ALU, particularly ALU Yb8, an SVA, or a LINE element. The retrotransposable element may have a copy number in excess of 1000 copies per genome.
[0072] In the methods of this invention the short retrotransposable element targets may have a length from about 60 base pairs to about 135 base pairs, about 60 base pairs to about 120 base pairs, about 60 base pairs to about 120 base pairs, and about 70 bp to about 130 bp. For example, the retrotransposable element target may have a length of e.g. 60 bp, 65 bp, 71 bp, 80 bp, 97 bp, 105 bp, or 120 bp. In the methods of this invention the long retrotransposable element target may have a length from about 200 bp to about 300 bp, or about 207 pb to about 270 bp, e.g. 265 bp -267 bp. The RE targets may be amplified with the forward and reverse primer pairs set forth in Table 2A, 2B and/or 2C:
TABLE-US-00001 TABLE 2A ALU-Yb8 targets' primer and probe sequences Name Size Primer Type Primer & Probe Sequence SEQ ID NO Yb8-80bp 80bp Forward GGAAGCGGAGCTTGCAGTGA 1 Reverse AGACGGAGTCTCGCTCTGTCGC 2 Probe AGATTGCGCCACTGCAGTCCGCAGT 3 Yb8-71bp 71bp Forward CTTGCAGTGAGCCGAGATT 4 Reverse GAGACGGAGTCTCGCTCTGTC 5 Probe ACTGCAGTCCGCAGTCCGGCCT 6 Yb8-97bp 97bp Forward GTGGCTCACGCCTGTAAT 7 Reverse GGGTTTCACCTTGTTAGCCA 8 Probe TGGATCATGAGGTCAGGAGAT 9 Yb8-105bp 105bp Forward AGGCAGGAGAATGGCGTGAACC 10 Reverse AGACGGAGTCTCGCTCTGTCGC 11 Probe AGATTGCGCCACTGCAGTCCGCAGT 12 Yb8-119bp 119 Forward AGACCATCCTGGCTAACAA 13 Reverse GCCATTCTCCTGCCTCA 14 Probe Yb8-120bp 120bp Forward TGGATCATGAGGTCAGGAGAT 15 Reverse CCGAGTAGCTGGGACTACA 16 Probe ACCATCCTGGCTAACAAGGTGAAACC 17 Yb8-123bp 123bp Forward ATCCTGGCTAACAAGGTCAAA 18 Reverse CGGGTTCACGCCATTCT 19 Probe
TABLE-US-00002 TABLE 2B SVA targets' primer and probe sequences Name Size Primer Type Primer & Probe Sequence SEQ ID NO SVA-100bp 100bp Forward AATGGCGGCTTTGTGGAATA 20 Reverse GTCTCCCATGTCTACTTCTTTCTAC 21 Probe AGAAATCGGATGGTTGCCGTGTCT 22 SVA-101bp 101bp Forward AACCCTGTGCTCTCTGAAAC 23 Reverse ACGCTGCCTTCAAGCAT 24 Probe SVA-103bp 103bp Forward GCCCAACAGCTCATTGAGAA 25 Reverse ACGGCAACCATCCGATTT 26 Probe SVA-104bp 104bp Forward TGTCCACTCAGGGTTAAATGG 27 Reverse GATTAGGGATTGGTGATAACTCTTA 28 Probe AAGGGCGGTGCAAGATGTGCTTTGTT 29 SVA-106bp 106bp Forward TGTGTCCACTCAGGGTTAAAT 30 Reverse GATTAGGGATTGGTGATGACTCT 31 Probe AAGGGCGGTGCAAGATGTGCTTTGTT 32 SVA-106bp-v2 106bp Forward TGTGCCCAACAGCTCATT 33 Reverse ACGGCAACCATCCGATTT 34 Probe SVA-116bp 116bp Forward CTGTGTCCACTCAGGGTTAAATG 35 Reverse ATTACTTGAGATTAGGGATTGGTGATG 36 Probe AAGGGCGGTGCAAGATGTGCTTTGTT 37 SVA-116bp-v2 116bp Forward CCCAACAGCTCATTGAGAACG 38 Reverse CTTTCTACACAGACACGGCAA 39 Probe SVA-118bp 118bp Forward CTCTCTGAAACATGTGCTGTGT 40 Reverse GGGATTGGTGATGACTCTTAACG 41 Probe AAGGGCGGTGCAAGATGTGCTTTGTT 42 SVA-118bp-v2 118bp Forward CTGTGTCCACTCAGGGTTAAAT 43 Reverse TGATTACTTGAGATTAGGGATTGGT 44 Probe AAGGGCGGTGCAAGATGTGCTTTGTT 45 SVA-126bp 126bp Forward CTGTGTCCACTCAGGGTTAAAT 46 Reverse TGTGTCCCTGATTACTTGAGATTAG 47 Probe SVA-126bp-V2 126bp Forward CCTGTTGATCTGTGACCTTACC 48 Reverse ACGCTGCCTTCAAGCAT 49 Probe AAGGGCGGTGCAAGATGTGCTTTGTT 50 SVA-128bp 128bp Forward GTTGCCGTGTCTGTGTAGAA 51 Reverse TTTCAGAGAGCACAGGGTTG 52 Probe AAGGGCGGTGCAAGATGTGCTTTGTT 53 SVA-132bp 132bp Forward AACCCTGTGCTCTCTGAAAC 54 Reverse GATTAGGGATTGGTGATAACTCTTA 55 Probe AAGGGCGGTGCAAGATGTGCTTTGTT 56 SVA-207bp 207bp Forward CTGTGTCCACTCAGGGTTAAAT 57 Reverse GAGGGAAGGTCAGCAGATAAAC 58 Probe AAGGGCGGTGCAAGATGTGCTTTGTT 59 SVA-257bp 257bp Forward CCTGTGCTCTCTGAAACATGTGCT 60 Reverse GATTTGGCAGGGTCATGGGACAAT 61 Probe AAGGGCGGTGCAAGATGTGCTTTGTT 62 SVA-265bp 265bp Forward ATGTGCTGTGTCCACTCAGGGTTA 63 Reverse ATTCTTGGGTGTTTCTCACAGAGG 64 Probe AAGGGCGGTGCAAGATGTGCTTTGTT 65 SVA-290bp 290bp Forward TGGGATCCTGTTGATCTGTGACCT 66 Reverse GATTTGGCAGGGTCATGGGACAAT 67 Probe SVA-355bp 355bp Forward GTTGCCGTGTCTGTGTAGAA. 68 Reverse ATGGGACAATAGTGGAGGGA 69 Probe SVA-367bp 367bp Forward CCGTGTCTGTGTAGAAAGAAGTAG 70 Reverse GGGATTTGGCAGGGTCAT 71 Probe SVA-399bp 399bp Forward GGCGGCTTTGTGGAATAGA 72 Reverse GAGGGAAGGTCAGCAGATAAAC 73 Probe ATCAGGGACACAAACACTGCGGAA 74 SVA-411bp 411bp Forward TGGAATAGAAAGGCAGGAAAGG 75 Reverse GCAGGGTCATGGGACAATAG 76 Probe
TABLE-US-00003 TABLE 2C Linel targets' primer and probe sequences Name Size Primer Type Primer & Probe Sequence SEQ ID NO Line1-252bp 252bp Forward CACAATAGCAAAGACTTGGAACC 77 Reverse CCCTTCCTGTGTCCATGTG 78 Probe CCTTTGTAGGGACATGGATGAAAGTGGA 79 Line1-257bp 257bp Forward GACTTGGAACCAACCCAAATG 80 Reverse CCCAGAGTGTGACGTTCC 81 Probe AGTGAGAACACATGGACACAGGAAGG 82 Line1-262bp 262bp Forward GTGGCACATATACACCATGGAA 83 Reverse CGTTAGGTATATCTCCCAATGCTATC 84 Probe TGAGAACACATGGACACAGGAAGGG 85 Line1-266bp 266bp Forward ACTTGGAACCAACCCAAATG 86 Reverse CACAACAGTCCCCAGAGTG 87 Probe TGAGAACACATGGACACAGGAAGGG 88 Line1-267bp 267bp Forward CATGGAATACTATGCAGCCATAAA 89 Reverse CCCACTAACTCGTCATCTAGC 90 Probe TGAGAACACATGGACACAGGAAGGG 91
[0073] The samples used in the methods of this invention may be from a patient has been diagnosed as having a has stage I, stage II, stage III or stage IV cancer, is suffering from cancer, is in remission from cancer, is at risk for developing cancer, has had surgery to remove a tumor, has undergone a neoadjuvant therapy, a targeted therapy, a chemotherapy, immunotherapy and/or radiotherapy to treat a cancer.
[0074] The methods of this invention are also useful in further evaluating the patient having a minimum residual disease diagnosis to implement a disease treatment. For example, in an embodiment of this invention a determination is made that the quantity of the short RE targets as compared to the long Re targets is higher in the sample from the patient than that of a control sample, e.g., a sample from a healthy subject, and in view of that determination an appropriate treatment of the patient is instituted, e.g., a targeted therapy, cancer chemotherapy, immunotherapy, or radiotherapy is administered. Such treatment might include e.g., antineoplastic agents, alkylating agents, topoisomerase inhibitors, mitotic inhibitors, methotrexate, vinca alkaloids, antimetabolites, antifolates, pyrimidine antagonists, purine analogs, purine antagonists, proteasome inhibitors, tyrosine kinase inhibitors, nitrogen mustards, or another cancer therapy. Alternatively, a determination of a threshold cycle number of the quantitated nucleic acid fragment, is made and based on that number the clinical provider administers the treatment to the patient.
Multiplex Methods
[0075] An embodiment of this invention is a method to quantitate the integrity of circulating cell free human DNA and optionally to implement a treatment of a subject, comprising: providing a sample from a subject, preferably a sample that has been treated to remove cells, the sample comprising cell free human DNA comprising a first RE target being 97 base pairs and the second RE target having a length between 260 and 265 base pairs, e.g., 263 bp; using a quantitative polymerase chain reaction (qPCR) method to quantitate the first and second RE targets; obtaining for the quantitated RE targets a threshold cycle number; comparing the threshold cycle number with a standard curve to determine a quantity of each of the RE targets that was present in the sample; calculating a ratio of the quantity of the 97 RE target to the quantity of the between 260 and 265 base pair nucleic acid fragment; and using the quantitated nucleic acid fragment to quantitate the integrity of the circulating cell free human DNA and optionally to implement treatment of a patient. The subject's sample may be serum, plasma, urine, or other biological fluid from a human, preferably the sample is a plasma sample. The targets may be amplified in singleplex qPCR wherein a single target is amplified in a single reaction well or the targets may be amplified in a multiplex qPCR wherein all the targets are amplified in a single reaction well.
[0076] Also an embodiment of this invention is a method to quantitate the integrity of circulating cell free human DNA and optionally to implement a treatment of a subject, comprising: providing a sample from a subject, preferably a sample that has been treated to remove cells, the sample comprising cell free human DNA comprising a first short RE nucleic acid target having a length between 60 and 135 base pairs, 70 bp and about 130 bp, e.g., 71 and 132 base pairs, or between 60 and 120 bp (the first RE target), and the second RE nucleic acid target having a length between 200 to 300 base pairs, between about 207 and 270 bp, or between 260 and 265 base pairs; using a quantitative polymerase chain reaction (qPCR) method to quantitate the first and second RE targets; obtaining for the quantitated RE nucleic acid targets a threshold cycle number; comparing the threshold cycle number with a standard curve to determine a quantity of each of the RE nucleic acid targets that was present in the sample; calculating a ratio of the quantity of the short RE target to the quantity of second RE target; and using the quantitated nucleic acid targets to quantitate the integrity of the circulating cell free human DNA and to implement treatment of a patient. The subject's sample may be serum, plasma, urine, or other biological fluid from a human, preferably the sample is a plasma sample. The first and second RE target may be a target of the same retrotransposable element or may be different retrotransposable elements. If they are from the same retrotransposable element then PCR blockers may be included to limit extension from the primers beyond the position of the blockers, thus limiting the extension from a primer pair used to amplify one RE target into the other RE target and thereby enhancing the specificity by limiting the production of extraneous or overlapping products. In an embodiment the first and second RE targets are targets of an ALU, an SVA or a LINE1 target. In an embodiment the first and second RE targets are targets of an ALU or SVA target or a LINE1 target. Preferably the short RE target is an ALU or an SVA target, e.g., a Yb8 ALU target, and the long RE element is an SVA or LINE1 target. In an embodiment the prime pairs used in the qPCR to quantitate the RE targets are selected from the primer pairs of Table 2A and 2B and 2C. The targets may be amplified in singleplex qPCR wherein a single target is amplified in a single reaction well or the targets may be amplified in a multiplex qPCR wherein all the targets are amplified in a single reaction well.
[0077] An embodiment of this invention is a method to quantitate the integrity of circulating cell free human DNA and optionally to implement a treatment of a subject, comprising: [0078] providing a sample from a subject, preferably a sample that has been treated to remove cells, the sample comprising cell free human DNA comprising a two short RE targets, i.e., first RE nucleic acid target and a second RE nucleic acid target having a length of having a length between 60 and 135 base pairs, e.g., 71 and 132 base pairs or between 60 and 120 bp, and optionally a third long RE target having a length of between 200 bp and 300 bp, between about 207 bp to about 270 base pairs, between 260 and 265 base pairs, e.g., 263 bp; [0079] using a quantitative polymerase chain reaction (qPCR) method to quantitate the three targets; [0080] obtaining for the targets a threshold cycle number; comparing the threshold cycle number with a standard curve to determine a quantity of each of the targets that was present in the sample; [0081] calculating the difference between the quantity of the first target and the second target and optionally calculating a ratio of the quantity of the first or second target to the quantity of the third target; and [0082] using the quantitated targets to implement treatment of a patient. The subject's sample may be serum, plasma, urine, or other biological fluid from a human, preferably the sample is a plasma sample.
The RE targets may be amplified in singleplex qPCR wherein a single target is amplified in a single reaction well or the targets may be amplified in a multiplex qPCR wherein all the targets are amplified in a single reaction well.
[0083] The methods of this invention are contemplated to be useful in identifying a subject having progressive disease or MRD. Accordingly, an embodiment of this invention is a method for identifying a subject having progressive cancer or MRD, said method comprising: [0084] (a) providing a first and second sample of serum, plasma, urine, or other biological fluid from a subject wherein the first and second samples are obtained at least one week apart, at least 2 weeks apart, at least 3 weeks apart or at least 4 weeks apart, e.g., 12 to 21 days apart, [0085] the samples comprising cell free human DNA (cfDNA), the cfDNA comprising (i) a first and second short retrotransposable interspersed element (RE) target sequence having a length of between about 60 base pairs to about 135 base pairs and (ii) a long RE target having a length of between 200 base pairs and about 300 base pairs, wherein the first short target is shorter than the second short RE target; [0086] (b) quantitating each of the short and long RE targets in the first and second samples using a quantitative polymerase chain reaction (qPCR) method; [0087] (c) obtaining for each of the quantitated RE targets in the first and second samples a threshold cycle number; [0088] (d) comparing the threshold cycle number of each quantitated RE target with a standard curve to determine an amount of each of the quantitated RE targets that were present in the samples; [0089] (e) determining the amount of first short RE target less the amount of the second RE target in the first sample (Frag1) and the amount of first short RE target less the amount of the second RE target in the second sample (Frag2) wherein in increase in Frag2 as compared to Frag1 over a threshold level identifies the subject as having progressive disease or MRD.
The targets may be amplified in singleplex PCR wherein a single target is amplified in a single reaction well or the targets may be amplified in a multiplex PCR wherein all the targets are amplified in a single reaction well.
[0090] A subject identified as having progressive disease or MRD may be administered a cancer therapy or MRD therapy. The method may further comprise the step of determining the DNA integrity index (DII) of the cfDNA in the sample
[0091] In an embodiment of this method, an increase in Frag2 as compared to Frag1 may be determined by subtracting Frag1 from Frag2 to generate a value, FragDiff, that is compared to a threshold value and based on that comparison it is concluded that the ctDNA has increased and identifies the subject as having progressive disease or MRD and an appropriate therapy may be administered.
[0092] Neoadjuvant therapies, which include, e.g., chemotherapy, hormone therapy, immunotherapy, radiation therapy, and targeted therapy are delivered to a subject before the main treatment is administered to help reduce the size of a tumor or kill cancer cells that have spread. Neoadjuvant therapies are recommended when a patient with early-stage cancer, stage I, stage II or stage III, undergoes surgery or radiation therapy. The methods of this invention may be applied to a sample of subject having a stage I, stage II, stage III or stage IV cancer wherein the samples are obtained from the subject before and after the neoadjuvant therapy to quantitate the integrity of circulating cell free human DNA and to implement a treatment of a subject. The methods of this invention may also be applied to samples from a subject who has had a therapy for hepatoma, esophageal cancer, rectal cancer, anal cancer, head and neck cancer, colon cancer, colorectal cancer, lung cancer, breast cancer, neu metastatic breast cancer or a blood cancer, e.g., leukemia, and the first sample was taken from the subject before administering the a first cycle of therapy and the second sample was taken from the subject after administering the first therapy cycle, but before the administration of another cycle of therapy, and as such the first and second samples may be obtained from the subject at least 1 week apart, at least 2 weeks apart, at least 3 weeks apart, at least 4 weeks apart, e.g. 12 to 21 days apart. The therapy may be a targeted therapy, a chemotherapy, immunotherapy or radiotherapy. The therapy may be treatment with an antineoplastic agents, alkylating agents, topoisomerase inhibitors, mitotic inhibitors, methotrexate, vinca alkaloids, antimetabolites, antifolates, pyrimidine antagonists, purine analogs, purine antagonists, proteasome inhibitors, tyrosine kinase inhibitors, nitrogen mustards, immunotherapy, or another cancer therapy.
[0093] In the methods described herein for identifying the patient as having progressive disease or MRD, The short and long retrotransposable elements may have a copy number in excess of 1000 copies per genome, e.g., the short retrotransposable interspersed element may be an ALU or an SVA and the long RE may be an ALU, SVA or LINE.
[0094] The short RE targets may be from about 60 base pairs to about 135 base pairs, or from about 60 base pairs to about 120 base pairs, or from about 70 base pairs to about 130 base pairs, or from about 80 base pairs to about 100 base pairs. The long RE target may be about 200 bp to about 300 bp or about 207 bp to about 270 bp, or about 260 bp to about 265 bp in length.
[0095] The forward and reverse primer pairs used to amplify the short and long target sequences in the qPCR may be selected from the following forward and reverse primer pairs of Tables 2A, 2B, or 2C.
[0096] The samples used in the methods described herein may be a sample of serum, plasma, urine, or other biological fluid, preferably the sample is a plasma sample.
[0097] The method may further comprise a step of adding a synthetic DNA sequence as an internal positive control (IPC) to the samples prior to quantitating each of the short and long RE targets in the first and second samples by qPCR, and then quantitating the IPC and utilizing the quantitative IPC result in the step of comparing the threshold cycle number of each quantitated RE target with a standard curve to improve the accuracy and reliability of the comparing step. For example, the use of the IPC enables a determination of a concentration of cell free DNA in the sample.
[0098] It is specifically contemplated that the quantitation of the short and long retrotransposable interspersed elements of each sample by qPCR may be carried out in a single tube or well.
[0099] The amplified RE targets may be detected with one or more hybridization probes that hybridize specifically to the RE targets sequences. The probes may comprise an observable label, e.g., a fluorescent label, e.g., FAM, Cy5, Hex, or Cy3. The observable label could be detected using a microfluidic device. In some embodiments of this invention, the amplification products of the qPCR method used in the methods of this invention may be detected and/or quantified using electrical biosensors (see Liu et al. Single-Nucleotide Polymorphism Genotyping Using a Novel Multiplexed Electrochemical Biosensor with Nonfouling Surface. Biosens. Bioelectron. 2013, 42, 516-521).
[0100] Also an embodiment of this invention is a system for characterizing cancer or MRD in a patient, the system comprising: [0101] (a) a sample of serum, plasma, urine, or other biological fluid from a patient, the sample comprising cell free DNA, the cell free DNA comprising a first and second short retrotransposable element targets, the short targets having a length of from about 60 bp to about 135 bp, the sample further comprising an added third target, the third target being an internal positive control (IPC) comprising synthetic DNA; [0102] (b) a TaqMan® probe corresponding to each of the two short targets, and the third target, each probe comprising a detectable label that is distinct from the labels incorporated into the other probes; [0103] (c) a forward primer and a reverse primer pair for amplifying each of the short targets, and the third target; [0104] (d) a DNA standard for generating standard curves for the two short targets; [0105] (e) a qPCR system for simultaneously amplifying the short targets, and the third target and for producing a threshold cycle number for each the short targets and the third target; and [0106] (f) a qPCR data analysis system for producing DNA quantitation values for each retrotransposable element target by interpolation using threshold cycle numbers and standard curves and for using the DNA quantitation values to produce an indication of the amount of the two short retrotransposable element target, and determining a difference in the amount of the first short RE target less the amount of the second RE target compared to a threshold value and characterizing the cancer or MRD.
The system may be a singleplex system wherein a single target is amplified in a single reaction well or the system may be a multiplex system where multiple target are amplified in a single reaction well.
[0107] In the system of this invention for characterizing cancer or MRD in a patient the patient may be a patient who is suffering from a cancer, e.g., is diagnosed as having a stage 1, stage II or stage III cancer, is in remission from cancer, is at high risk for developing cancer, has been categorized by another method as having a complete response (“CR”), a stable disease (“SD”), a partial response (“PR”), or progressive disease (“PD”), or has had a neoadjuvant therapy, has had surgery to remove a tumor, or has undergone chemotherapy, immunotherapy or radiotherapy to treat the cancer or MRD. The cfDNA in the multiplex system may further comprise cfDNA comprising a long retrotransposable element target having a length of between 200 bp and 300 bp, or 207 bp to 270 bp, e.g., 260-267 bp, a TaqMan probe corresponding to the long RE target, and forward and reverse primers for amplifying the long RE target. In the system, the forward primer and reverse primer pair for amplifying the RE targets are selected from Table 2A, 2B or 2C.
[0108] The method of this invention are contemplated for allow for the quantitated RE target amounts to be correlated to one cancer cell in 500,000 total cells or greater, one cancer cell in 1,000,000 total cells or greater, one cancer cell in 1,500,000 cells or greater.
EXAMPLES
Example 1
Protocol for Serum and Plasma Separation
[0109] Serum and plasma separation were performed according to the standard protocol and within four hours of collection, and stored at −80° C. until they were processed. Care was taken to avoid freeze-thaw cycles. For serum specimens, whole blood is collected in the commercially available red-topped test tube Vacutainer (Becton Dickinson). For plasma specimens, whole blood is collected in the commercially available anticoagulant-treated tubes e.g., EDTA-treated or citrate-treated.
Example 2
Protocol for Direct DNA Quantitation
[0110] Two separate protocols have previously been described for direct DNA quantification from either human serum (Umetani, N., et al., Increased integrity of free circulating DNA in sera of patients with colorectal or periampullary cancer: Direct quantitative PCR for ALU repeats, Clin. Chem. 52 (6): 1062-1069 (2006), doi:10.1373/clinchem.2006.068577, incorporated herein in its entirety) or plasma (Breitbach, S, et al., Direct quantification of cell-free, circulating DNA from unpurified plasma, PLOS One 9 (3): e87838 (2014), doi:10.1371/journal.pone.0087838, incorporated herein in its entirety). We used both of these methods on serum and plasma and compared the amplification efficiency from both methods. The first method includes deactivation or elimination of proteins that bind to template DNA or DNA polymerase and might invalidate qPCR results. Briefly, a volume of 20 μL of each serum or plasma sample was mixed with 20 μL of a preparation buffer that contains 25 mL/L Tween 20, 50 mM Tris, and 1 mM EDTA. This mixture was then digested with 16 μg of proteinase K solution (Qiagen) at 50° C. for 20 min, followed by 5 min of heat deactivation and inactivation at 95° C. After subsequent centrifugation at 10,000 g for 5 min, 0.2 μL of the supernatant (containing 0.1-μL equivalent volume of serum or plasma) was used as a template for each direct RE-qPCR reaction. The second method bypasses the protein removal step and only requires 1:40 dilution of the serum/plasma sample with sterile H.sub.2O.
Example 3
Procedure for DNA Purification
[0111] For comparison to and validation of direct quantification of cfDNA, RE-qPCR has been performed on isolated, purified cfDNA. cfDNA was purified by magnetic bead extraction or by using the silica based membrane QIAamp DNA Investigator Kit (Qiagen).
Example 4
Design of Primers and TaqMan® Probes for ALU Yb8 and SVA Targets
[0112] In general primers and labeled probes used in the qPCR reactions may be obtained from Eurofins MWG/Operon, Integrated DNA Technologies, or a variety of other vendors.
[0113] Short ALU primer sets were designed to produce amplicon lengths of 80 bp, 97 bp, 105 bp, 120 bp, and 123 bp among others, were developed for use in the assays of the present invention. The primer sequences are shown in Table 2A. Primer pairs to produce amplicon lengths from SVA of 100 bp, 104 bp, 106 bp, 116 bp, 118 bp, 126 bp, 132bp, 207 bp, 257 bp, 265 bp, 290 bp, or to produce amplicon lengths of 252 bp, 257 bp, 262 bp, and 267 bp from LINE1, among others are set forth in Table 2B and 2C. The primer pairs were developed using Primer 3 software and an SVA or LINE1 (genebank ID: AH005269 (PUBMED 10655552) retrotransposon sequence. Because the SVA and LINE1 sequences are truncated in many individuals and also have sequence similarities with ALU sequences in certain regions, the target SVA sequences were selected from the SVA-R region, and the target LINE1 sequence was selected from the LINE1 ORF2 region, which have no or minimal sequence similarity as compared with the ALU sequence. The primer sequences and probes that hybridize to the amplified targets are shown in Table 2A, 2B and 2C.
[0114] Additional primer design based on ALU Yb8, SVA and LINE1 may be done using Primer software (Koressaar, T; Remm, M, Bioinformatics 23 (10): 1289-91 (2007), doi:10.1093/bioinformatics/btm091; Untergasser A, et al., Nucleic Acids Res. 40 (15): e115 (2012), doi:10.1093/nar/gks596).
Example 5
Procedure for qPCR
[0115] The qPCR assays were run on an Applied Biosystems 7500 Real Time PCR instrument and/or the Biorad CFX, but useful instrument platforms are not limited thereto. The qPCR assays of the present invention may be adapted to work on most Real-Time PCR instruments. To assess the concentration and integrity index of serum and plasma circulating cfDNA, both short and long fragments may be amplified and quantified. The short fragment primer sets may amplify the short (apoptotic) DNA fragments, whereas the long fragment primer sets may amplify the long (non-apoptotic) DNA fragments. The RE-qPCR multiplex reaction may contain three targets in a Taqman based assay: a short RE target, a long RE target, and a synthetic IPC sequence. The hybridization probes detecting each target may be labeled with different fluorophores (e.g. FAM, Cy5, Hex, or Cy3) to enable simultaneous detection. The following PCR conditions may be used, but they can be modified as necessary: 10 min 95° C. denaturation cycle, followed by 32 cycles of 2-step qPCR (15 s at 95° C. and 2 min at 61° C. combined annealing/extension time) at maximum ramp speed. Additional PCR parameters (i.e. cycle number, denaturation and annealing/extension times and temperatures) are investigated to obtain a robust, sensitive qPCR multiplex.
[0116] Short Yb8 and long SVA primer pairs selected from those shown in Table 2A and 2B were combined into eight different multiplex sets (Yb8-80 & SVA-207, Yb8-80 & SVA-257, Yb8-80 & SVA-265, Yb8-80 & SVA-290, Yb8-120 & SVA-207, Yb8-120 & SVA-257, Yb8-120 & SVA-265, and Yb8-120 & SVA-290). The optimal temperature for each multiplex was determined by a temperature gradient ranging from 64.0° C. to 55.0° C. The concentration of primers and additives including DMSO and additional MgCl.sub.2 were optimized for each multiplex set.
[0117] The reaction mixture of each multiplex Yb8-SVA-qPCR included a template, forward primer and reverse primer pairs, fluorescent probe, Brilliant Multiplex QPCR Master Mix (Agilent) and the additives bovine serum albumin (BSA), dimethyl sulfoxide (DMSO), and magnesium chloride (MgCl.sub.2). Real-time PCR amplification was performed with pre-cycling heat activation of DNA polymerase at 95° C. for 10 min followed by 32 cycles of denaturation at 95° C. for 15 sec and extension at 61-62.5° C. (adapted to the multiplex set) in a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories). The quantification of DNA in each sample was determined by use of a calibration curve with serial dilutions (20ng/ul to 0.6 pg/ul).
Example 6
Procedure for qPCR—97 bp Fragment of ALU Yb8
[0118] The qPCR assays may be run on an Applied Biosystems 7500 Real Time PCR instrument and/or the Biorad CFX, but useful instrument platforms are not limited thereto. The qPCR assays of the present invention may be adapted to work on most Real-Time PCR instruments. To assess the concentration of a 97 bp target of ALU Y8b in plasma circulating cfDNA in control healthy subjects compared to cancer patients, plasma samples of control (healthy subjects) and test (samples from patients with metastatic colorectal cancer (mCRC)) containing cfDNA was combined with the 97 bp forward primer (GTGGCTCACGCCTGTAAT)(SEQ ID NO: 7), 97 bp reverse primer (GGGTTTCACCTTGTTAGCCA) (SEQ ID NO: 8), a fluorescent probe comprising TGGATCATGAGGTCAGGAGAT (SEQ ID NO: 9), Brilliant Multiplex QPCR Master Mix (Agilent) and the additives bovine serum albumin (BSA), dimethyl sulfoxide (DMSO), and magnesium chloride (MgCl.sub.2). Real-time PCR amplification was performed with pre-cycling heat activation of DNA polymerase at 95° C. for 10 min followed by 40 cycles of denaturation at 90-95° C. for 10-15 sec and extension at 61-64° C. (depending on the multiplex set) in an ABI 7500 Instrument (ThermoFisher Scientific). The quantification of DNA in each sample was determined by use of a calibration curve with serial dilutions (20 ng/ul to 0.6 pg/ul)
Example 7
Procedure for qPCR 97 bp ALU Yb8 and 80 bp ALU Yb8
[0119] To assess the concentration of plasma circulating cfDNA, both 80 bp and 97 bp fragments of ALU Yb8 are amplified and quantified. The RE-qPCR multiplex reaction contains three targets in a TaqMan® based assay: 80 bp ALU Yb8 forward and reverse primers (GGAAGCGGAGCTTGCAGTGA (SEQ ID NO:1) and AGACGGAGTCTCGCTCTGT CGC (SEQ ID NO: 2)), the 97 bp ALU Yb8 RE forward and reverse primers GTGGCTCACGCCTGTAAT (SEQ ID NO: 7) and GGGTTTCACCTTGTTAGCCA(SEQ ID NO:8)), an 80R-blocker, peptide nucleic acid (PNA) oligo which binds to the 80 bp ALU Yb8 fragment, a 97R-PNA blocker a PNA which binds to the 97 bp ALU Yb8 fragment and probes that hybridize to the 80 bp and the 97 bp sequences (e.g., Fluorophore-TGAGGTCAGGAGATCGAGACCATCC-Quencher)(SEQ ID NO: 92), and in some instances a synthetic IPC sequence. PNA oligo mimics DNA. In PNA, the negatively-charged sugar phosphate backbone of DNA is replaced with an uncharged pseudo-peptide backbone. The two strands of a PNA/DNA hybrid therefore lack the electrostatic repulsion as observed for DNA/DNA duplexes, giving rise to thermal stability. Hybridization probes are also included in some instances for detecting each target and the probes are labeled with different fluorophores (e.g. FAM, Cy5, Hex, or Cy3) to enable simultaneous detection. The reaction mixture includes the forward primers, reverse primers, the blockers, the fluorescent probe, Brilliant Multiplex QPCR Master Mix (Agilent) and the additives bovine serum albumin (BSA), dimethyl sulfoxide (DMSO), and magnesium chloride (MgCl.sub.2). Real-time PCR amplification is performed with pre-cycling heat activation of DNA polymerase at 95° C. for 10 min followed by 32 cycles of denaturation at 95° C. for 15 sec and extension at 61-62.5° C. (depending on the multiplex set) in a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories). The quantification of DNA in each sample is determined by use of a calibration curve with serial dilutions (20 ng/ul to 0.6 pg/ul).
[0120]
Example 8
Procedure for qPCR 80 bp ALU Yb8 and 120 bp ALU Yb8 and 265 SVA
[0121] Plasma from 40 control subjects, healthy subjects without cancer and 39 subjects having cancer were subjected to qPCR assays to assess the level of ctDNA. The qPCR assays were run on an Applied Biosystems 7500 Real Time PCR instrument and/or the Biorad CFX, but useful instrument platforms are not limited thereto. The qPCR assays of the present invention may be adapted to work on most Real-Time PCR instruments. To assess the concentration and integrity index of serum circulating cfDNA in the samples from control and cancer subject, a first ALU Yb8 target of 80 bp, and a second ALU Yb8 target of 120 bp and an SVA target of 265 bp were amplified and quantified in a RE-qPCR multiplex reaction. The RE-qPCR multiplex reaction contained three targets in a Taqman based assay: the first ALU Yb8 target of 80 bp, the second ALU Yb8 target of 120 bp, a third SVA target of 265 bp, and a synthetic internal positive control (IPC) sequence. The hybridization probes detecting each amplified target were labeled with different fluorophores (FAM, Cy5, or Hex) to enable simultaneous detection. The following PCR conditions are used: 10 min 95° C. denaturation cycle, followed by 40 cycles of 2-step qPCR (15 s at 96° C. and 2 min at 64° C. combined annealing/extension time) at maximum ramp speed.
[0122] The reaction mixture of each multiplex Yb8-qPCR included the forward primers and reverse primers for the first Yb8-80 target and for the second ALU Yb8-120 target, and the long SVA 265 target (see Table 2A and 3B for primer pair sequences). the fluorescent probes for detecting the amplified fragments, Brilliant Multiplex QPCR Master Mix (Agilent) and the additives bovine serum albumin (BSA), dimethyl sulfoxide (DMSO), and magnesium chloride (MgCl.sub.2). Real-time PCR amplification was performed with pre-cycling heat activation of DNA polymerase at 95° C. for 10 min followed by 40 cycles of denaturation at 95° C. for 15 sec and extension at 61-62.5° C. (depending on the multiplex set) in a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories). The quantification of the targets in each sample was determined by use of a calibration curve with serial dilutions (20 ng/ul to 0.6 pg/ul). Table 3 sets forth the quantitated amounts of the 80 bp target, the 120 bp target and the 265 bp target in each sample and the difference in the quantitated amount of 80 bp Yb8 target and the quantitated amount of 120 bp Yb8 target.
TABLE-US-00004 TABLE 3 Healthy Control (ng/mL) Cancer patient (ng/mL) 80 bp- 80 bp- 120 bp 120 bp Median 1.85 Median 25.60 Average 2.22 Average 217.52 SD 1.87 SD 793.35 Target Size (bp) Target Size (bp) Sample 80 bp- Sample 80 bp- ID# 80 bp 120 bp 265 bp 120 bp ID# 80 bp 120 bp 265 bp 120 bp 1287 4.68 2.98 1.06 1.69 1683 16.13 10.07 3.19 6.06 1289 4.77 3.24 1.01 1.53 1685 1125.52 468.29 114.47 657.23 1291 5.51 3.64 0.79 1.88 1689 24.00 14.81 3.54 9.19 1293 9.93 6.13 2.04 3.80 1691 108.65 50.63 8.78 58.02 1295 20.82 9.56 2.25 11.26 1693 30.47 17.16 3.94 13.31 1299 11.79 6.52 1.99 5.26 1695 109.66 61.52 12.89 48.14 1301 7.40 5.32 2.02 2.08 1697 142.73 71.97 16.07 70.76 1303 12.19 5.93 2.37 6.26 1699 98.21 46.29 10.31 51.92 1305 5.07 3.73 1.26 1.34 1701 458.87 163.28 36.89 295.60 1307 3.71 2.17 0.96 1.53 1703 19.19 8.19 2.30 11.00 1311 8.89 4.87 1.40 4.02 1705 36.65 17.82 6.06 18.84 1313 5.47 3.03 0.88 2.44 1707 25.60 12.62 2.13 12.98 1315 4.60 2.59 1.04 2.01 1709 14.10 8.33 2.83 5.77 1316 3.07 1.72 0.59 1.35 1711 66.40 30.19 8.93 36.21 1317 4.17 2.19 0.73 1.98 1713 116.21 67.75 16.99 48.47 1318 5.92 3.09 1.18 2.84 1715 86.71 39.03 3.47 47.68 1319 4.15 2.98 1.38 1.17 1717 154.01 56.55 16.67 97.46 1320 6.82 4.77 1.73 2.05 1719 69.53 26.53 6.86 43.00 1321 3.09 1.93 0.65 1.16 1721 22.51 11.52 3.22 10.98 1322 2.25 1.61 0.64 0.65 1723 7395.87 2497.71 372.11 4898.16 1323 3.97 2.09 0.81 1.88 1725 182.55 95.65 32.66 86.91 1324 5.49 3.63 1.55 1.86 1727 10.26 6.80 2.77 3.46 1325 4.74 3.13 0.90 1.61 1729 281.95 104.02 31.17 177.93 1329 2.27 1.69 0.63 0.58 1731 401.77 168.31 39.10 233.46 1331 3.29 1.99 0.34 1.31 1733 17.73 8.26 2.78 9.47 1333 8.64 6.80 1.94 1.84 1735 21.73 11.47 2.26 10.26 1421 6.73 4.30 1.72 2.43 1737 67.34 29.16 8.38 38.18 1431 10.39 8.24 2.77 2.15 1739 55.40 29.80 8.20 25.60 1435 5.00 3.93 1.24 1.07 1741 381.36 178.68 46.72 202.68 1439 7.39 4.24 1.13 3.15 1743 38.51 15.86 3.56 22.66 1441 2.56 1.62 0.54 0.94 1745 1643.19 612.70 129.68 1030.49 1443 6.03 4.12 1.30 1.91 1747 18.35 8.52 2.51 9.83 1447 2.51 1.97 0.67 0.54 1749 23.30 14.88 5.17 8.43 1449 4.52 2.80 1.15 1.72 1751 53.04 46.31 31.81 6.74 1451 10.17 8.20 2.65 1.98 1753 31.03 17.16 4.19 13.87 1453 4.73 3.49 1.09 1.24 1755 22.51 13.15 4.35 9.37 1455 7.34 5.81 1.63 1.54 1757 8.00 5.37 1.85 2.64 1457 7.43 6.18 1.23 1.25 1759 46.28 36.00 8.47 10.28 1459 7.61 5.60 1.90 2.00 1761 282.85 142.45 25.42 140.40 1765 4.77 3.36 1.16 1.41
Example 9
Procedure for qPCR Data Analysis and Quality Control
[0123] Data analysis was performed utilizing the respective AB 7500, QuantStudio-5 or BioRad CFX instrument software. Melt curve analysis was generated using Qiagen's QuantiTect 1 SYBR1 Green PCR Kit (Cat#204141) and operated using the Applied Biosystems 7500 Real Time PCR instrument. For each experiment, a freshly prepared 3-fold serial dilution of high molecular weight standard DNA (ranging from 10 ng/μL to 0.004 ng/μL) was run in duplicate on each plate to generate standard curves for the long and short targets. The standard curves are plotted C.sub.T vs. Delta R.sub.n (the fluorescence emission intensity of the reporter dye divided by the fluorescence emission intensity of the passive reference dye). Resultant DNA quantitation values are interpolated from the resulting linear standard curves. At least one negative No Template Control (NTC) was run on each plate.
[0124] In experiments where a ratio between DNA concentration of a 265 bp SVA long target and 80 bp ALU short target were calculated, the DNA concentration of the long target divided by DNA concentration of the short target provides an indication as to the degree of DNA integrity for the quantified sample. DNA integrity index is calculated as the ratio of concentrations ([concentration of long RE marker]/[concentration of short RE marker]). Quality metrics, including PCR efficiencies (i.e. slope) of both short and long targets, Y-intercept values, and verification of no true amplification in negative controls was assessed.
Example 10
Identifying Patients With Increasing ctDNA
[0125] Blinded samples of plasma from 66 cancer patients were subjected to a qPCR to assess the level of ctDNA using the methods described herein and identify patients as having progressive disease. The plasma samples were from patients who had been previously diagnosed as having either colorectal cancer, non-small cell lung cancer, small cell lung cancer or breast cancer and had received either chemotherapy, targeted therapy, immunotherapy, or a combination of therapies.
[0126] A first plasma sample was obtained from the patients before receiving a cycle of therapy and a second plasma sample was obtained 12 days to 21 days after the cycle of therapy and before receiving another cycle of therapy. The qPCR assays were run on an Applied Biosystems 7500 Real Time PCR instrument and/or the Biorad CFX, but useful instrument platforms are not limited thereto and the qPCR assays of the present invention may be adapted to work on most Real-Time PCR instruments.
[0127] To assess the concentration and integrity index of the cfDNA in the samples from control and cancer patients, a first ALU Yb8 target of 80 bp, and a second ALU Yb8 target of 105 bp and an SVA target of 265 bp were amplified and quantified in a RE-qPCR multiplex reaction. The sequence of the primer pairs used to amplify yb-8-80, yb-8 105 and SVA 265 are set forth in Table 1. The RE-qPCR multiplex reaction was a Taqman® based assay comprising Brilliant Multiplex QPCR Master Mix (Agilent), bovine serum albumin (BSA), dimethyl sulfoxide (DMSO), and magnesium chloride (MgCl.sub.2), and comprised the plasma sample, a primer pair for amplifying the first ALU yb-8 target of 80 bp, a primer pair for amplifying the second ALU Yb8 target of 105 bp, and a primer pair for amplifying a third SVA target of 265 bp, and a synthetic internal positive control (IPC). The amplification products were detected with hybridization probes for the Yb-8 80 bp target, the Yb8-105 bp target and the SVA 265 bp target, each labeled with a different fluorophore to enable simultaneous detection of the different amplified targets.
[0128] Real-time PCR amplification was performed with pre-cycling heat activation of DNA polymerase in a QuantStudio-5 (Thermofisher Scientifics). The quantification of the RE targets in each sample was determined by use of a calibration curve with serial dilutions (20 ng/ul to 0.6 pg/ul) and the difference between the amount of the first Yb8 80 bp target and the amount of the second Yb8 105 bp target in the first sample (Frag1) and the amount of the first Yb8 80 bp target and the amount of the second Yb8 105 bp target in the second samples of plasma (Frag2) were calculated. The difference between Frag2 and Frag1 (Frag Diff) was also calculated. An increase in the amount of the 80 bp yb-8 target as compared to the 105 bp yb-8 target in the second sample as compared to the first sample indicated an increase in the ctDNA.
[0129]
[0130] While the invention has been described and illustrated with reference to certain particular embodiments thereof, those skilled in the art will appreciate that various adaptations, changes, modifications, substitutions, deletions, or additions of procedures and protocols may be made without departing from the spirit and scope of the invention. It is intended, therefore, that the invention be defined by the scope of the claims that follow and that such claims be interpreted as broadly as is reasonable. All references cited herein are incorporated by reference.