METHOD FOR ASYMMETRIC AMPLIFICATION OF TARGET NUCLEIC ACID

20230055008 · 2023-02-23

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided is a method for multiplex and asymmetric amplification of one or more target nucleic acids in a sample. The method can simultaneously amplify multiple target nucleic acids existing in a sample, and can simultaneously produce a large number of single-chain products.

    Claims

    1. A method for amplifying one or more target nucleic acids in a sample, comprising: (1) providing: (i) a sample containing one or more target nucleic acids; (ii) a universal primer; and (iii) a target-specific primer pair for each target nucleic acid to be amplified; wherein, the universal primer comprises a first universal sequence; the target-specific primer pair is capable of amplifying the target nucleic acid and comprises a forward primer and a reverse primer, wherein the forward primer comprises a second universal sequence and a forward nucleotide sequence specific to the target nucleic acid, and the forward nucleotide sequence is located at a 3′ end of the second universal sequence; the reverse primer comprises the first universal sequence and a reverse nucleotide sequence specific to the target nucleic acid, and the reverse nucleotide sequence is located at a 3′ end of the first universal sequence; and, under a condition allowing nucleic acid hybridization or annealing, the first universal sequence is capable of hybridizing or annealing to a complementary sequence of the second universal sequence, and there is a difference between the second universal sequence and the first universal sequence, and the difference comprises that one or more nucleotides located at the 3′ end of the first universal sequence are each independently deleted or substituted; and, the first universal sequence is not completely complementary to a complementary sequence of the forward primer; and (2) amplifying the target nucleic acids in the sample through a PCR reaction using the universal primer and the target-specific primer pair under a condition that allows nucleic acid amplification.

    2. The method according to claim 1, wherein the method has one or more technical features selected from the following: (1) the method is used to amplify 1-5, 5-10, 10-15, 15-20, 20-50 or more target nucleic acids; (2) in step (1) of the method, 1-5, 5-10, 10-15, 15-20, 20-50 or more target-specific primer pairs are provided; (3) in step (2) of the method, the universal primer has a working concentration higher than the working concentration of the forward primer and the reverse primer; (4) in step (2) of the method, the forward primer and the reverse primer have the same or different working concentration; (5) the sample or target nucleic acid comprises mRNA, and before performing step (2) of the method, a reverse transcription reaction is performed on the sample; and (6) in step (2) of the method, a nucleic acid polymerase is used to perform the PCR reaction.

    3.-10. (canceled)

    11. The method according to claim 1, wherein the method has one or more technical features selected from the following: (1) the universal primer has a working concentration 1-5 times, 5-10 times, 10-15 times, 15-20 times, 20-50 times or more times higher than the working concentration of the forward primer and the reverse primer; (2) the nucleic acid polymerase is a template-dependent nucleic acid polymerase; (3) the nucleic acid polymerase is a DNA polymerase; (4) the nucleic acid polymerase is a thermostable DNA polymerase; (5) the nucleic acid polymerase is obtained from Thermus aquaticus (Taq), Thermus thermophiles (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Thermus antranildanii, Thermus caldophllus, Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus thermophllus, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Thermococcus literalis, Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosiphoafricanus, Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyssi, Pyrodictium occultum, Aquifexpyrophilus and Aquifex aeolieus; and (6) the nucleic acid polymerase is Taq polymerase.

    12. The method according to claim 1, wherein the method has one or more technical features selected from the following: (1) the universal primer consists of the first universal sequence, or, the universal primer comprises the first universal sequence and an additional sequence, wherein the additional sequence is located at a 5′ end of the first universal sequence; (2) the first universal sequence is located in a 3′ portion of the universal primer; (3) the universal primer has a length of 5-15 nt, 15-20 nt, 20-30 nt, 30-40 nt, or 40-50 nt; (4) the universal primer or any component thereof comprises a naturally occurring nucleotide, a modified nucleotide, a non-natural nucleotide, or any combination thereof.

    13. The method according to claim 1, wherein the method has one or more technical features selected from the following: (1) in the forward primer, the forward nucleotide sequence is directly linked to the 3′ end of the second universal sequence, or the forward nucleotide sequence is linked to the 3′ end of the second universal sequence through a nucleotide linker; (2) the forward primer further comprises an additional sequence, which is located at a 5′ end of the second universal sequence; (3) the forward primer comprises the second universal sequence and a forward nucleotide sequence from 5′ to 3′; or, the forward primer comprises the second universal sequence, a nucleotide linker and a forward nucleotide sequence from 5′ to 3′; or, the forward primer comprises an additional sequence, the second universal sequence and a forward nucleotide sequence from 5′ to 3′; or, the forward primer comprises an additional sequence, the second universal sequence, a nucleotide linker and a forward nucleotide sequence from 5′ to 3′; (4) the forward nucleotide sequence is located in a 3′ portion of the forward primer; (5) the forward nucleotide sequence has a length of 10-20 nt, 20-30 nt, 30-40 nt, 40-50 nt, 50-60 nt, 60-70 nt, 70-80 nt, 80-90 nt, or 90-100 nt; (6) the forward primer has a length of 15-20 nt, 20-30 nt, 30-40 nt, 40-50 nt, 50-60 nt, 60-70 nt, 70-80 nt, 80-90 nt, 90-100 nt, 100-110 nt, 110-120 nt, 120-130 nt, 130-140 nt, or 140-150 nt; (7) the forward primer or any component thereof comprises a naturally occurring nucleotide, a modified nucleotide, a non-natural nucleotide, or any combination thereof; (8) in the reverse primer, the reverse nucleotide sequence is directly linked to the 3′ end of the first universal sequence, or the reverse nucleotide sequence is linked to the 3′ end of the first universal sequence through a nucleotide linker; (9) the reverse primer further comprises an additional sequence, which is located at a 5′ end of the first universal sequence; (10) the reverse primer comprises the first universal sequence and a reverse nucleotide sequence from 5′ to 3′; or, the reverse primer comprises the first universal sequence, a nucleotide linker and a reverse nucleotide sequence from 5′ to 3′; or, the reverse primer comprises an additional sequence, the first universal sequence, and a reverse nucleotide sequence from 5′ to 3′; or, the reverse primer comprises an additional sequence, the first universal sequence, a nucleotide linker and a reverse nucleotide sequence from 5′ to 3′; (11) the reverse nucleotide sequence is located in a 3′ portion of the reverse primer; (12) the reverse nucleotide sequence has a length of 10-20 nt, 20-30 nt, 30-40 nt, 40-50 nt, 50-60 nt, 60-70 nt, 70-80 nt, 80-90nt, or 90-100nt; (13) the reverse primer has a length of 15-20 nt, 20-30 nt, 30-40 nt, 40-50 nt, 50-60 nt, 60-70 nt, 70-80 nt, 80-90 nt, 90-100 nt, 100-110 nt, 110-120 nt, 120-130 nt, 130-140 nt, or 140-150 nt; (14) the reverse primer or any component thereof comprises a naturally occurring nucleotide, a modified nucleotide, a non-natural nucleotide, or any combination thereof; (15) at least one nucleotide at the 3′ end of the first universal sequence is not complementary to a complementary sequence of the forward primer; (16) 1-5, 5-10, 10-15, 15-20 or more nucleotides at the 3′ end of the first universal sequence is not complementary to a complementary sequence of the forward primer; and (17) the difference between the second universal sequence and the first universal sequence comprises 1-5, 5-10, 10-15, 15-20 or more nucleotides at the 3′ end of the first universal sequence, wherein each nucleotide is independently deleted or substituted.

    14. The method according to claim 1, wherein the method has one or more technical features selected from the following: (1) the sample contains DNA, RNA, or any combination thereof; (2) the target nucleic acid to be amplified is DNA, RNA, or any combination thereof; (3) the target nucleic acid to be amplified is single-stranded or double-stranded; and (4) the sample or target nucleic acid is obtained from a prokaryote, a eukaryote, a virus, or a viroid.

    15. The method according to claim 14, wherein the method has one or more technical features selected from the following: (1) said DNA is a genomic DNA or cDNA; (2) said RNA is a mRNA; (3) the eukaryote is selected from a protozoan, parasite, fungus, yeast, plant, and animal; (4) the eukaryote is a mammal; (5) the eukaryote is a human; and (6) the virus is selected from Herpes virus, HIV, influenza virus, EB virus, hepatitis virus, and polio virus.

    16. The method according to claim 1, wherein the steps (1) to (2) of the method are carried out by a protocol comprising the following steps (a) to (f): (a) providing: (i) the sample containing the one or more target nucleic acids; (ii) the universal primer; and (iii) the target-specific primer pair for each nuclei acid to be amplified; (b) mixing the sample with the universal primer and the target-specific primer pair, and a nucleic acid polymerase; (c) incubating the product of the previous step under a condition that allow nucleic acid denaturation; (d) incubating the product of the previous step under a condition that allow nucleic acid annealing or hybridization; (e) incubating the product of the previous step under a condition that allow nucleic acid extension; and (f) optionally, repeating steps (c) to (e) one or more times.

    17. The method according to claim 16, wherein the method has one or more technical features selected from the following: (1) in step (c), incubating the product of step (b) at a temperature of 80-105° C., thereby allowing the nucleic acid denaturation; (2) in step (c), incubating the product of step (b) for 10-20 s, 20-40 s, 40-60 s, 1-2 min, or 2-5 min; (3) in step (d), incubating the product of step (c) at a temperature of 35-40° C., 40-45° C., 45-50° C., 50-55° C., 55-60° C., 60-65° C., or 65-70° C., thereby allowing the nucleic acid annealing or hybridization; (4) in step (d), incubating the product of step (c) for 10-20 s, 20-40 s, 40-60 s, 1-2 min, or 2-5 min; (5) in step (e), incubating the product of step (d) at a temperature of 35-40° C., 40-45° C., 45-50° C., 50-55° C., 55-60° C., 60-65° C., 65-70° C., 70-75° C., 75-80° C., 80-85° C., thereby allowing the nucleic acid extension; (6) in step (e), incubating the product of step (d) for 10-20 s, 20-40 s, 40-60 s, 1-2 min, 2-5 min, 5-10 min, 10-20 min or 20-30 min; (7) performing steps (d) and (e) at the same or different temperatures; and (8) repeating steps (c) to (e) at least once; optionally, when repeating steps (c) to (e) one or more times, the conditions used in steps (c) to (e) of each cycle are independently the same or different.

    18. A method for detecting one or more target nucleic acids in a sample, comprising: (i) using the method according to claim 1 to amplify the one or more target nucleic acids in the sample; and (ii) performing melting curve analysis on the product of step (i).

    19. The method according to claim 18, wherein the method comprises the steps of: (1) providing: (i) a sample containing one or more target nucleic acids; (ii) a universal primer; and (iii) a target-specific primer pair and a detection probe for each target nucleic acid to be amplified; wherein, the universal primer comprises a first universal sequence; the target-specific primer pair is capable of amplifying the target nucleic acid and comprises a forward primer and a reverse primer, wherein the forward primer comprises a second universal sequence and a forward nucleotide sequence specific to the target nucleic acid, and the forward nucleotide sequence is located at a 3′ end of the second universal sequence; the reverse primer comprises the first universal sequence and a reverse nucleotide sequence specific to the target nucleic acid, and the reverse nucleotide sequence is located at a 3′ end of the first universal sequence; and, under a condition allowing nucleic acid hybridization or annealing, the first universal sequence is capable of hybridizing or annealing to a complementary sequence of the second universal sequence, and there is a difference between the second universal sequence and the first universal sequence, and the difference comprises that one or more nucleotides located at the 3′ end of the first universal sequence are each independently deleted or substituted; and, the first universal sequence is not completely complementary to a complementary sequence of the forward primer; the detection probe comprises a probe nucleotide sequence specific to the target nucleic acid, and is labeled with a reporter group and a quencher group, wherein the reporter group is capable of emitting a signal, and the quencher group is capable of absorbing or quenching the signal emitted by the reporter group; and the signal emitted by the detection probe when it hybridizes to its complementary sequence is different from the signal emitted when it is not hybridized to its complementary sequence; (2) amplifying the target nucleic acids in the sample through a PCR reaction by using the universal primer and the target-specific primer pair under a condition that allows nucleic acid amplification; and (3) performing melting curve analysis on the product in step (2) using the detection probe; and determining whether the target nucleic acid exists in the sample according to the result of the melting curve analysis.

    20. The method according to claim 19, wherein the method has one or more technical features selected from the following: (1) the universal primer consists of the first universal sequence, or, the universal primer comprises the first universal sequence and an additional sequence, wherein the additional sequence is located at a 5′ end of the first universal sequence; (2) the first universal sequence is located in a 3′ portion of the universal primer; (3) in the forward primer, the forward nucleotide sequence is directly linked to the 3′ end of the second universal sequence, or the forward nucleotide sequence is linked to the 3′ end of the second universal sequence through a nucleotide linker; (4) the forward primer further comprises an additional sequence, which is located at a 5′ end of the second universal sequence; (5) the forward primer comprises the second universal sequence and a forward nucleotide sequence from 5′ to 3′; or, the forward primer comprises the second universal sequence, a nucleotide linker and a forward nucleotide sequence from 5′ to 3′; or, the forward primer comprises an additional sequence, the second universal sequence and a forward nucleotide sequence from 5′ to 3′; or, the forward primer comprises an additional sequence, the second universal sequence, a nucleotide linker and a forward nucleotide sequence from 5′ to 3′; (6) the forward nucleotide sequence is located in a 3′ portion of the forward primer; (7) in the reverse primer, the reverse nucleotide sequence is directly linked to the 3′ end of the first universal sequence, or the reverse nucleotide sequence is linked to the 3′ end of the first universal sequence through a nucleotide linker; (8) the reverse primer further comprises an additional sequence, which is located at a 5′ end of the first universal sequence; (9) the reverse primer comprises the first universal sequence and a reverse nucleotide sequence from 5′ to 3′; or, the reverse primer comprises the first universal sequence, a nucleotide linker and a reverse nucleotide sequence from 5′ to 3′; or, the reverse primer comprises an additional sequence, the first universal sequence, and a reverse nucleotide sequence from 5′ to 3′; or, the reverse primer comprises an additional sequence, the first universal sequence, a nucleotide linker and a reverse nucleotide sequence from 5′ to 3′; (10) the reverse nucleotide sequence is located in a 3′ portion of the reverse primer; and (11) at least one nucleotide at the 3′ end of the first universal sequence is not complementary to a complementary sequence of the forward primer; and (12) 1-5, 5-10, 10-15, 15-20 or more nucleotides at the 3′ end of the first universal sequence is not complementary to a complementary sequence of the forward primer.

    21. The method according to claim 19, wherein the method has one or more technical features selected from the following: (1) in step (2), the sample is mixed with the universal primer, the target-specific primer pair, and the nucleic acid polymerase, and the PCR reaction is performed, and then, after the PCR reaction is completed, the detection probe is added to the product of step (2), and the melting curve analysis is performed; or, in step (2), the sample is mixed with the universal primer, the target-specific primer pair and the detection probe, and the nucleic acid polymerase, and the PCR reaction is performed, and then, after the PCR reaction is completed, the melting curve analysis is performed; (2) the detection probe comprises a naturally occurring nucleotide, a modified nucleotide, a non-natural nucleotide, or any combination thereof; (3) the detection probe has a length of 15-20 nt, 20-30 nt, 30-40 nt, 40-50 nt, 50-60 nt, 60-70 nt, 70-80 nt, 80-90 nt, 90-100 nt, 100-200 nt, 200-300 nt, 300-400 nt, 400-500 nt, 500-600 nt, 600-700 nt, 700-800 nt, 800-900 nt, or 900-1000 nt; (4) the detection probe has a 3′-OH terminus; or, a 3′-terminus of the detection probe is blocked; (5) the detection probe is a self-quenched probe; (6) the reporter group in the detection probe is a fluorescent group; and the quencher group is a molecule or group capable of absorbing/quenching the fluorescence; (7) the detection probe has a resistance against nuclease activity; (8) the detection probe is linear or has a hairpin structure; (9) each of the detection probes independently has the same or different reporter group; (10) in step (3), the product in step (2) is gradually heated or cooled and the signal emitted by the reporter group on each detection probe is monitored in real time, so as to obtain a curve of signal intensity of each reporter group that varies with the change of temperature; then, the curve is differentiated to obtain a melting curve of the product in step (2); and (11) the presence of the target nucleic acid corresponding to the melting peak (melting point) is determined according to the melting peak (melting point) in the melting curve.

    22. The method according to claim 19, wherein steps (1) to (3) of the method are carried out by a protocol comprising the following steps (a) to (g): (a) providing: (i) the sample containing one or more target nucleic acids; (ii) the universal primer ; and (iii) the target-specific primer pair and the detection probe for each target nucleic acid to be amplified; (b) mixing the sample with the universal primer, the target-specific primer pair and the detection probe, and a nucleic acid polymerase; (c) incubating the product of the previous step under a condition that allow nucleic acid denaturation; (d) incubating the product of the previous step under a condition that allow nucleic acid annealing or hybridization; (e) incubating the product of the previous step under a condition that allow nucleic acid extension; (f) optionally, repeating steps (c) to (e) once or more times; and (g) performing melting curve analysis on the product of the previous step

    23. The method according to claim 21, wherein the method has one or more technical features selected from the following: (1) the naturally occurring nucleotide is a deoxyribonucleotide or a ribonucleotide; (2) the non-natural nucleotide is a peptide nucleic acid (PNA) or a locked nucleic acid; (3) the 3′-terminus of the detection probe is blocked by adding a chemical moiety to the 3′-OH of the last nucleotide of the detection probe, by removing the 3′-OH of the last nucleotide of the detection probe, or by replacing the last nucleotide with a dideoxynucleotide; (4) the 3′-terminus of the detection probe is blocked by adding a biotin or an alkyl to a 3′-OH of the last nucleotide of the detection probe; (5) the reporter group and the quencher group are separated by a distance of 10-80 nt or more; (6) the reporter group is selected from ALEX-350, FAM, VIC, TET, CAL Fluor® Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, and combination thereof; (7) the quencher group is selected from DABCYL, BHQ, ECLIPSE, TAMRA, and combination thereof; (8) the detection probe has a resistance against 5′ nuclease activity; (9) the detection probe has a resistance against 5′ to 3′ exonuclease activity; (10) the detection probe has a backbone comprising a modification for resisting nuclease activity; (11) the detection probe has a backbone comprising a modification selected from phosphorothioate ester bond, alkyl phosphotriester bond, aryl phosphotriester bond, alkyl phosphonate ester bond, aryl phosphonate ester bond, hydrogenated phosphate ester bond, alkyl phosphoramidate ester bond, aryl phosphoramidate ester bond, 2′-O-aminopropyl modification, 2′-O-alkyl modification, 2′-O-allyl modification, 2′-O-butyl modification, and 1-(4′-thio-PD-ribofuranosyl) modification; (12) the detection probe is labeled with a reporter group at its 5′ end or upstream and labeled with a quencher group at its 3′ end or downstream, or labeled with a reporter group at its 3′ end or downstream and labeled with a quencher group at its 5′ end or upstream; and (13) the detection probes have the same reporter group, and the product in step (2) is subjected to melting curve analysis, and then the presence of the target nucleic acid is determined according to the melting peak in the melting curve; or, the detection probes have different reporter groups, and the product in step (2) is subjected to melting curve analysis, and then the presence of the target nucleic acid is determined according to the signal type of the reporter group and the melting peak in the melting curve.

    24. A primer set, which comprises: a universal primer, and, one or more target-specific primer pairs; wherein, the universal primer comprises a first universal sequence; each target-specific primer pair is capable of amplifying a target nucleic acid and comprises a forward primer and a reverse primer, wherein the forward primer comprises a second universal sequence and a forward nucleotide sequence specific to the target nucleic acid, and the forward nucleotide sequence is located at a 3′ end of the second universal sequence; the reverse primer comprises the first universal sequence and a reverse nucleotide sequence specific to the target nucleic acid, and the reverse nucleotide sequence is located at a 3′ end of the first universal sequence; and, under a condition that allows nucleic acid hybridization or annealing, the first universal sequence is capable of hybridizing or annealing to a complementary sequence of the second universal sequence, and there is a difference between the second universal sequence and the first universal sequence, and the difference comprises that one or more nucleotides located at the 3′ end of the first universal sequence are each independently deleted or substituted; and, the first universal sequence is not completely complementary to a complementary sequence of the forward primer.

    25. The primer set according to claim 24, wherein the primer set has one or more technical features selected from the following: (1) the universal primer consists of the first universal sequence, or, the universal primer comprises the first universal sequence and an additional sequence, and the additional sequence is located at a 5′ end of the first universal sequence; (2) the first universal sequence is located in a 3′ portion of the universal primer; (3) in the forward primer, the forward nucleotide sequence is directly linked to the 3′ end of the second universal sequence, or the forward nucleotide sequence is linked to the 3′ end of the second universal sequence through a nucleotide linker; (4) the forward primer further comprises an additional sequence, which is located at a 5′ end of the second universal sequence; (5) the forward primer comprises the second universal sequence and a forward nucleotide sequence from 5′ to 3′; or, the forward primer comprises the second universal sequence, a nucleotide linker and a forward nucleotide sequence from 5′ to 3′; or, the forward primer comprises an additional sequence, the second universal sequence and a forward nucleotide sequence from 5′ to 3′; or, the forward primer comprises an additional sequence, the second universal sequence, a nucleotide linker and a forward nucleotide sequence from 5′ to 3′; (6) the forward nucleotide sequence is located in a 3′ portion of the forward primer; (7) in the reverse primer, the reverse nucleotide sequence is directly linked to the 3′ end of the first universal sequence, or the reverse nucleotide sequence is linked to the 3′ end of the first universal sequence through a nucleotide linker; (8) the reverse primer further comprises an additional sequence, which is located at a 5′ end of the first universal sequence; (9) the reverse primer comprises the first universal sequence and a reverse nucleotide sequence from 5′ to 3′; or, the reverse primer comprises the first universal sequence, a nucleotide linker and a reverse nucleotide sequence from 5′ to 3′; or, the reverse primer comprises an additional sequence, the first universal sequence, and a reverse nucleotide sequence from 5′ to 3′; or, the reverse primer comprises an additional sequence, the first universal sequence, a nucleotide linker and a reverse nucleotide sequence from 5′ to 3′; (10) the reverse nucleotide sequence is located in a 3′ portion of the reverse primer; (11) at least one nucleotide at the 3′ end of the first universal sequence is not complementary to a complementary sequence of the forward primer; (12) 1-5, 5-10, 10-15, 15-20 or more nucleotides at the 3′ end of the first universal sequence is not complementary to a complementary sequence of the forward primer; and (13) the primer set comprises 1-5, 5-10, 10-15, 15-20, 20-50 or more target-specific primer pairs.

    26. A kit comprising the primer set according to claim 24, and one or more components selected from the following: a nucleic acid polymerase, a reagent for carrying out nucleic acid amplification, a reagent for carrying out sequencing, a reagent for gene chip detection, a reagent for melting curve analysis, or any combination thereof.

    27. The kit according to claim 26, wherein the kit has one or more technical features selected from the following: (1) the nucleic acid polymerase is a template-dependent nucleic acid polymerase; (2) the reagent for nucleic acid amplification comprises a working buffer for enzyme, dNTPs, water, a solution containing ion, a single-stranded DNA-binding protein, or any combination thereof; (3) the reagent for sequencing comprises a working buffer for enzyme, dNTPs, ddNTPs, water, a solution containing ion, a single-strand DNA-binding protein (SSB), a ligase, a nucleic acid linker, a sequencing primer, or any combination thereof; (4) the reagent for gene chip detection comprises a working buffer for enzyme, dNTPs, water, a hybridization buffer, a washing buffer, a labeling reagent, or any combination thereof; and (5) the reagent for melting curve analysis comprises a detection probe.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0140] FIG. 1 schematically shows an exemplary embodiment of the method of the present invention to illustrate the basic principle of the method of the present invention.

    [0141] FIG. 1A schematically shows a primer set used in this embodiment, which comprises: a universal primer, and a first target-specific primer pair comprising a first forward primer and a first reverse primer; wherein,

    [0142] the universal primer comprises a first universal sequence (Tag1);

    [0143] the first forward primer comprises a second universal sequence (Tag2) and a first forward nucleotide sequence specific to a first target nucleic acid, and the first forward nucleotide sequence is located at the 3′ end of the second universal sequence;

    [0144] the first reverse primer comprises the first universal sequence and a first reverse nucleotide sequence specific to the first target nucleic acid, and the first reverse nucleotide sequence is located at the 3′ end of the first universal sequence; and,

    [0145] the first forward primer and the first reverse primer are capable of specifically amplifying the first target nucleic acid; and,

    [0146] the first universal sequence is capable of hybridizing or annealing to a complementary sequence of the second universal sequence under a condition allowing nucleic acid hybridization or annealing, and there is a difference between the second universal sequence and the first universal sequence, the difference comprises that one or more nucleotides located at the 3′ end of the first universal sequence are each independently deleted or substituted; and, the first universal sequence is not completely complementary to the complementary sequence of the first forward primer.

    [0147] FIG. 1B schematically shows the principle that the non-specific amplification of primer-dimer is suppressed when the primer set of FIG. 1A is used for amplification, wherein the primer-dimer formed due to the non-specific amplification of the first forward primer and the first reverse primer will generate after denaturation a single-stranded nucleic acid whose 5′ and 3′ ends are complementary and can anneal to each other, and the single-stranded nucleic acid will form a stable panhandle structure during the annealing stage, preventing the universal primer from annealing and extending the single-stranded nucleic acid, thereby inhibiting the further amplification of the primer-dimer.

    [0148] FIG. 1C schematically shows the principle of multiplex, asymmetric amplification using the primer set of FIG. 1A. In this embodiment, firstly, a low concentration of the first target-specific primer pair is used to initiate PCR amplification to generate an initial amplification product, which comprises two nucleic acid strands (nucleic acid strand A and nucleic acid strand B) that are respectively complementary to the first forward primer and the first reverse primer/universal primer; subsequently, a high concentration of universal primer is used to perform subsequent PCR amplification of the initial amplification product.

    [0149] Since both the first reverse primer and the universal primer comprise the first universal sequence, the nucleic acid strand B complementary to the first reverse primer can also be complementary to the universal primer. Thus, during the PCR reaction, the universal primer can anneal to the nucleic acid strand B and normally initiate PCR amplification (i.e., normally synthesize a complementary strand of the nucleic acid strand B).

    [0150] At the same time, since the first universal sequence is capable of hybridizing or annealing to the complementary sequence of the second universal sequence under a condition that allows nucleic acid hybridization or annealing, during the PCR reaction, the universal primer (which comprises the first universal sequence) is also capable of annealing to the nucleic acid strand A complementary to the first forward primer (which comprises the second universal sequence). However, since there is a difference between the second universal sequence and the first universal sequence (in which one or more nucleotides located at the 3′ end of the first universal sequence are each independently deleted or substituted), the universal primer (especially its 3′ end) is not completely complementary to the nucleic acid strand A, which results in the inhibition of PCR amplification of the nucleic acid strand A by the universal primer (that is, the synthesis of the complementary strand of the nucleic acid strand A is inhibited).

    [0151] Therefore, as the PCR amplification proceeds, the synthesis efficiency of the complementary strand (nucleic acid strand B) of nucleic acid strand A will be significantly lower than that of the complementary strand (nucleic acid strand A) of nucleic acid strand B, resulting in that the complementary strand (nucleic acid strand A) of nucleic acid strand B is synthesized and amplified in large quantities, while the synthesis and amplification of the complementary strand (nucleic acid strand B) of nucleic acid strand A is inhibited, so that a large amount of the target single-stranded product (nucleic acid strand A, which comprises a sequence complementary to the first forward primer/the second universal sequence and the sequence of the first reverse primer/universal primer), thereby achieving the asymmetric amplification. Further, the universal primer as defined above can also be used in combination with at least two or more target-specific primer pairs as defined above, wherein each target-specific primer pair comprises a forward primer and a reverse primer, and is capable of specifically amplifying one target nucleic acid, wherein the forward primer comprises a second universal sequence and a forward nucleotide sequence specific to the target nucleic acid, and the reverse primer comprises a first universal sequence and a reverse nucleotide sequence specific to the target nucleic acid, whereby the embodiment (primer set) of the present invention can be used to achieve multiplex, asymmetric amplification of at least two or more target nucleic acids.

    [0152] In the exemplary embodiment shown in FIG. 1C, a universal primer as defined above is used in combination with two target-specific primer pairs, wherein the first target-specific primer pair comprises a first forward primer and a first reverse primer, and is capable of specifically amplifying the first target nucleic acid, and the first forward primer comprises a second universal sequence and a first forward nucleotide sequence specific to the first target nucleic acid, and the first reverse primer comprises the first universal sequence and a first reverse nucleotide sequence specific to the first target nucleic acid; the second target-specific primer pair comprises a second forward primer and a second reverse primer, and is capable of specifically amplifying the second target nucleic acid, and the second forward primer comprises a second universal sequence and a second forward nucleotide sequence specific to the second target nucleic acid, and the second reverse primer comprises the first universal sequence and a second reverse nucleotide sequence specific to the second target nucleic acid sequence. Therefore, the primer set can be used to achieve simultaneous, asymmetric amplification of the first and second target nucleic acids.

    [0153] FIG. 2 shows the results of real-time PCR amplification using the HAND system, the conventional asymmetric PCR system and the system of the present invention in Example 1; wherein, the black and gray dashed lines represent amplification curves of using the HAND system to amplify human genomic DNA and the negative control, respectively; the black and gray dotted lines represent amplification curves of using the conventional asymmetric PCR system to amplify human genomic DNA and the negative control, respectively; the black and gray solid lines represent amplification curves of using the system of the present invention to amplify human genomic DNA and the negative control, respectively.

    [0154] FIG. 3 shows the results of melting curve analysis after amplification using the HAND system, the conventional asymmetric PCR system and the system of the present invention in Example 1; wherein, the black and gray dashed lines represent the results of melting curve analysis after using the HAND system to amplify human genomic DNA and the negative control, respectively; the black and gray dotted lines represent the results of melting curve analysis after using the conventional asymmetric PCR system to amplify human genomic DNA and the negative control, respectively; the black and gray solid lines represent the results of melting curve analysis after using the system of the present invention to amplify human genomic DNA and the negative control, respectively.

    [0155] FIG. 4 shows the results of agarose gel electrophoresis of the amplification products obtained by using the HAND system, the conventional asymmetric PCR system and the system of the present invention in Example 1; wherein, lane M represents molecular weight marker; lanes 1 to 3 represent the products of amplifying human genomic DNA by using the HAND system (lane 1), the system of the present invention (lane 2) and the conventional asymmetric PCR system (lane 3), respectively; lanes 4 to 6 represent the products of amplifying the negative control by using the HAND system, the system of the present invention and the conventional asymmetric PCR system, respectively.

    [0156] FIG. 5 shows the results of melting curve analysis after amplification using different forward primers in Example 2, wherein, the gray dashed line, the black solid line, the black dashed line, the gray solid line or the black dotted line represent the results of melting curve analysis after amplification using rs2252992-F-A, rs2252992-F-C, rs2252992-F-G, rs2252992-F-T or rs2252992-F-D, respectively.

    [0157] FIG. 6 shows the results of melting curve analysis after amplification using the system of the present invention in Example 3, wherein, the black solid line (Sample 1), the black dashed line (Sample 2), the gray solid line (Sample 3), the gray dashed line (Sample 4) represent the results of melting curve analysis after using the system of the present invention to amplify Samples 1 to 4, respectively.

    [0158] FIG. 7 shows the results of melting curve analysis after amplification using the system of the present invention in Example 4, wherein, the black solid line (Sample 5), the black dashed line (Sample 6), the black dotted line (Sample 7), the gray solid line (Sample 8), the gray dashed line (Sample 9), and the gray dotted line (Sample 10) represent the results of melting curve analysis after using the system of the present invention to amplify Samples 5 to 10, respectively.

    [0159] FIG. 8 shows the results of melting curve analysis after amplification using the system of the present invention in Example 5, wherein, the black dotted line, the black dashed line, the gray dotted line, the gray dashed line, the black solid line, and the gray solid line represent the results of melting curve analysis after amplification of samples with DNA concentrations of 10 ng/μL, 1 ng/μL, 0.1 ng/μL, 0.05 ng/μL, 0.01 ng/μL, or 0.005 ng/μL, respectively.

    [0160] FIG. 9 shows the results of melting curve analysis after amplification using the conventional multiplex asymmetric PCR system in Example 5, wherein, the black dotted line, the black dashed line, the gray dotted line, the gray dashed line, the black solid line, and the gray solid line represent the results of melting curve analysis after amplification of samples with genomic DNA concentrations of 10 ng/μL, 1 ng/μL, 0.1 ng/μL, 0.05 ng/μL, 0.01 ng/μL, or 0.005 ng/μL, respectively.

    SPECIFIC MODELS FOR CARRYING OUT THE PRESENT INVENTION

    [0161] The present invention will now be described with reference to the following examples, which are intended to illustrate, but not limit, the present invention. It should be understood that these examples are only used to illustrate the principles and technical effects of the present invention, but do not represent all possibilities of the present invention. The present invention is not limited to the materials, reaction conditions or parameters mentioned in these examples. Those skilled in the art can implement other technical solutions using other similar materials or reaction conditions according to the principles of the present invention. Such technical solutions do not depart from the basic principles and concepts described in the present invention, and fall into the scope of the present invention.

    EXAMPLE 1

    [0162] In this example, by using the DNA fragment covering the gene polymorphism site rs2252992 on human chromosome 21 as a target nucleic acid to be amplified, the HAND system, the conventional asymmetric PCR system and the system (primer set) of the present invention were investigated to generate single stranded nucleic acid products. The sequences of primers and probes used in this example were shown in Table 1. The instrument used in this example was an SLAN 96 real-time fluorescence PCR instrument (Xiamen Zeesan Biotech Co., Ltd., Xiamen).

    [0163] Briefly, in this example, a 25 μL PCR reaction system was used for PCR amplification and melting curve analysis. The PCR reaction system comprised: 1×Taq PCR buffer (TaKaRa, Beijing), 5.0 mM MgCl.sub.2, 0.2 mM dNTPs, 1 U Taq DNA polymerase (TaKaRa, Beijing), 0.2 μM rs2252992-P probe, 5 μL of human genomic DNA (rs2252992 genotype was A/A homozygous) or negative control (water) and primers; wherein,

    [0164] (1) the HAND system was added with 0.03 μM rs2252992-F1, 0.03 μM rs2252992-R, 0.3 μM Tag primer (i.e., universal primer);

    [0165] (2) the conventional asymmetric PCR system was added with 0.03 μM rs2252992-F1 and 0.3 μM rs2252992-R;

    [0166] (3) the PCR system based on the method of the present invention was added with 0.03 μM rs2252992-F2, 0.03 μM rs2252992-R, 0.3 μM Tag primer.

    [0167] The PCR amplification program was: pre-denaturation at 95° C. for 5 min; 10 cycles of (denaturation at 95° C. for 15 s, annealing at 65° C.-56° C. for 15 s (1° C. drop for each cycle), extension at 76° C. for 20 s); 50 cycles of (denaturation at 95° C. for 15 s, annealing at 55° C. for 15 s, extension at 76° C. for 20 s); and the fluorescence signal of CY5 channel was collected during the annealing stage. After PCR amplification, the melting curve analysis was carried out according to the program of: denaturation at 95° C. for 1 min; incubation at 37° C. for 3 min; then, the temperature was elevated from 40° C. to 85° C. at a heating rate of 0.04° C./s, and the fluorescence signal of CY5 channel was collected. Finally, each PCR product was analyzed by 2% agarose gel electrophoresis. The experimental results were shown in FIG. 2 to FIG. 4.

    TABLE-US-00001 TABLE 1 Sequences of primers and probes used in Example 1 SEQ Sequence ID Name (5′.fwdarw.3′) No. Primer rs2252992- GTCGCAAGCACTCACGTAGAGACTCTCCTAA 1 F1 AGTCACTCAATCTTA rs2252992- GTCGCAAGCACTCACGTAGAGCCTCTCCTAA 2 F2 AGTCACTCAATCTTA rs2252992- GTCGCAAGCACTCACGTAGAGATGCCCTCAC 3 R TACTTGGAACT Tag primer GTCGCAAGCACTCACGTAGAGA 4 Fluorescent probe rs2252992- CY5-TGGAGCTCACACTTCTTAGACGCAGTG 5 P CTCCA-BHQ2

    [0168] FIG. 2 showed the results of real-time PCR amplification using the HAND system, the conventional asymmetric PCR system and the system of the present invention in Example 1; wherein, the black and gray dashed lines represented the amplification curves of using the HAND system to amplify human genomic DNA and the negative control, respectively; the black and gray dotted lines represented the amplification curves of using the conventional asymmetric PCR system to amplify human genomic DNA and the negative control, respectively; the black and gray solid lines represented the amplification curves of using the system of the present invention to amplify human genomic DNA and the negative control, respectively. The results showed that all the three systems could effectively and specifically amplify human genomic DNA, and generate corresponding amplification signals (the black dashed line, the black dotted line, and the black solid line); and the negative controls of each system had no amplification signal (the gray dashed line, the gray dotted line and the gray solid line). In addition, it was noted that the amplification curve (the black dotted line) of the conventional asymmetric PCR system had the smallest Ct value, which is caused by the direct amplification of the target nucleic acid by the high concentration of target-specific primer.

    [0169] FIG. 3 showed the results of melting curve analysis after amplification using the HAND system, the conventional asymmetric PCR system and the system of the present invention in Example 1; wherein, the black and gray dashed lines represented the results of melting curve analysis after using the HAND system to amplify human genomic DNA and the negative control, respectively; the black and gray dotted lines represented the results of melting curve analysis after using the conventional asymmetric PCR system to amplify human genomic DNA and the negative control, respectively; the black and gray solid lines represented the results of melting curve analysis after using the system of the present invention to amplify human genomic DNA and the negative control, respectively.

    [0170] FIG. 4 showed the results of agarose gel electrophoresis of the amplification products obtained by using the HAND system, the conventional asymmetric PCR system and the system of the present invention in Example 1; wherein, lane M represented molecular weight marker; lanes 1 to 3 represented the products of amplifying human genomic DNA by using the HAND system (lane 1), the system of the present invention (lane 2) and the conventional asymmetric PCR system (lane 3), respectively; lanes 4 to 6 represented the products of amplifying the negative control by using the HAND system, the system of the present invention and the conventional asymmetric PCR system, respectively.

    [0171] The results in FIG. 3 to FIG. 4 showed that when the HAND system was used for amplification, the amplification products were basically a double-stranded nucleic acid and could not produce single-stranded nucleic acid products (FIG. 4, lane 1); accordingly, in the process of melting curve analysis, the probes could not effectively hybridize to the amplification products and could not generate an effective melting peak (FIG. 3, black dashed line). Therefore, when the HAND system was used for amplification, efficient probe melting curve analysis could not be performed on the amplification product. However, when the system of the present invention and the conventional asymmetric PCR system were used for amplification, large amounts of single-stranded nucleic acid products were produced (FIG. 4, lanes 2 and 3); therefore, in the process of melting curve analysis, the probe could efficiently hybridize to the amplification products, and generate specific melting peaks (FIG. 3, black solid line and black dotted line). In addition, the results in FIG. 3 to FIG. 4 also showed that none of the negative control systems using water as a template could produce effective melting peaks (FIG. 3, gray dashed line, gray dotted line and gray solid line), this was because that no desired amplification product was generated in the PCR process (FIG. 4, lanes 4 to 6).

    [0172] The results of this example demonstrated that the system of the present invention could be used to obtain asymmetric amplification of target nucleic acid, and thus could be used in conjunction with probe melting curve analysis.

    EXAMPLE 2

    [0173] In this example, the DNA fragment of the gene polymorphism site rs2252992 on human chromosome 21 was used as a target nucleic acid to be amplified, and the effects of the differences between the second universal sequence and the first universal sequence (i.e., different variant types of the second universal sequence relative to the first universal sequence) on asymmetric amplification were investigated. The sequences of the primers and probes used in this example were shown in Table 2, wherein the nucleotide at the 3′ end of the universal primer (Tag primer) used was A; and 5 kinds of forward primers were designed, namely: the nucleotide at the 3′ end of the second universal sequence of rs2252992-F-C was C, the nucleotide at the 3′ end of the second universal sequence of rs2252992-F-G was G, the nucleotide at the 3′ end of the second universal sequence of rs2252992-F-T was T, the nucleotide at the 3′ end of the second universal sequence of rs2252992-F-A was A, and the penultimate nucleotide G at the 3′ end of the second universal sequence of rs2252992-F-D was deleted. The rs2252992-F-C, rs2252992-F-G, rs2252992-F-T and rs2252992-F-D were respectively used in the system of the present invention, and their complementary sequences respectively formed mismatches A-G, A-C, A-A and GA-TA with the universal primer during the amplification. The control primer rs2252992-F-A was used in the HAND system, and its complementary sequence perfectly matched the universal primer during the amplification. The instrument used in this example was an SLAN 96 real-time fluorescent PCR instrument.

    [0174] Briefly, in this example, a 25 μL PCR reaction system was used for PCR amplification and melting curve analysis. The PCR reaction system comprised: 1×Taq PCR buffer, 5.0 mM MgCl.sub.2, 0.2 mM dNTPs, 1 U Taq DNA polymerase, 0.4 μM rs2252992-P probe, 0.04 μM rs2252992-R primer, 1.6 μM Tag primer, 5 μL of human genomic DNA (rs2252992 genotype was T/C heterozygous) or negative control (water), and 0.04 μM designated forward primer (i.e., rs2252992-F-A, or rs2252992-F-C, or rs2252992-F-G, or rs2252992-F-T, or rs2252992-F-D primer).

    [0175] The PCR amplification program was: pre-denaturation at 95° C. for 5 min; 10 cycles of (denaturation at 95° C. for 15 s, annealing at 65° C.-56° C. for 15 s (1° C. drop for each cycle), extension at 76° C. for 20 s); 50 cycles of (denaturation at 95° C. for 15 s, annealing at 55° C. for 15 s, and extension at 76° C. for 20 s). After the PCR amplification was completed, melting curve analysis was performed, and its program was: denaturation at 95° C. for 1 min; incubation at 37° C. for 3 min; then, the melting curve analysis was carried out at a temperature elevated from 50° C. to 85° C. by a heating rate of 0.04° C./s, and the fluorescence signal of CY5 channel was collected. The melting curve analysis results were shown in FIG. 5.

    TABLE-US-00002 TABLE 2 Sequences of primers and probes used in Example 2 SEQ Sequence  ID Name (5′.fwdarw.3′) No. Primer rs2252992- GTCGCAAGCACTCACGTAGAGATCTGTTG  6 F-A TCCAATCTGGCA rs2252992- GTCGCAAGCACTCACGTAGAGCTCTGTTG  7 F-C TCCAATCTGGCA rs2252992- GTCGCAAGCACTCACGTAGAGGTCTGTTG  8 F-G TCCAATCTGGCA rs2252992- GTCGCAAGCACTCACGTAGAGTTCTGTTG  9 F-T TCCAATCTGGCA rs2252992- GTCGCAAGCACTCACGTAGAATCTGTTGT 10 F-D CCAATCTGGCA rs2252992-R GTCGCAAGCACTCACGTAGAGAGGTCTAA 11 AGCCACAAGGACTTA Tag primer GTCGCAAGCACTCACGTAGAGA  4 Fluorescent probe rs2252992-P CY5-TGGAGCTCACACTTCTTAGACGCAG  5 TGCTCCA-BHQ2

    [0176] FIG. 5 showed the results of melting curve analysis after amplification using different forward primers in Example 2, wherein, the gray dashed line, the black solid line, the black dashed line, the gray solid line or the black dotted line represented the results of melting curve analysis after amplification using rs2252992-F-A, rs2252992-F-C, rs2252992-F-G, rs2252992-F-T or rs2252992-F-D, respectively.

    [0177] The experimental results in FIG. 5 showed that when the rs2252992-F-A primer (which complementary sequence completely matched the universal primer) was used for amplification, the entire reaction system was equivalent to the HAND system, and the amplification product did not contain single-stranded nucleic acid product; accordingly, no target melting peak was observed in the melting curve (gray dashed line); while when the rs2252992-F-C (black solid line), rs2252992-F-G (black dashed line), rs2252992-F-T (gray solid line) or rs2252992-F-D (black dotted line) primers was used for amplification, since the universal primer could not be completely complementary to the complementary sequence of the forward primer (A-G, A-C, A-A or GA-TA mismatches were formed at the 3′ end of the universal primer), the amplification efficiencies of the two nucleic acid strands were different, and asymmetric amplification was formed, thereby resulting in a single-stranded nucleic acid product; correspondingly, the target melting peak was observed in the melting curve of the amplification product. This experimental result shows that a variety of mismatches/substitutions were applicable to the system of the present invention. Also, it was worth noting that different mismatch types could contribute to differences in amplification efficiency (as reflected by the differences in melting peak height). Therefore, when using the system of the present invention for asymmetric amplification, a suitable mismatch type could be selected in the forward primer/second universal sequence according to actual needs.

    EXAMPLE 3

    [0178] In this example, the typing of gene polymorphism sites rs2252992 and rs4816597 was taken as an example to illustrate that the system of the present invention could realize duplex and asymmetric amplification in a single reaction tube, and could be used for probe melting curve analysis. The sequences of primers and probes used in this example were shown in Table 3. The instrument used in this example was an SLAN 96 real-time fluorescent PCR instrument.

    [0179] Briefly, in this example, a 25 μL PCR reaction system was used for PCR amplification and melting curve analysis, and the PCR reaction system comprised: 1×Taq PCR buffer, 5.0 mM MgCl.sub.2, 0.2 mM dNTPs, 1 U Taq DNA polymerase, 0.05 μM rs4816597-F, 0.05 μM rs4816597-R, 0.4 μM rs4816597-P, 0.04 μM rs2252992-F, 0.04 μM rs2252992-R, 0.4 μM rs2252992-P, 1.6 μM Tag primer, 5 μL of human genomic DNA or negative control (water). In this example, four samples were detected (Samples 1, 2, 3 and 4; each PCR reaction system was used to detect one of the samples), wherein the genotypes of the rs2252992 and rs4816597 sites of Sample 1 were sequenced to be T/C, C/C, the genotypes of rs2252992 and rs4816597 sites of Sample 2 were sequenced to be T/C, T/C, the genotypes of rs2252992 and rs4816597 sites of Sample 3 were sequenced to be T/T, C/C, and the genotypes of rs2252992 and rs4816597 sites of Sample 4 were sequenced to be C/C, C/C.

    [0180] The PCR amplification program was as follows: pre-denaturation at 95° C. for 5 min; 10 cycles of (denaturation at 95° C. for 15 s, annealing at 65° C.-56° C. for 15 s (1° C. drop for each cycle), extension at 76° C. for 20 s); 50 cycles of (denaturation at 95° C. for 15 s, annealing at 55° C. for 15 s, and extension at 76° C. for 20 s); then, melting curve analysis was performed and its program was: denaturation at 95° C. for 1 min, incubation at 37° C. for 3 min; then, the melting curve analysis was performed at a temperature elevated from 40° C. to 85° C. by a heating rate of 0.04° C./s, and the fluorescence signal of CY5 channel was collected. The melting curve analysis results were shown in FIG. 6.

    TABLE-US-00003 TABLE 3 Sequences of primers and probes in Example 3 SEQ Sequence ID Name (5′.fwdarw.3′) No. Primer rs2252992- GTCGCAAGCACTCACGTAGAGTCTGTTGT 12 F CCAATCTGGCA rs2252992- GTCGCAAGCACTCACGTAGAGAGGTCTAA 11 R AGCCACAAGGACTTA rs4816597- GTCGCAAGCACTCACGTAGAGGAATCAGG 13 F AAGCTTTCTATGAACA rs4816597- GTCGCAAGCACTCACGTAGAGATATAGAA 14 R CGTGCACACTACCA Tag primer GTCGCAAGCACTCACGTAGAGA  4 Fluorescent probe rs2252992- CY5-TGGAGCTCACACTTCTTAGACGCAG  5 P TGCTCCA-BHQ2 rs4816597- CY5-CGAAAGTCTCCAACGTATAGCATTT 15 P CG-BHQ2

    [0181] FIG. 6 showed the result of melting curve analysis after amplification using the system of the present invention in Example 3, wherein, the black solid line (Sample 1), the black dashed line (Sample 2), the gray solid line (Sample 3), the gray dashed line (Sample 4) represented the results of melting curve analysis after using the system of the present invention to amplify Samples 1 to 4, respectively.

    [0182] The results in FIG. 6 showed that the genotypes of gene polymorphism sites rs2252992 and rs4816597 in Sample 1 (black solid line) were T/C and C/C, respectively; the genotypes of gene polymorphism sites rs2252992 and rs4816597 in Sample 2 (black dashed line) were T/C and T/C, respectively; the genotypes of gene polymorphism sites rs2252992 and rs4816597 in Sample 3 (gray solid line) were T/T and C/C, respectively; the genotypes of gene polymorphism sites rs2252992 and rs4816597 in Sample 4 (gray dashed line) were C/C and C/C, respectively; the negative control (gray solid line) had no melting peak; the genotyping results of each sample were consistent with the results obtained by sequencing. These results showed that the system of the present invention could simultaneously asymmetrically amplify two target nucleic acids in a single reaction system, and respectively generate enough single-stranded nucleic acid products for effective and reliable melting curve analysis, thereby realizing the identification of the two target nucleic acids (e.g., genotyping of two gene polymorphism sites). Therefore, combined with the melting curve analysis technology, the system of the present invention could simultaneously realize the detection and identification (e.g., genotyping) of two target nucleic acids.

    EXAMPLE 4

    [0183] In this example, the typing of 8 gene polymorphism sites (that was, rs979393, rs34521064, rs2835906, rs7275547, rs418298, rs60871880, rs4816597 and rs2252992) was taken as an example to demonstrate that the system of the present invention could realize eight-plex, asymmetric amplification in a single reaction tube, and could be used for probe melting curve analysis. The sequences of primers and probes used in this example were shown in Table 4. The instrument used in this example was a SLAN 96 real-time fluorescent PCR instrument.

    [0184] Briefly, in this example, a 25 μL PCR reaction system was used for PCR amplification and melting curve analysis, and the PCR reaction system comprised: 1×Taq PCR buffer, 5.0 mM MgCl.sub.2, 0.24 mM dNTPs, 1 U Taq DNA polymerase, 5 μL of human genomic DNA, and, primers and probes. The concentrations of primers and probes used were shown in Table 4. In this example, a total of 6 samples were detected (Samples 5-10; each PCR reaction system detected one of the samples).

    [0185] The PCR amplification program was: pre-denaturation at 95° C. for 5 min; 4 cycles of (denaturation at 95° C. for 15 s, annealing at 52° C. for 15 s, extension at 76° C. for 20 s); 55 cycles of (denaturation at 95° C. for 15 s, annealing at 58° C. for 15 s, and extension at 76° C. for 20 s); and the fluorescence signals of FAM, HEX, ROX and CY5 channels were collected during the annealing stage. Then, the melting curve analysis was carried out, and its program was: denaturation at 95° C. for 1 min, and incubation at 37° C. for 3 min; then, the temperature was elevated from 40° C. to 85° C. at a heating rate of 0.04° C./s, and the fluorescence signals of FAM, HEX, ROX and CY5 channels were collected. The experimental results were shown in FIG. 7.

    TABLE-US-00004 TABLE 4 Sequences of primers and probes used in Example 4 Working concen- SEQ Sequence tration  ID Name (5′.fwdarw.3′) (μM) No. Primer rs979393- GTCGCAAGCACTCACGTAGAGTGGCAC 0.04 16 F TATCCCTTTCAAACA rs979393- GTCGCAAGCACTCACGTAGAGACAGCT 0.04 17 R TTAAGTGAATTTATTGGCA rs34521064- GTCGCAAGCACTCACGTAGAGTATTTG 0.04 18 F CTATATCTAGTGACCTGAATC rs34521064- GTCGCAAGCACTCACGTAGAGATCGGG 0.04 19 R GAGCACAGATGA rs2835906- GTCGCAAGCACTCACGTAGAGTGTTTT 0.06 20 F TGTGTAAGTCTGATAGGTT rs2835906- GTCGCAAGCACTCACGTAGAGATGAGT 0.06 21 R CCCCGTTAAGCCT rs7275547- GTCGCAAGCACTCACGTAGAGCCAGGA 0.04 22 F CATGCCTCAGT rs7275547- GTCGCAAGCACTCACGTAGAGAGAGGA 0.04 23 R GGTACAGACATTTGGA rs418298- GTCGCAAGCACTCACGTAGAGGAAATT 0.02 24 F TCAGAATTGTTATGGACCAG rs418298- GTCGCAAGCACTCACGTAGAGACAGAG 0.02 25 R GCAGGTCGTCT rs60871880- GTCGCAAGCACTCACGTAGAGCAGGCC 0.04 26 F CAAATCCATTCTC rs60871880- GTCGCAAGCACTCACGTAGAGATCAAG 0.04 27 R AGGCACAGCCA rs4816597- GTCGCAAGCACTCACGTAGAGGAATCA 0.04 13 F GGAAGCTTTCTATGAACA rs4816597- GTCGCAAGCACTCACGTAGAGAATATA 0.04 14 R GAACGTGCACACTACCA rs2252992- GTCGCAAGCACTCACGTAGAGTCTGTT 0.05 12 F GTCCAATCTGGCA rs2252992- GTCGCAAGCACTCACGTAGAGAGGTCT 0.05 11 R AAAGCCACAAGGACTTA Tag GTCGCAAGCACTCACGTAGAGA 1.60  4 primer Fluorescent probe rs979393- FAM-CGTCAACTTGAGAGGTTTTTAAT 0.40 28 P ATGACG-BHQ1 rs34521064- FAM-TGGGCACGTTTCACAGGGCTGGA 0.40 29 P CACC-BHQ1 rs2835906- HEX-ACATCAAAAGAAGCGTAAAATGA 0.40 30 P TG-BHQ1 rs7275547- HEX-TTGCCTCTGAGTGAATGCCTCTT 0.40 31 P CGTCACCT-BHQ1 rs418298- ROX-ATGCTCTATGTGTTCAATTTGTT 0.40 32 P CCGAGCA-BHQ2 rs60871880- ROX-TGTGCTGAAGCTAAGAGCAAAGG 0.40 33 P GGGCCAGCAC-BHQ2 rs4816597- CY5-CGAAAGTCTCCAACGTATAGCAT 0.40 15 P TTCG-BHQ2 rs2252992- CY5-TGGAGCTCACACTTCTTAGACGC 0.40  5 P AGTGCTCCA-BHQ2

    [0186] FIG. 7 showed the results of melting curve analysis after amplification using the system of the present invention in Example 4, wherein, the black solid line (Sample 5), the black dashed line (Sample 6), the black dotted line (Sample 7), the gray solid line (Sample 8), the gray dashed line (Sample 9), and the gray dotted line (Sample 10) represented the results of melting curve analysis after using the system of the present invention to amplify Samples 5 to 10, respectively.

    TABLE-US-00005 TABLE 5 Typing results of 8 gene polymorphism sites in Samples 5 to 10 Sample 5 Sample 6 Sample 7 Sample 8 Sample 9 Sample 10 (black solid (black dashed (black dotted (gray solid (gray dashed (gray dotted line) line) line) line) line) line) rs979393 T/G T/G G/G T/G T/G G/G rs34521064 T/T C/C T/C T/C C/C T/T rs2835906 T/T T/C T/C T/C T/C T/C rs7275547 G/C C/C G/C G/C C/C G/C rs418298 A/G A/A G/G A/G A/A G/G rs60871880 T/C T/C C/C C/C T/C T/C rs4816597 C/C T/C T/C T/C T/C C/C rs2252992 T/C T/C C/C C/C T/C T/C

    [0187] In addition, the genotyping results of 8 gene polymorphism sites in Samples 5 to 10 were also identified by sequencing. The results showed that the genotyping results of each sample obtained by the system of the present invention (FIG. 7 and Table 5) were completely consistent with the results obtained by the sequencing.

    [0188] These results showed that the system of the present invention could simultaneously asymmetrically amplify 8 target nucleic acids in a sample in a single reaction system, and respectively generate enough single-stranded nucleic acid products for effective and reliable melting curve analysis, and this in turn enabled the identification of multiple target nucleic acids (e.g., genotyping of multiple genetic polymorphism sites). Therefore, combined with the melting curve analysis technology, the system of the present invention could simultaneously realize the detection and identification (e.g., genotyping) of multiple target nucleic acids.

    EXAMPLE 5

    [0189] In this example, the genotyping of samples containing different concentrations of human genomic DNA was taken as an example to compare the analytical sensitivity of the system of the present invention with the conventional multiplex asymmetric PCR system. The genomic DNA used in this example had 8 known genotype polymorphism sites, which were specifically as follows: rs979393: T/G; rs34521064: T/C; rs2835906: T/C; rs7275547: G/C; rs1005546: C/C; rs857998: C/C; rs4816597: T/C; rs2252992: C/C). The sequences of primers and probes used in this example were shown in Table 6. The instrument used in this example was a SLAN 96 real-time fluorescent PCR instrument.

    [0190] Briefly, in this example, a 25 μL PCR reaction system was used for PCR amplification and melting curve analysis, and the PCR reaction system comprised: 1×Taq PCR buffer, 5.0 mM MgCl.sub.2, 0.24 mM dNTPs, 2 U Taq DNA polymerase, 5 μL of human genomic DNA (at concentrations of 10 ng/μL, 1 ng/μL, 0.1 ng/μL, 0.05 ng/μL, 0.01 ng/μL, or 0.005 ng/μL), and primers and probes. The concentrations of primers and probes used were shown in Table 6.

    [0191] The PCR amplification program was as follows: pre-denaturation at 95° C. for 5 min; 6 cycles of (denaturation at 95° C. for 15 s, annealing at 52.5° C. for 15 s, extension at 76° C. for 20 s); 55 cycles of (denaturation at 95° C. for 15 s, annealing at 58° C. for 15 s, and extension at 76° C. for 20 s); and the fluorescence signals of FAM, HEX, ROX and CY5 channels were collected during the annealing stage. Then, the melting curve analysis was carried out, and its program was: denaturation at 95° C. for 1 min, and incubation at 37° C. for 3 min; then, the temperature was elevated from 40° C. to 85° C. at a heating rate of 0.04° C./s, and the fluorescence signals of FAM, HEX, ROX and CY5 channels were collected. The experimental results were shown in FIG. 8 and FIG. 9.

    TABLE-US-00006 TABLE 6 Concentrations of primers and probes used in Example 5 Working concen- tration SEQ Sequence (μM) No. Name (5′.fwdarw.3′) 1 2 ID Primer rs979393- GTCGCAAGCACTCACGTAGAGTGG 0.04 0.04 16 F CACTATCCCTTTCAAACA rs979393- GTCGCAAGCACTCACGTAGAGACA 0.04 0.4 17 R GCTTTAAGTGAATTTATTGGCA rs34521064- GTCGCAAGCACTCACGTAGAGTAT 0.04 0.04 18 F TTGCTATATCTAGTGACCTGAATC rs34521064- GTCGCAAGCACTCACGTAGAGATC 0.04 0.4 19 R GGGGAGCACAGATGA rs2835906- GTCGCAAGCACTCACGTAGAGTGT 0.06 0.06 20 F TTTTGTGTAAGTCTGATAGGTT rs2835906- GTCGCAAGCACTCACGTAGAGATG 0.06 0.6 21 R AGTCCCCGTTAAGCCT rs7275547- GTCGCAAGCACTCACGTAGAGCCA 0.04 0.04 22 F GGACATGCCTCAGT rs7275547- GTCGCAAGCACTCACGTAGAGAGA 0.04 0.4 23 R GGAGGTACAGACATTTGGA rsl005546- GTCGCAAGCACTCACGTAGAGCAT 0.04 0.04 34 F TTTGCCAATTTTTCCAACCA rsl005546- GTCGCAAGCACTCACGTAGAGAGG 0.04 0.4 35 R GAAAGACAGAAGAATTCCACT rs857998- GTCGCAAGCACTCACGTAGAGCCA 0.04 0.04 36 F GTTTTCTGAAACCCAGATA rs857998- GTCGCAAGCACTCACGTAGAGAAG 0.04 0.4 37 R GTCTGAAGGGCTTAGTTAG rs4816597- GTCGCAAGCACTCACGTAGAGGAA 0.04 0.04 13 F TCAGGAAGCTTTCTATGAACA rs4816597- GTCGCAAGCACTCACGTAGAGAAT 0.04 0.4 14 R ATAGAACGTGCACACTACCA rs2252992- GTCGCAAGCACTCACGTAGAGTCT 0.05 0.05 12 F GTTGTCCAATCTGGCA rs2252992- GTCGCAAGCACTCACGTAGAGAGG 0.05 0.5 11 R TCTAAAGCCACAAGGACTTA Tag primer GTCGCAAGCACTCACGTAGAGA 1.60 0  4 Fluorescent probe rs979393- FAM-CGTCAACTTGAGAGGTTTTT 0.20 0.20 28 P AATATGACG-BHQ1 rs34521064- FAM-TGGGCACGTTTCACAGGGCT 0.20 0.20 29 P GGACACC-BHQ1 rs2835906- HEX-ACATCAAAAGAAGCGTAAAA 0.20 0.20 30 P TGATG-BHQ1 rs7275547- HEX-TTGCCTCTGAGTGAATGCCT 0.20 0.20 31 P CTTCGTCACCT-BHQ1 rsl005546- ROX-TCTTTGTTGTCATGTCTCTC 0.20 0.20 38 P AAAG-BHQ2 rs857998- ROX-ACGCAGCTCTCCCAGCAGAT 0.20 0.20 39 P AGGCAAGCCCCTGCG-BHQ2 rs4816597- CY5-CGAAAGTCTCCAACGTATAG 0.20 0.20 15 P CATTTCG-BHQ2 rs2252992- CY5-TGGAGCTCACACTTCTTAGA 0.20 0.20  5 P CGCAGTGCTCCA-BHQ2 Note: 1, the system of the present invention; 2, conventional multiplex asymmetric PCR.

    [0192] FIG. 8 showed the results of melting curve analysis after amplification using the system of the present invention in Example 5, wherein, the black dotted line, the black dashed line, the gray dotted line, the gray dashed line, the black solid line, and the gray solid line represented the results of melting curve analysis after amplification of samples with DNA concentrations of 10 ng/μL, 1 ng/μL, 0.1 ng/μL, 0.05 ng/μL, 0.01 ng/μL, or 0.005 ng/μL, respectively.

    [0193] FIG. 9 shows the results of melting curve analysis after amplification using the conventional multiplex asymmetric PCR system in Example 5, wherein, the black dotted line, the black dashed line, the gray dotted line, the gray dashed line, the black solid line, and the gray solid line represented the results of melting curve analysis after amplification of samples with genomic DNA concentrations of 10 ng/μL, 1 ng/μL, 0.1 ng/μL, 0.05 ng/μL, 0.01 ng/μL, or 0.005 ng/μL, respectively.

    [0194] The results of FIG. 8 showed that even the concentration of human genomic DNA was as low as 0.05 ng/μL (gray dashed line), the system of the present invention could still stably and accurately detect the genotypes of all 8 gene polymorphism sites. In contrast, the results of FIG. 9 showed that the conventional multiplex asymmetric PCR system was able to detect the genotypes of all 8 gene polymorphism sites only when the concentration of human genomic DNA was 10 ng/μL (black dotted line) and 1 ng/μL, (black dashed line); and when the concentration of human genomic DNA was 0.1 ng/μL (gray dotted line), the genotypes of some gene polymorphism sites (e.g., sites rs34521064, rs4816597) could no longer be detected and discriminated (no discernable melting peak was generated). This might be because in the conventional multiplex asymmetric PCR reaction system, high concentrations of multiple kinds of primers and probes interacted with each other, resulting in the asymmetric amplification of some gene polymorphism sites could not be carried out effectively, and could not generate sufficient amounts of single-stranded products for melting curve analysis.

    [0195] The above results showed that the detection sensitivity of the system of the present invention was significantly higher than that of the conventional multiplex asymmetric PCR system. This was mainly because the system of the present invention used low-concentration target-specific primers and high-concentration universal primers for amplification, which effectively reduced the interference between primers, reduced non-specific amplification of dimers and so on, and made the amplification of each target nucleic acid in the reaction system to reach equilibrium, thereby improving the detection sensitivity of the entire reaction system.

    [0196] Although specific embodiments of the present invention have been described in detail, those skilled in the art will appreciate that various modifications and changes can be made to the details in light of all the teachings that have been disclosed, and that these changes are all within the scope of the present invention. The full scope of the present invention is given by the appended claims and any equivalents thereof.