Methods for Identifying Modulators of G Protein-Coupled Receptors
20230053864 · 2023-02-23
Inventors
- Daniel Isom (Miami, FL, US)
- William Morgan (Miaimi, FL, US)
- Nicholas Kapolka (Miami, FL, US)
- Geoffrey Taghon (Miami, FL, US)
- Jacob Rowe (Miami, FL, US)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
G01N2500/04
PHYSICS
G01N33/6872
PHYSICS
C12N2320/12
CHEMISTRY; METALLURGY
C07K14/705
CHEMISTRY; METALLURGY
International classification
C07K14/705
CHEMISTRY; METALLURGY
Abstract
The disclosure relates to a plurality of cells, compositions and methods for identifying modulators of a target protein. The cells, compositions and methods comprise a (i) a target domain gene (ii) an intracellular chimeric G-protein alpha subunit comprising an endogenous G-protein alpha subunit with a humanized C-terminus; and (iii) an inducible reporter, wherein the expression of the reporter is dependent on the activation of the target domain encoded by target domain gene, and wherein the target domain gene comprises a barcode. The disclosure further relates to a host cell comprising a plurality of exogenous landing pads integrated in the host cell's genome, wherein each exogenous landing pad is integrated at a safe harbor genome loci in the host cell's genome.
Claims
1. A plurality of cells, wherein each cell comprises (i) one or more of a target domain gene that specifically binds to a binding partner (ii) one or more of an intracellular chimeric G-protein alpha subunit comprising an endogenous G-protein alpha subunit with a humanized C-terminus; and (iii) one or more of an inducible reporter, wherein the expression of the reporter is dependent on the activation of the target domain encoded by the target domain gene, and wherein the target domain gene comprises a barcode.
2. The plurality of cells of claim 1, wherein the one or more of target domain is a membrane channel, a symporter transporter, an antiporter transporter, an ATPase, an enzyme or a receptor.
3. The plurality of cells of claim 2, wherein the receptor is a G-protein coupled receptor (GPCR).
4. The plurality of cells of claim 1, wherein the one or more of inducible reporter is a transcriptional reporter.
5. The plurality of cells of claim 1, wherein the transcriptional reporter is mTurquoise2.
6. The plurality of cells of claim 1, wherein the cells are yeast cells.
7. The plurality of cells of claim 6, where the yeast cells are Saccharomyces cervisiae.
8. The plurality of cells of claim 6, wherein the yeast cells lack an endogenous GPCR.
9. A method for identifying a compound capable of modulating the activity of a target domain, comprising: (a) contacting the plurality of cells of claim 1 with a compound; (b) determining the activity of the target domain by detecting the reporter; wherein detection of the reporter in the cell indicates that the compound interacts with the target domain.
10. The method of claim 9, wherein the target domain is a membrane channel, a symporter transporter, an antiporter transporter, an ATPase, an enzyme or a receptor.
11. The method of claim 10, wherein the receptor is a G-protein coupled receptor (GPCR).
12. The method of claim 10, wherein the compound is a metabolite, lead compound, drug, natural product, or other experimental small molecule, lipid, peptide, or protein.
13. A yeast cell comprising a plurality of landing pads integrated in the yeast cell's genome, wherein each exogenous landing pad is integrated at a safe harbor genome loci in the yeast cell's genome.
14. The yeast cell of claim 13, wherein the yeast cell comprises between 1 to 4 exogenous landing pads.
15. The yeast cell of claim 14, wherein the yeast cell comprises 4 exogenous landing pads.
16. The yeast cell of claim 13, where the yeast cell is Saccharomyces cervisiae.
17. The yeast cell of claim 13, wherein the plurality of exogenous landing pads are integrated at loci X-2, X-3, XI-2, and/or XII-5 of the yeast cell's genome.
18. The yeast cell of claim 13, wherein the plurality of exogenous landing pads comprise a unique targeting sequence.
19. The yeast cell of claim 13, wherein the plurality of exogenous landing pads comprise a unique targeting sequence, a PAM site, and buffer DNA.
20. The yeast cell of claim 13, wherein the plurality of exogenous landing pads are integrated sequentially.
21. The yeast cell of claim 20, wherein the landing pads are integrated sequentially in the following order: X-2, XII-5, X-3, and XI-2.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
DETAILED DESCRIPTION
[0030] The disclosure relates to a plurality of cells, compositions and methods for identifying modulators of a target domain. The cells, compositions and methods comprise a (i) one or more of a target domain gene that specifically binds to a binding partner (ii) one or more of an intracellular chimeric G-protein alpha subunit comprising an endogenous G-protein alpha subunit with a humanized C-terminus; and (iii) one or more of an inducible reporter, wherein the expression of the reporter is dependent on the activation of the target domain encoded by the target domain gene, and wherein the target domain gene comprises a barcode.
[0031] As utilized in accordance with the present disclosure, unless otherwise indicated, all technical and scientific terms shall be understood to have the same meaning as commonly understood by one of ordinary skill in the art. Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.
[0032] Without limiting the disclosure, a number of embodiments of the disclosure are described herein for purpose of illustration.
[0033] In particular embodiments, provided herein are a plurality of cells, wherein each cell comprises (i) one or more of a target domain gene that specifically binds to a binding partner (ii) one or more of an intracellular chimeric G-protein alpha subunit comprising an endogenous G-protein alpha subunit with a humanized C-terminus; and (iii) one or more of an inducible reporter, wherein the expression of the reporter is dependent on the activation of the target domain encoded by target domain gene, and wherein the target domain gene comprises a barcode.
[0034] The term “encode” as it is applied to polynucleotides refers to a polynucleotide which is said to “encode” a polypeptide if, in its native state or when manipulated by methods well known to those skilled in the art, it can be transcribed and/or translated to produce the mRNA for the polypeptide and/or a fragment thereof.
[0035] The plurality of cells may comprise cells, each of which contains only one target domain comprising a barcode that can be used to identify the target domain and an inducible reporter that is activated in the same cell. In particular embodiments, the plurality of cells is ns a “mixture” or “multiplex mixture” of many different GPCR-containing cells against a particular ligand. The population of cells may comprise at least or at most 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4500, 5000, 6000, 7000, 8000, 9000, 10000.
[0036] “Binding partner” refers to an ion, ligand, small molecule, metabolite, aptamer, peptide, or protein that activates the target domain gene.
[0037] The target domain gene can encode a membrane channel, a symporter transporter, an antiporter transporter, an ATPase, an enzyme or a receptor. In particular embodiments, the receptor is a G-protein coupled receptor (GPCR).
[0038] The term “G-Coupled Protein Receptor” or “GCPR” refers to any member of the large family of transmembrane receptors that typically function to bind molecules outside the cell and activate inside signal transduction pathways, ultimately inducing one or more cellular responses. G protein-coupled receptors are found only in eukaryotes, including yeast and animals.
[0039] Binding and activation of a GPCR typically involves signal transduction pathways including the cAMP signal pathway and the phosphatidylinositol signal pathway. When a ligand binds to the GPCR it causes a conformational change in the GPCR, which allows it to act as a guanine nucleotide exchange factor (GEF). The GPCR can then activate an associated G-protein by exchanging its bound GDP for a GTP. The G-protein's a subunit, together with the bound GTP, can then dissociate from the β and γ subunits to further affect intracellular signaling proteins or target functional proteins directly depending on the a subunit type (Gαs, Gαi/o, Gαq/11, Gα12/13).
[0040] All GPCRs share a common structure and mechanism of signal transduction. Generally, GPCRs can be grouped into 6 classes based on sequence homology and functional similarity: Class A (or 1) (Rhodopsin-like), Class B (or 2) (Secretin receptor family), Class C (or 3) (Metabotropic glutamate/pheromone), Class D (or 4) (Fungal mating pheromone receptors), Class E (or 5) (Cyclic AMP receptors), Class F (or 6) (Frizzled/Smoothened). The human genome alone encodes thousands of G protein-coupled receptors, many of which are involved in detection of endogenous ligands (e.g., hormones, growth factors, etc.).
[0041] In some embodiments, the GPCR is localized to the cell membrane. In some embodiments, the GPCR is localized intracellularly. In some embodiments, the cell lacks an endogenous gene that encodes for a GPCR that is at least 80% identical to the target domain GPCR gene. In some embodiments, the GPCR gene is integrated into the cell's genome. In particular embodiments, the GPCR gene is integrated from a safe harbor locus located in chromosome X, known as X-2. In some embodiments, the inducible reporter is integrated into the cell's genome.
[0042] In particular embodiments, the target domain gene comprises a “barcode” or a unique sequence. The barcode is used to uniquely identify or distinguish the target domain. The barcode may be of any suitable length for unambiguously identifying the target domain gene. The length of the barcode sequence is not critical, and may be of any length sufficient to distinguish the barcode sequence from other barcode sequences. In particular embodiments, the target domain gene is heterologous to the yeast system and represents a unique DNA sequence that can be identified by quantitative polymerase chain reaction, NanoString, sequencing, and similar methods.
[0043] In some embodiments, the reporter is induced by signal transduction upon activation of the GPCR. In some embodiments, the reporter comprises one or more of a cAMP response element (CRE), a nuclear factor of activated T-cells response element (NFAT-RE), serum response element (SRE), and serum response factor response element (SRF-RE). In some embodiments, the reporter is a transcriptional reporter such as mTurquoise2 (mTq2). In particular embodiments, the mTq2 reporter replaces the pheromone-responsive gene FIG1 open reading frame in the cell.
[0044] In some embodiments, the cells are yeast cells Saccharomyces cerevisiae, Schizosaccharomyces pombe, Yarrowia lipolytica, Candida glabrata, Ashbya gossypii, Cyberlindnera jadinii, Pichia pastoris, Kluyveromyces lactis, Hansenula polymorpha, Candida boidinii, Arxula adeninivorans, Xanthophyllomyces dendrorhous, or Candida albicans species.
[0045] In particular embodiments, the cells have disruption of the pheromone pathway such as deletion of FAR1 and SST2. In particular embodiments, the factor arrest protein (FAR1) is deleted to prevent cell-cycle arrest upon pathway activation. In some embodiments, the GTPase-activating protein (SST2) is deleted to sensitize the pheromone pathway by prolonging Gα activation. In some embodiments, the endogenous yeast GPCR STE2 gene is deleted.
[0046] In particular embodiments, each cell has an endogenous G-protein alpha subunit with a humanized C-terminus. In particular embodiments, the last five yeast residues of the yeast Gα subunit, Gpa1, is replaced by the last five residues of a human Gα subunit. In some embodiments, activation of the Gα chimera triggers a MAP kinase signaling cascade that drives the expression of the transcriptional reporter, mTurquoise2 (mTq2).
[0047] In particular embodiments, each cell has two target domain genes that specifically binds to a binding partner, two intracellular chimeric G-protein alpha subunits comprising an endogenous G-protein alpha subunit with a humanized C-terminus, and two inducible reporters. In particular embodiments, each cell has three target domain genes that specifically binds to a binding partner, three intracellular chimeric G-protein alpha subunits comprising an endogenous G-protein alpha subunit with a humanized C-terminus, and three inducible reporters. In particular embodiments, each cell has four target domain genes that specifically binds to a binding partner, four intracellular chimeric G-protein alpha subunits comprising an endogenous G-protein alpha subunit with a humanized C-terminus, and four inducible reporters.
[0048] In some embodiments, provided herein is a method for identifying a compound capable of modulating the activity of a target domain, comprising: (a) contacting the plurality of cells disclosed herein with a compound; (b) determining the activity of the target domain by detecting the reporter; wherein detection of the reporter in the cell indicates that the compound interacts with the target domain.
[0049] In one embodiment, a compound is capable of modulating the activity of a target domains when it is capable of affecting directly or indirectly the activity of the domain.
[0050] The methods disclosed herein involve identification of a candidate compound which affects in some way the activity of the target domain. The methods also encompass the ability to screen a library of potential candidate compounds, such that compounds can be utilized in further therapeutic development. Many GPCRs bind ligands at multiple recognition sites. Endogenous ligands that bind to primary binding sites are referred to as orthosteric ligands, while those that bind to secondary sites are allosteric modulators. In particular embodiments, the methods allow identification of metabolites that serve as these types of regulators for a variety of GPCRs. In particular embodiments, the methods allow identification of activating ligands, agonists, antagonists, lead compounds, drugs, or portions thereof.
[0051] In particular embodiments, determining the activity of the target domain by detecting the reporter is performed using fluorescence activated cell sorting. In particular embodiments, a tracer strain is included in the methods to enable the comparison of different runs and to empirically determine the optimal duration of the sorting procedure. In particular embodiments, FACS gates are used to discern tracer, active, and inactive cell pools.
[0052] A safe harbor loci refers to a loci of the host cell located in non-coding regions and possess high gene expression. In some embodiments provided herein is a yeast cell comprising a plurality of exogenous landing pads integrated in the yeast cell's genome, wherein each exogenous landing pad is integrated at a safe harbor genome loci in the yeast cell's genome.
[0053] In some embodiments, the host cell comprises between 1 to 4 exogenous landing pads. In some embodiments, the host cell comprises 1, 2 or 3 exogenous landing pads. In some embodiments, the host cell comprises 4 exogenous landing pads.
[0054] In some embodiments, the host cell is Saccharomyces cervisiae. In some embodiments, the plurality of exogenous landing pads are integrated at loci X-2, X-3, XI-2, and/or XII-5 of the host cell's genome. In some embodiments, the plurality of exogenous landing pads are integrated sequentially. In some embodiments, the plurality of exogenous landing pads are integrated sequentially in the following order: X-2 , XII-5, X-3, and XI-2.
[0055] In some embodiments, the plurality of exogenous landing pads comprise a unique targeting sequence. In some embodiments, the plurality of exogenous landing pads comprise a unique target sequence, a PAM site, buffer DNA.
EXAMPLES
[0056] The Examples that follow are illustrative of specific embodiments of the disclosure, and various uses thereof. They are set forth for explanatory purposes only and should not be construed as limiting the scope of the disclosure in any way.
Example 1: High-Throughput CRISPR Genome Editing Pipeline
i. Materials and Methods
[0057] Media. The different media types used in the examples are detailed in Table 1.
TABLE-US-00001 TABLE 1 REAGENT or RESOURCE SOURCE IDENTIFIER Media Formulations Concentration Medium Synthetic Complete Dextrose/Synthetic Complete SCD/SCD -U Dextrose - Uracil Medium Ammonium sulfate 5.00 g/L CSM/CSM-URA supplement mixture 0.79/0.77 g/L Glucose 20.00 g/L Sodium hydroxide 0.1 g/L Yeast nitrogen base without amino acids & 1.70 g/L ammonium sulfate Synthetic Complete Dextrose Low Fluorescence SCD LoFo pH 7.0 Screening Medium Ammonium sulfate 5.00 g/L CSM supplement mixture 0.79 g/L Dextrose 20.00 g/L MES monohydrate 9.76 g/L Potassium phosphate dibasic 8.72 g/L Yeast nitrogen base- Low fluorescence without 1.70 g/L amino acids, folic acid, and riboflavin Potassium hydroxide solution pH adjustment to 7.0 Hydrochloric acid solution pH adjustment to 7.0 Yeast Peptone Dextrose Medium YPD Yeast extract 10.00 g/L Peptone 20.00 g/L D-(+)-Glucose 10.00 g/L 5FOA Counterselection Medium 5FOA Yeast nitrogen base 6.7 g/L CSM supplement mixture 0.79 g/L (has 20 mg uracil) Uracil 30 mg/L (50 mg total) 5FOA 1 g/L Dextrose 20 g/L Bacto Agar 15 g/L Chemicals, Peptides, and Recombinant Proteins (+)-Sodium L-ascorbate Research Products S42165 International (±)-Epinephrine hydrochloride Sigma-Aldrich E4642 (Arg.sup.8)-vasopressin acetate Sigma-Aldrich V9879 18:1 Lyso PA (LPA) Avanti Polar Lipids 857130 2-amino-1-phenylethanol (PEOA) Sigma-Aldrich A72405 2-arachidonoylglycerol (2-AG) Sigma-Aldrich A8973 3-hydroxyoctanoic acid Sigma-Aldrich H3898 Acetylcholine chloride Sigma-Aldrich A6625 Adenosine Sigma-Aldrich A9521 Agar bacteriological grade Research Products 20030 International Ammonium sulfate Sigma-Aldrich A4915 Androsterone Sigma-Aldrich E3375 CSM supplement mixture MP Biomedicals SKU 114500012 CSM-URA supplement mixture MP Biomedicals SKU 114511212 D-(+)-Glucose Research Products G32045 International Dehydroepiandrosterone (DHEA) EMD Millipore 252805 Dopamine hydrochloride Sigma-Aldrich H8502 Ethylenediaminetetraacetate disodium salt Sigma-Aldrich E5134 dihydrate (EDTA) HU-210 Supelco S-024 Human Endogenous Metabolite Compound Library MedChemExpress HY-L030 Hydrochloric acid 5N J T Baker 5618-02 Isoprenaline hydrochloride Sigma-Aldrich I5627 Kynurenic acid Sigma-Aldrich K3375 L-kynurenine Sigma-Aldrich K8625 Lithium acetate Sigma-Aldrich 517992 Melatonin Sigma-Aldrich M5250 MES monohydrate Research Products M22040 International Nicotinic acid (niacin) Sigma-Aldrich N4126 Peptone Research Products P20240 International Petroselinic acid Sigma-Aldrich P8750 Platelet-activating factor (PAF) Sigma-Aldrich P7568 Polyethylene glycol 3350 (PEG.sub.3350) Sigma-Aldrich 88276 Potassium phosphate dibasic Sigma-Aldrich P3786 Prostaglandin E2 Sigma-Aldrich P5172 Salmon sperm DNA Invitrogen 15632-011 Serotonin hydrochloride Sigma-Aldrich H9523 Sodium acetate Sigma-Aldrich S2889 Sodium ascorbate Sigma-Aldrich A7631 Sodium butyrate Sigma-Aldrich B5887 Sodium hydroxide BDH-VWR BDH9292 Sodium propionate Sigma-Aldrich P1880 Sodium succinate Sigma-Aldrich 14160 Somatostatin-14 (SRIF-14) Cayman Chemical 20809 Sphingosine-1-phosphate (S1P) Avanti Polar Lipids LM2144 Trizma base Sigma-Aldrich 93352 Tryptamine hydrochloride Sigma-Aldrich 246557 Yeast extract Research Products Y20020 International Yeast nitrogen base - Low fluorescence without Formedium CYN6505 amino acids, folic acid and riboflavin Yeast nitrogen base without amino acids & Research Products Y20060 ammonium sulfate International β-alanine Sigma-Aldrich 146064 Experimental Models: Organisms/Strains BY4741 Gift from Dohlman lab BY4741 BY4741 far1Δ sst2Δ ste2Δ fig1Δ::mTq2 X- This paper DI dCyFIR P1 I 2: P.sub.TEF1a-UnTS-T.sub.CYC1b gpal(468- 472)(KIGII > ECGLY) BY4741 far1Δ sst2Δ ste2Δ fig1Δ::mTq2 X- This paper DI dCyFIR P1 O 2: P.sub.TEF1a-UnTS-T.sub.CYC1b gpal(468- 472)(KIGII > GCGLY) BY4741 far1Δ sst2Δ ste2Δ fig1Δ::mTq2 X- This paper DI dCyFIR P1 T 2: P.sub.TEF1a-UnTS-T.sub.CYC1b gpal(468- 472)(KIGII > DCGLF) BY4741 far1Δ sst2Δ ste2Δ fig1Δ::mTq2 X- This paper DI dCyFIR P1 Z 2: P.sub.TEF1a-UnTS-T.sub.CYC1b gpal(468- 472)(KIGII > YIGLC) BY4741 far1Δ sst2Δ ste2Δ fig1Δ::mTq2 X- This paper DI dCyFIR P1 Q 2: P.sub.TEF1a-UnTS-T.sub.CYC1b gpal(468- 472)(KIGII > EYNLV) BY4741 far1Δ sst2Δ ste2Δ fig1Δ::mTq2 X- This paper DI dCyFIR P1 14 2: P.sub.TEF1a-UnTS-T.sub.CYC1b gpal(468- 472)(KIGII > EFNLV) BY4741 far1Δ sst2Δ ste2Δ fig1Δ::mTq2 X- This paper DI dCyFIR P1 15 2: P.sub.TEF1a-UnTS-T.sub.CYC1b gpal(468- 472)(KIGII > EINLL) BY4741 far1Δ sst2Δ ste2Δ fig1Δ::mTq2 X- This paper DI dCyFIR P1 12 2: P.sub.TEF1a-UnTS-T.sub.CYC1b gpal(468- 472)(KIGII > DIMLQ) BY4741 far1Δ sst2Δ ste2Δ fig1Δ::mTq2 X- This paper DI dCyFIR P1 13 2: P.sub.TEF1a-UnTS-T.sub.CYC1b gpal(468- 472)(KIGII > QLMLQ) BY4741 far1Δ sst2Δ ste2Δ fig1Δ::mTq2 X- This paper DI dCyFIR P1 S 2: P.sub.TEF1a-UnTS-T.sub.CYC1b gpal(468- 472)(KIGII > QYELL) Software and Algorithms GraphPad Prism 7 GraphPad Software https://www.graphpad.com BLAST National Center for https://blast.ncbi.nlm.nih.gov Biotechnological Information Python v2.7.16 Python Software Foundation https://www.python.org Primer3 Open Source https://primer3.org JMP SAS https://jmp.com Zen Zeiss https://www.zeiss.com biomekController.py This study N/A matrixMinusPlus.py This study N/A matrixMinusPlusParse.py This study N/A libraryScreener.py This study N/A hitPickerByZ.py This study N/A biomekYeastTrafo.py This study N/A qPcrPrimerDesigner.py This study N/A biomekQpcrDeconvo.py This study N/A qPcrDeconvoParse.py This study N/A
[0058] CRISPR transformation reactions. CRISPR edits in yeast were done by co-transforming plasmids containing the CRISPR machinery (Cas9 endonuclease and guide RNA) and DNA payloads containing homology arms typically within 30 bp of the double-stranded DNA break made by Cas9 at the targeted genome locus. The transformations were performed both on an individual basis and in high-throughput format.
[0059] Individual CRISPR transformation reactions. Five milliliters of cells were grown to mid-log phase (OD=0.2-1.0) in YPD medium. Cells were harvested by centrifugation and washed with 5 mL TE buffer (10 mM Tris, 1 mM EDTA), then harvested again and washed with 5 mL lithium acetate mix buffer (LiOAc mix; 10 mM Tris, 1 mM EDTA, 100 mM LiOAc). Cells were harvested by centrifugation and resuspended in 200 μL LiOAc mix buffer. CRISPR vector(s) (300 ng) and DNA payload (4-5 μg) were combined with salmon sperm DNA (100 μg) in a mix with 50 μL cells and 350 μL PEG mix (10 mM Tris, 1 mM EDTA, 100 mM LiOAc, 40% PEG.sub.3350). This mixture was incubated at room temperature for 30 minutes before addition of 24 μL DMSO and a 15 minute heat shock at 42° C. Following heat shock, cells were harvested by centrifugation at 8000×g for 1 minute, resuspended in 200 μL YPD and spread on selective media plates poured in petri-dishes with a 100 mm diameter. This protocol is sufficient for 4 individual CRISPR transformations and is scalable.
[0060] High-throughput CRISPR transformation reactions. Hundreds of new yeast strains were engineered using a miniaturized version of the protocol for “Individual CRISPR transformation reactions”. Both approaches used the same culture and plate media compositions. For the miniaturized protocol, the necessary CRISPR vector(s) (150 ng) and DNA payload (4-5 μg) for many transformation reactions (typically 80-100 at a time) were combined in a mixture with 50 μL cells and 175 μL PEG mix in individual wells of a 96-well plate (CytoOne CC7672-7596). This mixture was incubated for 30 minutes at room temperature before addition of 12 μL DMSO and a 15 minute heat shock at 42° C. Cells were harvested by centrifugation and resuspended in 100 μL YPD. 30 μL transformant resuspension was distributed over miniaturized selective media plates poured in a 22.1 mm 12-well microplates (CytoOne CC7672-7512). Each step was performed on our Biomek NXp liquid-handling robot driven by our custom Python code. Colonies were picked into SCD-U media.
[0061] Counterselection to remove CRISPR vectors. An advantage of CRISPR in yeast is the ability to engineer a genome modification without exhausting available auxotrophic markers. In the examples, CRISPR vectors conferring URA selectivity were primarily used, which could be removed via counter-selection on 5FOA plates after the desired genome edit was confirmed. In cases where two CRISPR vectors where used, such as gene deletions, the CRISPR vector conferring URA selectivity was removed as usual by counter-selection on 5FOA and the CRISPR vector conferring LEU selectivity was naturally lost after several generations of outgrowth in non-selective media. As a result, the base BY4741 genotype remained unchanged, despite the many changes introduced into the genomes of the GPCR-Gα reporter strains.
[0062] CRISPR guide RNA plasmid design. Previously described methods and base CRISPR vectors pML104 (Addgene #67638), pML107 (Addgene #67639), and pT040 (Addgene #67640) (Laughery, et al., (2015). Yeast 32, 711-720) were used to construct all genomically targeted guide RNA plasmids used in this study. Briefly, pML104 and pML107 plasmids both contain the Cas9 endonuclease ORF, a gRNA scaffold flanked by a SNR52 promoter and SUP4 terminator, and an auxotrophic marker (URA and LEU, respectively). Plasmid pT040 contains the same gRNA scaffold as pML104 and pML107, as well as a URA auxotrophic marker.
[0063] CRISPR DNA payload design. In every CRISPR transformation reaction, the necessary CRISPR vector(s) were co-transformed with a DNA sequence that serves to both 1) patch the locus-specific double-stranded DNA break caused by the Cas9 endonuclease and 2) incorporate the desired gene deletion, edit, replacement, or knock-in. This DNA sequence, referred to as a DNA payload, contains both the DNA required for the desired CRISPR change (usually a heterologous gene or gene fragment) and important design features for targeting the intended genome location (homology arms) and preventing continued Cas9 cutting once the genome has been altered (PAM silencing).
[0064] Homology arm design. The DNA payloads were flanked by homology arms that typically contained 60 bp of genome sequence upstream and downstream of the targeted genome locus. These homology arms were introduced by PCR amplification (using primers with overhangs containing the necessary homology), or by including the sequence homology directly in the designs of synthetic payloads (e.g. gBlocks and synthetic DNA constructs cloned into storage vectors). Based on empirical observations from thousands of CRISPR edits, homology arms less than 60 bp were not used to prevent diminished CRISPR efficiency.
[0065] PAM silencing design. Once a DNA payload has been integrated into the yeast genome, Cas9 endonuclease will continue to create a double-stranded break at the targeted genome locus if the PAM site is not removed by the genome edit. Such constant cutting can reduce CRISPR efficiency due to its effect as a cytotoxic stress and as a mechanism for reversing the desired genome edit. In such cases where PAM silencing was needed, continuous genome cutting was prevented by including a point mutation in the portion of the homology arm that corresponds to the PAM site. This process was called PAM silencing. In cases where PAM silencing occurred within the open reading frame of a protein, an alternative amino acid codon that removes the PAM site was used in place of the original codon in the homology arm.
[0066] The collection of PAM-silenced homology arms used to deliver the various CRISPR payloads is listed in Table 2. Deletion, editing, and replacement of all genes was verified by PCR gel electrophoresis using the relevant primers.
TABLE-US-00002 TABLE 2 Construct name Type Sequence (5'-3') FAR1 gBlock TGTCTTGAGAGTGTATATTATCTTATCTATTCAAAAAATTTC DP TATTTACTTTTATATTTCTTGACCATCCTTTACACAAAGTCT ATAGATCCACTGGAAAGCTTCGTGGGCGTAAGAAGGCAAT CTATTATAGTTCGGGAATCGAGGCCCGTATTTCGAGGCTTT TGCTTTTCCTTTTTTTTTTTTCGTTTCTCCACGTCTATACTAC GCAATGACTGAATATATATAATGCGTCGTAAATAGCAGTT AATGTATAAATA Ste2 DP gBlock CTTCAAAGCAATACGATACCTTTTCTTTTCACCTGCTCTGGC TATAATTATAATTGGTTACTTAAAAATGCACCGTTAAGAAC CATATCCAAGAATCAAAATCAAAATTTACGGCTTTGAAAA AGTAATTTCGTGACCTTCGGTATAAGGTTACTACTAGATTC AGGTGCTCATCAGATGCACCACATTCTCTATAAAAAAA GPA1_ gBlock TTTTTGAGCTTGAATAAGACAAACAAACCAATCTACGTGA chimera_ AACGAACCTGCGCTACCGATACCCAAACTATGAAGTTCGT GNAI3 ATTGAGTGCAGTCACTGATCTAATCATCCAGCAAAACCTTA AAGAATGTGGTTTGTATTGAAGGAACTGTATAATTAAAGT AGTGTTTAGATACGTAAATTCTGTTTCCGAAGATGCAAGAA GGAGCAGCAGCACCAGAAAAAATTACTATTTTTCTTCTCCA TTAGAGTCTATGATGGAA GPA1_ gBlock TTTTTGAGCTTGAATAAGACAAACAAACCAATCTACGTGA chimera_ AACGAACCTGCGCTACCGATACCCAAACTATGAAGTTCGT GNAO ATTGAGTGCAGTCACTGATCTAATCATCCAGCAAAACCTTA AAGGTTGTGGTTTGTATTGAAGGAACTGTATAATTAAAGTA GTGTTTAGATACGTAAATTCTGTTTCCGAAGATGCAAGAAG GAGCAGCAGCACCAGAAAAAATTACTATTTTTCTTCTCCAT TAGAGTCTATGATGGAA GPA1_ gBlock TTTTTGAGCTTGAATAAGACAAACAAACCAATCTACGTGA chimera_ AACGAACCTGCGCTACCGATACCCAAACTATGAAGTTCGT GNAT12 ATTGAGTGCAGTCACTGATCTAATCATCCAGCAAAACCTTA 3_I12 AAGATTGCGGTTTGTTTTGAAGGAACTGTATAATTAAAGTA GTGTTTAGATACGTAAATTCTGTTTCCGAAGATGCAAGAAG GAGCAGCAGCACCAGAAAAAATTACTATTTTTCTTCTCCAT TAGAGTCTATGATGGAA GPA1_ gBlock TTTTTGAGCTTGAATAAGACAAACAAACCAATCTACGTGA chimera_ AACGAACCTGCGCTACCGATACCCAAACTATGAAGTTCGT GNAZ ATTGAGTGCAGTCACTGATCTAATCATCCAGCAAAACCTTA AATATATCGGTTTGTGCTGAAGGAACTGTATAATTAAAGTA GTGTTTAGATACGTAAATTCTGTTTCCGAAGATGCAAGAAG GAGCAGCAGCACCAGAAAAAATTACTATTTTTCTTCTCCAT TAGAGTCTATGATGGAA GPA1_ gBlock TTTTTGAGCTTGAATAAGACAAACAAACCAATCTACGTGA chimera_ AACGAACCTGCGCTACCGATACCCAAACTATGAAGTTCGT GNAQ_1 ATTGAGTGCAGTCACTGATCTAATCATCCAGCAAAACCTTA 1 AAGAATATAATTTGGTTTGAAGGAACTGTATAATTAAAGT AGTGTTTAGATACGTAAATTCTGTTTCCGAAGATGCAAGAA GGAGCAGCAGCACCAGAAAAAATTACTATTTTTCTTCTCCA TTAGAGTCTATGATGGAA GPA1_ gBlock TTTTTGAGCTTGAATAAGACAAACAAACCAATCTACGTGA chimera_ AACGAACCTGCGCTACCGATACCCAAACTATGAAGTTCGT GNA14 ATTGAGTGCAGTCACTGATCTAATCATCCAGCAAAACCTTA AAGAATTTAATTTGGTTTGAAGGAACTGTATAATTAAAGTA GTGTTTAGATACGTAAATTCTGTTTCCGAAGATGCAAGAAG GAGCAGCAGCACCAGAAAAAATTACTATTTTTCTTCTCCAT TAGAGTCTATGATGGAA GPA1_ gBlock TTTTTGAGCTTGAATAAGACAAACAAACCAATCTACGTGA chimera_ AACGAACCTGCGCTACCGATACCCAAACTATGAAGTTCGT GNA15 ATTGAGTGCAGTCACTGATCTAATCATCCAGCAAAACCTTA AAGAAATTAATTTGTTGTGAAGGAACTGTATAATTAAAGT AGTGTTTAGATACGTAAATTCTGTTTCCGAAGATGCAAGAA GGAGCAGCAGCACCAGAAAAAATTACTATTTTTCTTCTCCA TTAGAGTCTATGATGGAA GPA1_ gBlock TTTTTGAGCTTGAATAAGACAAACAAACCAATCTACGTGA chimera_ AACGAACCTGCGCTACCGATACCCAAACTATGAAGTTCGT GNA12 ATTGAGTGCAGTCACTGATCTAATCATCCAGCAAAACCTTA AAGATATTATGCTACAATGAAGGAACTGTATAATTAAAGT AGTGTTTAGATACGTAAATTCTGTTTCCGAAGATGCAAGAA GGAGCAGCAGCACCAGAAAAAATTACTATTTTTCTTCTCCA TTAGAGTCTATGATGGAA GPA1_ gBlock TTTTTGAGCTTGAATAAGACAAACAAACCAATCTACGTGA chimera_ AACGAACCTGCGCTACCGATACCCAAACTATGAAGTTCGT GNA13 ATTGAGTGCAGTCACTGATCTAATCATCCAGCAAAACCTTA AACAATTGATGTTGCAATGAAGGAACTGTATAATTAAAGT AGTGTTTAGATACGTAAATTCTGTTTCCGAAGATGCAAGAA GGAGCAGCAGCACCAGAAAAAATTACTATTTTTCTTCTCCA TTAGAGTCTATGATGGAA GPA1_ gBlock TTTTTGAGCTTGAATAAGACAAACAAACCAATCTACGTGA chimera_ AACGAACCTGCGCTACCGATACCCAAACTATGAAGTTCGT GNAS_L ATTGAGTGCAGTCACTGATCTAATCATCCAGCAAAACCTTA AACAATATGAATTGTTGTGAAGGAACTGTATAATTAAAGT AGTGTTTAGATACGTAAATTCTGTTTCCGAAGATGCAAGAA GGAGCAGCAGCACCAGAAAAAATTACTATTTTTCTTCTCCA TTAGAGTCTATGATGGAA CHRM1 gBlock ATGAATACAAGCGCTCCTCCAGCGGTTTCCCCAAATATTAC Δil3 GGTGCTGGCACCTGGGAAAGGACCATGGCAAGTTGCTTTT ATCGGTATCACCACCGGCTTGCTCTCCTTGGCAACAGTCAC GGGCAATTTGCTCGTACTGATCTCATTTAAGGTGAACACAG AGCTGAAAACAGTGAACAACTACTTCTTGTTGAGTTTGGCC TGTGCGGACCTTATTATCGGAACGTTTTCAATGAATCTGTA TACAACCTATCTCCTGATGGGCCACTGGGCGCTGGGAACCC TTGCTTGCGACCTTTGGTTGGCCCTTGATTACGTGGCGAGC AACGCAAGCGTCATGAATCTCCTGTTGATATCATTTGACAG GTATTTTTCTGTTACCCGGCCCCTGAGCTACAGAGCTAAAC GAACTCCACGACGCGCTGCACTGATGATTGGTCTGGCCTGG CTGGTCAGTTTTGTCCTGTGGGCCCCTGCCATACTGTTTTGG CAGTACCTGGTGGGAGAGCGCACCGTGCTTGCAGGTCAGT GCTATATACAGTTTCTGTCTCAGCCCATAATCACATTCGGC ACCGCGATGGCGGCATTTTACTTGCCTGTGACTGTTATGTG TACTCTGTATTGGCGAATTTACCGCGAAACCGAGAATAGA GCCAGGGAACTTGCTGCACTGCAGGGTTCAGAGACAAAGG AACAGCTGGCGAAGCGGAAAACCTTCAGCCTCGTGAAGGA AAAGAAAGCCGCACGAACCCTGTCCGCTATCTTGCTGGCTT TCATACTGACCTGGACGCCTTATAACATTATGGTGCTGGTC TCCACCTTTTGTAAAGATTGCGTCCCAGAGACACTTTGGGA GCTGGGGTACTGGCTGTGCTATGTGAACTCCACAATTAACC CAATGTGTTATGCCTTGTGTAATAAAGCGTTCAGAGATACA TTCCGGCTTCTCCTTCTGTGCCGGTGGGATAAGAGGCGCTG GCGCAAAATCCCCAAACGGCCCGGGTCAGTTCACAGAACA CCTAGCAGACAATGTTAA CHRM3 gBlock ATGACGCTGCATAATAATTCAACCACAAGCCCTCTGTTCCC Δil3 TAACATCAGTAGTAGCTGGATACACTCTCCTAGCGACGCCG GACTTCCTCCCGGAACCGTGACCCACTTTGGGTCATATAAC GTCTCTCGGGCCGCAGGCAATTTTTCTTCCCCAGATGGGAC AACCGACGATCCGCTCGGCGGCCACACTGTATGGCAGGTG GTTTTCATAGCCTTTCTGACCGGCATTCTGGCTCTGGTCAC AATCATCGGCAATATTCTGGTAATTGTGTCCTTCAAGGTAA ACAAACAACTGAAGACTGTCAATAACTACTTTCTGCTTAGT TTGGCATGCGCCGATCTGATTATCGGAGTGATAAGTATGAA TCTCTTCACTACTTACATCATTATGAACAGATGGGCTCTGG GTAACTTGGCTTGCGACCTGTGGCTCGCAATTGACTATGTC GCAAGCAACGCCAGTGTGATGAACCTTCTGGTTATTAGCTT CGACCGCTATTTTAGCATTACACGCCCTCTGACCTACAGAG CGAAACGCACTACAAAGCGGGCAGGAGTTATGATCGGCCT GGCCTGGGTCATTTCCTTCGTGCTCTGGGCACCAGCCATCT TGTTCTGGCAGTATTTCGTCGGTAAGAGGACAGTCCCACCA GGCGAGTGCTTCATCCAATTTTTGTCCGAGCCAACCATAAC ATTCGGCACAGCCATCGCGGCATTTTACATGCCAGTGACTA TCATGACCATTCTGTACTGGAGAATCTACAAAGAAACCGA AAAGCGGACAAAGGAGTTGGCAGGGCTTCAGGCATCAGGC ACAGAGACCCGGTCACAGATAACCAAGCGCAAGCGAATGT CACTCGTGAAAGAAAAAAAAGCAGCACAGACATTGAGCGC CATCTTGCTCGCTTTTATCATAACATGGACACCCTACAATA TCATGGTCCTCGTGAACACTTTCTGCGACTCCTGTATTCCTA AGACTTTCTGGAACCTCGGCTACTGGCTGTGCTATATCAAC AGTACAGTTAACCCTGTGTGCTACGCTCTCTGTAACAAGAC CTTTAGGACCACGTTCAAGATGCTCCTCCTGTGCCAGTGTG ACAAAAAGAAACGACGAAAGCAGCAATATCAGCAGCGAC AGAGTGTGATCTTTCATAAACGGGCGCCAGAACAAGCGCT CTAA CHRM5 gBlock ATGGAGGGCGACTCATATCACAATGCCACGACTGTGAACG Δil3 GCACACCCGTCAACCACCAGCCACTTGAAAGGCACAGGCT TTGGGAGGTAATAACCATAGCCGCAGTGACTGCAGTAGTT AGTCTGATTACCATTGTTGGCAATGTATTGGTCATGATTTC TTTTAAGGTTAACAGCCAGCTGAAGACCGTGAATAATTATT ATCTCCTTTCCCTGGCATGCGCTGACTTGATCATCGGGATC TTTAGCATGAACCTGTATACTACGTACATCCTGATGGGGCG CTGGGCACTGGGTTCATTGGCATGTGACTTGTGGCTTGCGC TGGATTATGTTGCATCTAACGCCAGCGTAATGAATCTTCTC GTGATATCCTTTGACAGATACTTCTCTATTACACGGCCCCT GACGTACAGAGCCAAAAGGACCCCCAAACGAGCAGGCATC ATGATTGGACTGGCTTGGCTCATATCCTTCATACTCTGGGC CCCTGCGATCCTCTGTTGGCAGTATCTCGTGGGGAAAAGGA CTGTGCCCCTGGACGAATGCCAGATCCAGTTCCTGAGTGAG CCCACAATAACTTTTGGGACCGCCATAGCTGCTTTCTATAT TCCGGTATCCGTTATGACCATCCTTTACTGCAGGATCTACA GAGAGACAGAGAAAAGGACCAAAGATTTGGCTGATCTTCA GGGGTCTGATTCTGTGTCTACTAAAGGACTCAACCCGAATC CCAGCCATCAGATGACCAAACGCAAGCGGGTAGTGCTGGT TAAAGAAAGGAAAGCTGCACAGACTCTGAGCGCGATTCTG CTGGCCTTTATCATTACTTGGACCCCCTATAACATCATGGT GCTCGTATCTACTTTCTGTGACAAGTGCGTCCCCGTGACCC TGTGGCACCTGGGCTACTGGCTGTGCTACGTTAATTCAACA GTGAATCCCATCTGTTATGCCCTTTGTAACCGGACCTTTCG CAAAACCTTTAAGATGCTGCTTTTGTGTAGGTGGAAGAAG AAAAAAGTCGAAGAAAAGCTTTACTGGCAGGGCAATAGCA AATTGCCATAA X2-LP- PCR TCCATTTCTTTTTCCTCGGGCAGAGAAACTCGCAGGCAACT CYC 1b product TGCTCTCGAAGTGGTCACGCACACACCATAGCTTCAAAATG TTTCTACTCCTTTTTTACTCTTCCAGATTTTCTCGGACTCCG CGCATCGCCGTACCACTTCAAAACACCCAAGCACAGCATA CTAAATTTCCCCTCTTTCTTCCTCTAGGGTGTCGTTAATTAC CCGTACTAAAGGTTTGGAAAAGAAAAAAGAGACCGCCTCG TTTCTTTTTCTTCGTCGAAAAAGGCAATAAAAATTTTTATC ACGTTTCTTTTTCTTGAAAATTTTTTTTTTTGATTTTTTTCTC TTTCGATGACCTCCCATTGATATTTAAGTTAATAAACGGTC TTCAATTTCTCAAGTTTCAGTTTCATTTTTCTTGTTCTATTAC AACTTTTTTTACTTCTTGCTCATTAGAAAGAAAGCATAGCA ATCTAATCTAAGTTTTAATTACAATTGCGTAAGTGGCCCCT AGCGGGGCAGTGGTAATTAGTTATGTCACGCTTACATTCAC GCCCTCCTCCCACATCCGCTCTAACCGAAAAGGAAGGAGT TAGACAACCTGAAGTCTAGGTCCCTATTTATTTTTTTTAATA GTTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTT CTTTTTTTTCTGTACAAACGCGTGTACGCATGTAACATTAT ACTGAAAACCTTGCTTGAGAAGGTTTTGGGACGCTCGAAG GCTTTAATTTGGCATAATCGGCCCTCACAGAGGGATCCCGT TACCCATCTATGCTGAAGATTTATCATACT fig1- PCR GCTTGTCTTTGGTAGAAGAAATTATAGTAAACAAACAAAC mTq2 product AAACAAACAAAAAAAAAAAAAAAAAAatgtctaaaggtgaagaattgtt tactggtgttgttccaattttggttgaattggatggtgatgttaatggtcataaattttctgtttctggtga aggtgaaggtgatgctacttatggtaaattgactttgaaatttatttgtactactggtaaattgccagttc catggccaactttggttactactttgtcttggggtgttcaatgttttgctagatatccagatcatatgaaa caacatgatttttttaaatctgctatgccagaaggttatgttcaagaaagaactattttttttaaagatgat ggtaattataaaactagagctgaagttaaatttgaaggtgatactttggttaatagaattgaattgaaa ggtattgattttaaagaagatggtaatattttgggtcataaattggaatataattatttttctgataatgttt atattactgctgataaacaaaaaaatggtattaaagctaattttaaaattagacataatattgaagatg gtggtgttcaattggctgatcattatcaacaaaatactccaattggtgatggtccagttttgttgccag ataatcattatttgtctactcaatctgctttgtctaaagatccaaatgaaaaaagagatcatatggttttg ttggaatttgttactgctgctggtattactttgggtatggatgaattgtataaataaTTTTATCCT CAAATAAACATATAAGTTTTGAGCGGATATTTCAGAATGTC AATTTTTAAAAGTAA fus1- PCR TACGACATCCTTTATCTTTTTTCCTTTAAGAGCAGGATATA mTq2 product AGCCATCAAGTTTCTGAAAATCAAAatgtctaaaggtgaagaattgtttact ggtgttgttccaattttggttgaattggatggtgatgttaatggtcataaattttctgtttctggtgaaggt gaaggtgatgctacttatggtaaattgactttgaaatttatttgtactactggtaaattgccagttccatg gccaactttggttactactttgtcttggggtgttcaatgttttgctagatatccagatcatatgaaacaa catgatttttttaaatctgctatgccagaaggttatgttcaagaaagaactattttttttaaagatgatggt aattataaaactagagctgaagttaaatttgaaggtgatactttggttaatagaattgaattgaaaggt attgattttaaagaagatggtaatattttgggtcataaattggaatataattatttttctgataatgtttatat tactgctgataaacaaaaaaatggtattaaagctaattttaaaattagacataatattgaagatggtgg tgttcaattggctgatcattatcaacaaaatactccaattggtgatggtccagttttgttgccagataat cattatttgtctactcaatctgctttgtctaaagatccaaatgaaaaaagagatcatatggttttgttgga atttgttactgctgctggtattactttgggtatggatgaattgtataaataaTGAAAATAATA TTGACGTTCGCATTTAATCTATACCTATAATTCTGTACTTAT ATACTGTTCCTT
[0067] Design of the X-2 CRISPR-addressable expression cassette. Random 20 base pair (bp) guide sequences were generated using a custom Python program. Using the BLAST algorithm (Altschul, et al., (1990). J Mol Bio! 215, 403-410), the uniqueness of each guide sequence was tested against a locally built BLAST database for the updated release of the S. cerevisiae BY4741 genome (BY4741_Toronto_2012) available via www.yeastgenome.org (Cherry et al., (2012). Nucleic Acids Res 40, D700-705). Using the established threshold for avoiding off-target Cas9 cutting (DiCarlo, J. E., et al., (2013). Nucleic Acids Res 41, 4336-4343), guide sequences with more than three mismatched bases were identified and used as synthetic unique targeting sites (UnTS). The CRISPR-addressable expression cassette, referred to as a landing pad, was designed to include one of these UnTS sequences (5′-TTGCGTAAGTGGCCCCTAGC-3′) preceding a protospacer adjacent motif (PAM) site (5′-GGG-3′) flanked upstream by a constitutive TEF1 promoter (Partow, S., et al., (2010). Yeast 27, 955-964) and downstream by a CYC1 terminator variant, CYC1b, a corrected version that leads to higher expression output than other CYC1 terminator variants (Curran,.et al., (2013). Metab Eng 19, 88-97). Lastly, the landing pad was extended to include 500 bp homology arms to the known yeast X-2 safe harbor locus on chromosome X (Mikkelsen, et al., (2012). Metab Eng 14, 104-111; Ronda,et al., (2015). Microb Cell Fact 14, 97). The X-2 landing pad sequence synthetically constructed was ordered and cloned into the pMARQ vector by ThermoFisher. The sequence of the X-2 landing pad with homology arms is available in Table 2.
[0068] Engineering CRISPR-optimized yeast strains for human GPCR studies. The major steps used to build the 10 base GPCR-Gα reporter strains are summarized below. CRISPR was used to make every gene deletion, replacement, edit, and knock-in in this study (see “CRISPR transformation reaction” method for further detail).
[0069] Deletion of signaling components to sensitize the pheromone pathway. In the first steps of strain engineering efforts, the DI2Δ strain was created by sequentially deleting the pheromone pathway components FAR1 and SST2. The factor arrest protein (FAR1) was deleted to prevent cell-cycle arrest upon pathway activation and the GTPase-activating protein (SST2) was deleted to sensitize the pheromone pathway by prolonging Gα activation. The CRISPR gene deletion procedure employed two CRISPR vectors, pML107 and pT040, each having their own selectable markers LEU and URA. Vector pT040 contained a guide RNA sequence that targeted the N-terminal/C-terminal region of the gene to be deleted. These vectors were co-transformed with DNA payload comprising homology arms generally having 60-100 bp of sequence immediately upstream and downstream of the targeted open reading frame.
[0070] Installation of the mTq2 transcriptional reporter. Following the creation of the DI2Δ strain, the pheromone-responsive gene FIG1 open reading frame was replaced with the cyan fluorescence protein mTq2. For the CRISPR gene deletion procedure, the FIG1 open reading frame was replaced with the mTq2 gene using two CRISPR vectors pML107 and pT040, each having their own selectable markers LEU and URA. Vectors pML107 and pT040 contained a guide RNA sequence that targeted the N-terminal/C-terminal region of the FIG1 gene. These vectors were co-transformed with DNA payload comprising homology arms having 60 bp of sequence immediately upstream and downstream of FIG1 open reading frame. The resultant genotype of this strain, referred to as DI2Δ fig1Δ::mTq2, was BY4741 far1Δ sst2Δ fig1Δ::mTq2.
[0071] Deleting the endogenous yeast GPCR STE2 gene. Following the creation of the DI2Δ fig1Δ::mTq2 strain the native yeast GPCR gene (STE2) was deleted using the same plasmids and procedure described in the section Deletion of signaling components to sensitize the pheromone pathway. This new strain, DI3Δ fig1Δ::mTq2, had the genotype BY4741 far1Δ sst2Δste2Δ fig1Δ::mTq2.
[0072] Installation of the X-2 landing pad. Following the creation of the DI3Δ fig1Δ::mTq2 strain, the CRISPR-addressable expression cassette was installed (see “Creating the CRISPR-addressable expression cassette into the X-2 locus” for details) into the X-2 locus of chromosome X. To install the X-2 landing pad into the X-2 safe harbor locus, the landing pad sequence from the pMARQ vector was PCR amplified and co-transformed the resultant DNA payload with the CRISPR vector pML104 X2. The resultant genotype of this strain, referred to as DI3Δ fig1Δ::mTq2 P1, was BY4741 far1Δ sst2Δ ste2Δ fig1Δ::mTq2 X-2:P.sub.TEF1a-UnTS-T.sub.CYC1bb.
[0073] Genome-editing to create humanized yeast C-terminal Gα chimeras. To build the panel of 10 GPCR-Gα base reporter strains, 10 different versions of our DI3Δ fig1Δ::mTq2 P1 strain were created, each having its own unique Gα C-terminal yeast/human chimera. In each Gα chimera, the last five yeast residues of the yeast Gα subunit, Gpa1, were replaced by the last five residues of a human Gα subunit (see
[0074] Installation of human GPCRs into X-2 CRISPR-addressable expression cassette. All human GPCR DNA sequences were lifted from the Presto-TANGO plasmid library (Kroeze, et al., (2015). Nat Struct Mol Biol 22, 362-369), using primers to PCR amplify only the GPCR open reading frame, avoiding the additional N- and C-terminal DNA sequence elements in the Presto-TANGO plasmid constructs. Using two rounds of PCR amplification, each GPCR sequence was extended with homology arms corresponding to sequences within the TEF promoter and CYC lb terminator of the X-2 landing pad. For the first round of PCR, receptor-specific primers having ˜45 bp homology overhangs were used. In a second round of PCR, universal primers to extend both homology arms to a final length of 60 bp were used. With the exception of the muscarinic receptors CHRM1, CHRM3, and CHRM5, native GPCR sequences were used (i.e. no affinity tags or localization sequences were added). However, residues corresponding to the third intracellular loop (iL3) of CHRM1, CHRM3, and CHRMS were deleted to reproduce iL3 deletion results that were previously published in a similar yeast system (Erlenbach, et al., (2001) J Neurochem 77, 1327-1337). As with these original studies, full-length CHRM1, CHRM3, and CHRM5 did not functionally express in the system. The CHRM1, CHRM3, and CHRMS sequences in Table 1 correspond to the iL3 loop deletion variants. To install human GPCRs into the X-2 landing pad, the amplified GPCR PCR product with 60 bp homology arms was co-transformed with the CRISPR vector pML104 X2 UnTS using the approach described in “CRISPR transformation reactions”. Because each human GPCR was installed into all 10 base GPCR-Gα reporter strains, a library of 300 new GPCR-Gα reporter strains barcoded with a human GPCR were produced.
[0075] Engineering positive controls strains for dCyFIRplex development. To establish the dCyFIRplex FACS gating procedure a set of 10 base GPCR-Gα reporter strains were used (mixed as a 10-plex) as a negative control (inactive bin in
[0076] Determining G protein transcript levels in the 10 base GPCR-Gα reporter strains. The 10 base GPCR-Gα reporter strains were individually seeded into pH 5.0 Synthetic Complete Low Fluorescence Screening Media (SCD LoFo), grown for several hours, and back-diluted in pH 7.0 of the same medium to achieve an OD.sub.600 between 1 and 2 after overnight growth. The next morning, these cultures were back-diluted again into SCD LoFo pH 7.0 and grown to an OD.sub.600 of 1.0. The procedure ensured that the yeast cells were in log phase for multiple divisions before harvesting their mRNA. Cells were then pelleted and frozen at −80° C. for later processing using a Zymolase enzyme (Zymo Research #E1004) to digest the cell wall (37° C. for 1 hour), YeaStar high purity RNA extraction column kit (Zymo #R1002), and DNasel enzyme treatment (Zymo #E1010) to digest unwanted genomic DNA. The resultant RNA samples were serial diluted to a concentration of 5 ng/uL as confirmed by NanoDrop quantitation. mRNA quantification using one step, gene-specific qRT-PCR was performed on a Bio-Rad CFX384 with a SYBR Green 1-step kit (Bio-Rad SYBR Green 2× iTaq #1725151 with Bio-Rad iScript #L002630) and analyzed with Bio-Rad Maestro qPCR software, with two housekeeper genes for normalization, ALG9 and TAF10. One primer set amplified the native and all humanized yeast Gα chimeras. High primer efficiencies above 90% with an R.sup.2 value of 97.8 or higher were confirmed on a linear template standard curve from 7 pg/μL to 70 ng/μL. For each primer set, controls without template confirmed a lack of primer-dimer products and controls without the reverse-transcriptase enzyme confirmed a lack of genomic DNA amplification. Each qRT-PCR reaction was 7.125 μL with 11 ng of template (1.54 ng/μL) with each primer at 300 nM.
[0077] dCyFIRscreen protocol. Individual Gα reporter strains were grown in SCD LoFo pH=7.0 at 30° C. to an OD=1.0 in a 2.0 mL 96-well DeepWell block (Greiner; 780271-FD). Cells were normalized to an OD of 0.1 in SCD LoFo pH=7.0 using a Biomek NXp liquid-handling robot. 10× ligand/vehicle stocks were prepared (see Table 2) and 4 μL were distributed to each well of a 384-well plate (Greiner; 781096) in quadruplicate using a Biomek NXp. 36 μL normalized cells were distributed to each well containing the appropriate 10× ligand/vehicle. Plates were sealed with a breathable cover (Diversified Biotech; BERM-2000) and incubated at 30° C. Fluorescence readings were collected after 18 hours using a plate reader (ClarioStar, BMG LabTech, Offenburg, Germany) (bottom read, 10 flashes/well, excitation filter: 430-10 nm, dichroic filter: LP 458 nm, emission filter: 482-16 nm, gain=1300 (1500 for
[0078] dCyFIRplex protocol. Control/tracer strain(s) (DI P1 mTq2, individual Gα reporter strains lacking an integrated receptor, DI P1 mRuby3, and the 300 GPCR-Gα reporter strains were grown in SCD LoFo pH =5.0 to saturation in individual wells of a 2.0 mL 96-well DeepWell block (Greiner; 780271-FD). The 10 GPCR-Gα reporter strains for a single receptor were then consolidated in growth-normalized amounts into single wells of a DeepWell block using a Biomek NXp (each well is comprised of one unique receptor in all 10 Gα reporter strains). Each receptor-consolidated well and control well was grown to mid-log phase in SCD LoFo pH=7.0 then further consolidated into a single tube (300-plex; 30 receptors, 300 Gα strains) in growth-normalized amounts (this consolidation was performed three times for each sorting procedure {n=3}). 10× ligand/vehicle stocks were added to individual wells of a DeepWell block. The consolidated 300-plex or control strains were then added to each well and grown in the presence of ligand/vehicle overnight, so that each culture would reach an OD=4.0 before dCyFIRplex profiling. Samples were washed with sterile ddH.sub.2O and normalized to an OD=2.0 in SCD LoFo pH=7.0. Tracer cells were added to each sample at a 1:301 ratio. The final mixture was then transferred into a glass sample tube (USA Scientific; 1450-2810) and used for cell sorting. A BD FACSAria-II cell sorter was used for all dCyFIRplex experiments to assess mTq2 (405 nm excitation, 450/50 nm emission) and mRuby3 fluorescence (535 nm excitation, 610/20 nm emission). A gating strategy was set using the three control samples (DI P1 mTq2, individual Gα reporter strains lacking an integrated receptor, and DI P1 mRuby3) such that tracer cells and any cell expressing mTq2 was sorted into a 14 mL collection tube (USA Scientific; 1485-2810) containing 500 μL YPD. Samples treated with water or 500 μM adenosine (well-characterized using dCyFIRscreen, inexpensive, and water-soluble) were used to build a standard curve measuring total events in the mRuby3 and mTq2 positive gates. The standard curve from a water-treated 300-plex was used to determine the number of tracer events that would correspond to 15,000 events in the mTq2 gate for a water-treated 300-plex. Each sample was sorted until the standardized tracer count was reached. Sorted cells were enriched by outgrowth in 5 mL YPD at 30° C. with shaking (200 rpm) for 18 hours. Cells were harvested by centrifugation at 3,000×g for 5 min, and resuspended in 1 mL ddH.sub.2O. Cells were either processed immediately for qPCR deconvolution or frozen in 100 μL aliquots for storage at −20° C. The set of samples comparatively deconvoluted by qPCR and NanoString methods were derived from aliquots of the same dCyFIRplex experiments.
[0079] Over the course of our dCyFIRplex profiling, the relationship between the magnitude of ACq values and validated ligand hits were characterized. In the dCyFIRplex datasets, ACq values for most confirmed ligand hits varied between 1 and 8. These log.sub.2 values correspond to a dynamic ΔCq range between 2-fold (2.sup.1) and 256-fold (2.sup.8). To assess the possibility of ligand hits having ΔCq values between zero and 1, follow-up experiments were performed for 121 select instances in which ΔCq values <1 (presented in
[0080] Extraction of genomic DNA for qPCR deconvolution. Yeast sample aliquots (100 μL, see “dCyFIRplex protocol”) were harvested by centrifugation at 8,000×g for 1 minute, resuspended in 200 μL of genomic DNA lysis buffer (200 mM lithium acetate, 1% SDS), and incubated at 70° C. for 10 minutes. Genomic DNA was collected by adding 600 μL of 100% ethanol to each tube of lysed cells and centrifugation at 13,000×g for 5 minutes. Supernatant was then removed and the pellet of genomic DNA was washed with 600 μL 70% ethanol followed by centrifugation at 13,000×g for 5 minutes. The resultant pellet of genomic DNA was dried at 70° C. for 10 minutes before a final resuspension in 50 μL nuclease-free H.sub.2O. Genomic DNA was normalized to a final concentration of 10 ng/μL and used as the template for qPCR deconvolution.
[0081] qPCR primer design for dCyFIRplex deconvolution. There were several challenges associated with developing qPCR primers with the specificity and performance necessary to deconvolute complex gene mixtures. These primers must bind only one gene sequence in the mixture, avoid non-specific binding to background genomic DNA, produce the desired amplicon size with an optimal melting temperature, and lack the propensity to form secondary structures (e.g. hairpins), primer-dimers, and primer-heterodimers. To address these issues, a Python program was created that utilized the Primer3 module, a Python-specific application programming interface that provides accessibility to the open source primer design software package Primer3 (www.primer3.org). Using this program, forward primers were designed targeting specific C-terminal sequences in each of the 30 GPCRs in our exploratory panel. These forward primers, when combined with a universal reverse primer (targeting the CYC lb terminator in the X-2 landing pad), were designed to produce amplicons between 111 and 200 bp, an ideal size for qPCR analysis. Using this in silico design process, hundreds of forward qPCR primers for each GPCR using the following Primer3 settings were generated and tested:
[0082] PRIMER_OPT_SIZE: 20,
[0083] PRIMER_MIN_SIZE: 18,
[0084] PRIMER_MAX_SIZE: 22,
[0085] PRIMER_OPT_TM: 58,
[0086] PRIMER_MIN_TM: 52,
[0087] PRIMER_MAX_TM: 60,
[0088] PRIMER_MIN_GC: 20,
[0089] PRIMER_MAX_GC: 80,
[0090] PRIMER_GC_CLAMP: 1,
[0091] PRIMER_MAX_POLY_X: 6,
[0092] PRIMER_SALT_MONOVALENT: 50.0,
[0093] PRIMER_DNA_CONC: 50.0,
[0094] PRIMER_THERMODYNAMIC_ALIGNMENT: 1,
[0095] PRIMER_MAX_SELF_ANY_TH: 47.0,
[0096] PRIMER_MAX_SELF_END_TH: 47.0,
[0097] PRIMER_PAIR_MAX_COMPL_ANY_TH: 47.0,
[0098] PRIMER_PAIR_MAX_COMPL_END_TH: 47.0,
[0099] and PRIMER_PRODUCT_SIZE_RANGE: [111, 200].
[0100] The resultant set of primer candidates for each GPCR were ranked from best to worst by their Primer3 scores and assessed for uniqueness via sequential BLAST queries against locally built BLAST databases for 1) the updated release of S. cerevisiae BY4741 genome (BY4741_Toronto_2012) available via www.yeastgenome.org (Cherry, et al., (2012) Nucleic Acids Res 40, D700-705) and 2) the set of GPCR)sequences comprising the Presto-TANGO library (Kroeze, et al., (2015) Nat Struct Mol Biol 22, 362-369). After BLAST filtering, the top 8 primer designs for each GPCR were ordered from ThermoFisher and experimentally validated. In almost all cases, the primer designs met the specificity standards. However, only the top primer design was selected for thedeconvolution procedure.
[0101] qPCR dCyFlRplex deconvolution. To achieve an accurate, reproducible, and scalable qPCR deconvolution procedure, all processes were automated using our Biomek NXp liquid-handling robot programmed using in-house Python code. The following procedure describes the process for deconvoluting a 300-plex genomic DNA sample from a single dCyFIRplex experiment. A reaction master mix was created by combining the necessary volumes of qPCR master mix (Bio-Rad Cat. #1725124), universal reverse primer, and template (i.e., the pool of extracted gDNA from a dCyFIRplex profile). In 384-well format, the robot was used to first distribute 3.0 μL of each GPCR forward qPCR primer in duplicate at a concentration of 500 ng/μL. Next, the robot was used to distribute 3.65 μL of reaction master mix to each well, giving a total qPCR reaction volume of 6.65 μL. For 30 receptors in a 300-plex, plus the additional mRuby3 tracer gene, a total of 62 wells were needed. The microplate was removed from the robot deck, centrifuged it for 1 min at 1000×g to consolidate the samples at the bottom of the microplate wells, sealed the microplate with adhesive film (Applied Biosystems Cat. #4311971), and performed the qPCR experiment using a Bio-Rad CFX384.
[0102] As described, in each deconvolution run qPCR reactions were done twice for each of the 30 deconvolution primers (and mRuby3 control tracer primer), giving n=2 observations for each GPCR primer. However, in practice, deconvolution was done in triplicate for each agonist treatment using three independent builds of the 300-plex. As a result, there was n=6 observations for each GPCR primer in the deconvolution run. Therefore, all Cq and ACq values reported in this work represent an average of n=6 deconvolution runs, with error bars representing SEM of these values. All Cq values were quantified using the Bio-Rad Maestro qPCR software.
[0103] NanoString dCyFIRplex deconvolution. In addition to the qPCR-based deconvolution method, the same 300-plex samples were analyzed and presented in
[0104] Microscopy. Two microscopy approaches were used in the Examples.
[0105] Fluorescence microscopy. Consolidated pools of GPCR-Gα strains treated with metabolites were grown in 384-well plates (see “dCyFIRscreen protocol” above) for 18 hours to an OD˜1.0-2.0. Brightfield and fluorescence images (445/20 nm excitation, 510/40 nm emission, 455 nm longpass dichroic) were captured at 20× magnification using a fluorescence microscope (Echo Revolve, San Diego, USA).
[0106] Confocal microscopy. Cells were grown to mid-log phase in SCD LoFo pH 7.0 media. Cells were harvested by centrifugation, washed with sterile H.sub.2O and concentrated to an OD=20 in SCD LoFo pH 7.0 media. 2 μL cells were added to an agar pad (SCD LoFo pH 7.0 media, 15% agar) on a 75×25×1 mm microscope slide (VWR Cat. #16004-422) and covered with a 22×22 mm no. 1.5 glass cover slip (VWR Cat. #48366-227). Brightfield and fluorescence images were captured at 63× magnification under oil immersion on a confocal microscope (LSM800, Carl Zeiss, Jena, Germany). Fluorescence images for mTq2 (433 nm excitation, 475 nm emission) and mRuby3 (587 nm excitation, 610 nm emission) (
[0107] Ligands and metabolite library. All ligands were purchased from Sigma, Cayman, Tocris, and Avanti. The library of 320 endogenous human metabolites was purchased from MedChem Express (HY-L030). A table describing the source and composition of each ligand is available in the Key Resource Table. Lipid stocks in organic solvent were prepared using the general protocol from Avanti.
[0108] Titration Analyses. All titration curves were analyzed using Prism software and the pharmacological fitting function log(agonist) vs. response—Variable slope (four parameters) (GraphPad Software, San Diego, USA).
ii. dCyFIRscreen Profiling for Metabolite Ligand Discovery
[0109] A high-throughput CRISPR/Cas9 genome-editing pipeline for engineering, screening, and validating thousands of yeast reporter strains that were individually barcoded with genome-integrated human GPCRs was created (
[0110] All 16 human Gα genes can be represented by 10 degenerate C-termini (
[0111] Next the library of 300 GPCR-Gα reporter strains was finalized in preparation for ligand discovery. First, each of the 30 sets of 80 candidate GPCR-Gα reporter strains were screened to PCR-verify the presence of genome-integrated receptors. Then, a single PCR-confirmed hit was selected and stocked for each GPCR-Gα reporter strain (10 Gα strains per GPCR). In the case of constitutively active and agonist-inducible GPCR-Gα reporter strains, the best performing (i.e. brightest) PCR-verified colonies were selected and stocked. The result was a library of 300 GPCR-Gα reporter strains. Importantly, each new reporter strain was barcoded with a single human GPCR and Gα chimera. Prior to developing this multiplexing capability, the GPCR-Gα strain library was validated via an extensive agonist rescreening campaign. For this, all 300 GPCR-Gα strains were analyzed in technical quadruplicate for agonism and constitutive activity in 384-well plate format using an approach calledl dCyFIRscreen (
iii. dCyFIRplex Profiling for Metabolite Ligand Discovery
[0112] Following the dCyFIRscreen (
[0113] The probabilistic character of the dCyFIRplex method is illustrated in
[0114] As shown in
iv. New Interactions for Known Metabolite Ligands With Prototypic and Dark GPCRs
[0115] As proof-of-principle for dCyFIRplex sorting and deconvolution, the ability to identify GPCR gene(s) in active pools from a 20-plex of SUCNR1 and HTR4 reporter strains was evaluated (
[0116] As shown in
v. dCyFIR Profiling of 320 Metabolites Identifies New GPCR Agonists and Allosteric Modulators
[0117] Next, the 300-plex of GPCR-Gα reporter strains were profiled against a library of 320 endogenous human metabolites. As illustrated in the schematic of the discovery pipeline (
[0118] For the initial dCyFIRscreen profiling experiments the 300-plex were divided into three sets (
[0119]
[0120] As shown in
[0121] Based on the methods and cells disclosed herein, several new interactions between GPCRs and amino acid metabolites from the tryptophan, phenylalanine, and tyrosine pathways were identified. Three of these metabolites were from the tryptophan pathway and included an inflammation biomarker (KYNA), neurotransmitter produced in the gut and brain (serotonin), and neuromodulator produced in the brain, gut, and found at high concentrations in fermented foods (tryptamine) (Hastings, et al., (2016) Nucleic Acids Res 44, D1214-1219; Wishart et al., 2018 Nucleic Acids Res 46, D608-D617). Although structurally similar, these metabolites exclusively interacted with a wide variety of GPCRs. KYNA activated GPR35 and the dark GPCR HCAR3 and was a negative allosteric modulator of ADRA2B.
[0122] Surprisingly, it also found that serotonin activated the melatonin receptor MTNR1A. Although serotonin and melatonin receptors bind similar endogenous molecules, few of these ligands are known to bind receptors from both families (Stauch et al., (2019) Nature 569, 284-288). The discovery that serotonin can activate MTNR1A appears to be an exception to this rule, and may have been overlooked due to the relatively low, yet metabolically relevant affinity of MTNR1A for serotonin (EC.sub.50 of 60 μM). Notably, it was not find that serotonin agonized the other melatonin receptor in our set (MTNR1B), nor was it observed that melatonin bound to the serotonin receptor HTR4. Similarly, tryptamine, which is almost identical in structure to serotonin (5-hydroxytryptamine), did not activate either melatonin receptor, but did activate HTR4 and ADRA2B. Recently it has been shown that tryptamine produced in the gut, rather than in the brain, can also activate HTR4 (Bhattara et al., (2018) Cell Host Microbe 23, 775-785 e775). As such, the findings now implicate ADRA2B as an additional regulatory target of tryptamine.
[0123] In addition to tryptamine, new GPCR interactions were observed involving two other trace amines, PEOA and phenethylamine (PEA), both phenylalanine metabolites. PEOA and PEA are produced in the brain, where they can act as neuromodulators and neurotransmitters and activate the trace amino-associated receptor 1 (TAAR1), a GPCR also known to bind tryptamine Rutigliano et al., (2017) Front Pharmacol 8, 987; Wainscott et al., (2007) J Pharmacol Exp Ther 320, 475-485). Recently it was shown that PEA is also produced by the gut microbiota and can act as a dopamine receptor agonist (Chen et al., (2019) Cell 177, 1217-1231 e1218). It was found that PEOA and PEA were also nanomolar (
[0124] Gut microbiota can produce a variety of metabolites including short-chain fatty acids, secondary bile acids, and a variety of neurotransmitters (Husted et al., (2017) Cell Metab 25, 777-796; Strandwitz (2018) Brain Res 1693, 128-133). A s mentioned, some of these metabolites, such as PEA and tryptamine, can readily cross the blood-brain barrier and possibly elicit neuromodulatory effects. However, most other microbiome-derived metabolites are excluded from the central nervous system and instead are absorbed into the circulation and distributed throughout the body, where their effects are poorly understood. Two recent studies shed light onto the fate and actions of a few of these bacterially-derived metabolites. In screens of microbiome extracts, Chen et al. identified PEA as a dopamine receptor agonist (Chen et al., (2019) Cell 177, 1217-1231 e1218)). The current results substantiate these findings, and additionally show that PEA is an agonist of another aminergic receptor, ADRA2B. Chen et al. also found that dopamine agonized ADRA2B, which was confirmed by our screen, in addition to our new finding that dopamine agonizes ADRA2A.
[0125] In a second gut microbiome study, Colosimo et al. identified niacin, 3-hydroxyoctanoic acid, and phenylpropanoic acid as agonists of HCAR3 (Colosimo et al., 2019). The current results substantiate these findings as well; however, higher HCAR ligand affinities were observed. For example, Colosimo et al. observed a 12.6-fold higher EC.sub.50 value for 3-hydroxyoctanoic acid agonism of HCAR3 (304 μM versus 24 μM in this study). This observation, and their high EC.sub.50 value for phenylpropanoic acid binding (208 μM), led the authors to speculate that either low binding affinities were inherent to HCAR3, or that the endogenous ligand for HCAR3 has yet to be identified (Colosimo et al., (2019) Cell Host Microbe 26, 273-282 e277). However, the current findings indicate that KYNA activates HCAR3 with a 5.1-fold lower EC.sub.50 value than phenylpropanoic acid and 18.6-fold lower EC.sub.50 value than for its known target GPR35. These observations indicate that both KYNA and 3-hydroxyoctanoic acid are the highest affinity endogenous ligands known for HCAR3.
[0126] The exploratory panel of 30 receptors included members of two evolutionarily related lipid receptor families, LPAR and S1PR. Both of these receptor families are involved in inflammatory responses, fibrosis, and a variety of other disorders (Blaho and Hla (2014) J Lipid Res 55, 1596-1608; Yung et al., (2014) J Lipid Res 55, 1192-1214) . The LPAR and S1PR families have 30-35% sequence identity, and also share similar spatially-conserved residues that determine their respective specificities for LPA and S11.sup.3 metabolites (Wang et al, (2001) J Biol Chem 276, 49213-49220). Here, the known cross-activation of LPA for S1PR1 was confirmed and the first report of LPA cross-activation of S1PR2 (
[0127] Allosteric GPCR ligands bind to locations outside the orthosteric binding site (Thal et al., (2018) Nature 559, 45-53). Such ligands can act as positive/negative allosteric modulators (PAMs/NAMs), either by modulating constitutive activity and/or receptor responses to orthosteric agonists. Pharmacologically, the actions of PAMs and NAMs cause shifts in EC.sub.50 values and changes in signaling strength (i.e. efficacy). However, these effects typically occur in combination, giving rise to a variety of classifiable pharmacological binding profiles (Kenakin (2012) Br J Pharmacol 165, 1659-1669). Structural studies over the past decade have identified a variety of endogenous allosteric modulators, such as ions, lipids, amino acids, peptides, and accessory proteins (van der Westhuizen et al, (2015) J Pharmacol Exp Ther 353, 246-26).
[0128] The metabolite inositol is a structural isoform of glucose that is used as a dietary supplement, present in many foods, and produced from glucose in the kidneys. It serves as a precursor for a variety of second messengers and is an important component of lipids ((Wishart et al., (2018) Nucleic Acids Res 46, D608-D6178). Here, inositol is shown to be a PAM-agonist of GPR65, GPR68, and GPR35, and a NAM-agonist of ADORA2A (
[0129] The endogenous steroid metabolites DHEA and its sulfonated form DHEA-S are the most abundant circulating steroid hormones in humans (Rutkowski et al., (2014) Drugs 74, 1195-1207). DHEA is produced in the adrenal glands, gonads, adipose tissue, and brain ((Wishart et al., (2018) Nucleic Acids Res 46, D608-D617), is widely used as a nutritional supplement, and is the indirect precursor to estrogen, testosterone, and other steroid hormones (Sahu et al., (2019) Steroids 153, 108507). While steroids such as DHEA typically exert effects on steroid receptors in the nucleus, the discovery of extranuclear mediators of steroid responses has garnered long-standing interest in the field (Losel and Wehling (2003) Nat Rev Mol Cell Biol 4, 46-56). Here, it was shown that structurally similar steroids DHEA and androsterone are broad-spectrum PAM-agonists of several GPCRs (
[0130] Two recent studies have illuminated the pharmacotherapeutic potential of GPR68, a dark receptor known for its pH sensing capabilities (Ludwig et al., (2003) Nature 425, 93-98). Huang et al. have recently identified the benzodiazepine drug lorazepam as a non-selective GPR68 PAM (Huang et al., (2015) Nature 527, 477-483) and Foster et al. have identified the first known peptide ligands for GPR68, which also function as PAMs (Foster et al., (2019) Cell 179, 895-908 e821). Here, GPR68 PAMs comprising the endogenous metabolites inositol, DHEA, and androsterone. Given that GPR68 was expressed in the brain and is important for processes such as learning and memory, the findings may help to explain the mechanistic effects of inositol and DHEA in several neuropsychiatric conditions. Beyond GPR68, this is the first report of endogenous metabolite PAMs for three additional dark GPCRs, GPR65 (inositol), GPR4 (DHEA and androsterone), and HCAR3 (DHEA and androsterone).
[0131] KYNA is a tryptophan metabolite linked to neuroprotection, depression, schizophrenia, obesity, diabetes, and cancer. Prior to this study, it was only known to target GPR35 (Wang et al, (2006) J Biol Chem 281, 22021-22028). Here, KYNA was a more potent agonist of the dark receptor HCAR3 and acted as a NAM of ADRA2B (
Example 2: Mulit-Padded GPCR Reporter Strains
i. Materials and Methods
[0132] Materials. Yeast extract, yeast nitrogen base, peptone, tryptone, and 5-fluoroorotic acid (5-FOA) were purchased from Research Products International (RPI; Mt. Prospect, Ill.). Low-fluorescence yeast nitrogen base used for preparing screening media was purchased from Formedium (Hunstanton, UK). Complete supplement mixture and complete supplement single dropout (without Uracil) mixture were purchased from MP Biomedicals (Solon, Ohio). Screening media was adjusted to desired pH with HCl or KOH and were buffered with potassium phosphate dibasic (Alfa Aesar; Ward Hill, Mass.) and MES hydrate (RPI).
[0133] Plasmids. All CRISPR plasmids used in this work were derived from pML104. Four new versions of the pML104 plasmid were made to first install each landing pad into the genome loci X-2, X-3, XI-2, and XII-5. Four additional versions of the pML104 plasmid were then made for targeting DNA payloads to the artificial guide sequences within each CRISPR-addressable landing pad. All plasmids were maintained in the E. coli strain DH5α (New England BioLabs; Ipswich, Mass.) and purified using the EZ Plasmid Miniprep Kit (EZ BioResearch; St. Louis, Mo.). Genes for GPR68 and SSTR5 were sourced from the PRESTO-TANGO plasmid library.
[0134] Media, Buffers, and Solutions. The complete list of growth media, buffers, and solutions used in this study can be found in Table 1. Growth media, buffers, and solutions prepared at specified pH values were measured using an Accumet XL150 pH meter (Fisher Scientific; Hampton, N.H.).
[0135] CRISPR protocol. Preparing base strains. Base yeast strains were struck from glycerol onto YPD plates and incubated at 30° C. for 1-2 days. Colonies were picked into 5 mL YPD and grown at 30° C. shaking (200 rpm) until an OD.sub.600 of 0.2−1.0 was reached.
[0136] Preparing cells for transformation. Log-phase cultures were centrifuged (3000×g for 3 min), harvested and washed with 5 mL TE. Cells were centrifuged, harvested, washed with 5 mL LiOAc mix, centrifuged again, and resuspended in 200 μL LiOAc mix.
[0137] Preparing transformation mixtures. The solution for a single yeast transformation reaction comprised 175 μL PEG mix, 250 ng CRISPR plasmid, 20 μL DNA payload (5-15 μg DNA total), and 5 μL salmon sperm DNA (boiled at 100° C. for 10 min then placed on ice immediately after boiling).
[0138] Transformation procedure. 50 μL of prepared cells were added to the transformation mixture described above. Mixtures were briefly vortexed, then incubated at room temperature for 30 minutes, spiked with 12 μL DMSO, vortexed, and incubated at 42° C. for 15 minutes. The mixtures were then centrifuged (5000×g for 1 min) and the harvested cells were resuspended in 200 μL YPD by gently pipetting 5-8 times. The resuspended cells were plated onto SCD-U agar plates and grown at 30° C. for 3 days. This protocol works for well for plating on both large (100 mm petri dishes, plate 100 μL) and small (22 mm 12-well petri dishes, plate 35 μL) agar plates.
[0139] Validation and storage of yeast strains. Genomic DNA extraction to confirm payload integration. Transformed colonies were picked into SCD-U liquid medium and grown at 30° C. for 1-2 days. Genomic DNA (gDNA) was then extracted and purified as previously described (15). Briefly, 100 μL resuspended cells were added to a 1.5-mL Eppendorf tube, centrifuged (15,000×g for 3 min), harvested, and resuspended in 100 μL extraction buffer. Cells were then resuspended by vortexing and incubated at 70° C. for 10 minutes. 300 μL 100% EtOH was added to the mixture, which was then vortexed, and centrifuged. The gDNA pellet was washed with 70% EtOH and dried at 70° C. for 10 minutes. The dried gDNA pellet was resuspended in 50 μL nuclease-free H.sub.2O by thorough vortexing and pipetting, centrifuged (15,000×g for 30 s), and 25 μL of supernatant containing the purified gDNA was transferred to a clean 1.5-mL Eppendorf tube. 1 μL of purified gDNA was then used to PCR-verify integration of the desired DNA payload. PCR reactions were resolved on 1% agarose gels and imaged using an Amersham Imager 600 (GE Healthcare Bio-Sciences; Pittsburgh, Pa.).
[0140] Removing the CRISPR plasmid by counter-selection. For a given CRISPR reaction, one strain containing the correctly integrated gene was struck from SCD-U liquid medium onto a CSM+5FOA plate and placed at 30° C. until colonies were present (≈2 days).
[0141] Yeast glycerol stocks. One colony was picked from a CSM+5FOA plate into 3 mL YPD and grown at 30° C. overnight. Using this culture, gDNA was purified and PCR verified as described in Genomic DNA extraction to confirm payload integration. For a single PCR-verified strain, 15% v/v glycerol stocks were prepared for long-term storage at −80° C.
[0142] Landing pad design and integration. Landing pad design. The X-2 landing pad was synthesized in a pMARQ plasmid (Invitrogen; Carlsbad, Calif.), and the X-3, XI-2, and XII-5 landing pads were synthesized as gBlocks (IDT; Coralville, Iowa). All four CRISPR-addressable landing pads contained a unique core sequence (a 32 bp synthetic sequence consisting of a 20 bp unique targeting site (UnTS), 3 bp PAM site, and 9 bp of buffer DNA) flanked by a P.sub.TEF1 (419 bp) promoter and T.sub.CYC1b terminator (242 bp). Additionally, each landing pad cassette was flanked upstream and downstream by 110 bp of homology to the X-2, X-3, XI-2, or XII-5 chromosome loci.
[0143] Landing pad integration. DNA payloads were prepared by PCR amplifying the gBlocks described in Landing pad design. Using the CRISPR protocol described above, each DNA payload and its cognate CRISPR plasmid (pML104 X-2, X-3, XI-2, or XII-5) were co-transformed into the desired base yeast strain. Integration of each landing pad was then validated as described in Validation and storage of yeast strains and confirmed via Sanger sequencing (Eurofins Genomics; Louisville, Ky.). Four-padded strains were created by installing the landing pads sequentially in the following order: X-2 (first), XII-5, X-3, and XI-2 (last).
[0144] Using the CRISPR-addressable landing pads. Preparing the DNA payload. DNA payloads originating from plasmid sources (i.e. mTq2, pHluorin, mRuby3, GPR68, and SSTR5) were prepared via two rounds of PCR. The first round of PCR amplified the desired gene, while the second round of PCR extended the amplified gene product with 60 bp of homology to the TEF1 promoter and CYC1b terminator. In some case, the 60 bp of TEF1 and CYC1b homology could be provided directly by PCR primers, and introduced in one PCR reaction (Ste2 sourced from the yeast genome and the mNeonGreen and SRIF-14 sourced from gBlocks).
[0145] CRISPR-addressable gene integration. DNA payloads were installed into the desired landing pads using the CRISPR protocol described above, and the cognate CRISPR plasmid (i.e. pML104 X-2 UnTS, X-3 UnTS, XI-2 UnTS, or XII-5 UnTS). For strains in which a fluorescent protein gene was integrated, transformant colonies on SCD-U plates were imaged using an Amersham Imager 600 (excitation filters: 460 nm, 520 nm) to identify fluorescent colonies. All integrations were validated using the approach described in Validation and storage of yeast strains.
[0146] Fluorescence measurements. A CLARIOstar multimode microplate reader (BMG LabTech; Offenburg, Germany) was used for all microplate-based fluorescence (bottom read; 10 flashes/well; excitation: 430-10 nm, dichroic filter: LP 458 nm, emission filter: 482-16 nm) and absorbance (22 flashes/well; excitation filter: 600 nm) measurements.
[0147] Sample preparation. Strains were struck from glycerol onto YPD plate(s) and grown at 30° C. for 1-2 days. Four colonies per strain were picked from YPD into 96-well deep well blocks (Greiner Bio-One; Item #780271-FD) containing 500 μL SCD Screening media was adjusted to pH 6.5 and grown at 30° C. until they reached log-phase growth (OD.sub.600mn 0.2-1.5). 200 μL aliquots of cells were transferred to a 96-well plate(s), centrifuged (3000×g for 5 min), harvested, and resuspended in 200 μL screening media adjusted pH 6.0 (pH 7.0 for SSTR5 and SRIF-14 experiments). Resuspended cells were used to prepare 200 μL of normalized cultures in 96-well format having an OD.sub.600mn of 0.05 using a Biomek NX.sup.P liquid-handling robot. Plates with normalized cultures were covered with porous film (Diversified Biotech; Cat. #BERM-2000), shaken (1200 rpm for 30 s) on a MixMate microplate shaker (Eppendorf; Hamburg, Germany), and incubated at 30° C. for 18 hours.
[0148] Data acquisition. All data were collected from four biological replicates (i.e. colonies), the fluorescence of which was measured over a linear dilution series. This data was fit in Prism to generate slope and intercept values that were used to extrapolate mTq2 fluorescence to a standardized OD.sub.600mn value of 1.0. Error bars represent the standard error of the fitted slopes. All samples were assayed as 50 μL aliquots in black 384-well clear-bottom plates (Greiner Bio-One; Item #781096).
[0149] Confocal microscopy. Colonies were picked into screening media pH 6.0 and grown at 30° C. with shaking until an OD.sub.600mn of 1.0 was reached. Cultures were then centrifuged (3000×g for 3 min), harvested, and cells resuspended in 200 μL fresh pH 6.0 media. 2 μL of cells were added to a 75×25×1 mm microscope slide (VWR; Cat. #16004-422) and covered with a 22×22mm no. 1.5 glass cover slip (VWR; Cat. #48366-227). Cells were imaged using an LSM800 confocal microscope (Carl Zeiss; Jena, Germany) at 63× magnification. For a given field, both DIC and fluorescence images were acquired, which were overlaid and further processed using Zeiss's Zen software. Fluorescence images were acquired using excitation lasers of 405 nm (mTq2; 2.00% intensity), 561 nm (mRuby3; 2.00% intensity), 405 and 488 nm (pHluorin; 3.50% and 4.50% intensity, respectively), and 488 nm (mNeonGreen; 0.04% intensity)
ii. Ste2 Expression From CRISPR-Addressable Landing Pads Rescues Pheromone Signaling
[0150] Engineering multi-padded GPCR reporter strains required several base strains as described in the examples above. As shown in
[0151] Using the 2Δ reporter strain as a starting point, a series of strains to individually test the functionality of each CRISPR-addressable landing pad were generated. The native yeast GPCR (ste2Δ) was deleted to create the 3Δ reporter strain (
[0152] A series of Ste2 rescue experiments were conducted to demonstrate the functionality of each landing pad. This was done by installing the yeast GPCR Ste2 into the CRISPR-addressable landing pad of each single-padded 3Δ reporter strain (
iii. Engineering Four-Padded GPCR Reporter Strains
[0153] Having validated the performance of each landing pad individually, all four landing pads were combined into a panel of GPCR reporter strains that cover all possible human Gα coupling combinations. As illustrated in
iv. Testing the Four-Padded GPCR Reporter Strains
[0154] Having characterized the individual landing pads in the GPCR-Gα.sub.I reporter strain, all 10 four-padded GPCR reporter strains were tested using the proton-sensing receptor GPR68. To do this GPR68 was installed in each four-padded GPCR reporter strain, generating 40 new strains, each with one copy of GPR68 in the X-2, X-3, XI-2, or XII-5 pad. Agonist treatment was not needed in the testing procedure because GPR68 is constitutively active below pH 7. As shown in
v. Potentiating Gα Coupling by Incrementally Increasing GPR68 Gene Copy Number
[0155] As shown in
[0156] As shown in
vi. Autocrine Activation of SSTR5 With its Peptide Agonist SRIF-14
[0157] In a second application of the padded GPCR reporter strains, the somatostatin receptor SSTR5 and its peptide agonist SRIF-14 were co-expressed from the X-2 (SSTR5) and XII-5 (SRIF-14) pads, generating 10 new strains. For this experiment, a version of the SRIF-14 peptide was used that included a N-terminal pre-alpha factor secretion signal (PFSS) and a C-terminal Flol.sub.(1496-1537) sequence. As illustrated in
[0158] As shown in
[0159] In principle, this application could be extended to any GPCR-peptide agonist pair, or any interaction between a GPCR and a genetically-encodable ligand, including proteins such as chemokines and nanobodies. Perhaps the greatest benefit of pad-based autocrine secretion is that it circumvents the time and expense of producing and purifying genetically-encodable GPCR ligands in the lab, or purchasing them from commercial sources.
vii. Engineering and Validating a Four-Padded General-Utility BY4741 Yeast Strain
[0160] Given the demonstrated utility of the four landing pads in the GPCR reporter strains, a more general-purpose strain in the BY4741 background was generated. To do this, each landing pad was sequentially installed into the base BY4741 strain, creating a new four-padded yeast model (
[0161] Having confirmed the functionality of the four-padded BY4741 strain, its utility was demonstrated using four different fluorescent proteins. To do this we installed mTq2 (J. Goedhart et al., Nat Commun 3, 751 (2012)), mRuby3 (B. T. Bajar et al., Sci Rep 6, 20889 (2016)), pHluorin (G. Miesenbock, et al., Nature 394, 192-195 (1998), and mNeonGreen (N. C. Shaner et al., Nat Methods 10, 407-409 (2013)) in the X-2, X-3, XI-2, and XII-5 pads respectively. This process generated four new strains, each with a single fluorescent protein in one of the four pads. As shown in the confocal microscopy images in
[0162] All publications and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.