FLAVONE COMPOUNDS FOR THE TREATMENT AND PROPHYLAXIS OF HEPATITIS B VIRUS DISEASE

20220363657 · 2022-11-17

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides flavone derivatives having the general formula (I) which are useful for the treatment of Hepatitis B Virus infection (HBV). The compounds act as cccDNA (covalently closed circular DMA) inhibitors.

##STR00001##

Claims

1. A compound of formula (I), ##STR00240## wherein: W is O or S; A.sub.1 is CH or CR.sup.4; A.sub.2 is CH or CR.sup.4; A.sub.3 is CH or CR.sup.4; A.sub.4 is N, CH or CR.sup.4; A.sub.5 is N, CH or CR.sup.4; A.sub.6 is CH; A.sub.7 is N or CH; R.sup.1 is halogen, C.sub.1-6alkyl or C.sub.3-7cycloalkyl; R.sup.2 is H, OH, halogen, C.sub.1-6alkoxy, haloC.sub.1-6alkoxy or phenylC.sub.1-6alkoxy; R.sup.3 is carboxy or C.sub.1-6alkoxycarbonyl; R.sup.4 is halogen, OH, CN, C.sub.1-6alkyl, C.sub.3-7cycloalkyl, C.sub.1-6alkoxy, oxopyrrolidinyl, morpholinyl or haloC.sub.1-6alkyl; G.sub.1 is C.sub.1-6alkylenyl, hydroxyC.sub.1-6alkylenyl or C.sub.3-7cycloalkylC.sub.1-6alkylenyl; and G.sub.2 is C.sub.1-6alkylenyl, C.sub.3-7cycloalkylenyl or phenylene; or a pharmaceutically acceptable salt, or enantiomer, or diastereomer thereof.

2. A compound according to claim 1, wherein: R.sup.1 is Cl, Br, methyl or cyclopropyl; R.sup.2 is H, OH, Cl, Br, methoxy, trifluoromethoxy or benzyloxy; R.sup.3 is carboxy, methoxycarbonyl or ethoxycarbonyl; R.sup.4 is F, Cl, Br, OH, CN, methyl, isopropyl, cyclopropyl, methoxy, ethoxy, isopropoxy, oxopyrrolidinyl, morpholinyl or trifluoromethyl; G.sub.1 is cyclobutylmethylene, ethylenyl, hydroxypropylenyl, isopropylenyl or propylenyl; and G.sub.2 is cyclobutylenyl, cyclohexylenyl, cyclopentylenyl, cyclopropylenyl, isopropylenyl, ethylenyl, methylene and phenylene; or a pharmaceutically acceptable salt, or enantiomer, or diastereomer thereof.

3. A compound according to claim 1, wherein A.sub.1 is CH.

4. A compound according to claim 1, wherein A.sub.4 is CH or CR.sup.4.

5. A compound according to claim 1, wherein A.sub.5 is CH or CR.sup.4.

6. A compound according to claim 1, wherein A.sub.7 is CH.

7. A compound according to claim 1, wherein R.sup.1 is halogen.

8. A compound according to claim 1, wherein R.sup.2 is H.

9. A compound according to claim 1, wherein R.sup.3 is carboxy.

10. A compound according to claim 1, wherein R.sup.4 is halogen, C.sub.1-6alkyl or C.sub.1-6alkoxy.

11. A compound according to claim 1, wherein G.sub.1 is C.sub.1-6alkylenyl.

12. A compound according to claim 1, wherein G.sub.2 is C.sub.1-6alkylenyl or C.sub.3-7cycloalkylenyl.

13. A compound according to claim 1, wherein: A.sub.1 is CH; A.sub.4 is CH or CR.sup.4; A.sub.5 is CH or CR.sup.4; A.sub.7 is CH; R.sup.1 is halogen; R.sup.2 is H; R.sup.3 is carboxy; R.sup.4 is halogen, C.sub.1-6alkyl or C.sub.1-6alkoxy; G.sub.1 is C.sub.1-6alkylenyl; and G.sub.2 is C.sub.1-6alkylenyl or C.sub.3-7cycloalkylenyl.

14. A compound according to claim 13, wherein: R.sup.1 is Cl, Br; R.sup.4 is F, Cl, Br, methyl, ethoxy or methoxy; G.sub.1 is ethylenyl or isopropylenyl; and G.sub.2 is cyclobutylenyl or methylene.

15. A compound according to claim 1, selected from: 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; ethyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate; 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]benzoic acid; ethyl 2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopropanecarboxylate; cis-2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopropanecarboxylic acid; trans-2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopropanecarboxylic acid; 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopentanecarboxylic acid; cis-4-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclohexanecarboxylic acid; trans-4-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclohexanecarboxylic acid; 2-[3-[[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]methyl]cyclobutoxy]acetic acid; 2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid; 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]propanoic acid; 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]-2,2-dimethyl-propanoic acid; 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-1-methyl-ethoxy]cyclobutanecarboxylic acid; 3-[3-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propoxy]cyclobutanecarboxylic acid; 3-[3-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]benzoic acid; 3-[2-[4-(8-chloro-7-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(8-chloro-7-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(7,8-dichloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(8-chloro-6-cyano-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(8-chloro-7-cyano-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(8-chloro-5-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(8-chloro-5-isopropoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(5-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(5,8-dichloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(8-chloro-5-cyclopropyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(8-chloro-5-methyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(8-bromo-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(8-cyclopropyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(8-methyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; 2-[2-[4-(8-chloro-5-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid; cis-3-[2-[[5-(8-chloro-4-oxo-chromen-2-yl)-2-pyridyl]oxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[[5-(8-chloro-4-oxo-chromen-2-yl)-2-pyridyl]oxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[5-(8-chloro-4-oxo-chromen-2-yl)pyrazin-2-yl]oxyethoxy]cyclobutanecarboxylic acid; cis-methyl 3-[2-[5-(8-chloro-4-oxo-chromen-2-yl)pyrazin-2-yl]oxyethoxy]cyclobutanecarboxylate; cis-methyl 3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)pyridazin-3-yl]oxyethoxy]cyclobutanecarboxylate; cis-3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-chloro-4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-bromo-4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-cyclopropyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-cyano-phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-isopropyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-3-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-3-ethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(3,8-dichloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(8-chloro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(8-chloro-3-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(8-chloro-4-oxo-thiochromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; 2-[2-[4-(8-chloro-4-oxo-thiochromen-2-yl)phenoxy]ethoxy]acetic acid; 2-[2-[4-(8-chloro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid; 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-3-morpholino-phenoxy]ethoxy]cyclobutanecarboxylic acid; 2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetamide; methyl 3-[2-[4-[8-chloro-6-fluoro-4-oxo-3-(trifluoromethoxy)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylate; 3-[2-[4-[8-chloro-6-fluoro-4-oxo-3-(trifluoromethoxy)chromen-2-yl]phenoxy]ethoxy]-cyclobutanecarboxylic acid; 3-[2-[4-(3-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(3-benzyloxy-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-[8-chloro-4-oxo-6-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(8-chloro-6-cyclopropyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-[8-chloro-4-oxo-6-(2-oxopyrrolidin-1-yl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(8-chloro-7-cyclopropyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; ethyl 2-[2-[4-(7-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetate; 3-[2-[4-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]-2-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; and Cis-3-[2-[2-chloro-4-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]-cyclobutanecarboxylic acid; or a pharmaceutically acceptable salt, or enantiomer, or diastereomer thereof.

16. A compound according to claim 13, selected from: 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-1-methyl-ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(8-chloro-5-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(5,8-dichloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(8-bromo-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-chloro-4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-bromo-4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-3-ethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[4-(8-chloro-4-oxo-thiochromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; 2-[2-[4-(8-chloro-4-oxo-thiochromen-2-yl)phenoxy]ethoxy]acetic acid; and 2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetamide; or a pharmaceutically acceptable salt, or enantiomer, or diastereomer thereof.

17. A process for preparing a compound according to claim 1, the process comprising any one of: a) substituting a compound of formula (X) ##STR00241## with a compound of formula (XI) in the presence of a base; b) substituting a compound of formula (IX) ##STR00242## with a compound of formula (XII) in the presence of a base; or c) cyclization of a compound of formula (XIV) ##STR00243## in the presence of a Lewis acid.

18. (canceled)

19. A pharmaceutical composition comprising a compound in accordance with claim 1 and a therapeutically inert carrier.

20. (canceled)

21. (canceled)

22. (canceled)

23. (canceled)

24. (canceled)

25. (canceled)

26. (canceled)

27. A compound manufactured according to the process of claim 17.

28. A method for the treatment or prophylaxis of HBV infection, which method comprises: administering an effective amount of a compound as defined in claim 1 to a patient in need thereof.

29. A method for the treatment or prophylaxis of HBV infection, which method comprises: administering an effective amount of a compound as defined in claim 15 to a patient in need thereof.

30. A pharmaceutical composition comprising a compound in accordance with claim 15 and a therapeutically inert carrier.

31. A method for inhibiting the activity of one or more targets selected from cccDNA, HBeAg, HBsAg, and HBV DNA, which method comprises: administering an effective amount of a compound as defined in claim 1 to a patient in need thereof.

32. A method for inhibiting the activity of one or more targets selected from cccDNA, HBeAg, HBsAg, and HBV DNA, which method comprises: administering an effective amount of a compound as defined in claim 15 to a patient in need thereof.

Description

BRIEF DESCRIPTION OF THE FIGURE(S)

[0241] FIG. 1: the result of Example 1 in cccDNA Southern Blot assay, it indicates that Example 1 dose-dependently reduced cccDNA level in HepDES19 cells.

EXAMPLES

[0242] The invention will be more fully understood by reference to the following examples. They should not, however, be construed as limiting the scope of the invention.

Abbreviations used herein are as follows: [0243] ACN: acetonitrile [0244] BBr.sub.3: boron tribromide [0245] DMAP: 4-dimethylaminopyridine [0246] DME: dimethoxyethane [0247] DMF: N,N-dimethylformamide [0248] EC.sub.50: the molar concentration of an inhibitor, which produces 50% of the maximum possible response for that inhibitor. [0249] FBS: fetal bovine serum [0250] H.sub.2O.sub.2: hydrogen peroxide [0251] HPLC: high performance liquid chromatography [0252] hr(s): hour(s) [0253] min: minute [0254] MS (ESI): mass spectroscopy (electron spray ionization) [0255] Ms: methylsulfonyl [0256] NCS: N-chlorosuccinimide [0257] NMP: N-methyl-2-pyrrolidone [0258] obsd.: observed [0259] PE: petroleum ether [0260] PPA: polyphosphoric acid [0261] PPh.sub.3: triphenylphosphine [0262] Py: pyridine [0263] rt: room temperature [0264] Sphos: 2-dicyclohexylphosphino-2′,6′-dimethoxybiphenyl [0265] Tf: trifluoromethanesulfonyl [0266] TFA: trifluoroacetic acid [0267] TFAA: trifluoroacetic anhydride [0268] TMS: trimethylsilyl [0269] Ts: p-tolylsulfonyl [0270] δ: chemical shift

General Experimental Conditions

[0271] Intermediates and final compounds were purified by flash chromatography using one of the following instruments: i) Biotage SP1 system and the Quad 12/25 Cartridge module. ii) ISCO combi-flash chromatography instrument. Silica gel Brand and pore size: i) KP-SIL 60 Å, particle size: 40-60 μm; ii) CAS registry NO: Silica Gel: 63231-67-4, particle size: 47-60 micron silica gel; iii) ZCX from Qingdao Haiyang Chemical Co., Ltd, pore: 200-300 or 300-400.

[0272] Intermediates and final compounds were purified by preparative HPLC on reversed phase column using X Bridge™ Perp C.sub.18 (5 μm, OBD™ 30×100 mm) column or SunFire™ Perp C.sub.18 (5 μm, OBD™ 30×100 mm) column.

[0273] LC/MS spectra were obtained using a Waters UPLC-SQD Mass. Standard LC/MS conditions were as follows (running time 3 minutes): [0274] Acidic condition: A: 0.1% formic acid and 1% acetonitrile in H.sub.2O; B: 0.1% formic acid in acetonitrile; [0275] Basic condition: A: 0.05% NH.sub.3.H.sub.2O in H.sub.2O; B: acetonitrile.

[0276] Mass spectra (MS): generally only ions which indicate the parent mass are reported, and unless otherwise stated the mass ion quoted is the positive mass ion (M+H).sup.+.

[0277] NMR Spectra were obtained using Bruker Avance 400 MHz.

[0278] All reactions involving air-sensitive reagents were performed under an argon atmosphere. Reagents were used as received from commercial suppliers without further purification unless otherwise noted.

Preparative Examples

Intermediate 1: methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate

[0279] ##STR00011##

Step 1: Preparation of 2-benzyloxyethoxy(trimethyl)silane

[0280] ##STR00012##

[0281] To a solution of 2-benzyloxyethanol (20.0 g, 131.4 mmol) and TEA (20.0 g, 197.1 mmol) in dichloromethane (200 mL) cooled at 0° C. was added trimethylsilyl chloride (17.1 g, 157.7 mmol) and the mixture was then stirred at 25° C. for 16 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by column chromatography on silica gel (elution with PE:EtOAc=50:1 to 10:1) to give the 2-benzyloxyethoxy(trimethyl)silane (25.0 g, 84.9%) as a colorless oil.

Step 2: Preparation of methyl 3-(2-benzyloxyethoxy)cyclobutanecarboxylate

[0282] ##STR00013##

[0283] To a solution of 2-benzyloxyethoxy(trimethyl)silane (25.0 g, 111.4 mmol) and methyl 3-oxocyclobutanecarboxylate (CAS #: 4934-99-0, Cat. #: PB01390, from PharmaBlock (Nanjing) R&D Co. Ltd, 15.0 g, 117.0 mmol) in dichloromethane (200 mL) was added trimethylsilyl trifluoromethanesulfonate (12.4 g, 55.7 mmol) dropwise at −78° C. After addition, the mixture was stirred at −78° C. for additional 1 hour and then to the resulting mixture was added triethylsilane (14.25 g, 122.57 mmol). After addition, the resulting mixture was warmed to room temperature and stirred at room temperature for 1 hour. After the reaction was completed, the mixture was washed with saturated NH.sub.4Cl solution, brine, dried over anhydrous sodium sulfate, and concentrated in vacuo. The residue was purified by column chromatography on silica gel (elution with PE/EtOAc=100:1-50:1) to give methyl 3-(2-benzyloxyethoxy)cyclobutanecarboxylate (28 g, 95.1%) as a colorless oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 265.1.

Step 3: Preparation of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate

[0284] ##STR00014##

[0285] To a solution of methyl 3-(2-benzyloxyethoxy)cyclobutanecarboxylate (28.0 g, 105.9 mmol) in MeOH (300.0 mL) was added Pd(OH).sub.2(wet) (1.48 g, 10.6 mmol) at room temperature and the mixture was then hydrogenated under H.sub.2 atmosphere at room temperature overnight. After the reaction was completed, the reaction was filtered through silica gel pad and the filtrate was concentrated in vacuo to give 18 g crude methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate (18 g, 97.6%) as a colorless oil.

Intermediate 2: methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate

[0286] ##STR00015##

[0287] To a solution of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate (5 g, 28.7 mmol) and DMAP (5.26 g, 43.1 mmol) in dichloromethane (80 mL) was added 4-methylbenzene-1-sulfonyl chloride (6.02 g, 31.6 mmol) at room temperature and the mixture was then stirred at room temperature overnight. After the reaction was completed, the mixture was washed with 1N HCl (25 mL), water (15 mL), saturated NaHCO.sub.3 solution, brine and concentrated in vacuo to give the crude methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (8.1 g, 85.6%) as a colorless oil, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 329.2.

Intermediate 3: methyl 3-[2-(4-formylphenoxy)ethoxy]cyclobutanecarboxylate

[0288] ##STR00016##

[0289] To a solution of 4-hydroxybenzaldehyde (5.0 g, 16.38 mmol) and methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (5.38 g, 16.38 mmol) in DMF (50 mL) was added K.sub.2CO.sub.3 (4.53 g, 32.75 mmol). The mixture was stirred at 60° C. for 12 hours. The resulting mixture was then poured into water (200 mL) and extracted with EtOAc (200 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (elution with PE:EtOAc=50:1˜10:1) to give methyl 3-[2-(4-formylphenoxy)ethoxy]cyclobutanecarboxylate (3.6 g 78.99%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 279.1.

Intermediate 4: cis-ethyl 3-[2-(4-formylphenoxy)ethoxy]cyclobutanecarboxylate

[0290] ##STR00017##

Step 1: Preparation of 2-(4-formylphenoxy)ethyl trifluoromethanesulfonate

[0291] ##STR00018##

[0292] To a solution of 4-(2-hydroxyethoxy)benzaldehyde (3 g, 18.1 mmol) and 2,6-dimethylpyridine (3.87 g, 4.21 mL, 36.1 mmol) in dichloromethane (40 mL) was added trifluoromethanesulfonic anhydride (9.17 g, 5.33 mL, 32.5 mmol) at −30° C. and the mixture was then stirred at 0° C. for 1 hour. The mixture was then washed with 1 N HCl (20 mL) twice, water (20 mL) twice, brine (20 mL), dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude 2-(4-formylphenoxy)ethyl trifluoromethanesulfonate (5.4 g, 100%), which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 299.1.

Step 2: Preparation of cis-ethyl 3-[2-(4-formylphenoxy)ethoxy]cyclobutanecarboxylate

[0293] ##STR00019##

[0294] To a solution of ethyl 3-hydroxycyclobutanecarboxylate (CAS #: 17205-02-6, Cat. #: PBN20120730, from PharmaBlock (Nanjing) R&D Co. Ltd, 2.6 g, 18 mmol, the ratio of cis isomer:trans isomer=10:1) in THF (20 mL) was added NaH (793 mg, 19.8 mmol) portion wise at 0° C. and the mixture was then stirred at 0° C. for 30 minutes. Then to the resulting mixture was added the solution of 2-(4-formylphenoxy)ethyl trifluoromethanesulfonate (5.4 g, 18.1 mmol, crude) in THF (40 mL) dropwise at 0° C. After addition, the mixture was poured into ice-water (50 mL) and extracted with dichloromethane (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (elution with PE:EtOAc=100:1 to 3:1) to give cis-ethyl 3-[2-(4-formylphenoxy)ethoxy]cyclobutanecarboxylate as a yellow solid (1.7 g, 32% yield). .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 9.78-9.94 (m, 1H), 7.74-7.91 (m, 2H), 7.07-7.19 (m, 2H), 4.19 (dd, J=3.85, 5.32 Hz, 2H), 4.02-4.10 (m, 2H), 3.90-4.00 (m, 1H), 3.66 (dd, J=3.79, 5.26 Hz, 2H), 2.60-2.73 (m, 1H), 2.41-2.48 (m, 2H), 1.93-2.05 (m, 2H), 1.10-1.23 (m, 3H). The trans isomer was not collected in the purification.

Intermediate 5: methyl 3-methylsulfonyloxycyclobutanecarboxylate

[0295] ##STR00020##

[0296] To a solution of methyl 3-hydroxycyclobutanecarboxylate (1 g, 7.68 mmol) and TEA (1.17 g, 1.61 mL, 11.5 mmol) in dichloromethane (10 mL) was added methanesulfonyl chloride (1.14 g, 778 μL, 9.99 mmol) at 0° C. and the mixture was then stirred at room temperature overnight. The mixture was then diluted with dichloromethane (50 mL), the resulting solution was then washed with water (20 mL) twice, saturated NaHCO.sub.3 (20 mL) twice, brine (20 mL), dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude methyl 3-methylsulfonyloxycyclobutanecarboxylate (1.6 g, 100%) as a colorless oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 209.2.

Example 1

3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0297] ##STR00021##

Step 1: Preparation of (E)-1-(3-chloro-2-hydroxy-phenyl)-3-[4-(2-hydroxyethoxy)phenyl]prop-2-en-1-one

[0298] ##STR00022##

[0299] To a solution of 1-(3-chloro-2-hydroxy-phenyl) ethanone (8 g, 46.9 mmol) and 4-(2-hydroxyethoxy) benzaldehyde (7.79 g, 46.9 mmol) in EtOH (150 ml) was added KOH (5.26 g, 93.8 mmol) at room temperature and the mixture was then stirred at 100° C. for 3 hours. After the reaction was completed, the resulting mixture was adjusted to pH˜4 by 2N HCl to yield a suspension. The solid was collected by filtration and dried in vacuo to give the crude (E)-1-(3-chloro-2-hydroxy-phenyl)-3-[4-(2-hydroxyethoxy)phenyl]prop-2-en-1-one (14 g, 93.7%) as a light yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 329.2.

Step 2: Preparation of 8-chloro-2-[4-(2-hydroxyethoxy)phenyl]chromen-4-one

[0300] ##STR00023##

[0301] To a solution of (E)-1-(3-chloro-2-hydroxy-phenyl)-3-[4-(2-hydroxyethoxy)phenyl]prop-2-en-1-one (14 g, 43.9 mmol) in DMSO (50 mL) was added I.sub.2 (557 mg, 2.2 mmol) at room temperature and the mixture was then stirred at 140° C. for 3 hours. After the reaction was completed, to the mixture was added saturated NaHSO.sub.3 solution (10 mL) and water (40 mL). The resulting suspension was filtered, the solid was collected and dried in vacuo to give the crude 8-chloro-2-[4-(2-hydroxyethoxy)phenyl]chromen-4-one (12 g, 86.3%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 317.2.

Step 3: Preparation of 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0302] ##STR00024##

[0303] To a solution of 8-chloro-2-[4-(2-hydroxyethoxy)phenyl]chromen-4-one (2 g, 6.31 mmol) in DMSO (20 mL) was added sodium hydride (1.14 g, 28.4 mmol) at room temperature. The mixture was stirred at room temperature for 30 minutes and then to the resulting mixture was added methyl 3-((methylsulfonyl)oxy)cyclobutanecarboxylate (5.26 g, 25.3 mmol) within 1 hour. After addition, the mixture was stirred at room temperature for another 4 hours. After the reaction was completed, the reaction was adjusted to pH˜4 by addition of 1N HCl and diluted with water (60 mL). The resulting mixture was extracted by EtOAc (60 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (1.67 g, 62.7%) as a white solid. The solid was further purified by supercritical fluid chromatography (SFC) to give cis-3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (Example 1-A) and trans-3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (Example 1-B). The configuration of Example 1-A and Example 1-B were determined by NOESY.

[0304] Example 1: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.17-12.07 (m, 1H), 8.12-8.05 (m, 2H), 8.00 (d, J=7.8 Hz, 2H), 7.49 (t, J=7.8 Hz, 1H), 7.18 (d, J=9.0 Hz, 2H), 7.07 (s, 1H), 4.23-4.15 (m, 2H), 4.06-3.90 (m, 1H), 3.70-3.64 (m, 2H), 2.64-2.54 (m, 1H), 2.48-2.36 (m, 2H), 2.21-1.96 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 415.1.

[0305] Example 1-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.13 (s, 1H), 8.12-8.05 (m, 2H), 8.00 (d, J=7.8 Hz, 2H), 7.49 (t, J=7.9 Hz, 1H), 7.20-7.15 (m, 2H), 7.07 (s, 1H), 4.22-4.16 (m, 2H), 3.99-3.88 (m, 1H), 3.67 (dd, J=3.8, 5.3 Hz, 2H), 2.64-2.54 (m, 1H), 2.48-2.40 (m, 2H), 2.04-1.95 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 415.1.

[0306] Example 1-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.12 (br. s., 1H), 8.09 (d, J=9.0 Hz, 2H), 8.00 (d, J=8.1 Hz, 2H), 7.49 (t, J=7.8 Hz, 1H), 7.18 (d, J=9.0 Hz, 2H), 7.07 (s, 1H), 4.23-4.17 (m, 2H), 3.70-3.63 (m, 2H), 2.97-2.87 (m, 1H), 2.39 (ddd, J=3.5, 7.0, 13.2 Hz, 2H), 2.21-2.11 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 415.1.

##STR00025##

Example 2

Ethyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

[0307] ##STR00026##

[0308] To a mixture of 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (0.4 g, 0.96 mmol) in EtOH (10 mL) was added H.sub.2SO.sub.4 (0.2 mL) and the mixture was then stirred at 60° C. for 12 hours. After the reaction was completed, the mixture was poured into water (50 mL) and the resulting mixture was extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo, the residue was then purified by preparative HPLC to give ethyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (305.0 mg, 71.7%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.15-8.12 (m, 1H), 7.98-7.96 (d, J=8.0 Hz, 2H), 7.76-7.74 (d, J=8.0 Hz, 2H), 7.08-7.06 (m, 2H), 6.79 (s, 1H), 4.32-4.14 (m, 5H), 3.78-3.76 (m, 2H), 2.57-2.55 (m, 3H), 2.31-2.29 (m, 2H), 1.3-1.25 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 443.1.

Example 3

3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]benzoic acid

[0309] ##STR00027##

Step 1: Preparation of (E)-1-(3-chloro-2-hydroxy-phenyl)-3-(4-methoxyphenyl)prop-2-en-1-one

[0310] ##STR00028##

[0311] A mixture of 1-(3-chloro-2-hydroxy-phenyl)ethanone (2.5 g, 14.7 mmol), 4-methoxybenzaldehyde (2 g, 14.7 mmol) and KOH (1.64 g, 29.3 mmol) in the EtOH (25 mL) was stirred at 100° C. for 3 hours. The mixture was then adjusted to PH ˜4 by addition of 2N HCl and the resulting suspension was filtered. The solid was collected and dried in vacuo to give the crude (E)-1-(3-chloro-2-hydroxy-phenyl)-3-(4-methoxyphenyl)prop-2-en-1-one (3.3 g, 78%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 289.1.

Step 2: Preparation of 8-chloro-2-(4-methoxyphenyl)chromen-4-one

[0312] ##STR00029##

[0313] To a solution of (E)-1-(3-chloro-2-hydroxy-phenyl)-3-(4-methoxyphenyl)prop-2-en-1-one (5.3 g, 18.4 mmol) in DMSO (60 mL) was added I.sub.2 (466 mg, 1.84 mmol) and then the mixture was stirred at 140° C. for 3 hours. After the reaction was completed, the reaction was cooled to room temperature, quenched with saturated NaHSO.sub.3 solution (10 mL) and diluted with water 100 mL. The resulting suspension was filtered and the solid was collected and dried in vacuo to give the 8-chloro-2-(4-methoxyphenyl)chromen-4-one (5 g, 95% yield) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 287.2.

Step 3: Preparation of 8-chloro-2-(4-hydroxyphenyl)chromen-4-one

[0314] ##STR00030##

[0315] To a solution of 8-chloro-2-(4-methoxyphenyl)chromen-4-one (5 g, 17.4 mmol) in dichloromethane (40 mL) was added BBr.sub.3 (1 M solution in dichloromethane, 69.8 mL, 69.8 mmol) at room temperature, the mixture was stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo and the residue was suspended in saturated NH.sub.4Cl solution (30 mL). The solid was collected by filtration and dried in vacuo to give the crude 8-chloro-2-(4-hydroxyphenyl)chromen-4-one, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 272.1.

Step 4: Preparation of 2-[4-(2-bromoethoxy)phenyl]-8-chloro-chromen-4-one

[0316] ##STR00031##

[0317] To a solution of 8-chloro-2-(4-hydroxyphenyl)chromen-4-one (800.0 mg, 2.94 mmol) and K.sub.2CO.sub.3 (1.2 g, 8.82 mmol) in DMF (20 mL) was added 1,2-dibromoethane (2.76 g, 14.7 mmol) at room temperature and the mixture was then stirred at 80° C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give crude 2-[4-(2-bromoethoxy)phenyl]-8-chloro-chromen-4-one (1.0 g, 89.7%) as a yellow solid, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 379.0.

Step 5: Preparation of methyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]benzoate

[0318] ##STR00032##

[0319] To a solution of 2-[4-(2-bromoethoxy)phenyl]-8-chloro-chromen-4-one (100.0 mg, 0.26 mmol) and methyl 3-hydroxybenzoate (48.0 mg, 0.32 mmol) in DMSO (3.0 mL) was added K.sub.2CO.sub.3 (107.6 mg, 0.78 mmol) at room temperature. Then the mixture was stirred at room temperature under N.sub.2 for 10 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give crude methyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]benzoate (117 mg, 100%) as a yellow solid, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 451.2.

Step 6: Preparation of 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]benzoic acid

[0320] ##STR00033##

[0321] To a solution of methyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]benzoate (117.0 mg, 0.26 mmol) in the mixed solvent of MeOH (20 mL) and H.sub.2O (3 mL) was added LiOH.H.sub.2O (70.0 mg, 1.67 mmol) at room temperature. The mixture was then stirred at room temperature for 48 hours. After the reaction was completed, the reaction was adjusted to pH˜4 by addition of 4N HCl. The resulting mixture was then concentrated in vacuo, the residue was purified by preparative HPLC to give 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]benzoic acid (8.0 mg, 7.0%) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.07-8.15 (m, 2H), 8.00 (d, J=7.8 Hz, 2H), 7.39-7.59 (m, 4H), 7.24 (d, J=8.8 Hz, 3H), 7.08 (s, 1H), 4.45 ppm (dd, J=18.3, 4.5 Hz, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:437.2.

Example 4

Ethyl 2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopropanecarboxylate

[0322] ##STR00034##

Step 1: Preparation of 2-vinyloxyethyl 4-methylbenzenesulfonate

[0323] ##STR00035##

[0324] To a solution of 2-vinyloxyethanol (4.0 g, 45.4 mmol) and TEA (12.66 mL, 90.8 mmol) in dichloromethane (50 mL) was added 4-methylbenzene-1-sulfonyl chloride (12.98 g, 68.1 mmol) at 0° C. and the mixture was then stirred at room temperature for 4 hour. After the reaction was completed, the mixture was concentrated in vacuo. The residue was purified by column chromatography on silica gel (elution with petroleum ether:EtOAc=50:1˜5:1) to give 2-vinyloxyethyl 4-methylbenzenesulfonate (10.5 g, 95.46%). MS obsd. (ESI.sup.+) [(M+H).sup.+]:243.1.

Step 2: Preparation of ethyl 2-[2-(p-tolylsulfonyloxy)ethoxy]cyclopropanecarboxylate

[0325] ##STR00036##

[0326] To a solution of 2-vinyloxyethyl 4-methylbenzenesulfonate (1.0 g, 4.13 mmol) and rhodium acetate (0.1 g, 0.230 mmol) cooled at 0° C. in dichloromethane (10 mL) was added ethyl 2-diazoacetate (0.57 g, 4.95 mmol) dropwise. After addition, the mixture was stirred at room temperature for 12 hours. After the reaction was completed, the resulting mixture was filtered and the filtrate was concentrated in vacuo. The residue was purified by column chromatography on silica gel (elution with petroleum ether:EtOAc=50:1˜5:1) to give ethyl 2-[2-(p-tolylsulfonyloxy)ethoxy]cyclopropanecarboxylate (1.1 g, 81.16%). MS obsd. (ESI.sup.+) [(M+H).sup.+]:329.1.

Step 3: Preparation of ethyl 2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopropanecarboxylate

[0327] ##STR00037##

[0328] To a mixture of ethyl 2-[2-(p-tolylsulfonyloxy)ethoxy]cyclopropanecarboxylate (145.72 mg, 0.44 mmol) and 8-chloro-2-(4-hydroxyphenyl)chromen-4-one (110.0 mg, 0.40 mmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (167.2 mg, 1.2 mmol) at room temperature and the mixture was then stirred at 80° C. for 12 hours. After the reaction was completed, to the mixture was added H.sub.2O (10 mL) and the resulting mixture was extracted with ethyl acetate (10 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4, and concentrated in vacuo to give the crude ethyl 2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopropanecarboxylate. The crude was further purified by preparative HPLC to give two diastereomers with cis- and trans-configuration, one of which is characterized as Example 4-A (40 mg, 20.4%) and the other is Example 4-B (60 mg, 35%).

[0329] Example 4-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.15-8.06 (m, J=8.9 Hz, 2H), 8.00 (d, J=7.9 Hz, 2H), 7.49 (t, J=7.8 Hz, 1H), 7.21-7.14 (m, J=8.9 Hz, 2H), 7.06 (s, 1H), 4.23 (t, J=4.4 Hz, 2H), 4.05 (dq, J=1.8, 7.1 Hz, 2H), 3.95-3.81 (m, 2H), 3.70 (dt, J=2.1, 4.4 Hz, 1H), 1.84-1.76 (m, 1H), 1.34-1.23 (m, 1H), 1.22-1.12 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 429.1.

[0330] Example 4-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.09 (d, J=9.0 Hz, 2H), 8.00 (d, J=7.8 Hz, 2H), 7.50 (t, J=7.9 Hz, 1H), 7.16 (d, J=9.0 Hz, 2H), 7.07 (s, 1H), 4.19 (br d, J=3.3 Hz, 2H), 4.08-4.01 (m, 2H), 3.87-3.80 (m, 1H), 3.79-3.60 (m, 2H), 1.80-1.73 (m, 1H), 1.35 (d, J=4.8 Hz, 1H), 1.21-1.15 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 429.1.

Example 5-A and Example 5-B

Cis-2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopropanecarboxylic acid and trans-2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopropanecarboxylic acid

[0331] ##STR00038##

[0332] To a solution of ethyl 2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopropanecarboxylate (520.0 mg, 1.2 mmol) in the mixed solvent of THF (2 mL) and water (2 mL) was added LiOH.H.sub.2O (96 mg, 2.43 mmol). The mixture was stirred at room temperature for 4 hours. After the reaction was completed, the mixture was adjusted to pH˜5 by addition of 1N HCl. The resulting mixture was extracted by EtOAc (20 mL) three times. The combined organic layer was washed with brine, dried with anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give two diastereomers of 2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopropanecarboxylic acid with cis- and trans-configuration, one of which is characterized as Example 5-A (2.9 mg, 3.6%) and the other is Example 5-B (17 mg, 35.3%).

[0333] Example 5-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.05 (br d, J=8.5 Hz, 2H), 7.97 (d, J=7.9 Hz, 2H), 7.47 (t, J=7.8 Hz, 1H), 7.15 (br d, J=8.5 Hz, 2H), 7.02 (s, 1H), 4.20-4.11 (m, 2H), 3.86-3.70 (m, 2H), 3.65-3.56 (m, 1H), 1.59 (q, J=7.1 Hz, 1H), 1.31-1.18 (m, 1H), 0.97-0.81 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 401.0.

[0334] Example 5-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.13 (d, J=8.8 Hz, 2H), 8.04 (d, J=7.9 Hz, 2H), 7.54 (t, J=7.8 Hz, 1H), 7.22 (d, J=8.8 Hz, 2H), 7.10 (s, 1H), 4.27 (br t, J=4.3 Hz, 2H), 3.99-3.85 (m, 2H), 3.63 (br d, J=4.3 Hz, 1H), 1.68 (br t, J=6.9 Hz, 1H), 1.15-1.07 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 401.0.

Example 6

3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopentanecarboxylic acid

[0335] ##STR00039##

Step 1: Preparation of methyl 3-(2-hydroxyethoxy)cyclopentanecarboxylate

[0336] ##STR00040##

[0337] Compound 6a was prepared in analogy to the procedure described for the preparation of Int-1 by using methyl 3-oxocyclopentanecarboxylate as the starting materials instead of methyl 3-oxocyclobutanecarboxylate in Step 2.

Step 2: Preparation of methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclopentanecarboxylate

[0338] ##STR00041##

[0339] Compound 6b was prepared in analogy to the procedure described for the preparation of Int-2 by using methyl 3-(2-hydroxyethoxy)cyclopentanecarboxylate as the starting materials instead of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate in Step 2.

Step 3: Preparation of methyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopentanecarboxylate

[0340] ##STR00042##

[0341] To a solution of methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclopentanecarboxylate (1.0 g, 3.67 mmol) and K.sub.2CO.sub.3 (1.02 g, 7.33 mmol) in DMF (20 mL) was added 8-chloro-2-(4-hydroxyphenyl)chromen-4-one (compound 3c, 1.38 g, 4.03 mmol). The mixture was then stirred at 80° C. for 4 hours. After the reaction was completed, to the mixture was added H.sub.2O (50 mL) and the resulting mixture was extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude methyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopentanecarboxylate (1.6 g, 98.4%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 443.1.

Step 4: Preparation of 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopentanecarboxylic acid

[0342] ##STR00043##

[0343] To a solution of methyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopentanecarboxylate (1.6 g, 3.61 mmol) in the mixed solvent of THF (10 mL) and H.sub.2O (10 mL) was added LiOH.H.sub.2O (259.55 mg, 10.84 mmol). The mixture was stirred at room temperature for 4 hours. After the reaction was completed, the mixture was adjusted to pH ˜5 by addition of 1N HCl. The resulting mixture was extracted by EtOAc (20 mL) three times. The combined organic layer was washed with brine, dried with anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopentanecarboxylic acid (1.2 g, 77.7%) as a solid.

[0344] Example 6: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.07 (br s, 1H), 8.12-8.05 (m, J=8.9 Hz, 2H), 7.99 (d, J=7.9 Hz, 2H), 7.49 (t, J=7.8 Hz, 1H), 7.21-7.14 (m, J=8.9 Hz, 2H), 7.06 (s, 1H), 4.25-4.13 (m, 2H), 4.09-3.88 (m, 1H), 3.76-3.66 (m, 2H), 2.80-2.78 (m, 1H), 1.99-1.78 (m, 4H), 1.75-1.61 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 429.1.

Example 7-A and Example 7-B

Cis-4-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclohexanecarboxylic acid and trans-4-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclohexanecarboxylic acid

[0345] ##STR00044##

Step 1: Preparation of methyl 4-(2-hydroxyethoxy)cyclohexanecarboxylate

[0346] ##STR00045##

[0347] Compound 7a was prepared in analogy to the procedure described for the preparation of Int-1 by using methyl 4-oxocyclohexanecarboxylate as the starting materials instead of methyl 3-oxocyclobutanecarboxylate in Step 2.

Step 2: Preparation of methyl 4-[2-(p-tolylsulfonyloxy)ethoxy]cyclohexanecarboxylate

[0348] ##STR00046##

[0349] Compound 7b was prepared in analogy to the procedure described for the preparation of Int-2 by using methyl 4-(2-hydroxyethoxy)cyclohexanecarboxylate as the starting materials instead of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate in Step 2.

Step 3: Preparation of methyl 4-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclohexanecarboxylate

[0350] ##STR00047##

[0351] To a solution of methyl 4-[2-(p-tolylsulfonyloxy)ethoxy]cyclohexanecarboxylate (1.0 g, 3.67 mmol) and K.sub.2CO.sub.3 (1.02 g, 7.33 mmol) in DMF (20 mL) was added 2-[4-(2-bromoethoxy)phenyl]-8-chloro-chromen-4-one (1.44 g, 4.03 mmol). The mixture was then stirred at 80° C. for 4 hours. After the reaction was completed, to the mixture was added H.sub.2O (50 mL) and the resulting mixture was extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude methyl 4-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclohexanecarboxylate (1.45 g, 86.4%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 457.1.

Step 4: Preparation of 4-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclohexanecarboxylic acid

[0352] ##STR00048##

[0353] To a solution of methyl 4-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclohexanecarboxylate (1.45 g, 3.17 mmol) in the mixed solvent of THF (10 mL) and H.sub.2O (10 mL) was added LiOH.H.sub.2O (259.55 mg, 10.84 mmol). The mixture was stirred at room temperature for 4 hours. After the reaction was completed, the mixture was adjusted to pH˜5 by addition of 1N HCl. The resulting mixture was extracted by EtOAc (20 mL) three times. The combined organic layer was with brine, dried with anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give two diastereomers of the 4-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclohexanecarboxylic acid with cis- and trans-configuration, one of which is characterized as Example 7-A (720 mg, 51.2%) and the other is Example 7-B (30 mg, 2.1%).

[0354] Example 7-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.06 (s, 1H), 8.08 (d, J=8.9 Hz, 2H), 8.00 (d, J=7.9 Hz, 2H), 7.49 (t, J=7.9 Hz, 1H), 7.18 (dd, J=2.8, 9.0 Hz, 2H), 7.06 (s, 1H), 4.26-4.17 (m, 2H), 3.78 (td, J=4.5, 16.4 Hz, 2H), 3.31-3.24 (m, 1H), 2.22-2.10 (m, 1H), 2.01 (br d, J=8.9 Hz, 2H), 1.98 (br d, J=13.1 Hz, 2H), 1.39-1.37 (m, 2H), 1.22-1.18 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 443.0.

[0355] Example 7-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.06 (s, 1H), 8.08 (d, J=8.9 Hz, 2H), 8.00 (d, J=7.9 Hz, 2H), 7.49 (t, J=7.9 Hz, 1H), 7.18 (dd, J=2.8, 9.0 Hz, 2H), 7.06 (s, 1H), 4.26-4.17 (m, 2H), 3.78 (td, J=4.5, 16.4 Hz, 2H), 3.59-3.51 (m, 1H), 2.29-2.27 (m, 1H), 1.68-1.74 (m, 4H), 1.40-1.60 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 443.0.

Example 8

2-[3-[[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]methyl]cyclobutoxy]acetic acid

[0356] ##STR00049##

Step 1: Preparation of 3-(hydroxymethyl)cyclobutanol

[0357] ##STR00050##

[0358] The mixture of methyl 3-oxocyclobutanecarboxylate (3.0 g, 26.3 mmol) in THF (20.0 mL) at −78° C. was added B.sub.2H.sub.6.Me.sub.2S (2.0 mL) at room temperature and the mixture was then stirred at room temperature for 12 hours. After the reaction was completed, the mixture was concentrated in vacuo, the residue was partitioned between dichloromethane (40 mL) and water (50 mL). The mixture was concentrated and extracted with dichloromethane (40.0 mL) and water (50.0 mL). The organic layer was then separated out and the aquatic phase was extracted with dichloromethane (50 mL) twice. The combined organic layer was washed with brine, dried over Na2SO4 and concentrated in vacuo to yield the crude 3-(hydroxymethyl)cyclobutanol (2.0 g, 74.5%) as an oil.

Step 2: Preparation of (3-hydroxycyclobutyl)methyl 4-methylbenzenesulfonate

[0359] ##STR00051##

[0360] To a solution of 3-(hydroxymethyl)cyclobutanol (2.0 g, 20.0 mmol) and TEA (2.0 g, 20.0 mmol) in dichloromethane (50 mL) was added 4-methylbenzene-1-sulfonyl chloride (4.8 g, 20.0 mmol) at room temperature and the mixture was then stirred at room temperature for 5 hours. After the reaction was completed, the mixture was washed with 1N HCl (25 mL), water (15 mL), saturated NaHCO.sub.3 solution, brine and concentrated in vacuo to give the crude (3-hydroxycyclobutyl)methyl 4-methylbenzenesulfonate (1.0 g, 19.4%) as colorless oil, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]:257.1.

Step 3: Preparation of 8-chloro-2-[4-[(3-hydroxycyclobutyl)methoxy]phenyl]chromen-4-one

[0361] ##STR00052##

[0362] To a solution of 8-chloro-2-(4-hydroxyphenyl)chromen-4-one (1.0 g, 3.7 mmol) and (3-hydroxycyclobutyl)methyl 4-methylbenzenesulfonate (1.0 g, 5.0 mmol) in DMF (10 mL) was added K.sub.2CO.sub.3 (1.0 g, 10.0 mmol) and the mixture was then stirred at 80° C. for 12 hours. After the reaction was completed, the mixture was diluted with water (50 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude 8-chloro-2-[4-[(3-hydroxycyclobutyl)methoxy]phenyl]chromen-4-one (1.0 g, 75.6%) as a yellow solid, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]:357.1.

Step 4: Preparation of ethyl 2-[3-[[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]methyl]cyclobutoxy]acetate

[0363] ##STR00053##

[0364] To a mixture of 8-chloro-2-[4-[(3-hydroxycyclobutyl)methoxy]phenyl]chromen-4-one (0.1 g, 0.3 mmol) and ethyl 2-diazoacetate (0.11 g, 1.0 mmol) in THF (10 mL) at 0° C. was added BF.sub.3.Et.sub.2O (0.1 mL) and the mixture was then stirred at room temperature for 2 hours. After the reaction was completed, the reaction was quenched with 1N HCl and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude ethyl 2-[3-[[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]methyl]cyclobutoxy]acetate (0.1 g, 75.2%) as a yellow solid, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]:443.1.

Step 5: Preparation of 2-[3-[[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]methyl]cyclobutoxy]acetic acid

[0365] ##STR00054##

[0366] The solution of ethyl 2-[3-[[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]methyl]cyclobutoxy]acetate (0.1 g, 0.26 mmol, crude) in the mixed solvent of THF (10 mL) and H.sub.2O (10 mL) was added LiOH.H.sub.2O (259.55 mg, 10.84 mmol). The mixture was stirred at room temperature for 4 hours. After the reaction was completed, the mixture was adjusted to pH˜5 by addition of 1N HCl. The resulting mixture was extracted by EtOAc (20 mL) three times. The combined organic layer was with brine, dried with anhydrous Na2SO4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 2-[3-[[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]methyl]cyclobutoxy]acetic acid (45.0 mg, 41.7%) as a light yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.08 (d, J=8.9 Hz, 2H), 8.00 (d, J=7.9 Hz, 2H), 7.50 (t, J=7.8 Hz, 1H), 7.12-7.22 (m, 2H), 7.06 (s, 1H), 4.05-4.13 (m, 2H), 3.89-4.03 (m, 3H), 2.59-2.65 (m, 1H), 2.35-2.41 (m, 1H), 2.20-2.30 (m, 1H), 2.10-2.15 (m, 1H), 1.71-1.83 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:415.2.

Example 9

2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid

[0367] ##STR00055##

Step 1: Preparation of methyl 2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetate

[0368] ##STR00056##

[0369] To the solution of 8-chloro-2-[4-(2-hydroxyethoxy)phenyl]chromen-4-one (0.3 g, 0.1 mmol) in DMF (2.5 mL) was added NaH (0.1 g, 60% in oil) and the mixture was stirred at room temperature for 1 hour. Then to the resulting mixture was added methyl 2-chloroacetate (0.3 g, 2.84 mmol) and the mixture was stirred at room temperature for additional 3 hours. After the reaction was completed, the reaction was quenched with water (50 mL) and extracted with dichloromethane (40 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude methyl 2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetate (0.38 g, 100%) as yellow solid, which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]:389.2.

Step 2: Preparation of 2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid

[0370] ##STR00057##

[0371] To a solution of methyl 2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetate (0.38 g, 0.1 mmol, crude) in the mixed solvent of THF (2 mL) and water (2 mL) was added LiOH.H.sub.2O (96 mg, 2.43 mmol). The mixture was stirred at room temperature for 4 hours. After the reaction was completed, the mixture was adjusted to pH˜5 by addition of 1N HCl. The resulting mixture was extracted by EtOAc (20 mL) three times. The combined organic layer was washed with brine, dried with anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid (153 mg, 40.8%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.10-8.08 (d, J=8.0 Hz, 2H), 8.00-7.98 (d, J=8.0 Hz, 2H), 7.51-7.47 (t, J=7.8 Hz, 1H), 7.19-7.17 (d, J=8.0 Hz, 2H), 7.06 (s, 1H), 4.25-4.23 (m, 2H), 4.11 (s, 2H), 3.87-3.85 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:375.0.

Example 10

3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]propanoic acid

[0372] ##STR00058##

[0373] Example 10 was prepared in analogy to the procedure described for the preparation of example 9 by using ethyl 3-chloropropanoate as the starting material instead of methyl 2-chloroacetate in Step 1.

[0374] Example 10: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.10-8.08 (d, J=9.0 Hz, 2H), 8.01-7.99 (d, J=8.0 Hz, 2H), 7.52-7.48 (t, J=7.8 Hz, 1H), 7.19-7.17 (d, J=8.0 Hz, 2H), 7.07 (s, 1H), 4.25 (s, 2H), 3.77 (s, 2H), 3.72-3.69 (m, 2H), 2.48-2.47 (d, J=4.0 Hz, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 389.0.

Example 11

3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]-2,2-dimethyl-propanoic acid

[0375] ##STR00059##

[0376] To a solution of 8-chloro-2-[4-(2-hydroxyethoxy)phenyl]chromen-4-one (100.0 mg, 0.32 mmol) and 3-chloro-2,2-dimethyl-propanoic acid (172.5 mg, 1.26 mmol) in DMF (2 mL) was added NaH (75.8 mg, 1.89 mmol) at room temperature and the mixture was stirred at 80° C. for 16 hours. Then the mixture was poured into water (20 mL) and adjusted to pH˜4 by addition of conc. HCl. The resulting mixture was extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was then purified by preparative HPLC to give 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]-2,2-dimethyl-propanoic acid (5 mg, 3.7%) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.08-8.05 (m, 3H), 7.91-7.89 (m, 1H), 7.48-7.44 (m, 1H), 7.16-7.14 (d, J=8.8 Hz, 2H), 6.89 (s, 1H), 4.50-4.48 (m, 2H), 4.36-4.34 (m, 2H), 3.59 (s, 2H), 1.19 (s, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 417.1.

Example 12

3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-1-methyl-ethoxy]cyclobutanecarboxylic acid

[0377] ##STR00060##

Step 1: Preparation of (2-chloro-1-methyl-ethoxy)-trimethyl-silane

[0378] ##STR00061##

[0379] To a solution of 1-chloropropan-2-ol (6.0 g, 63.47 mmol) and TEA (13.27 mL, 95.2 mmol) in dichloromethane (50 mL) was added trimethylsilyl chloride (7.51 g, 69.81 mmol) at 0° C. and the mixture was then stirred at 0° C. for 4 hours. After the reaction was completed, the mixture was filtered and the filtrate was concentrated in vacuo. The residue was purified by column chromatography on silica gel (elution with PE:EtOAc=50:1 to 10:1) to give the (2-chloro-1-methyl-ethoxy)-trimethyl-silane (7.2 g, 68.0%) as colorless oil.

Step 2: Preparation of methyl 3-(2-chloro-1-methyl-ethoxy)cyclobutanecarboxylate

[0380] ##STR00062##

[0381] To a solution of (2-chloro-1-methyl-ethoxy)-trimethyl-silane (7.2 g, 43.2 mmol) and methyl 3-oxocyclobutanecarboxylate (5.8 g, 45.4 mmol) in dichloromethane (100 mL) was added trimethylsilyl trifluoromethanesulfonate (4.8 g, 21.6 mmol) at −78° C. After addition, the mixture was stirred at −78° C. for another 1 hour and then to the resulting mixture was added triethylsilane (14.25 g, 122.57 mmol). After addition, the resulting mixture was warmed to room temperature and stirred for 1 hour. After the reaction was completed, the mixture was washed with saturated NH.sub.4Cl solution, brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (elution with PE/EtOAc=100:1-50:1) to give methyl 3-(2-chloro-1-methyl-ethoxy)cyclobutanecarboxylate (5.6 g, 62.7% yield). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 207.2.

Step 3: Preparation of 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-1-methyl-ethoxy]cyclobutanecarboxylic acid

[0382] ##STR00063##

[0383] Example 12 was prepared in analogy to the procedure described for the preparation of Example 7 by using methyl 3-(2-chloro-1-methyl-ethoxy)cyclobutanecarboxylate as the starting material instead of methyl 4-[2-(p-tolylsulfonyloxy)ethoxy]cyclohexanecarboxylate in Step 3. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.18 (br s, 1H), 8.12-8.06 (m, J=8.9 Hz, 2H), 8.00 (d, J=7.9 Hz, 2H), 7.50 (t, J=7.9 Hz, 1H), 7.21-7.14 (m, J=8.9 Hz, 2H), 7.07 (s, 1H), 4.07-3.97 (m, 3H), 3.87-3.74 (m, 1H), 2.94-2.82 (m, 0.5 H), 2.58-2.55 (m, 0.5 H), 2.48-2.38 (m, 2H), 2.22-2.07 (m, 1H), 1.99-1.94 (m, 1H), 1.19 (d, J=6.2 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 429.2.

Example 13

3-[3-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propoxy]cyclobutanecarboxylic acid

[0384] ##STR00064##

Step 1: Preparation of 8-chloro-2-[4-(3-hydroxypropoxy)phenyl]chromen-4-one

[0385] ##STR00065##

[0386] To a solution of 8-chloro-2-(4-hydroxyphenyl)chromen-4-one (400.0 mg, 1.3 mmol) and K.sub.2CO.sub.3 (1.0 g, 7.2 mmol) in DMF (20 mL) was added 3-bromopropan-1-ol (500 mg, 1.3 mmol) at room temperature and the mixture was then stirred at 80° C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude 8-chloro-2-[4-(3-hydroxypropoxy)phenyl]chromen-4-one (400 mg, 93.1%) as a yellow solid, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 330.1.

Step 2: Preparation of 3-[3-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propoxy]cyclobutanecarboxylic acid

[0387] ##STR00066##

[0388] Example 13 was prepared in analogy to the procedure described for the preparation of Example 1 by using 8-chloro-2-[4-(3-hydroxypropoxy)phenyl]chromen-4-one as the starting material instead of 8-chloro-2-[4-(2-hydroxyethoxy)phenyl]chromen-4-one in Step 3.

[0389] Example 13: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.08-8.06 (d, J=6.0 Hz, 2H), 8.00-7.97 (d, J=9.0 Hz, 2H), 7.51-7.46 (t, J=5.8 Hz, 1H), 7.17-7.14 (d, J=9.0 Hz, 2H), 7.04 (s, 1H), 4.15-4.11 (m, 2H), 3.88-3.83 (m, 1H), 3.54-3.50 (m, 2H), 2.59-2.56 (m, 1H), 2.78-2.65 (m, 2H), 2.03-1.98 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 428.9.

Example 14

3-[3-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]benzoic acid

[0390] ##STR00067##

Step 1: Preparation of 8-chloro-2-[4-(oxiran-2-ylmethoxy)phenyl]chromen-4-one

[0391] ##STR00068##

[0392] To a mixture of 8-chloro-2-(4-hydroxyphenyl)chromen-4-one (800 mg, 2.93 mmol) and 2-(chloromethyl)oxirane (814 mg, 8.8 mmol) in DMF (20 mL) was added K.sub.2CO.sub.3 (405 mg, 2.93 mmol) at room temperature and the mixture was then was stirred at room temperature overnight. After the reaction was completed, to the mixture was added water (100 mL), the resulting suspension was filtered. The solid was collected and further purified by recrystallization (MeOH, 20 mL) to give 8-chloro-2-[4-(oxiran-2-ylmethoxy)phenyl]chromen-4-one (650 mg, 67.4%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 329.2.

Step 2: Preparation of methyl 3-[3-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]benzoate

[0393] ##STR00069##

[0394] To a solution of 8-chloro-2-[4-(oxiran-2-ylmethoxy)phenyl]chromen-4-one (100 mg, 0.3 mmol), methyl 3-hydroxybenzoate (46.3 mg, 0.3 μmol) in THF (5 mL) was added NaH (40 mg, 60% in mineral oil, 1 μmol), the mixture was then stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo to give the crude methyl 3-[3-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]benzoate (146 mg, 99.8%), which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 481.3.

Step 3: Preparation of 3-[3-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]benzoic acid

[0395] ##STR00070##

[0396] To a solution of methyl 3-[3-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]benzoate (146 mg, 0.3 mmol, crude, prepared above) in the mixed solvent of MeOH (5 mL), THF (5 mL) and water (1 mL) was added LiOH (10 mg, 0.4 μmol). The mixture was then stirred at room temperature overnight. After the reaction was completed, to the mixture was added AcOH (60 mg, 1 mmol) and the resulting mixture was then concentrated in vacuo. The residue was then purified by preparative HPLC to give 3-[3-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]benzoic acid (40 mg, 27.9%) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.95-13.03 (m, 1H), 8.06-8.13 (m, 2H), 8.00 (d, J=8.07 Hz, 2H), 7.47-7.57 (m, 3H), 7.39-7.44 (m, 1H), 7.18-7.26 (m, 3H), 7.05-7.08 (m, 1H), 5.50 (d, J=4.89 Hz, 1H), 4.20-4.26 (m, 2H), 4.14-4.20 (m, 2H), 4.07-4.13 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 467.2.

Example 15

3-[2-[4-(8-chloro-7-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0397] ##STR00071##

Step 1: Preparation of (2-chloro-3-fluoro-phenyl) acetate

[0398] ##STR00072##

[0399] To a mixture of 2-chloro-3-fluoro-phenol (10.0 g, 68.24 mmol) and TEA (7.6 g, 75.06 mmol) in dichloromethane (150 mL) was added acetyl chloride (5.36 g, 68.24 mmol) at 0° C. and the mixture was then stirred at room temperature for 16 hours. After the reaction was completed, the mixture was poured into water (30 mL) and extracted with dichloromethane (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was then purified by column chromatography on silica gel (elution with PE:EtOAc=50:1-20:1) to give (2-chloro-3-fluoro-phenyl) acetate (10.0 g, 75%) as colorless oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 189.2.

Step 2: Preparation of 1-(3-chloro-4-fluoro-2-hydroxy-phenyl)ethanone

[0400] ##STR00073##

[0401] A mixture of (2-chloro-3-fluoro-phenyl) acetate (10.0 g, 53.03 mmol) and AlCl.sub.3 (7.07 g, 53.03 mmol) was stirred at 150° C. for 5 hours. After the reaction was completed, the mixture was poured into water (100 mL) and extracted with EtOAc (250 mL) twice. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was then purified by column chromatography on silica gel (elution with PE:EtOAc=50:1˜20:1) to give 1-(3-chloro-4-fluoro-2-hydroxy-phenyl)ethanone (3.0 g, 30.0%) as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 189.2.

Step 3: Preparation of (E)-1-(3-chloro-4-fluoro-2-hydroxy-phenyl)-3-(4-methoxyphenyl)prop-2-en-1-one

[0402] ##STR00074##

[0403] To a solution of 1-(3-chloro-4-fluoro-2-hydroxy-phenyl)ethanone (2.0 g, 10.61 mmol) and 4-methoxybenzaldehyde (1.29 mL, 10.61 mmol) in EtOH (30 mL) was added KOH (1.79 g, 31.82 mmol) at room temperature and the mixture was then stirred at 100° C. for 3 hours. After the reaction was completed, the resulting mixture was adjusted to pH˜4 by 2N HCl to yield a suspension. The solid was collected by filtration and dried in vacuo to give the crude (E)-1-(3-chloro-4-fluoro-2-hydroxy-phenyl)-3-(4-methoxyphenyl)prop-2-en-1-one (1.5 g, 46.1%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 307.0.

Step 4: Preparation of 8-chloro-7-fluoro-2-(4-methoxyphenyl)chromen-4-one

[0404] ##STR00075##

[0405] To a solution of (E)-1-(3-chloro-4-fluoro-2-hydroxy-phenyl)-3-(4-methoxyphenyl)prop-2-en-1-one (1.5 g, 4.9 mmol) in DMSO (30 mL) was added I.sub.2 (60 mg, 0.24 mmol) and then the mixture was stirred at 140° C. for 3 hours. After the reaction was completed, the reaction was cooled to room temperature, quenched with saturated NaHSO.sub.3 solution (10 mL) and diluted with water 100 mL. The resulting suspension was filtered and the solid was collected and further purified by recrystallization (EtOH, 10 mL) to give 8-chloro-7-fluoro-2-(4-methoxyphenyl)chromen-4-one (1.2 g, 80.3%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 304.9.

Step 4: Preparation of 8-chloro-7-fluoro-2-(4-hydroxyphenyl)chromen-4-one

[0406] ##STR00076##

[0407] To a solution of 8-chloro-7-fluoro-2-(4-methoxyphenyl)chromen-4-one (1.2 g, 39 mmol) in dichloromethane (20 mL) was added BBr.sub.3 (2.96 g, 11.81 mmol) at room temperature and then stirred overnight. After the reaction was completed, the reaction was quenched by adding into saturated NaHCO.sub.3 solution (250 mL) slowly. The resulting suspension was filtered, the solid was collected and dried in vacuo to give the crude 8-chloro-7-fluoro-2-(4-hydroxyphenyl)chromen-4-one (700 mg, 61.8%) as a yellow solid, which was used in the next step directly without further purification. (ESI.sup.+) [(M+H).sup.+]: 290.9.

Step 5: Preparation of methyl 3-[2-[4-(8-chloro-7-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

[0408] ##STR00077##

[0409] To a solution of 8-chloro-7-fluoro-2-(4-hydroxyphenyl)chromen-4-one (350 mg, 1.2 mmol) and methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (435 mg, 1.3 mmol) in DMF (10 mL) was added K.sub.2CO.sub.3 (333 mg, 2.4 mmol) in DMF (20 mL) at room temperature. The mixture was then stirred at 80° C. for 4 hours. After the reaction was completed, to the mixture was added H.sub.2O (50 mL) and the resulting mixture was extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude methyl 3-[2-[4-(8-chloro-7-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (200 mg, 37.2%) as a yellow solid, which was used in the next step directly without further purification. (ESI.sup.+) [(M+H).sup.+]: 447.0.

Step 6: Preparation of 3-[2-[4-(8-chloro-7-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0410] ##STR00078##

[0411] A mixture of methyl 3-[2-[4-(8-chloro-7-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (200 mg, 0.45 mmol) in con. HCl (5 mL) was stirred at 100° C. for 4 hours. After the reaction was completed, the mixture was concentrated in vacuo. The residue was purified by preparative HPLC to give the 3-[2-[4-(8-chloro-7-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (50 mg, 25.7%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.18 (s, 1H), 8.06-8.01 (m, 3H), 7.57-7.55 (m, 1H), 7.16-7.04 (m, 2H), 7.04 (s, 1H), 4.20-4.18 (d, J=4.0 Hz, 2H), 3.97-3.95 (m, 1H), 3.68-3.66 (m, 2H), 2.92-2.87 (m, 0.4 H), 2.59-2.57 (m, 1H), 2.46-2.42 (m, 2H), 2.21-2.05 (m, 0.6 H), 2.03-1.96 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 433.0.

Example 19

3-[2-[4-(8-chloro-7-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0412] ##STR00079##

Step 1: Preparation of 1-(3-chloro-2,4-dihydroxy-phenyl)ethanone

[0413] ##STR00080##

[0414] To a mixture of 1-(2,4-dihydroxyphenyl)ethanone (10 g, 62.7 mmol) in H.sub.2O (350 mL) was added NaOH (3.2 g, 78.9 mmol) at room temperature. Then to the resulting mixture was added NaClO (5.38 g, 72.3 mmol) slowly (over 1 hour) while keeping the inner temperature no more than 20° C. After addition, the mixture was stirred at room temperature for 17 hour. Then the mixture was adjusted to pH˜3 by addition of 1N HCl solution. The resulting mixture was extracted with EtOAc (400 mL) three times. The combined organic layer was washed with saturated Na.sub.2S.sub.2O.sub.3 (200 mL) solution twice, water (300 mL), brine (200 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (elution with PE:EtOAc=20:1-5:1) to give 1-(3-chloro-2,4-dihydroxy-phenyl)ethanone (3 g, 25.6%) as a solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 187.0.

Step 2: Preparation of 3-[2-[4-[(E)-3-(3-chloro-2,4-dihydroxy-phenyl)-3-oxo-prop-1-enyl]phenoxy]ethoxy]cyclobutanecarboxylic acid

[0415] ##STR00081##

[0416] To a solution of 1-(3-chloro-2,4-dihydroxy-phenyl)ethanone (630 mg, 3.4 mmol) and methyl 3-[2-(4-formylphenoxy)ethoxy]cyclobutanecarboxylate (int-3, 1.03 g, 3.71 mmol) in EtOH (10 mL) was added KOH (0.57 g, 10.1 mmol) at room temperature and the mixture was then stirred at 80° C. for 24 hours. After the reaction was completed, the mixture was poured into water (20 mL) and adjusted to pH˜4 by 2N HCl, the resulting mixture was extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude 3-[2-[4-[(E)-3-(3-chloro-2,4-dihydroxy-phenyl)-3-oxo-prop-1-enyl]phenoxy]ethoxy]cyclobutanecarboxylic acid (200 mg, 13.5%) as a brown oil, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 433.1.

Step 3: Preparation of 3-[2-[4-(8-chloro-7-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0417] ##STR00082##

[0418] To a solution of 3-[2-[4-[(E)-3-(3-chloro-2,4-dihydroxy-phenyl)-3-oxo-prop-1-enyl]phenoxy]ethoxy]cyclobutanecarboxylic acid (200 mg, 0.46 mmol, crude) in DMSO (3 mL) was added I.sub.2 (6 mg, 0.02 mmol) at room temperature and then the mixture was stirred at 140° C. for 3 hours. After the reaction was completed, the reaction was cooled to room temperature, quenched with saturated NaHSO.sub.3 solution (20 mL) and then extracted with EtOAc (20 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude 3-[2-[4-(8-chloro-7-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid as a brown solid. The crude was further purified by recrystallization (EtOAc, 5 mL) to give 3-[2-[4-(8-chloro-7-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (60 mg, 30.2%) as a grey solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.07-8.05 (d, J=8.8, 2H), 7.85-7.83 (d, J=8.8, 1H), 7.18-7.16 (m, 2H), 7.12-7.10 (m, 1H), 6.93 (s, 1H), 4.20-4.18 (m, 2H), 3.99-3.91 (m, 1H), 3.68-3.66 (m, 2H), 2.63-2.59 (m, 1H), 2.42-2.41 (m, 2H), 2.03-1.96 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 431.0.

Step 4: Preparation of methyl 3-[2-[4-(8-chloro-7-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

[0419] ##STR00083##

[0420] To a mixture of 3-[2-[4-(8-chloro-7-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (50.0 mg, 0.120 mmol) and K.sub.2CO.sub.3 (48.12 mg, 0.350 mmol) in DMF (2 mL) was added MeI (41.18 mg, 0.290 mmol) at room temperature. The mixture was then stirred at room temperature for 16 hours. After the reaction was completed, the mixture was poured into water (5.0 mL) and the resulting suspension was filtered. The solid was collected and dried in vacuo to give the crude methyl 3-[2-[4-(8-chloro-7-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (50.0 mg, 90.7%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 459.1.

Step 5: Preparation of 3-[2-[4-(8-chloro-7-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0421] ##STR00084##

[0422] To a mixture of methyl 3-[2-[4-(8-chloro-7-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (50.0 mg, 0.110 mmol) in the mixed solvent of THF (2 mL) and water (1 mL) was added LiOH.H.sub.2O (13.72 mg, 0.330 mmol) at room temperature. Then the mixture was stirred at room temperature for 16 hours. After the reaction was completed, the mixture was poured into water (5.0 mL) and resulting suspension was filtered. The solid was collected and dried in vacuo to give 3-[2-[4-(8-chloro-7-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (20 mg, 40.8%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.08-8.06 (d, J=8.8, 2H), 8.01-7.98 (d, J=8.8 Hz, 1H), 7.38-7.36 (d, J=8.8 Hz, 1H), 7.18-7.16 (d, J=8.8 Hz, 2H), 6.96 (s, 1H), 4.20-4.17 (m, 2H), 4.03 (s, 3H), 3.97-3.93 (m, 1H), 3.68-3.66 (m, 2H), 2.61-2.47 (m, 0.6 H), 2.46-2.43 (m, 2H), 2.41-2.03 (m, 0.4H), 2.00-1.98 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 445.1.

Example 20

3-[2-[4-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0423] ##STR00085##

Step 1: Preparation of 1-(3-chloro-5-fluoro-2-hydroxy-phenyl)ethanone

[0424] ##STR00086##

[0425] Compound 20a was prepared in analogy to the procedure described for the preparation of compound 15b by using 2-chloro-4-fluoro-phenol as the starting materials instead of 2-chloro-3-fluoro-phenol in Step 1.

Step 2: Preparation of 3-[2-[4-[(E)-3-(3-chloro-5-fluoro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]phenoxy]ethoxy]cyclobutanecarboxylic acid

[0426] ##STR00087##

[0427] Compound 20b was prepared in analogy to the procedure described for the preparation of compound 19b by using 1-(3-chloro-5-fluoro-2-hydroxy-phenyl)ethanone as the starting materials instead of 1-(3-chloro-2,4-dihydroxy-phenyl)ethanone in Step 2.

Step 3: Preparation of 3-[2-[4-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0428] ##STR00088##

[0429] To a solution of 3-[2-[4-[(E)-3-(3-chloro-5-fluoro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]phenoxy]ethoxy]cyclobutanecarboxylic acid (100 mg, 0.23 mmol) in DMSO (2 mL) was added I.sub.2 (3 mg, 0.01 mmol) at room temperature and then the mixture was stirred at 140° C. for 3 hours. After the reaction was completed, the reaction was cooled to room temperature, quenched with saturated NaHSO.sub.3 solution (20 mL) and then extracted with EtOAc (20 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was then purified by preparative HPLC to give 3-[2-[4-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (500 mg, 20.1%) as a yellow solid.

[0430] Example 20: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.18 (s, 1H), 8.11-8.09 (m, 3H), 7.72-7.70 (m, 1H), 7.19-7.17 (m, 2H), 7.09-7.08 (m, 1H), 4.19-3.98 (m, 2H), 3.97-3.93 (m, 1H), 3.68-3.66 (m, 2H), 2.61-2.57 (m, 1H), 2.46-2.42 (m, 2H), 2.03-1.98 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 433.1.

Example 21

3-[2-[4-(7,8-dichloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0431] ##STR00089##

[0432] Example 21 was prepared in analogy to the procedure described for the preparation of Example 15 by using 2,3-dichlorophenol as the starting materials instead of 2-chloro-3-fluoro-phenol in Step 1.

[0433] Example 21: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.17 (s, 1H), 8.08-8.00 (d, J=3.6 Hz, 2H), 7.99-7.97 (d, J=8.0 Hz, 1H), 7.75-7.73 (d, J=8.0 Hz, 1H), 7.19-7.17 (d, J=8.0 Hz, 2H), 7.1 (s, 1H), 4.21-4.19 (m, 2H), 3.68-3.66 (m, 3H), 2.59-2.50 (m, 1H), 2.46-2.45 (m, 2H), 2.43-2.40 (m, 1H), 2.01-1.98 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 449.0.

Example 22

3-[2-[4-(8-chloro-6-cyano-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0434] ##STR00090##

Step 1: Preparation of 1-(5-bromo-3-chloro-2-hydroxy-phenyl)ethanone

[0435] ##STR00091##

[0436] Compound 22a was prepared in analogy to the procedure described for the preparation of compound 15b by using 4-bromo-2-chloro-phenol as the starting materials instead of 2-chloro-3-fluoro-phenol in Step 1.

Step 2: Preparation of 6-bromo-8-chloro-2-(4-methoxyphenyl)chromen-4-one

[0437] ##STR00092##

[0438] Compound 22b was prepared in analogy to the procedure described for the preparation of compound 15d by using 1-(5-bromo-3-chloro-2-hydroxy-phenyl)ethanone as the starting materials instead of 1-(3-chloro-4-fluoro-2-hydroxy-phenyl)ethanone in Step 3.

Step 3: Preparation of 8-chloro-2-(4-methoxyphenyl)-4-oxo-chromene-6-carbonitrile

[0439] ##STR00093##

[0440] To a solution of 6-bromo-8-chloro-2-(4-methoxyphenyl)chromen-4-one (1.4 g, 2.74 mmol) in DMF (20 mL) was added Zn(CN).sub.2 (643 mg, 5.47 mmol) and Pd(PPh.sub.3).sub.4 (0.16 g, 0.140 mmol) under N.sub.2 atmosphere at room temperature. The mixture was stirred at 150° C. for 4 hours. After the reaction was completed, the mixture was poured into water (100 mL) and the resulting suspension was filtered. The solid was collected and washed with EtOH (10 mL) to give the crude 8-chloro-2-(4-methoxyphenyl)-4-oxo-chromene-6-carbonitrile (1.2 g, 100%) as a solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 312.0.

Step 4: Preparation of 8-chloro-2-(4-hydroxyphenyl)-4-oxo-chromene-6-carbonitrile

[0441] ##STR00094##

[0442] To a solution of 8-chloro-2-(4-methoxyphenyl)-4-oxo-chromene-6-carbonitrile (1.2 g, 3.9 mmol) in dichloromethane (20 ml) was added BBr.sub.3 (3.86 g, 15.4 mmol) at room temperature and the mixture was then stirred at room temperature overnight. After the reaction was completed, the reaction was quenched by adding into saturated NaHCO.sub.3 solution (250 mL) slowly. The resulting suspension was filtered, the solid was collected and dried in vacuo to give the crude 8-chloro-2-(4-hydroxyphenyl)-4-oxo-chromene-6-carbonitrile (900 mg, 78.5%) as a yellow solid, which was used in the next step directly without further purification. (ESI.sup.+) [(M+H).sup.+]: 297.9.

Step 5: Preparation of 3-[2-[4-(8-chloro-6-cyano-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0443] ##STR00095##

[0444] Example 22 was prepared in analogy to the procedure described for the preparation of Example 15 by using 8-chloro-2-(4-hydroxyphenyl)-4-oxo-chromene-6-carbonitrile as the starting materials instead of 8-chloro-7-fluoro-2-(4-hydroxyphenyl)chromen-4-one in Step 5. 100 mg of 3-[2-[4-(8-chloro-6-cyano-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid was further purified by supercritical fluid chromatography (SFC) to give two diastereomers with cis- and trans-configuration, one of which is characterized as Example 22-A (45 mg) and the other is Example 22-B (45 mg).

[0445] Example 22: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.19 (br s, 1H), 8.58 (d, J=2.0 Hz, 1H), 8.43-8.36 (m, 1H), 8.10 (d, J=8.9 Hz, 2H), 7.24-7.11 (m, 2H), 7.13-7.11 (m, 1H), 4.30-4.12 (m, 3H), 3.76-3.61 (m, 2H), 3.01-2.83 (m, 1H), 2.46-2.35 (m, 2H), 2.23-2.11 (m, 1H), 2.07-1.92 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 440.2.

[0446] Example 22-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.17 (br s, 1H), 8.58 (d, J=2.0 Hz, 1H), 8.39 (d, J=2.0 Hz, 1H), 8.10 (d, J=9.0 Hz, 2H), 7.23-7.13 (m, 3H), 4.26-4.12 (m, 3H), 3.74-3.64 (m, 2H), 2.99-2.87 (m, 1H), 2.40 (ddd, J=3.7, 6.9, 13.1 Hz, 2H), 2.23-2.10 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 440.2.

[0447] Example 22-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.30-11.80 (m, 1H), 8.61-8.55 (m, 1H), 8.43-8.35 (m, 1H), 8.16-8.05 (m, 2H), 7.25-7.13 (m, 3H), 4.20 (br s, 2H), 3.95 (q, J=7.3 Hz, 1H), 3.73-3.64 (m, 2H), 2.63-2.56 (m, 1H), 2.47-2.38 (m, 2H), 2.06-1.93 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 440.2.

Example 23

3-[2-[4-(8-chloro-7-cyano-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0448] ##STR00096##

Step 1: Preparation of 1-(4-bromo-3-chloro-2-hydroxy-phenyl)ethanone

[0449] ##STR00097##

[0450] Compound 23a was prepared in analogy to the procedure described for the preparation of compound 15b by using 4-bromo-2-chloro-phenol as the starting materials instead of 2-chloro-3-fluoro-phenol in Step 1.

Step 2: Preparation of 7-bromo-8-chloro-2-(4-methoxyphenyl)chromen-4-one

[0451] ##STR00098##

[0452] Compound 23b was prepared in analogy to the procedure described for the preparation of compound 15d by using 1-(4-bromo-3-chloro-2-hydroxy-phenyl)ethanone as the starting materials instead of 1-(3-chloro-4-fluoro-2-hydroxy-phenyl)ethanone in Step 3.

Step 3: Preparation of 8-chloro-2-(4-methoxyphenyl)-4-oxo-chromene-7-carbonitrile

[0453] ##STR00099##

[0454] To a solution of 7-bromo-8-chloro-2-(4-methoxyphenyl)chromen-4-one (1.4 g, 2.74 mmol) in DMF (20 mL) was added Zn(CN).sub.2 (643 mg, 5.47 mmol) and Pd(PPh.sub.3).sub.4 (0.16 g, 0.140 mmol) under N.sub.2 atmosphere at room temperature. The mixture was stirred at 150° C. for 4 hours. After the reaction was completed, the mixture was poured into water (100 mL) and the resulting suspension was filtered. The solid was collected and washed with EtOH (10 mL) to give the crude 8-chloro-2-(4-methoxyphenyl)-4-oxo-chromene-7-carbonitrile (1.2 g, 100%) as a solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 312.0.

Step 4: Preparation of 8-chloro-2-(4-hydroxyphenyl)-4-oxo-chromene-7-carbonitrile

[0455] ##STR00100##

[0456] To a solution of 8-chloro-2-(4-methoxyphenyl)-4-oxo-chromene-7-carbonitrile (1.2 g, 3.9 mmol) in dichloromethane (20 ml) was added BBr.sub.3 (3.86 g, 15.4 mmol) at room temperature and the mixture was then stirred at room temperature overnight. After the reaction was completed, the reaction was quenched by adding into saturated NaHCO.sub.3 solution (250 mL) slowly. The resulting suspension was filtered, the solid was collected and dried in vacuo to give the crude 8-chloro-2-(4-hydroxyphenyl)-4-oxo-chromene-7-carbonitrile (900 mg, 78.5%) as a yellow solid, which was used in the next step directly without further purification. (ESI.sup.+) [(M+H).sup.+]: 297.9.

Step 5: Preparation of 3-[2-[4-(8-chloro-7-cyano-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0457] ##STR00101##

[0458] Example 23 was prepared in analogy to the procedure described for the preparation of Example 15 by using 8-chloro-2-(4-hydroxyphenyl)-4-oxo-chromene-7-carbonitrile as the starting materials instead of 8-chloro-7-fluoro-2-(4-hydroxyphenyl)chromen-4-one in Step 5. 45 mg of 3-[2-[4-(8-chloro-7-cyano-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid was further purified by supercritical fluid chromatography (SFC) to give two diastereomers with cis- and trans-configuration, one of which is characterized as Example 23-A (31 mg) and the other is Example 23-B (11 mg).

[0459] Example 23: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.19 (br s, 1H), 8.10 (dd, J=2.7, 8.1 Hz, 3H), 8.00 (d, J=8.2 Hz, 1H), 7.32-7.09 (m, 3H), 4.26-4.12 (m, 2H), 3.95 (q, J=7.3 Hz, 1H), 3.73-3.63 (m, 2H), 3.01-2.83 (m, 1H), 2.45-2.36 (m, 2H), 2.23-2.10 (m, 1H), 2.07-1.93 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 440.0.

[0460] Example 23-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.14-8.08 (m, 3H), 8.00 (d, J=8.2 Hz, 1H), 7.22-7.16 (m, 3H), 4.22-4.18 (m, 2H), 3.94 (s, 1H), 3.73-3.64 (m, 2H), 2.57 (br s, 1H), 2.44 (br d, J=9.2 Hz, 2H), 2.03-1.95 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 440.0.

[0461] Example 23-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.17-8.07 (m, 3H), 8.00 (d, J=8.3 Hz, 1H), 7.24-7.15 (m, 3H), 4.27-4.12 (m, 3H), 3.72-3.64 (m, 2H), 3.00-2.86 (m, 1H), 2.39 (ddd, J=3.7, 6.9, 13.1 Hz, 2H), 2.23-2.11 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 440.2.

Example 24

Cis-3-[2-[4-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0462] ##STR00102##

Step 1: Preparation of 1-(3-chloro-2,6-dihydroxy-phenyl)ethanone

[0463] ##STR00103##

[0464] To a solution of 1-(2,6-dihydroxyphenyl)ethanone (5 g, 32.9 mmol) in AcOH (40 mL) was added NCS (4.83 g, 36.1 mmol) at room temperature and then the mixture was stirred at 50° C. for 2 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by column chromatography on silica gel (elution with PE:EtOAc=5:1) to give 1-(3-chloro-2,6-dihydroxy-phenyl)ethanone (200 mg 3.26% yield) as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 187.1.

Step 2: Preparation of 1-[3-chloro-6-hydroxy-2-(2-methoxyethoxymethoxy)phenyl]ethanone

[0465] ##STR00104##

[0466] A mixture of 1-(3-chloro-2,6-dihydroxy-phenyl)ethanone (6 g, 32.2 mmol), 1-(chloromethoxy)-2-methoxyethane (4.81 g, 38.6 mmol) and K.sub.2CO.sub.3 (8.89 g, 3.88 ml, 64.3 mmol) in DMF (20 mL) was stirred at room temperature for 16 hours. After the reaction was completed, the mixture was diluted with water (50 mL) and the resulting mixture was extracted with dichloromethane (50 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (elution with PE:EtOAc=10:1 to 3:1) to give 1-[3-chloro-6-hydroxy-2-(2-methoxyethoxymethoxy)phenyl]ethanone (8.0 g, 90.6%) as a colorless oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 275.1.

Step 3: Preparation of cis-3-[2-[4-[(E)-3-[3-chloro-6-hydroxy-2-(2-methoxyethoxymethoxy)phenyl]-3-oxo-prop-1-enyl]phenoxy]ethoxy]cyclobutanecarboxylic acid

[0467] ##STR00105##

[0468] A mixture of 1-[3-chloro-6-hydroxy-2-(2-methoxyethoxymethoxy)phenyl]ethanone (1.3 g, 4.73 mmol), cis-ethyl 3-(2-(4-formylphenoxy)ethoxy)cyclobutanecarboxylate (int-4, 1.38 g, 4.73 mmol) and KOH (1.06 g, 18.9 mmol) in EtOH (40 mL) was stirred at room temperature for 16 hours. After the reaction was completed, the mixture was quenched with ice-water (60 mL) and adjusted to pH˜6 by addition of 2N HCl. The resulting mixture was extracted with EtOAc (100 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude cis-3-[2-[4-[(E)-3-[3-chloro-6-hydroxy-2-(2-methoxyethoxymethoxy)phenyl]-3-oxo-prop-1-enyl]phenoxy]ethoxy]cyclobutanecarboxylic acid (2.6 g, 100%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 521.1.

Step 4: Preparation of cis-3-[2-[4-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0469] ##STR00106##

[0470] To a solution of cis-3-[2-[4-[(E)-3-[3-chloro-6-hydroxy-2-(2-methoxyethoxymethoxy)phenyl]-3-oxo-prop-1-enyl]phenoxy]ethoxy]cyclobutanecarboxylic acid (100 mg, 192 umol) in DMSO (60 mL) was added I.sub.2 (5 mg, 19.2 μmol) and the mixture was stirred at 140° C. for 3 hours. After the reaction was completed, the reaction was cooled to room temperature, quenched with saturated NaHSO.sub.3 solution (10 mL) and diluted with water 100 mL. The resulting suspension was filtered, the solid was collected and purified by preparative HPLC to afford cis-3-[2-[4-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (20 mg, 24.2% yield) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.88-12.62 (br s, 1H), 12.32-11.91 (br s, 1H), 8.10 (d, J=9.0 Hz, 2H), 7.81 (d, J=8.9 Hz, 1H), 7.22-7.10 (m, 3H), 6.84 (d, J=8.9 Hz, 1H), 4.25-4.13 (m, 2H), 3.95 (q, J=7.3 Hz, 1H), 3.70-3.64 (m, 2H), 2.64-2.56 (m, 1H), 2.47-2.37 (m, 2H), 2.06-1.95 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 431.1.

Example 25

Cis-3-[2-[4-(8-chloro-5-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0471] ##STR00107##

[0472] Example 25 was prepared in analogy to the procedure described for the preparation of Example 19 by using cis-3-[2-[4-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid as the starting materials instead of 3-[2-[4-(8-chloro-7-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (intermediate 19c) in Step 1.

[0473] Example 25: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.73 (br s, 1H), 8.02 (d, J=8.93 Hz, 2H), 7.85 (d, J=9.05 Hz, 1H), 7.14 (d, J=8.93 Hz, 2H), 7.01 (d, J=9.05 Hz, 1H), 6.86 (s, 1H), 4.13-4.25 (m, 2H), 3.91-3.99 (m, 1H), 3.87 (s, 3H), 3.63-3.72 (m, 2H), 2.56-2.64 (m, 1H), 2.36-2.48 (m, 2H), 1.93-2.05 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:445.2.

Example 27

Cis-3-[2-[4-(8-chloro-5-isopropoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0474] ##STR00108##

[0475] Example 27 was prepared in analogy to the procedure described for the preparation of Example 19 by using cis-3-[2-[4-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid and 2-iodopropane as the starting materials instead of 3-[2-[4-(8-chloro-7-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (intermediate 19c) and iodomethane in Step 1.

[0476] Example 27: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.17 (br s, 1H), 8.03 (d, J=9.05 Hz, 2H), 7.81 (d, J=9.05 Hz, 1H), 7.15 (d, J=8.93 Hz, 2H), 7.02 (d, J=9.17 Hz, 1H), 6.82 (s, 1H), 4.61-4.74 (m, 1H), 4.12-4.23 (m, 2H), 3.93 (q, J=7.37 Hz, 1H), 3.63-3.69 (m, 2H), 2.53-2.61 (m, 1H), 2.36-2.47 (m, 2H), 1.93-2.04 (m, 2H), 1.32 (d, J=5.99 Hz, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:473.3.

Example 28

Cis-3-[2-[4-(5-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0477] ##STR00109##

Step 1: Preparation of 1-(6-bromo-3-chloro-2-hydroxy-phenyl)ethanone

[0478] ##STR00110##

[0479] Compound 28a was prepared in analogy to the procedure described for the preparation of compound 15b by using 5-bromo-2-chloro-phenol as the starting materials instead of 2-chloro-3-fluoro-phenol in Step 1.

Step 2: Preparation of cis-3-[2-[4-[(E)-3-(6-bromo-3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]phenoxy]ethoxy]cyclobutanecarboxylic acid

[0480] ##STR00111##

[0481] A mixture of 1-(6-bromo-3-chloro-2-hydroxy-phenyl)ethanone (230 mg, 0.9 mmol), cis-ethyl 3-(2-(4-formylphenoxy)ethoxy)cyclobutanecarboxylate (268 mg, 0.9 mmol) and KOH (207 mg, 3.7 mmol) in EtOH (40 mL) was stirred at room temperature for 16 hours. After the reaction was completed, the mixture was quenched with ice-water (60 mL) and adjusted to pH˜6 by addition of 2N HCl. The resulting mixture was extracted with EtOAc (100 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude cis-3-[2-[4-[(E)-3-(6-bromo-3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]phenoxy]ethoxy]cyclobutanecarboxylic acid (300 mg, 65.6%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 495.2.

Step 3: Preparation of Cis-3-[2-[4-(5-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0482] ##STR00112##

[0483] Example 28 was prepared in analogy to the procedure described for the preparation of Example 19 by using cis-3-[2-[4-[(E)-3-(6-bromo-3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]phenoxy]ethoxy]cyclobutanecarboxylic acid as the starting materials instead of 3-[2-[4-[(E)-3-(3-chloro-2,4-dihydroxy-phenyl)-3-oxo-prop-1-enyl]phenoxy]ethoxy]cyclobutanecarboxylic acid (intermediate 19b) in Step 3.

[0484] Example 28: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.15 (s, 1H), 8.00-8.15 (m, 2H), 7.85 (d, J=8.56 Hz, 1H), 7.69 (d, J=8.56 Hz, 1H), 7.16 (d, J=9.05 Hz, 2H), 7.05 (s, 1H), 4.13-4.28 (m, 2H), 3.87-4.04 (m, 1H), 3.62-3.71 (m, 2H), 2.54-2.64 (m, 1H), 2.39-2.48 (m, 2H), 1.94-2.04 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:493.2.

Example 29

Cis-3-[2-[4-(5,8-dichloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0485] ##STR00113##

Step 1: Preparation of 1-(3,6-dichloro-2-hydroxy-phenyl)ethanone

[0486] ##STR00114##

[0487] Compound 29a was prepared in analogy to the procedure described for the preparation of compound 15b by using 2,5-dichlorophenol as the starting materials instead of 2-chloro-3-fluoro-phenol in Step 1.

Step 2: Preparation of Cis-3-[2-[4-(5,8-dichloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0488] ##STR00115##

[0489] Example 29 was prepared in analogy to the procedure described for the preparation of Example 19 by using 1-(3,6-dichloro-2-hydroxy-phenyl)ethanone and cis-ethyl 3-(2-(4-formylphenoxy)ethoxy)cyclobutanecarboxylate as the starting materials instead of 1-(3-chloro-2,4-dihydroxy-phenyl)ethanone (intermediate 19a) and methyl 3-[2-(4-formylphenoxy)ethoxy]cyclobutanecarboxylate in Step 2.

[0490] Example 29: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.17 (br s, 1H), 7.98-8.06 (m, 2H), 7.89 (d, J=8.56 Hz, 1H), 7.46 (d, J=8.56 Hz, 1H), 7.12 (d, J=9.05 Hz, 2H), 6.97 (s, 1H), 4.12-4.23 (m, 2H), 3.95 (q, J=7.34 Hz, 1H), 3.62-3.73 (m, 2H), 2.54-2.66 (m, 1H), 2.41-2.49 (m, 2H), 1.94-2.06 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:447.2.

Example 30

Cis-3-[2-[4-(8-chloro-5-cyclopropyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0491] ##STR00116##

[0492] A mixture of cis-3-[2-[4-(5-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (50 mg, 101 μmol), cyclopropylboronic acid (26.1 mg, 304 μmol), K.sub.3PO.sub.4 (43 mg, 203 μmol) and Pd(dppf)Cl.sub.2 (37 mg, 50.6 μmol) in DMF (5 mL) was heated at 100° C. under microwave radiation for 1 hour. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by preparative HPLC to give cis-3-[2-[4-(8-chloro-5-cyclopropyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (14 mg, 30.4%) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.17 (br s, 1H), 8.07 (d, J=8.93 Hz, 2H), 7.79 (d, J=8.44 Hz, 1H), 7.17 (d, J=9.05 Hz, 2H), 6.90-7.01 (m, 2H), 4.13-4.25 (m, 2H), 3.93 (q, J=7.37 Hz, 1H), 3.64-3.70 (m, 2H), 3.55-3.64 (m, 1H), 2.54-2.61 (m, 1H), 2.38-2.47 (m, 2H), 1.94-2.04 (m, 2H), 1.01-1.08 (m, 2H), 0.74-0.81 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:445.1.

Example 31

Cis-3-[2-[4-(8-chloro-5-methyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0493] ##STR00117##

[0494] Example 31 was prepared in analogy to the procedure described for the preparation of Example 30 by using 2,4,6-trimethyl-1,3,5,2,4,6-trioxatriborinane as the starting materials instead of cyclopropylboronic acid.

[0495] Example 31: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.05 (d, J=9.0 Hz, 2H), 7.81 (d, J=8.1 Hz, 1H), 7.22 (dd, J=0.7, 8.1 Hz, 1H), 7.15 (d, J=9.0 Hz, 2H), 6.95 (s, 1H), 4.21-4.15 (m, 2H), 3.95 (s, 1H), 3.69-3.64 (m, 2H), 2.74 (s, 3H), 2.58 (d, J=8.1 Hz, 1H), 2.48-2.39 (m, 2H), 2.04-1.94 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:429.2.

Example 33

Cis-3-[2-[4-(8-bromo-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0496] ##STR00118##

[0497] Example 33 was prepared in analogy to the procedure described for the preparation of Example 19 by using 1-(3-bromo-2-hydroxy-phenyl)ethanone and cis-ethyl 3-(2-(4-formylphenoxy)ethoxy)cyclobutanecarboxylate as the starting materials instead of 1-(3-chloro-2,4-dihydroxy-phenyl)ethanone (intermediate 19a) and methyl 3-[2-(4-formylphenoxy)ethoxy]cyclobutanecarboxylate in Step 2.

[0498] Example 33: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.20 (br s, 1H), 8.07-8.18 (m, 3H), 8.03 (dd, J=1.53, 7.89 Hz, 1H), 7.43 (t, J=7.82 Hz, 1H), 7.14-7.21 (m, 2H), 7.03-7.10 (m, 1H), 4.16-4.25 (m, 2H), 3.89-4.01 (m, 1H), 3.62-3.71 (m, 2H), 2.55-2.64 (m, 1H), 2.40-2.48 (m, 2H), 1.94-2.05 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:459.3.

Example 34

Cis-3-[2-[4-(8-cyclopropyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0499] ##STR00119##

[0500] Example 34 was prepared in analogy to the procedure described for the preparation of Example 30 by using 3-[2-[4-(8-bromo-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid as the starting materials instead of cis-3-[2-[4-(5-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid.

[0501] Example 34: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.52-13.15 (m, 1H), 8.10 (d, J=8.93 Hz, 2H), 7.84 (dd, J=1.83, 7.58 Hz, 1H), 7.33-7.45 (m, 2H), 7.15 (d, J=8.93 Hz, 2H), 6.98 (s, 1H), 4.13-4.25 (m, 2H), 3.94 (q, J=7.34 Hz, 1H), 3.60-3.73 (m, 2H), 2.52-2.64 (m, 2H), 2.40-2.48 (m, 2H), 1.93-2.06 (m, 2H), 1.07-1.26 (m, 2H), 0.74-0.96 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:421.2.

Example 35

Cis-3-[2-[4-(8-methyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0502] ##STR00120##

[0503] Example 35 was prepared in analogy to the procedure described for the preparation of Example 30 by using 3-[2-[4-(8-bromo-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid and 2,4,6-trimethyl-1,3,5,2,4,6-trioxatriborinane as the starting materials instead of cis-3-[2-[4-(5-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid and 2,4,6-trimethyl-1,3,5,2,4,6-trioxatriborinane.

[0504] Example 35: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.16 (br s, 1H), 8.07 (d, J=8.93 Hz, 2H), 7.83-7.93 (m, 1H), 7.68 (d, J=7.21 Hz, 1H), 7.38 (t, J=7.58 Hz, 1H), 7.15 (d, J=9.05 Hz, 2H), 6.96 (s, 1H), 4.13-4.26 (m, 2H), 3.95 (q, J=7.37 Hz, 1H), 3.61-3.74 (m, 2H), 2.55-2.66 (m, 4H), 2.39-2.49 (m, 2H), 1.93-2.05 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:395.2.

Example 37

2-[2-[4-(8-chloro-5-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid

[0505] ##STR00121##

Step 1: Preparation of 1-(3-chloro-6-fluoro-2-hydroxy-phenyl)ethanone

[0506] ##STR00122##

[0507] Compound 37a was prepared in analogy to the procedure described for the preparation of compound 15b by using 2-chloro-5-fluoro-phenol as the starting materials instead of 2-chloro-3-fluoro-phenol in Step 1.

Step 2: Preparation of 8-chloro-5-fluoro-2-[4-(2-hydroxyethoxy)phenyl]chromen-4-one

[0508] ##STR00123##

[0509] Compound 37b was prepared in analogy to the procedure described for the preparation of compound 1a by using 1-(3-chloro-6-fluoro-2-hydroxy-phenyl)ethanone as the starting material instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone in Step 1.

Step 3: Preparation of 2-[2-[4-(8-chloro-5-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid

[0510] ##STR00124##

[0511] Example 37 was prepared in analogy to the procedure described for the preparation of Example 9 by using 8-chloro-5-fluoro-2-[4-(2-hydroxyethoxy)phenyl]chromen-4-one as the starting material instead of 8-chloro-2-[4-(2-hydroxyethoxy)phenyl]chromen-4-one in Step 1.

[0512] Example 37: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.07-11.92 (m, 1H), 8.07 (d, J=9.0 Hz, 2H), 8.00 (dd, J=4.9, 8.8 Hz, 1H), 7.30 (dd, J=8.9, 10.6 Hz, 1H), 7.18 (d, J=9.0 Hz, 2H), 7.01 (s, 1H), 4.27-4.20 (m, 2H), 4.09 (s, 2H), 3.90-3.81 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 393.1.

Example 38-A and Example 38-B

Cis-3-[2-[[5-(8-chloro-4-oxo-chromen-2-yl)-2-pyridyl]oxy]ethoxy]cyclobutanecarboxylic acid and trans-3-[2-[[5-(8-chloro-4-oxo-chromen-2-yl)-2-pyridyl]oxy]ethoxy]cyclobutanecarboxylic acid

[0513] ##STR00125##

Step 1: Preparation of (2-acetyl-6-chloro-phenyl) 6-chloropyridine-3-carboxylate

[0514] ##STR00126##

[0515] To a solution of 1-(3-chloro-2-hydroxy-phenyl)ethanone (5 g, 29.3 mmol) and TEA (3.56 g, 4.91 ml, 35.2 mmol) in dichloromethane (20 mL) was added 6-chloropyridine-3-carbonyl chloride (5.42 g, 30.8 mmol). The reaction was stirred at room temperature for 14 hours. After the reaction was completed, the solution was concentrated in vacuo to give the crude (2-acetyl-6-chloro-phenyl) 6-chloropyridine-3-carboxylate (9.1 g, 100%) as a yellow oil, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 310.1.

Step 2: Preparation of 1-(3-chloro-2-hydroxy-phenyl)-3-(6-chloro-3-pyridyl)propane-1,3-dione

[0516] ##STR00127##

[0517] To a solution of (2-acetyl-6-chloro-phenyl) 6-chloropyridine-3-carboxylate (9 g, 29 mmol) in THF (400 ml) was added potassium tert-butoxide (4.56 g, 40.6 mmol) at room temperature. Then mixture was stirred at room temperature for 2 hours. After the reaction was completed, the reaction was quenched with water (50 mL) and the aqueous was adjusted to pH˜6 by addition of 0.5N HCl. The resulting mixture was then extracted with dichloromethane (100 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was then triturated in hexane (15 mL) and the mixture was then filtered. The solid was collected and dried in vacuo to give 1-(3-chloro-2-hydroxy-phenyl)-3-(6-chloro-3-pyridyl)propane-1,3-dione (9.0 g, 100%) as a light brown solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 310.1.

Step 3: Preparation of 8-chloro-2-(6-chloro-3-pyridyl)chromen-4-one

[0518] ##STR00128##

[0519] To a mixture of 1-(3-chloro-2-hydroxy-phenyl)-3-(6-chloro-3-pyridyl)propane-1,3-dione (2.5 g, 8.06 mmol) in AcOH (15 mL) was added cat. con.H.sub.2SO.sub.4 (2 drop). The mixture was then stirred 130° C. for 4 hours. After the reaction was completed, the mixture was concentrated in vacuo to remove the solvent and the residue was suspended in water (20 mL). The suspension was then filtered, the solid was collected and dried in vacuo to give 8-chloro-2-(6-chloro-3-pyridyl)chromen-4-one (2.0 g, 84.9%) as a white solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 292.1.

Step 4: Preparation of

cis-3-[2-[[5-(8-chloro-4-oxo-chromen-2-yl)-2-pyridyl]oxy]ethoxy]cyclobutanecarboxylic acid and trans-3-[2-[[5-(8-chloro-4-oxo-chromen-2-yl)-2-pyridyl]oxy]ethoxy]cyclobutanecarboxylic acid

[0520] ##STR00129##

[0521] To a solution of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate (1.91 g, 16 mmol) in DMF (20 mL) was added NaH (986 mg, 24.6 mmol) and the mixture was stirred at room temperature for 0.5 hour. Then the resulting mixture was added into the solution of 8-chloro-2-(6-chloro-3-pyridyl)chromen-4-one (1.6 g, 5.48 mmol) in DMF (20 mL). After addition, the mixture was stirred at 80° C. for 3 hours. After the reaction was completed, the mixture was filtered and the filtrate was purified by preparative HPLC to give 3-[2-[[5-(8-chloro-4-oxo-chromen-2-yl)-2-pyridyl]oxy]ethoxy]cyclobutanecarboxylic acid (320 mg, 14.0%) as a white solid. The solid was then further purified by supercritical fluid chromatography (SFC) to give two diastereomers with cis- and trans-configuration, one of which is characterized as Example 38-A (175 mg, 7.68%) and the other is Example 38-B (40 mg, 1.76%).

[0522] Example 38-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.62 (s, 1H), 8.85-8.95 (m, 1H), 8.30-8.38 (m, 1H), 8.00-8.07 (m, 1H), 7.89-7.96 (m, 1H), 7.43-7.51 (m, 1H), 6.97-7.06 (m, 2H), 4.44-4.54 (m, 2H), 3.92-4.04 (m, 1H), 3.63-3.78 (m, 2H), 2.59-2.67 (m, 1H), 2.43-2.53 (m, 2H), 1.98-2.17 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 416.1.

[0523] Example 38-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.72-12.61 (m, 1H), 8.87-8.96 (m, 1H), 8.33-8.43 (m, 1H), 7.99 (dd, J=1.59, 7.83 Hz, 2H), 7.49 (s, 1H), 7.15 (s, 1H), 7.03-7.10 (m, 1H), 4.42-4.53 (m, 2H), 4.09-4.24 (m, 1H), 3.63-3.71 (m, 2H), 2.87-2.98 (m, 1H), 2.34-2.44 (m, 2H), 2.08-2.23 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 416.1.

Example 39 and Example 40

Cis-3-[2-[5-(8-chloro-4-oxo-chromen-2-yl)pyrazin-2-yl]oxyethoxy]cyclobutanecarboxylic acid and Cis-methyl 3-[2-[5-(8-chloro-4-oxo-chromen-2-yl)pyrazin-2-yl]oxyethoxy]cyclobutanecarboxylate

[0524] ##STR00130##

Step 1: Preparation of 5-chloropyrazine-2-carbonyl chloride

[0525] ##STR00131##

[0526] To a solution of 5-chloropyrazine-2-carboxylic acid (3 g, 18.9 mmol) in dichloromethane (60 mL) was added oxalyl dichloride (2.52 g, 1.7 mL, 19.9 mmol) dropwise at 0° C. Then to the mixture was added 2 drops of DMF and the mixture was stirred at room temperature for 2 hours. After the reaction was completed, the mixture was concentrated in vacuo to give 5-chloropyrazine-2-carbonyl chloride (3.4 g, 100%) as a white solid.

Step 2: Preparation of 8-chloro-2-(5-chloropyrazin-2-yl)chromen-4-one

[0527] ##STR00132##

[0528] Compound 39b was prepared in analogy to the procedure described for the preparation of compound 38c by using 5-chloropyrazine-2-carbonyl chloride as the starting material instead of 6-chloropyridine-3-carbonyl chloride chloride in Step 1.

Step 3: Preparation of cis-3-[2-[5-(8-chloro-4-oxo-chromen-2-yl)pyrazin-2-yl]oxyethoxy]cyclobutanecarboxylic acid and cis-methyl 3-[2-[5-(8-chloro-4-oxo-chromen-2-yl)pyrazin-2-yl]oxyethoxy]cyclobutanecarboxylate

[0529] ##STR00133##

[0530] To a mixture of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate (166 mg, 955 μmol) in DMF (5 mL) was added NaH (34.5 mg, 863 μmol) and the mixture was stirred at room temperature for 0.5 hour. Then to the resulting mixture was added the solution of 8-chloro-2-(5-chloropyrazin-2-yl)chromen-4-one (140 mg, 479 μmol) in DMF (5 mL). After addition, the mixture was stirred at room temperature for 12 hours. After the reaction was completed, the mixture was filtered and the filtrate was purified by preparative HPLC to give the cis configuration of 3-[2-[5-(8-chloro-4-oxo-chromen-2-yl)pyrazin-2-yl]oxyethoxy]cyclobutanecarboxylic acid (5 mg, 2.5%) and methyl 3-[2-[5-(8-chloro-4-oxo-chromen-2-yl)pyrazin-2-yl]oxyethoxy]cyclobutanecarboxylate (14 mg, 6.8%) as white foam. The trans isomer was not collected in the purification.

[0531] Example 39: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.83-8.98 (m, 1H), 8.52-8.62 (m, 1H), 7.99-8.09 (m, 2H), 7.43-7.58 (m, 1H), 7.02-7.13 (m, 1H), 4.50-4.56 (m, 2H), 3.92-3.99 (m, 1H), 3.68-3.75 (m, 2H), 2.55-2.63 (m, 1H), 2.39-2.48 (m, 2H), 1.94-2.05 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 417.1.

[0532] Example 40: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.92 (d, J=1.22 Hz, 1H), 8.55-8.59 (m, 1H), 8.00-8.07 (m, 2H), 7.49-7.56 (m, 1H), 7.07-7.11 (m, 1H), 4.50-4.55 (m, 2H), 3.93-4.02 (m, 1H), 3.68-3.76 (m, 2H), 3.63 (s, 3H), 2.67-2.73 (m, 1H), 2.42-2.48 (m, 2H), 1.98-2.05 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 431.1.

Example 41

Cis-methyl 3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)pyridazin-3-yl]oxyethoxy]cyclobutanecarboxylate

[0533] ##STR00134##

Step 1: Preparation of 6-chloropyridazine-3-carbonyl chloride

[0534] ##STR00135##

[0535] To a solution of 6-chloropyridazine-3-carboxylic acid (4.4 g, 27.8 mmol) in dichloromethane (60 mL) was added oxalyl dichloride (3.7 g, 2.5 mL, 29.1 mmol) dropwise at 0° C. Then to the mixture was added 2 drops of DMF and the mixture was stirred at room temperature for 2 hours. After the reaction was completed, the mixture was concentrated in vacuo to give 5-chloropyrazine-2-carbonyl chloride (5.0 g, 100%) as a yellow solid.

Step 2: Preparation of 8-chloro-2-(6-chloropyridazin-3-yl)chromen-4-one

[0536] ##STR00136##

[0537] Compound 41b was prepared in analogy to the procedure described for the preparation of compound 38c by using 6-chloropyridazine-3-carbonyl chloride as the starting material instead of 6-chloropyridine-3-carbonyl chloride chloride in Step 1.

Step 3: Preparation of cis-methyl 3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)pyridazin-3-yl]oxyethoxy]cyclobutanecarboxylate

[0538] ##STR00137##

[0539] To a mixture of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate (166 mg, 955 μmol) in DMF (5 mL) was added NaH (34.5 mg, 863 μmol) and the mixture was stirred at room temperature for 0.5 hour. Then to the resulting mixture was added the solution of 8-chloro-2-(6-chloropyridazin-3-yl)chromen-4-one (140 mg, 479 μmol) in DMF (5 mL). After addition, the mixture was stirred at room temperature for 12 hours. After the reaction was completed, the mixture was filtered and the filtrate was purified by preparative HPLC to give the cis configuration of methyl 3-[2-[5-(8-chloro-4-oxo-chromen-2-yl)pyrazin-2-yl]oxyethoxy]cyclobutanecarboxylate (60 mg, 29.2%) as white foam, the trans isomer was not collected in the purification.

[0540] Example 41: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.27 (d, J=9.41 Hz, 1H), 8.02-8.08 (m, 2H), 7.51-7.61 (m, 2H), 7.32 (s, 1H), 4.63-4.69 (m, 2H), 3.94-4.02 (m, 1H), 3.71-3.77 (m, 2H), 3.60 (s, 3H), 2.65-2.74 (m, 1H), 2.41-2.48 (m, 2H), 1.94-2.09 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 431.1.

Example 42

Cis-3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0541] ##STR00138##

Step 1: Preparation of 8-chloro-2-(3-fluoro-4-methoxy-phenyl)chromen-4-one

[0542] ##STR00139##

[0543] Compound 42a was prepared in analogy to the procedure described for the preparation of compound 38c by using 3-fluoro-4-methoxy-benzoyl chloride as the starting material instead of 6-chloropyridine-3-carbonyl chloride chloride in Step 1.

Step 2: Preparation of 8-chloro-2-(3-fluoro-4-hydroxy-phenyl)chromen-4-one

[0544] ##STR00140##

[0545] To a solution of 8-chloro-2-(3-fluoro-4-methoxy-phenyl)chromen-4-one (850 mg, 2.7 mmol) in dichloromethane (20 mL) was added BBr.sub.3 (1.0 M in dichloromethane, 13 mL, 13 mmol) at room temperature and the mixture was then stirred at room temperature overnight. After the reaction was completed, the reaction was quenched by adding into saturated NaHCO.sub.3 solution (250 mL) slowly. The resulting suspension was filtered, the solid was collected and dried in vacuo to give the crude 8-chloro-2-(3-fluoro-4-hydroxy-phenyl)chromen-4-one (250 mg) as a yellow solid, which was used in the next step directly without further purification. (ESI.sup.+) [(M+H).sup.+]: 291.1.

Step 3: Preparation of cis-3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0546] ##STR00141##

[0547] To a mixture of 8-chloro-2-(3-fluoro-4-hydroxy-phenyl)chromen-4-one (180 mg, 619 μmol) and methyl 3-(2-(tosyloxy)ethoxy)cyclobutanecarboxylate (224 mg, 681 μmol,) in DMF (5 mL) was added K.sub.2CO.sub.3 (171 mg, 1.24 mmol) and the mixture was then stirred at 50° C. overnight. Then to the resulting mixture was added MeOH (5 mL), water (1 mL) and LiOH (44.5 mg, 1.86 mmol). After the addition, the mixture was stirred at room temperature for 4 hours. The mixture was then filtered and the filtrate was purified by preparative HPLC to give the cis configuration of 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid (15 mg, 5.6%) as a white foam, the trans isomer was not collected in the purification. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.90-8.04 (m, 3H), 7.34-7.55 (m, 3H), 7.14 (s, 1H), 4.23-4.32 (m, 2H), 3.90-4.02 (m, 1H), 3.64-3.75 (m, 2H), 2.55-2.65 (m, 1H), 2.39-2.47 (m, 2H), 1.92-2.06 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 433.1.

Example 43

Cis-3-[2-[2-chloro-4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0548] ##STR00142##

Step 1: Preparation of 8-chloro-2-(3-chloro-4-methoxy-phenyl)chromen-4-one

[0549] ##STR00143##

[0550] Compound 43a was prepared in analogy to the procedure described for the preparation of compound 38c by using 3-chloro-4-methoxy-benzoyl chloride as the starting material instead of 6-chloropyridine-3-carbonyl chloride chloride in Step 1.

Step 2: Preparation of cis-3-[2-[2-chloro-4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0551] ##STR00144##

[0552] Example 43 was prepared in analogy to the procedure described for the preparation of Example 42 by using 8-chloro-2-(3-chloro-4-methoxy-phenyl)chromen-4-one as the starting material instead of 8-chloro-2-(3-fluoro-4-methoxy-phenyl)chromen-4-one in Step 2.

[0553] Example 43: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.02-12.44 (m, 1H), 8.15-8.21 (m, 1H), 8.05-8.10 (m, 1H), 7.96-8.02 (m, 2H), 7.45-7.54 (m, 1H), 7.34-7.40 (m, 1H), 7.14-7.21 (m, 1H), 4.26-4.31 (m, 2H), 3.92-4.07 (m, 1H), 3.67-3.77 (m, 2H), 2.55-2.63 (m, 1H), 2.39-2.47 (m, 2H), 1.96-2.06 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 449.1.

Example 44

Cis-3-[2-[2-bromo-4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0554] ##STR00145##

Step 1: Preparation of 2-(3-bromo-4-hydroxy-phenyl)-8-chloro-chromen-4-one

[0555] ##STR00146##

[0556] Compound 44a was prepared in analogy to the procedure described for the preparation of compound 3c by using 3-bromo-4-methoxy-benzaldehyde as the starting material instead of 4-methoxybenzaldehyde in Step 1.

Step 2: Preparation of methyl 3-[2-[2-bromo-4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

[0557] ##STR00147##

[0558] To a solution of 2-(3-bromo-4-hydroxy-phenyl)-8-chloro-chromen-4-one (250 mg, 711 μmol), methyl 3-(2-(4-(tosyloxy)phenoxy)ethoxy)cyclobutanecarboxylate (299 mg, 711 μmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (98.3 mg, 711 μmol). The mixture was then stirred at 50° C. overnight. After the reaction was completed, to the reaction was added water (30 mL) and the resulting suspension was filtered. The solid was collected and dried in vacuo to give methyl 3-[2-[2-bromo-4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (200 mg, 55.4%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 507.1.

Step 3: Preparation of cis-3-[2-[2-bromo-4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0559] ##STR00148##

[0560] To a solution of methyl 3-[2-[2-bromo-4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (200 mg, 394 μmol) in the mixed solvent of MeOH (5 mL) and water (1 mL) was added LiOH (40.9 mg, 1.71 mmol). The mixture was then stirred at room temperature for 4 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by prepare HPLC to give cis configuration of 3-[2-[2-bromo-4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (90 mg, 32%) as a white foam, the trans isomer was not collected in the purification. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.0-12.4 (m, 1H), 8.1-8.2 (m, 1H), 8.05-8.12 (m, 1H), 7.98-8.04 (m, 2H), 7.46-7.56 (m, 1H), 7.35-7.41 (m, 1H), 7.15-7.22 (m, 1H), 4.28-4.33 (m, 2H), 3.91-4.08 (m, 1H), 3.66-3.78 (m, 2H), 2.54-2.65 (m, 1H), 2.38-2.46 (m, 2H), 1.91-2.05 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 493.1.

Example 45

Cis-3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-cyclopropyl-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0561] ##STR00149##

Step 1: Preparation of methyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-cyclopropyl-phenoxy]ethoxy]cyclobutanecarboxylate

[0562] ##STR00150##

[0563] A mixture methyl 3-[2-[2-bromo-4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (200 mg, 394 μmol), cyclopropylboronic acid (67.7 mg, 788 μmol), K.sub.3PO.sub.4 (251 mg, 1.18 mmol) and Bis(triphenylphosphine)palladium(II) chloride (55.3 mg, 78.8 μmol) in the mixed solvent of dioxane (5 mL) and water (2 mL) was heated at 100° C. under microwave radiation for 2 hours. After the reaction was completed, the mixture was diluted with water (15 mL) and the resulting mixture was extracted with EtOAc (20 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (elution with PE:EA 100:1-2:1) to give methyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-cyclopropyl-phenoxy]ethoxy]cyclobutanecarboxylate (150 mg, 81.2%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 469.1.

Step 2: Preparation of cis-3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-cyclopropyl-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0564] ##STR00151##

[0565] To a mixture of methyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-cyclopropyl-phenoxy]ethoxy]cyclobutanecarboxylate (150 mg, 320 μmol) in the mixed solvent of MeOH (5 mL) and water (1 mL) was added LiOH (24 mg, 1.0 mmol). The mixture was then stirred at room temperature for 4 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by prepare HPLC to give cis-3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-cyclopropyl-phenoxy]ethoxy]cyclobutanecarboxylic acid (11 mg, 11.6%) as a white foam, the trans-isomer was not collected in the purification. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.05-12.18 (m, 1H), 7.87-8.05 (m, 3H), 7.41-7.59 (m, 2H), 7.10-7.23 (m, 2H), 4.18-4.28 (m, 2H), 3.94-4.03 (m, 1H), 3.67-3.75 (m, 2H), 2.56-2.65 (m, 2H), 2.38-2.45 (m, 2H), 2.14-2.24 (m, 1H), 1.94-2.08 (m, 1H), 0.96-1.03 (m, 2H), 0.79-0.87 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 455.1.

Example 46

3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-cyano-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0566] ##STR00152##

Step 1: Preparation of methyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-cyano-phenoxy]ethoxy]cyclobutanecarboxylate

[0567] ##STR00153##

[0568] A mixture of methyl 3-[2-[2-bromo-4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (150 mg, 295 μmol) and copper (I) cyanide (106 mg, 1.18 mmol) in NMP (4 mL) was heated at 160° C. under microwave radiation for 1.5 hours. After the reaction was completed, the mixture was diluted with EtOAc (50 mL). The resulting suspension was filtered through silica pad and the filtrate was concentrate in vacuo to give the crude methyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-cyano-phenoxy]ethoxy]cyclobutanecarboxylate (134 mg, 100%) as a brown oil, which was used in next step directly without further purification.

Step 2: Preparation of 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-cyano-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0569] ##STR00154##

[0570] To a solution of methyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-cyano-phenoxy]ethoxy]cyclobutanecarboxylate (130 mg, 286 μmol) in the mixed solvent of MeOH (10 mL) and water (2 mL) was added LiOH (100 mg, 4.18 mmol). After the reaction was completed, the mixture was quenched with AcOH (0.3 g) and the resulting mixture was purified by preparative HPLC to give 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-cyano-phenoxy]ethoxy]cyclobutanecarboxylic acid (22 mg, 17.1%) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.47-8.38 (m, 1H), 8.35-8.27 (m, 1H), 7.99-7.90 (m, 2H), 7.50-7.38 (m, 2H), 7.19-7.12 (m, 1H), 4.36-4.24 (m, 2H), 3.98-3.86 (m, 1H), 3.68-3.61 (m, 2H), 2.48 (m, 2H), 2.16-2.03 (m, 1H), 1.98-1.87 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 440.1.

Example 47

3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0571] ##STR00155##

Step 1: Preparation of 8-chloro-2-(4-hydroxy-3-methyl-phenyl)chromen-4-one

[0572] ##STR00156##

[0573] Compound 47a was prepared in analogy to the procedure described for the preparation of compound 3c by using 4-methoxy-3-methyl-benzaldehyde as the starting material instead of 4-methoxybenzaldehyde in Step 1.

Step 2: Preparation of 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0574] ##STR00157##

[0575] Example 47 was prepared in analogy to the procedure described for the preparation of Example 15 by using 8-chloro-2-(4-hydroxy-3-methyl-phenyl)chromen-4-one as the starting material instead of 8-chloro-2-(4-hydroxyphenyl)chromen-4-one in Step 5.

[0576] Example 47: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.27-11.83 (m, 1H), 8.03-7.91 (m, 4H), 7.49 (t, J=7.8 Hz, 1H), 7.16 (d, J=8.6 Hz, 1H), 7.05 (s, 1H), 4.22-4.16 (m, 2H), 3.98 (t, J=7.0 Hz, 1H), 3.72-3.66 (m, 2H), 2.58 (d, J=8.1 Hz, 1H), 2.47-2.38 (m, 2H), 2.26 (s, 3H), 2.05-1.92 (m, 2H) MS obsd. (ESI.sup.+) [(M+H).sup.+]:429.2.

Example 48

3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-isopropyl-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0577] ##STR00158##

Step 1: Preparation of 8-chloro-2-(4-hydroxy-3-isopropyl-phenyl)chromen-4-one

[0578] ##STR00159##

[0579] Compound 48a was prepared in analogy to the procedure described for the preparation of compound 3c by using 3-isopropyl-4-methoxy-benzaldehyde as the starting material instead of 4-methoxybenzaldehyde in Step 1.

Step 2: Preparation of 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-2-isopropyl-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0580] ##STR00160##

[0581] Example 48 was prepared in analogy to the procedure described for the preparation of Example 15 by using 8-chloro-2-(4-hydroxy-3-isopropyl-phenyl)chromen-4-one as the starting material instead of 8-chloro-2-(4-hydroxyphenyl)chromen-4-one in Step 5.

[0582] Example 48: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.04-7.91 (m, 4H), 7.53-7.43 (m, 1H), 7.22-7.14 (m, 1H), 7.13-7.05 (m, 1H), 4.25-4.16 (m, 2H), 3.98-3.89 (m, 1H), 3.71-3.65 (m, 2H), 2.90-2.80 (m, 1H), 2.61-2.57 (m, 0.6 H), 2.44-2.33 (m, 2H), 2.16-2.07 (m, 0.4 H), 2.03-1.92 (m, 2H), 1.34-1.17 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:457.3.

Example 50

3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-3-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0583] ##STR00161##

Step 1: Preparation of 8-chloro-2-(2-fluoro-4-hydroxy-phenyl)chromen-4-one

[0584] ##STR00162##

[0585] Compound 49a was prepared in analogy to the procedure described for the preparation of compound 3c by using 2-fluoro-4-methoxy-benzaldehyde as the starting material instead of 4-methoxybenzaldehyde in Step 1.

Step 2: Preparation of methyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-3-fluoro-phenoxy]ethoxy]cyclobutanecarboxylate

[0586] ##STR00163##

[0587] Compound 49b was prepared in analogy to the procedure described for the preparation of compound 15f by using 8-chloro-2-(2-fluoro-4-hydroxy-phenyl)chromen-4-one as the starting material instead of 8-chloro-2-(4-hydroxyphenyl)chromen-4-one in Step 5.

Step 2: Preparation of 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-3-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0588] ##STR00164##

[0589] To a mixture of methyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-3-fluoro-phenoxy]ethoxy]cyclobutanecarboxylate (120 mg, crude, 60% purity) in DMF (3 mL) was added LiOH (48 mg, 2 mmol), MeOH (10 mL) and water (1 mL) and the mixture was then stirred at room temperature for 72 hours. The mixture was then filtered and the filtrate was concentrated in vacuo, the residue was purified by preparative HPLC to give 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-3-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid (20 mg, 10.3%) as a white solid.

[0590] Example 50: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.19 (s, 1H), 7.98 (d, J=7.5 Hz, 3H), 7.47 (s, 1H), 7.05 (s, 1H), 6.81 (s, 2H), 4.26-4.19 (m, 2H), 3.97 (s, 3H), 3.95-3.90 (m, 1H), 3.70-3.64 (m, 2H), 2.63-2.55 (m, 0.7 H), 2.47-2.40 (m, 2H), 2.22-2.13 (m, 0.3 H), 2.04-1.96 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:445.2.

Example 51

3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-3-ethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0591] ##STR00165##

Step 1: Preparation of (E)-1-(3-chloro-2-hydroxy-phenyl)-3-(2-ethoxy-4-methoxy-phenyl)prop-2-en-1-one

[0592] ##STR00166##

[0593] To a mixture of 2-fluoro-4-methoxybenzaldehyde (600 mg, 3.89 mmol) and 1-(3-chloro-2-hydroxyphenyl)ethanone (664 mg, 3.89 mmol) in EtOH (25 mL) was added KOH (436 mg, 7.79 mmol) and the mixture was then stirred at 60° C. overnight. The reaction was then adjusted to pH˜4.0 by addition of 2N HCl and the resulting suspension was filtered. The solid was collected and dried in vacuo to give the crude (E)-1-(3-chloro-2-hydroxy-phenyl)-3-(2-ethoxy-4-methoxy-phenyl)prop-2-en-1-one (51a) (600 mg, 50% purity) as a orange solid, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]:333.2.

Step 2: Preparation of 8-chloro-2-(2-ethoxy-4-hydroxy-phenyl)chromen-4-one

[0594] ##STR00167##

[0595] Compound 51b was prepared in analogy to the procedure described for the preparation of compound 3c by using (E)-1-(3-chloro-2-hydroxy-phenyl)-3-(2-ethoxy-4-methoxy-phenyl)prop-2-en-1-one as the starting material instead of (E)-1-(3-chloro-2-hydroxy-phenyl)-3-(4-methoxyphenyl)prop-2-en-1-one in Step 2.

Step 3: Preparation of 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-3-ethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0596] ##STR00168##

[0597] Example 51 was prepared in analogy to the procedure described for the preparation of Example 15 by using 8-chloro-2-(2-ethoxy-4-hydroxy-phenyl)chromen-4-one as the starting material instead of 8-chloro-2-(4-hydroxyphenyl)chromen-4-one in Step 5.

[0598] Example 51: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.98 (d, J=8.1 Hz, 3H), 7.51-7.43 (m, 1H), 7.10 (s, 1H), 6.84-6.77 (m, 2H), 4.28-4.15 (m, 4H), 3.99-3.90 (m, 1H), 3.70-3.63 (m, 2H), 2.63-2.53 (m, 2H), 2.45-2.40 (m, 0.5H), 2.22-2.11 (m, 0.5H), 2.05-1.94 (m, 2H), 1.43 (t, J=6.9 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:459.2.

Example 53

3-[2-[4-(3,8-dichloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0599] ##STR00169##

Step 1: Preparation of ethyl 3-[2-[4-(3,8-dichloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

[0600] ##STR00170##

[0601] To a solution of ethyl 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (120 mg, 271 μmol) and 2,6-dimethylpyridine (29 mg, 0.5 mL, 271 μmol) in dichloromethane (12 mL) was added 1-chloropyrrolidine-2,5-dione (109 mg, 813 μmol) and the mixture was then stirred at 50° C. for 48 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by column chromatography on silica gel to give ethyl 3-[2-[4-(3,8-dichloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (120 mg, 92.8%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]:477.2.

Step 2: Preparation of 3-[2-[4-(3,8-dichloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0602] ##STR00171##

[0603] To a solution of ethyl 3-[2-[4-(3,8-dichloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (120 mg, 251 umol) in the mixed solvent of THF (5 mL), MeOH (5 mL) and Water (1 mL) was added LiOH (36.1 mg, 1.51 mmol) and the mixture was then stirred at room temperature for 4 hours. After the reaction was completed, to the mixture was added AcOH (120 mg, 2 mmol) and the resulting mixture was concentrated in vacuo. The residue was then purified by preparative HPLC to give 3-[2-[4-(3,8-dichloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (26 mg, 21.9%) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm.sup.1 12.17-11.92 (br, 1H), 8.06 (dt, J=1.5, 8.2 Hz, 2H), 8.01-7.94 (m, 2H), 7.55 (t, J=7.9 Hz, 1H), 7.23-7.17 (m, 2H), 4.26-4.16 (m, 2H), 3.95 (q, J=7.5 Hz, 1H), 3.72-3.65 (m, 2H), 2.61-2.56 (m, 1H), 2.46-2.40 (m, 2H), 2.04-1.94 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:449.1.

Example 55

Cis-3-[2-[4-(8-chloro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0604] ##STR00172##

Step 1: Preparation of 3-[2-[4-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]phenoxy]ethoxy]cyclobutanecarboxylic acid

[0605] ##STR00173##

[0606] Compound 55a was prepared in analogy to the procedure described for the preparation of compound 19b by using 1-(3-chloro-2-hydroxy-phenyl)ethanone as the starting material instead of 1-(3-chloro-2,4-dihydroxy-phenyl)ethanone in Step 5.

Step 2: Preparation of cis-3-[2-[4-(8-chloro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0607] ##STR00174##

[0608] To a solution of 3-[2-[4-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]phenoxy]ethoxy]cyclobutanecarboxylic acid (50 mg, 120 μmol) in Acetone (4 mL) was added 4N NaOH solution (1.5 mL) and H.sub.2O.sub.2 (1.5 mL, 30%) at room temperature and the reaction was then stirred at room temperature for 2 hours. After the reaction was completed, the mixture was adjusted to pH˜2 by addition of 4N HCl solution. The solid was collected and further purified by recrystallization (EtOH, 5 mL) to give cis-3-[2-[4-(8-chloro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (25 mg, 47.4%) as a yellow solid, the trans isomer was not collected in the purification. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.09 (br. s., 1H), 9.76 (s, 1H), 8.24 (d, J=9.0 Hz, 2H), 8.07 (dd, J=1.5, 7.9 Hz, 1H), 7.98 (dd, J=1.5, 7.7 Hz, 1H), 7.46 (t, J=7.9 Hz, 1H), 7.18 (d, J=9.2 Hz, 2H), 4.21-4.14 (m, 2H), 3.95 (s, 1H), 3.71-3.64 (m, 2H), 2.63-2.54 (m, 1H), 2.47-2.40 (m, 2H), 2.04-1.95 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:431.5.

Example 56

Cis-3-[2-[4-(8-chloro-3-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0609] ##STR00175##

[0610] To a solution of cis-3-[2-[4-(8-chloro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (50 mg, 116 μmol) and Cs.sub.2CO.sub.3 (94.5 mg, 290 μmol) in DMF (3 mL) was added MeI (41.2 mg, 18.1 μL, 290 μmol) at room temperature and then the mixture was stirred at 40° C. for 1 hour. Then to the mixture was added LiOH solution (1N in water, 0.5 mL) and the mixture was stirred at room temperature for 30 minutes. After the reaction was completed, the mixture was adjusted to pH˜2 by addition of 2N HCl and the resulting mixture was concentrated in vacuo. The residue was purified by preparative HPLC to give cis-3-[2-[4-(8-chloro-3-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (40 mg, 77.5%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.17 (br. s., 1H), 8.15-8.10 (m, 2H), 8.02 (ddd, J=1.5, 7.8, 17.9 Hz, 2H), 7.49 (t, J=7.9 Hz, 1H), 7.24-7.17 (m, 2H), 4.21-4.16 (m, 2H), 4.00-3.91 (m, 1H), 3.84 (s, 3H), 3.71-3.65 (m, 2H), 2.63-2.55 (m, 1H), 2.48-2.39 (m, 2H), 2.06-1.94 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:445.2.

Example 57

3-[2-[4-(8-chloro-4-oxo-thiochromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0611] ##STR00176##

Step 1: Preparation of 8-chloro-2-(4-methoxyphenyl)thiochromen-4-one

[0612] ##STR00177##

[0613] A mixture of 2-chlorobenzenethiol (2.56 g, 2 mL, 17.7 mmol) and ethyl 3-(4-methoxyphenyl)-3-oxopropanoate (3.93 g, 3.39 mL, 17.7 mmol) in PPA (20 mL) was stirred at 120° C. overnight. The reaction was quenched by pouring into water (80 mL) and the resulting mixture was extracted with EtOAc (60 mL) three times. The combined organic layers were washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was then purified by column chromatography on silica gel (elution with PE:EtOAc=5:1) to give 8-chloro-2-(4-methoxyphenyl)thiochromen-4-one (500 mg, 9.1%) as a grey solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]:303.1.

Step 2: Preparation of 8-chloro-2-(4-hydroxyphenyl)thiochromen-4-one

[0614] ##STR00178##

[0615] Compound 57b was prepared in analogy to the procedure described for the preparation of compound 3c by using 8-chloro-2-(4-methoxyphenyl)thiochromen-4-one as the starting material instead of 8-chloro-2-(4-methoxyphenyl)chromen-4-one in Step 3.

Step 3: Preparation of 3-[2-[4-(8-chloro-4-oxo-thiochromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0616] ##STR00179##

[0617] Example 57 was prepared in analogy to the procedure described for the preparation of Example 15 by using 8-chloro-2-(4-hydroxyphenyl)thiochromen-4-one as the starting material instead of 8-chloro-2-(4-hydroxyphenyl)chromen-4-one in Step 5.

[0618] Example 57: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.19-12.07 (m, 1H), 8.35 (dd, J=1.3, 7.9 Hz, 1H), 8.00 (dd, J=1.2, 7.8 Hz, 1H), 7.87-7.79 (m, 2H), 7.68 (t, J=7.9 Hz, 1H), 7.28 (s, 1H), 7.17-7.11 (m, 2H), 4.21-4.15 (m, 2H), 4.07-3.90 (m, 1H), 3.67 (dd, J=3.9, 5.4 Hz, 2H), 2.64-2.53 (m, 1H), 2.48-2.36 (m, 2H), 2.22-1.94 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:431.2.

Example 58

2-[2-[4-(8-chloro-4-oxo-thiochromen-2-yl)phenoxy]ethoxy]acetic acid

[0619] ##STR00180##

Step 1: Preparation of 8-chloro-2-[4-(2-hydroxyethoxy)phenyl]thiochromen-4-one

[0620] ##STR00181##

[0621] To a solution of 8-chloro-2-(4-hydroxyphenyl)thiochromen-4-one (40 mg, 139 μmol,) and K.sub.2CO.sub.3 (38.3 mg, 277 μmol) in DMF (3 mL) was added 2-bromoethanol (26 mg, 14.8 μL, 208 μmol) at room temperature and the mixture was then stirred at 80° C. overnight. The mixture was then quenched with water (10 mL) and the resulting suspension was filtered. The solid was collected and dried in vacuo to give the crude 8-chloro-2-[4-(2-hydroxyethoxy)phenyl]thiochromen-4-one (40 mg, 85%) as a white solid, which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]:333.2.

Step 2: Preparation of 2-[2-[4-(8-chloro-4-oxo-thiochromen-2-yl)phenoxy]ethoxy]acetic acid

[0622] ##STR00182##

[0623] Example 58 was prepared in analogy to the procedure described for the preparation of Example 9 by using 8-chloro-2-[4-(2-hydroxyethoxy)phenyl]thiochromen-4-one as the starting material instead of 8-chloro-2-[4-(2-hydroxyethoxy)phenyl]chromen-4-one in Step 1.

[0624] Example 58: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.03-11.97 (m, 1H), 8.36 (d, J=7.8 Hz, 1H), 8.00 (d, J=7.8 Hz, 1H), 7.84 (d, J=8.8 Hz, 2H), 7.68 (t, J=7.9 Hz, 1H), 7.28 (s, 1H), 7.16 (d, J=8.8 Hz, 2H), 4.25-4.20 (m, 2H), 4.08 (s, 2H), 3.88-3.84 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:391.1.

Example 59

2-[2-[4-(8-chloro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid

[0625] ##STR00183##

Step 1: Preparation of 8-chloro-3-hydroxy-2-[4-(2-hydroxyethoxy)phenyl]chromen-4-one

[0626] ##STR00184##

[0627] To a solution of (E)-1-(3-chloro-2-hydroxy-phenyl)-3-[4-(2-hydroxyethoxy)phenyl]prop-2-en-1-one (500 mg, 1.57 mmol) and NaOH (3.92 ml, 15.7 mmol) in EtOH (5 ml) was added H.sub.2O.sub.2 (1.78 g, 1.6 mL, 15.7 mmol) dropwise at room temperature. After the addition, the mixture was stirred at room temperature for additional 2 hours. The mixture was then adjusted to pH ˜2 by addition of conc. HCl and the resulting suspension was then filtered. The solid was collected and dried in vacuo to give 8-chloro-3-hydroxy-2-[4-(2-hydroxyethoxy)phenyl]chromen-4-one (340 mg, 61.9%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]:333.1.

Step 2: Preparation of 8-chloro-2-[4-(2-hydroxyethoxy)phenyl]-3-(methoxymethoxy)chromen-4-one

[0628] ##STR00185##

[0629] To a solution of 8-chloro-3-hydroxy-2-[4-(2-hydroxyethoxy)phenyl]chromen-4-one (340 mg, 1.02 mmol) and K.sub.2CO.sub.3 (212 mg, 1.53 mmol) in DMF (8 mL) was added bromo(methoxy)methane (153 mg, 100 μL, 1.23 mmol) at room temperature and the mixture was then stirred at room temperature overnight. The reaction was then diluted with water (30 mL) and extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was then purified by column chromatography on silica gel to give 8-chloro-2-[4-(2-hydroxyethoxy)phenyl]-3-(methoxymethoxy)chromen-4-one (200 mg, 41.6%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]:377.1.

Step 3: Preparation of tert-butyl 2-[2-[4-[8-chloro-3-(methoxymethoxy)-4-oxo-chromen-2-yl]phenoxy]ethoxy]acetate

[0630] ##STR00186##

[0631] To a solution of 8-chloro-2-[4-(2-hydroxyethoxy)phenyl]-3-(methoxymethoxy)chromen-4-one (100 mg, 265 μmol) in DMSO (5 mL) was added NaH (31.8 mg, 796 μmol) at room temperature and the mixture was stirred at room temperature for 15 minutes. Then to the resulting mixture was added tert-butyl 2-bromoacetate (155 mg, 796 μmol) and the mixture was stirred at room temperature for 8 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and the mixture was extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude tert-butyl 2-[2-[4-[8-chloro-3-(methoxymethoxy)-4-oxo-chromen-2-yl]phenoxy]ethoxy]acetate (130 mg, 100%) as a solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]:491.2.

Step 4: Preparation of 2-[2-[4-(8-chloro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid

[0632] ##STR00187##

[0633] A mixture of tert-butyl 2-[2-[4-[8-chloro-3-(methoxymethoxy)-4-oxo-chromen-2-yl]phenoxy]ethoxy]acetate (130 mg, 265 μmol) in the mixed solvent of THF (3 mL) and conc. HCl (3 mL) was stirred at room temperature overnight. After the reaction was completed, the reaction mixture was concentrated in vacuo and the residue was purified by preparative HPLC to give 2-[2-[4-(8-chloro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid (40 mg, 36.6%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.55 (br. s., 1H), 9.76 (br. s., 1H), 8.24 (d, J=9.0 Hz, 2H), 8.07 (dd, J=1.5, 8.1 Hz, 1H), 7.98 (dd, J=1.5, 7.6 Hz, 1H), 7.46 (t, J=7.8 Hz, 1H), 7.19 (d, J=9.3 Hz, 2H), 4.27-4.18 (m, 2H), 4.11 (s, 2H), 3.92-3.81 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 391.1.

Example 60

3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-3-morpholino-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0634] ##STR00188##

Step 1: Preparation of 2-(2-bromo-4-hydroxy-phenyl)-8-chloro-chromen-4-one

[0635] ##STR00189##

[0636] Compound 60a was prepared in analogy to the procedure described for the preparation of intermediate 3c by using 2-bromo-4-methoxy-benzaldehyde as the starting material instead of 4-methoxybenzaldehyde in Step 1.

Step 2: Preparation of methyl 3-[2-[3-bromo-4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

[0637] ##STR00190##

[0638] Compound 60 b was prepared in analogy to the procedure described for the preparation of compound 15f by using 2-(2-bromo-4-hydroxy-phenyl)-8-chloro-chromen-4-one as the starting material instead of 8-chloro-2-(4-hydroxyphenyl)chromen-4-one in Step 5.

Step 3: Preparation of 3-[2-[4-(8-chloro-4-oxo-chromen-2-yl)-3-morpholino-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0639] ##STR00191##

[0640] To a mixture of methyl 3-(2-(3-bromo-4-(8-chloro-4-oxo-4H-chromen-2-yl)phenoxy)ethoxy)cyclobutanecarboxylate (100 mg, 197 μmol), morpholine (51.5 mg, 591 μmol), TEA (159 mg, 220 μl, 1.58 mmol), sodium tert-butoxide (75.7 mg, 788 μmol), 2′-bis(diphenylphosphino)-1,1′-binaphthalene (83 mg, 133 μmol) in dioxane (4 mL) was added Pd.sub.2(dba).sub.3 (80 mg, 87.4 μmol) and the mixture was then stirred at 110° C. for 2 hours. After the reaction was completed, the mixture was partitioned between EtOAc (15 mL) and water (15 mL), the organic layer was separated out. The aquatic phase was extracted with EtOAc (15 mL) twice. The organic layer was combined, washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 3-(2-(4-(8-chloro-4-oxo-4H-chromen-2-yl)-3-morpholinophenoxy)ethoxy)cyclobutanecarboxylic acid (9 mg, 9.14% yield) as a yellow foam.

[0641] Example 60: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.96-8.03 (m, 2H), 7.71-7.75 (m, 1H), 7.45-7.52 (m, 1H), 7.15 (s, 1H), 6.78-6.85 (m, 1H), 6.68-6.74 (m, 1H), 4.12-4.22 (m, 2H), 3.73-3.95 (m, 1H), 3.61-3.72 (m, 6H), 2.93-3.03 (m, 4H), 2.56-2.63 (m, 1H), 2.36-2.47 (m, 2H), 2.16 (m, 1H), 1.94-2.04 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:500.1.

Example 61

2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetamide

[0642] ##STR00192##

[0643] To a solution of 2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid (example 9, 400.0 mg, 1.07 mmol), triethylamine (0.6 mL, 4.27 mmol) in THF (20 mL) was added HATU (486.99 mg, 1.28 mmol), ammonium chloride (114.2 mg, 2.13 mmol). The mixture was stirred at room temperature for 12 hours. The mixture was then washed by water (15 mL) and concentrated in vacuo. The residue was then triturated in DMF (15 mL) and the suspension was then filtered to give 2-[2-[4-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetamide (75 mg, 16.8%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.10 (d, J=8.9 Hz, 2H), 8.00 (d, J=7.9 Hz, 2H), 7.49 (t, J=7.8 Hz, 1H), 7.27 (d, J=7.7 Hz, 1H), 7.19 (d, J=9.0 Hz, 2H), 7.07 (s, 1H), 4.21-4.32 (m, 2H), 3.90 (s, 2H), 3.81-3.86 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:374.1.

Example 62

Methyl 3-[2-[4-[8-chloro-6-fluoro-4-oxo-3-(trifluoromethoxy)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylate

[0644] ##STR00193##

Step 1: Preparation of methyl 3-[2-[4-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

[0645] ##STR00194##

[0646] Compound 62a was prepared in analogy to the procedure described for the preparation of compound 15f by using 1-(3-chloro-5-fluoro-2-hydroxy-phenyl)ethanone as the starting materials instead of 1-(3-chloro-4-fluoro-2-hydroxy-phenyl)ethanone in Step 3.

Step 2: Preparation of methyl 3-[2-[4-(3-bromo-8-chloro-6-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

[0647] ##STR00195##

[0648] To a mixture of methyl 3-[2-[4-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (0.6 g, 1.34 mmol) in DCM (10 mL) was added Py (1 mL) and PyHBr.sub.3 (2.15 g, 6.71 mmol) and the mixture was stirred at room temperature for 16 hours. The reaction was quenched with water (30 mL) and the resulting mixture was extracted with DCM (50 mL) twice. The combined organic phase was dried over MgSO.sub.4 and concentrated in vacuo to give the crude of methyl 3-[2-[4-(3-bromo-8-chloro-6-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (0.5 g, 70.8%) as a yellow solid, which was used in the next step directly. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 525.8.

Step 3: Preparation of 3-[2-[4-(8-chloro-6-fluoro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0649] ##STR00196##

[0650] To a solution of methyl 3-[2-[4-(3-bromo-8-chloro-6-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (500 mg, 0.95 mmol) in DMF (5 mL) was added NaOH solution (4N, 5 mL) and the mixture was then stirred at 80° C. for 2 hours. The mixture was poured into water (30 mL) and adjusted to pH=5-6 by addition of conc. HCl. The resulting mixture was extracted with EtOAc (50 mL) twice and the combined organic phase was dried over Na.sub.2SO.sub.4, concentrated in vacuo to give the crude of 3-[2-[4-(8-chloro-6-fluoro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (0.3 g, 68.5% yield) as a yellow solid, which was used in the next step directly. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 449.1.

Step 4: Preparation of methyl 3-[2-[4-(8-chloro-6-fluoro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

[0651] ##STR00197##

[0652] A solution of 3-[2-[4-(8-chloro-6-fluoro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (0.3 g, 0.65 mmol) dissolved in hydrogen chloride methanol solution (4 mol/L, 7.5 ml, 30 mmol) was stirred at room temperature for 12 hours. After the reaction was completed, the mixture was concentrated in vacuo to give methyl 3-[2-[4-(8-chloro-6-fluoro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (0.3 g, 100% yield) as a white solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 463.2.

Step 5: Preparation of methyl 3-[2-[4-[3-[bromo(difluoro)methoxy]-8-chloro-6-fluoro-4-oxo-chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylate

[0653] ##STR00198##

[0654] To a solution of methyl 3-[2-[4-(8-chloro-6-fluoro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (200 mg, 0.43 mmol) in NMP (5 mL) was added sodium hydride (34.57 mg, 0.860 mmol) at 0° C., the mixture was then stirred at 0° C. for 30 minutes. Then to the resulting mixture was added dibromo(difluoro)methane (0.075 mL, 0.86 mmol, 2 eq) and the mixture was stirred at room temperature for 36 hours. The mixture was quenched with saturated NH.sub.4Cl solution (5 mL) and extracted with EtOAc (10 mL) three times. The organic phase was combined, washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was re-dissolved in MeOH (2 mL) and the mixture was then filtered. The filtrate was concentrated in vacuo to give the crude of methyl 3-[2-[4-[3-[bromo(difluoro)methoxy]-8-chloro-6-fluoro-4-oxo-chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylate (20 mg, 8.01%) as yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 592.1.

Step 6: Preparation of methyl 3-[2-[4-[8-chloro-6-fluoro-4-oxo-3-(trifluoromethoxy)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylate

[0655] ##STR00199##

[0656] To a solution of methyl 3-[2-[4-[3-[bromo(difluoro)methoxy]-8-chloro-6-fluoro-4-oxo-chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylate (40.0 mg, 0.070 mmol, 1 eq) in DCM (2 mL) cooled at −70° C. was added argentio(tetrafluoro)boron (32.9 mg, 0.170 mmol, 2.5 eq) and the mixture was stirred at 15° C. for 12 hours. The mixture was filtered and the filtrate was concentrated in vacuo to give the crude of methyl 3-[2-[4-[8-chloro-6-fluoro-4-oxo-3-(trifluoromethoxy)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylate, which was further purified by Prep-HPLC to give two diastereomers with cis- and trans-configuration, one of which is characterized as Example 62-A (4.8 mg, 12.8%) and the other is Example 62-B (5.2 mg, 14.3%). as white solid.

[0657] Example 62-A: .sup.1H NMR (CDCl.sub.3, 400 MHz): δ ppm 8.15 (d, J=9.03 Hz, 2H), 7.31-7.40 (m, 2H), 7.06 (d, J=8.91 Hz, 2H), 4.32 (t, J=6.78 Hz, 1H), 4.19-4.26 (m, 2H), 3.74-3.83 (m, 2H), 3.71 (s, 3H), 3.01-3.13 (m, 1H), 2.54-2.57 (m, 2H), 2.30-2.34 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 531.1.

[0658] Example 62-B: .sup.1H NMR (CDCl.sub.3, 400 MHz): δ ppm 8.15 (d, J=9.03 Hz, 2H), 7.30-7.38 (m, 2H), 7.06 (d, J=8.93 Hz, 2H), 4.22 (t, J=4.65 Hz, 1H), 4.02 (m, 2H), 3.73-3.83 (m, 2H), 3.70 (s, 3 H), 2.60-2.75 (m, 1H), 2.55-2.65 (m, 2H), 2.24-2.36 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 531.1.

Example 63

3-[2-[4-[8-chloro-6-fluoro-4-oxo-3-(trifluoromethoxy)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid

[0659] ##STR00200##

[0660] To a mixture of methyl 3-[2-[4-[8-chloro-6-fluoro-4-oxo-3-(trifluoromethoxy)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylate (100 mg, 0.19 mmol) in the mixed solvent of THF (5 mL) and water (2 mL) was added lithium hydroxide (48 mg, 2 mmol) and the mixture was then stirred at room temperature for 12 hours. The mixture was adjusted to pH˜4 by addition of 1M HCl and extracted with EtOAc (10 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 3-[2-[4-[8-chloro-6-fluoro-4-oxo-3-(trifluoromethoxy)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid (17.3 mg, 17.7% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.07 (d, J=9.2 Hz, 2H), 7.90-7.93 (m, 1H), 7.77-7.79 (m, 1H), 7.19 (d, J=8.8 Hz, 2H), 4.20-4.32 (m, 2H), 3.90-4.15 (m, 1H), 3.67-3.69 (m, 2H), 2.80-2.99 (m, 1H), 2.40-2.50 (m, 2H), 2.11-2.23 (m, 1H), 1.95-2.04 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 517.1.

Example 64

3-[2-[4-(3-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0661] ##STR00201##

Step 1: Preparation of ethyl 3-[2-[4-(3-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

[0662] ##STR00202##

[0663] To a solution of ethyl 3-(2-(4-(8-chloro-4-oxo-4H-chromen-2-yl)phenoxy)ethoxy)cyclobutanecarboxylate (200 mg, 452 μmol) in DCM (5 mL) was added 1-bromopyrrolidine-2,5-dione (88.4 mg, 497 μmol), the mixture was then stirred at room temperature for 5 hours. The mixture was then concentrated in vacuo and purified by column chromatography on silica gel (elution with DCM:MeOH 100:1-10:1) to give ethyl 3-[2-[4-(3-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (30 mg, 12.7% yield) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 520.9.

Step 2: Preparation of 3-[2-[4-(3-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0664] ##STR00203##

[0665] To a solution of ethyl 3-(2-(4-(3-bromo-8-chloro-4-oxo-4H-chromen-2-yl)phenoxy)ethoxy)cyclobutanecarboxylate (30 mg, 57.5 μmol) in the mixed solvent of THF (1 mL) and H.sub.2O (0.5 mL) was added LiOH (6.88 mg, 287 μmol) and the mixture was then stirred at room temperature for 1 hour. After the reaction was completed, the mixture was adjusted to pH˜6 by addition of HCl (1 N) and concentrated in vacuo. The residue was purified by preparative HPLC to give 3-[2-[4-(3-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (3.6 mg, 12.6%) as a light yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.06 (m, 2H), 7.93 (d, J=9.05 Hz, 2H), 7.55 (s, 1H), 7.19 (d, J=9.05 Hz, 2H), 4.15-4.24 (m, 2H), 3.91-4.02 (m, 1H), 3.60-3.72 (m, 2H), 2.56-2.63 (m, 1H), 2.40-2.51 (m, 2H), 1.90-2.08 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 492.9.

Example 65

3-[2-[4-(3-benzyloxy-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0666] ##STR00204##

[0667] To a solution of 3-(2-(4-(8-chloro-3-hydroxy-4-oxo-4H-chromen-2-yl)phenoxy)ethoxy)cyclobutanecarboxylic acid (30 mg, 69.6 μmol) and Cs2CO3 (56.7 mg, 174 μmol) in DMF (3 mL) was added (bromomethyl)benzene (26.2 mg, 153 μmol) and the mixture was then stirred at room temperature overnight. Then to the reaction was added LiOH (24 mg, 1 mmol) and the mixture was stirred at 50° C. for 1 hour. The mixture was adjusted to pH˜6 by addition of HCl (1 N) and concentrated in vacuo. The residue was purified by preparative HPLC to give 3-[2-[4-(3-benzyloxy-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (18 mg, 45.7%) as a light yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.93-8.14 (m, 4H), 7.50 (s, 1H), 7.28-7.44 (m, 5H), 7.14 (d, J=9.05 Hz, 2H), 5.11 (s, 2H), 4.15-4.24 (m, 2H), 3.90-3.99 (m, 1H), 3.57-3.73 (m, 2H), 2.55-2.63 (m, 1H), 2.40-2.51 (m, 2H), 1.88-2.09 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 521.1.

Example 66

3-[2-[4-[8-chloro-4-oxo-6-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid

[0668] ##STR00205##

Step 1: Preparation of 6-bromo-8-chloro-2-(4-hydroxyphenyl)chromen-4-one

[0669] ##STR00206##

[0670] To a solution of 6-bromo-8-chloro-2-(4-methoxyphenyl)chromen-4-one (intermediate 22b, 5.0 g, 13.68 mmol) in chloroform (20 mL) cooled at 0° C. was added BBr.sub.3 (17.13 g, 68.3 mmol). The mixture was then stirred at room temperature for 16 hours. After the reaction was completed, the reaction mixture was quenched with water (50 mL) and the resulting suspension was filtered and the solid was washed by water (200 mL) and EtOH (100 mL) in sequence. The solid was concentrated in vacuo to give the crude product of 6-bromo-8-chloro-2-(4-hydroxyphenyl)chromen-4-one (4.3 g, 71.55% yield) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 351.6.

Step 2: Preparation of methyl 3-[2-[4-(6-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

[0671] ##STR00207##

[0672] To a solution of 6-bromo-8-chloro-2-(4-hydroxyphenyl)chromen-4-one (4.3 g, 13.56 mmol) and potassium carbonate (3.75 g, 27.12 mmol) in DMF (30 mL) was added methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (int-2. 4.45 g, 13.56 mmol) and the mixture was then stirred at 80° C. for 16 hours. The reaction mixture was filtered and the filtrate was concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluent DCM:MeOH=30:1˜10:1) to give the methyl 3-[2-[4-(6-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (4.5 g, 63.11% yield) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 507.8.

Step 3: Preparation of methyl 3-[2-[4-[8-chloro-4-oxo-6-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylate

[0673] ##STR00208##

[0674] To a solution of copper(I) iodide (0.13 mL, 3.94 mmol) and sodium trifluoroacetate (1.07 g, 7.88 mmol) in NMP (10 mL) was added methyl 3-[2-[4-(6-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (400 mg, 0.79 mmol) and the mixture was stirred at 160° C. under nitrogen atmosphere for 4 hours. After the reaction was completed, the mixture was filtered and the filtrate was purified by preparative HPLC to give the crude of methyl 3-[2-[4-[8-chloro-4-oxo-6-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylate (230 mg, 52.89% yield) as brown oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 496.8.

Step 4: Preparation of 3-[2-[4-[8-chloro-4-oxo-6-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid

[0675] ##STR00209##

[0676] To a solution of methyl 3-[2-[4-[8-chloro-4-oxo-6-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylate (230 mg, 0.46 mmol, 1 eq) in the mixed solvent of THF (3 mL), methanol (3 mL) and water (3 mL) was added lithium hydroxide (0.03 mL, 3.32 mmol) and the mixture was then stirred at room temperature for 2 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by preparative HPLC to give [2-[4-[8-chloro-4-oxo-6-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid (150 mg, 44.44% yield) as a yellow solid. The solid was further purified by supercritical fluid chromatography (SFC) to give two diastereomers with cis- and trans-configuration, one of which is characterized as Example 66-A (55.3 mg, 36.2%) and the other is Example 66-B (54.6 mg, 34.1%). as white solid.

[0677] Example 66-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.41 (m, 1H), 8.15 (m 1H), 8.04 (d, J=8.2 Hz, 2H), 7.18-7.07 (m, 3H), 4.24-4.15 (m, 3H), 3.65 (m, 2H), 2.82 (t, J=10.0 Hz, 1H), 2.43-2.31 (m, 2H), 2.14-2.05 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 482.9.

[0678] Example 66-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.39 (m, 1H), 8.13 (m, 1H), 8.02 (d, J=7.9 Hz, 2H), 7.17-7.07 (m, 3H), 4.16 (m, 2H), 3.96-3.84 (m, 1H), 3.65 (br s, 2H), 2.45-2.30 (m, 3H), 2.06-1.95 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 482.9.

Example 67

3-[2-[4-(8-chloro-6-cyclopropyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0679] ##STR00210##

Step 1: Preparation of methyl 3-[2-[4-(8-chloro-6-cyclopropyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

[0680] ##STR00211##

[0681] To a solution of methyl 3-[2-[4-(6-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (500 mg, 0.980 mmol), tricyclohexyl phosphine (27.61 mg, 0.100 mmol), cyclopropylboronic acid (110 mg, 1.28 mmol) and phosphoric acid, potassium salt (0.24 mL, 2.95 mmol) in the mixed solvent of toluene (10 mL) and water (1 mL) was added palladium (II) acetate (11.0 mg, 0.050 mmol). The mixture was then stirred at 100° C. for 12 hours under N.sub.2 atmosphere. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by column chromatography on silica gel (elution with PE:EtOAc 2:1) to give methyl 3-[2-[4-(8-chloro-6-cyclopropyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (300 mg, 58.47% yield) as a yellow oil.

Step 2: Preparation of 3-[2-[4-(8-chloro-6-cyclopropyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0682] ##STR00212##

[0683] To a solution of methyl 3-[2-[4-(8-chloro-6-cyclopropyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (400 mg, 0.85 mmol) in THF (5 mL)/methanol (5 mL)/water (1 mL) was added lithium hydroxide (0.04 mL, 4.27 mmol). The mixture was stirred at room temperature for 2 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by preparative HPLC to give 3-[2-[4-(8-chloro-6-cyclopropyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (119.5 mg, 30.74% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.19 (br s, 1H), 8.08-8.00 (m, 2H), 7.69 (s, 1H), 7.64 (s, 1H), 7.15 (d, J=8.5 Hz, 2H), 7.00 (d, J=1.4 Hz, 1H), 4.22-3.91 (m, 3H), 3.72-3.62 (m, 2H), 2.97-2.56 (m, 1H), 2.47-2.32 (m, 2H), 2.22-1.94 (m, 3H), 1.08-0.99 (m, 2H), 0.84-0.75 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 455.0.

Example 68

3-[2-[4-[8-chloro-4-oxo-6-(2-oxopyrrolidin-1-yl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid

[0684] ##STR00213##

Step 1: Preparation of methyl 3-[2-[4-[8-chloro-4-oxo-6-(2-oxopyrrolidin-1-yl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylate

[0685] ##STR00214##

[0686] To a mixture of methyl 3-[2-[4-(6-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (300 mg, 0.59 mmol), 2-pyrrolidone (0.8 mL, 10.58 mmol), cesium carbonate (192.5 mg, 0.59 mmol) in 1,4-dioxane (10 mL) was added tBuXPhos PD G3 (46.9 mg, 0.060 mmol) and the reaction was then stirred at 90° C. for 12 hours under N.sub.2 atmosphere. After the reaction was completed, the mixture was filtered and filtrate was concentrated in vacuo. The residue was purified by column chromatography on silica gel (elution with PE:EtOAc 10:1-2:1) to give methyl 3-[2-[4-[8-chloro-4-oxo-6-(2-oxopyrrolidin-1-yl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylate (130 mg, 17.19% yield) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 511.9.

Step 2: Preparation of 3-[2-[4-[8-chloro-4-oxo-6-(2-oxopyrrolidin-1-yl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid

[0687] ##STR00215##

[0688] To a solution of methyl 3-[2-[4-[8-chloro-4-oxo-6-(2-oxopyrrolidin-1-yl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylate (110 mg, 0.21 mmol) in the mixed solvent of THF (6 mL) and water (2 mL) was added lithium hydroxide (25.6 mg, 1.07 mmol) and the mixture was stirred at room temperature for 12 hours. After the reaction was completed, the mixture was adjusted to pH=6 by addition of AcOH and the resulting mixture was concentrated in vacuo, the residue was purified by preparative HPLC to give the 3-[2-[4-[8-chloro-4-oxo-6-(2-oxopyrrolidin-1-yl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid (27 mg, 0.050 mmol, 25.24% yield) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.2 (br s, 1H), 8.44 (s, 1H), 8.06-8.09 (m, 3H), 7.16-7.18 (m, 2H), 7.04 (s, 1H), 4.12-4.20 (m, 2H), 3.90-3.96 (m, 2H), 3.66-3.69 (m, 2H), 2.65-2.86 (m, 1H), 2.51-2.58 (m, 3H), 2.28-2.41 (m, 2H), 1.90-2.15 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 498.1.

Example 69

3-[2-[4-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid

[0689] ##STR00216##

Step 1: Preparation of 7-bromo-8-chloro-2-(4-hydroxyphenyl)chromen-4-one

[0690] ##STR00217##

[0691] Compound 69a was prepared in analogy to the procedure described for the preparation of compound 66a by using 7-bromo-8-chloro-2-(4-methoxyphenyl)chromen-4-one as the starting materials instead of 6-bromo-8-chloro-2-(4-methoxyphenyl)chromen-4-one in Step 1.

Step 2: Preparation of methyl 3-[2-[4-(7-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

[0692] ##STR00218##

[0693] Compound 69b was prepared in analogy to the procedure described for the preparation of compound 66b by using 7-bromo-8-chloro-2-(4-hydroxyphenyl)chromen-4-one as the starting materials instead of 6-bromo-8-chloro-2-(4-hydroxyphenyl)chromen-4-one in Step 2.

Step 3: Preparation of 3-[2-[4-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid

[0694] ##STR00219##

[0695] Example 69 was prepared in analogy to the procedure described for the preparation of example 66 by using methyl 3-[2-[4-(7-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate as the starting materials instead of methyl 3-[2-[4-(6-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate in Step 3.

[0696] Example 69: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.05-8.17 (m, 3H), 7.83-7.95 (m, 1H), 7.14-7.23 (m, 3H), 4.13-4.25 (m, 3H), 3.62-3.71 (m, 2H), 2.87-2.97 (m, 1H), 2.39 (m, 2H), 2.10-2.22 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 482.9.

Example 70

3-[2-[4-(8-chloro-7-cyclopropyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

[0697] ##STR00220##

[0698] Example 70 was prepared in analogy to the procedure described for the preparation of example 67 by using methyl 3-[2-[4-(7-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate as the starting materials instead of methyl 3-[2-[4-(6-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate in Step 1. The solid of 3-[2-[4-(8-chloro-7-cyclopropyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (130 mg, mmol) was further purified by supercritical fluid chromatography (SFC) to give two diastereomers with cis- and trans-configuration, one of which is characterized as Example 70-A (45 mg, 17.8%) and the other is Example 70-B (30 mg, 27.7%) as white solid.

[0699] Example 70: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.19 (br s, 1H), 8.09 (d, J=8.9 Hz, 2H), 7.90-7.83 (m, 1H), 7.18 (d, J=8.9 Hz, 2H), 7.08 (d, J=8.4 Hz, 1H), 7.02 (s, 1H), 4.14-4.22 (m, 2H), 3.87-4.11 (m, 1H), 3.64-3.71 (m, 2H), 2.86-2.96 (m, 1H), 2.56-2.67 (m, 1H), 2.37-2.43 (m, 2H), 2.12-2.20 (m, 1H), 1.95-2.05 (m, 1H), 1.24-1.14 (m, 2H), 0.95-0.86 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 455.1.

[0700] Example 70-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.18-8.02 (m, 2H), 7.77-7.95 (m, 1H), 7.17 (d, J=8.9 Hz, 2H), 7.08 (d, J=8.4 Hz, 1H), 7.01 (s, 1H), 4.12-4.24 (m, 3H), 3.63-3.72 (m, 2H), 2.88-2.92 (m, 1H), 2.35-2.43 (m, 3H), 2.11-2.21 (m, 2H), 1.15-1.22 (m, 2H), 0.87-0.93 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 455.1.

[0701] Example 70-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.10 (d, J=8.9 Hz, 2H), 7.87 (d, J=8.4 Hz, 1H), 7.18 (d, J=9.0 Hz, 2H), 7.09 (d, J=8.4 Hz, 1H), 7.02 (s, 1H), 4.13-4.23 (m, 2H), 3.89-4.03 (m, 1H), 3.63-3.73 (m, 2H), 2.55-2.62 (m, 1H), 2.36-2.44 (m, 3H), 1.90-2.05 (m, 2H), 1.13-1.24 (m, 2H), 0.87-0.95 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 455.1.

Example 71

ethyl 2-[2-[4-(7-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetate

[0702] ##STR00221##

Step 1: Preparation of ethyl 2-(2-hydroxyethoxy)acetate

[0703] ##STR00222##

[0704] To a solution of ethyl 2-(2-benzyloxyethoxy)acetate (2.0 g, 8.39 mmol) in ethanol (20 mL) was added palladium hydroxide (1.18 g, 8.39 mmol) and the mixture was then hydrogenated under H.sub.2 atmosphere at room temperature overnight. After the reaction was completed, the reaction was filtered through silica gel pad and the filtrate was concentrated in vacuo to give ethyl 2-(2-hydroxyethoxy)acetate (1.1 g, 7.42 mmol, 44.23% yield) as a colorless oil.

Step 2: Preparation of ethyl 2-[2-(p-tolylsulfonyloxy)ethoxy]acetate

[0705] ##STR00223##

[0706] To a solution of ethyl 2-(2-hydroxyethoxy)acetate (1.1 g, 7.42 mmol) in DCM (20 mL) at room temperature was added triethylamine (2.07 mL, 14.85 mmol), m-toluenesulfonyl chloride (1.7 g, 8.91 mmol) and the reaction mixture was stirred at room temperature for 12 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by column chromatography on silica gel (elution with PE:EtOAc=50:1-10:1) to give ethyl 2-[2-(p-tolylsulfonyloxy)ethoxy]acetate (0.400 g, 1.32 mmol) as a colorless oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 303.1.

Step 3: Preparation of ethyl 2-[2-[4-(7-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetate

[0707] ##STR00224##

[0708] To a mixture of 7-bromo-8-chloro-2-(4-hydroxyphenyl)chromen-4-one (3.0 g, 8.53 mmol) and ethyl 2-[2-(p-tolylsulfonyloxy)ethoxy]acetate (3.1 g, 10.24 mmol) in DMF (30 mL) was added potassium carbonate (1.77 g, 12.8 mmol) and the mixture was stirred at 80° C. for 16 hours. After the reaction was completed, the mixture was poured into water (50 mL) and extracted with EtOAc (100 mL) twice. The combined organic phase was washed with brine, dried over Na.sub.2SO4 and concentrated in vacuo. The residue was then triturated in EtOAc (15 mL) and the mixture was then filtered. The solid was collected and dried in vacuo to give ethyl 2-[2-[4-(7-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetate (3.5 g, 58.23% yield) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.08 (br d, J=9.05 Hz, 2H), 7.81-7.94 (m, 2H), 7.16 (br d, J=9.17 Hz, 2H), 7.08 (s, 1H), 4.17-4.29 (m, 4H), 4.06-4.15 (m, 2H), 3.82-3.92 (m, 2H), 1.21 (t, J=7.15 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 482.1.

Example 72

3-[2-[4-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]-2-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0709] ##STR00225##

Step 1: Preparation of 4-(methoxymethoxy)-3-methyl-benzaldehyde

[0710] ##STR00226##

[0711] To a solution of 4-hydroxy-3-methyl-benzaldehyde (3000.0 mg, 22.03 mmol) and chloromethyl methyl ether (2.01 mL, 26.44 mmol) in THF (40 mL) cooled at 0° C. was added and sodium hydride (634.59 mg, 26.44 mmol), the mixture was stirred at 0° C. for 30 minutes. After the reaction was completed, the mixture was quenched by water (30 mL) and the resulting mixture was extracted with EtOAc (20 mL) twice. The combined organic layer was dried over Na2SO4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (elution with PE:EtOAc 10:1-5:1) to give 4-(methoxymethoxy)-3-methyl-benzaldehyde as a yellow liquid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 181.1.

Step 2: Preparation of (E)-1-(4-bromo-3-chloro-2-hydroxy-phenyl)-3-[4-(methoxymethoxy)-3-methyl-phenyl]prop-2-en-1-one

[0712] ##STR00227##

[0713] A mixture of 1-(4-bromo-3-chloro-2-hydroxy-phenyl)ethanone (2870.0 mg, 11.5 mmol), potassium hydroxide (3227.3 mg, 57.52 mmol) and 4-(methoxymethoxy)-3-methyl-benzaldehyde (2487.51 mg, 13.8 mmol) in ethanol (120 mL) was stirred at 30° C. for 16 hours. After the reaction was completed, the mixture was adjusted to pH ˜4.0 with 1N HCl solution. The resulting suspension was then filtered and solid was washed by water (200 mL) and EtOH (100 mL) in sequence. The solid was concentrated in vacuo to give the crude product of (E)-1-(4-bromo-3-chloro-2-hydroxy-phenyl)-3-[4-(methoxymethoxy)-3-methyl-phenyl]prop-2-en-1-one (4.0 g, 43% yield) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 411.1.

Step 3: Preparation of 7-bromo-8-chloro-2-(4-hydroxy-3-methyl-phenyl)chromen-4-one

[0714] ##STR00228##

[0715] To a solution of (E)-1-(4-bromo-3-chloro-2-hydroxy-phenyl)-3-[4-(methoxymethoxy)-3-methyl-phenyl]prop-2-en-1-one (600.0 mg, 1.46 mmol) in DMSO (6 mL) was added iodine (36.99 mg, 0.150 mmol) and the mixture was stirred at 140° C. for 4 hours. After the reaction was completed, the mixture was poured into water (60 mL). The resulting suspension was then filtered and solid was washed by Na.sub.2SO.sub.3 solution (2 mol/L, 10 mL) and water (50 mL) in sequence. The solid was concentrated in vacuo to give the crude product of 7-bromo-8-chloro-2-(4-hydroxy-3-methyl-phenyl)chromen-4-one (430 mg, 44% yield,) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 365.0.

Step 4: Preparation of methyl 3-[2-[4-(7-bromo-8-chloro-4-oxo-chromen-2-yl)-2-methyl-phenoxy]ethoxy]cyclobutanecarboxylate

[0716] ##STR00229##

[0717] To a solution of 7-bromo-8-chloro-2-(4-hydroxy-3-methyl-phenyl)chromen-4-one (340.0 mg, 0.930 mmol, 1 eq), potassium carbonate (385.59 mg, 2.79 mmol, 3 eq) in DMF (10 mL) was added methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (335.92 mg, 1.02 mmol, 1.1 eq) and the mixture was stirred at 80° C. for 4 hours. After the reaction was complete, the mixture was diluted with water (50 mL) and the resulting mixture was extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give two diastereomers of the methyl 3-[2-[4-(7-bromo-8-chloro-4-oxo-chromen-2-yl)-2-methyl-phenoxy]ethoxy]cyclobutanecarboxylate with cis- and trans-configuration, one of which is appointed as 72d-A (82 mg, 14% yield, purity 100%) and the other is 72d-B (170 mg, 19% yield, purity 63.69%). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 520.9.

Step 5: Preparation of methyl 3-[2-[4-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]-2-methyl-phenoxy]ethoxy]cyclobutanecarboxylate

[0718] ##STR00230##

[0719] To a solution of methyl 3-[2-[4-(7-bromo-8-chloro-4-oxo-chromen-2-yl)-2-methyl-phenoxy]ethoxy]cyclobutanecarboxylate (72d-A, 82.0 mg, 0.160 mmol) in DMF (5 mL) was added iodocopper (59.86 mg, 0.310 mmol), methyl 2,2-difluoro-2-(fluorosulfonyl)acetate (150.95 mg, 0.790 mmol) and the mixture was then stirred at 120° C. for 6 hours. After the reaction was completed, the reaction was diluted with water (20 mL) and the resulting mixture was extracted with EtOAc (20 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude of methyl 3-[2-[4-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]-2-methyl-phenoxy]ethoxy]cyclobutanecarboxylate (62 mg, 48% yield, purity 33.91%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 511.1

Step 6: Preparation of 3-[2-[4-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]-2-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid

[0720] ##STR00231##

[0721] To a solution of methyl 3-[2-[4-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]-2-methyl-phenoxy]ethoxy]cyclobutanecarboxylate (62.0 mg, 0.120 mmol) in the mixed solvent of THF (1 mL) and water (0.5 mL) was added lithium hydroxide (4.36 mg, 0.180 mmol) and the mixture was stirred at room temperature for 2 hours. After the reaction was completed, the mixture was adjusted to pH˜5 by addition of HCl solution (2M). The resulting mixture was extracted with EtOAc (20 mL) three times. The combined organic layer was concentrated in vacuo and the residue was purified by preparative HPLC to give 3-[2-[4-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]-2-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid (9.5 mg, 14% yield). .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.18 (br s, 1H), 8.13 (d, J=8.31 Hz, 1H), 7.81-8.06 (m, 3H), 7.09-7.21 (m, 2H), 4.13-4.27 (m, 3H), 3.70 (br s, 2H), 2.87-3.00 (m, 1H), 2.40 (ddd, J=3.48, 6.82, 12.93 Hz, 2H), 2.26 (s, 3H), 2.09-2.19 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 497.0.

Example 73

Cis-3-[2-[2-chloro-4-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid

[0722] ##STR00232##

Step 1: Preparation of 2-benzyloxyethyl trifluoromethanesulfonate

[0723] ##STR00233##

[0724] To a solution of 2-benzyloxyethanol (2.0 g, 13.4 mmol) and 2,6-dimethylpyridine (2.8 g, 26.8 mmol) in dichloromethane (40 mL) was added trifluoromethanesulfonic anhydride (7.4 g, 26.8 mmol) at −30° C. and the mixture was then stirred at 0° C. for 1 hour. The mixture was then washed with 1 N HCl (20 mL) twice, water (20 mL) twice, brine (20 mL), dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude of 2-benzyloxyethyl trifluoromethanesulfonate (4.0 g, 100% yield), which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 307.3.

Step 2: Preparation of cis-tert-butyl 3-(2-benzyloxyethoxy)cyclobutanecarboxylate

[0725] ##STR00234##

[0726] To a solution of cis-tert-butyl 3-hydroxycyclobutanecarboxylate (CAS #: 939768-64-6, Cat. #: B253665, from BePharm Ltd, 2.26 g, 18 mmol) in THF (20 mL) was added NaH (315 mg, 7.9 mmol) portion wise at 0° C. and the mixture was then stirred at 0° C. for 30 minutes. Then to the resulting mixture was added the solution of 2-benzyloxyethyl trifluoromethanesulfonate (4.0 g, 13.4 mmol, crude) in THF (40 mL) dropwise at 0° C. After addition, the mixture was poured into ice-water (50 mL) and extracted with dichloromethane (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (elution with PE:EtOAc=100:1 to 3:1) to give cis-tert-butyl 3-(2-benzyloxyethoxy)cyclobutanecarboxylate (1.5 g, 37.3% yield) as a yellow oil. MS obsd. (ESI.sup.+) [(M+Na).sup.+]: 329.2.

Step 3: Preparation of cis-tert-butyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate

[0727] ##STR00235##

[0728] Compound 73c was prepared in analogy to the procedure described for the preparation of Int-1 by using cis-tert-butyl 3-(2-benzyloxyethoxy)cyclobutanecarboxylate as the starting materials instead of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate in Step 2.

Step 4: Preparation of cis-tert-butyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate

[0729] ##STR00236##

[0730] Compound 73d was prepared in analogy to the procedure described for the preparation of intermediate Int-2 by using cis-tert-butyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate as the starting materials instead of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate.

Step 5: Preparation of 8-chloro-2-(3-chloro-4-hydroxy-phenyl)-7-(trifluoromethyl)chromen-4-one

[0731] ##STR00237##

[0732] Compound 73e was prepared in analogy to the procedure described for the preparation of compound 72c by using 3-chloro-4-hydroxy-benzaldehyde as the starting materials instead of 4-hydroxy-3-methyl-benzaldehyde in the step 1.

Step 6: Preparation of cis-tert-butyl 3-[2-[4-(7-bromo-8-chloro-4-oxo-chromen-2-yl)-2-chloro-phenoxy]ethoxy]cyclobutanecarboxylate

[0733] ##STR00238##

[0734] Compound 73f was prepared in analogy to the procedure described for the preparation of compound 72d by using 8-chloro-2-(3-chloro-4-hydroxy-phenyl)-7-(trifluoromethyl)chromen-4-one and cis-tert-butyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate as the starting material instead of 7-bromo-8-chloro-2-(4-hydroxy-3-methyl-phenyl)chromen-4-one and methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate in the step 4.

Step 7: Preparation of cis-3-[2-[2-chloro-4-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid

[0735] ##STR00239##

[0736] Example 73 was prepared in analogy to the procedure described for the preparation of example 72 by using cis-tert-butyl 3-[2-[4-(7-bromo-8-chloro-4-oxo-chromen-2-yl)-2-chloro-phenoxy]ethoxy]cyclobutanecarboxylate as the starting materials instead of methyl 3-[2-[4-(7-bromo-8-chloro-4-oxo-chromen-2-yl)-2-methyl-phenoxy]ethoxy]cyclobutanecarboxylate in the step 5.

[0737] Example 73: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 9.03 (s, 1H), 8.63 (d, J=5.7 Hz, 1H), 7.98-8.06 (m, 2H), 7.51 (t, J=7.9 Hz, 1H), 7.34 (d, J=5.8 Hz, 1H), 7.16 (s, 1H), 4.36-4.40 (s, 2H), 3.92-3.97 (m, 1H), 3.72-3.76 (m, 2H), 2.38-2.40 (m, 3H), 1.96-1.98 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:517.1.

BIOLOGICAL EXAMPLES

Example 74: Engineered HepDES19 Primary Screen Assay

[0738] The assay was employed to screen for novel cccDNA inhibitors. HepDES19 is a cccDNA-producing cell line. In this cell line, HBeAg in the cell culture supernatant as surrogate marker, as HBeAg production depends on cccDNA level and activity. HepDES19 is an engineered cell line which contains a 1.1 unit length HBV genome, and pgRNA transcription from the transgene is controlled by Tetracycline (Tet). In the absence of Tet, pgRNA transcription will be induced, but HBV e antigen (HBeAg) could not be produced from this pgRNA due to very short leader sequence before the HBeAg start codon and the start codon is disrupted. Only after cccDNA is formed, the missing leader sequence and start codon mutation would be restored from the 3′-terminal redundancy of pgRNA, and then HBeAg could be synthesized. Therefore, HBeAg could be used as a surrogate marker for cccDNA (Zhou, T. et al., Antiviral Res. (2006), 72(2), 116-124; Guo, H. et al., J. Virol. (2007), 81(22), 12472-12484).

[0739] HepDES19 cells were seeded at 2×10.sup.6 cells per T150 flask and cultured with the culture medium (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 [DMEM-F12, Gibco Cat. 11320-82], 10% Fetal Bovine Serum [FBS, Clontech Cat. 631101], 0.1 mM Non-Essential Amino Acids Solution [NEAA, Gibco Cat. 11140-050], 50 μg/mL Penicillin-Streptomycin [PS, Invitrogen Cat. 15140-163], 500 μg/mL Geneticin [G418, Invitrogen Cat. 10131-027]) containing 3 μg/mL Tet (Sigma, Cat. 87128) for 5 days. Cells were then seeded at 4×10.sup.6 cells per T150 in the same culture medium as described above in the absence of Tet for 8 days. Cells were then harvested and frozen at density of 2×10.sup.6 cells per mL. For compound testing, the frozen cells were thawed and seeded into 96-well plates at a density of 6×10.sup.4 cells per well. At 24 hrs after seeding, half log serial dilutions of compounds made with Dimethyl sulfoxide (DMSO, Sigma, Cat. D2650) were further diluted with the same culture medium as described above before they were added to the cells to reach desired final compound concentrations and 1% DMSO concentration. Plates were then incubated at 37° C. for another 5 days before measurement of HBeAg level and cell viability. Intracellular HBeAg level were measured with enzyme-linked immunosorbent assay (ELISA) kit (Shanghai Kehua Diagnostic Medical Products Co., Ltd). Cell viability was assessed using Cell Counting Kit-8 (Donjindo, Cat. CK04-20). IC.sub.50 values were derived from the dose-response curve using 4 parameter logistic curve fit method.

[0740] The compounds of the present invention were tested for their capacity to inhibit extracellular HBeAg level as described herein. The compounds of this invention were found to have IC.sub.50 below 50 μM. Particular compounds of formula (I) were found to have IC.sub.50 below 5.0 μM. Results of HepDES19 primary screen assay are given in Table 1.

TABLE-US-00001 TABLE 1 Activity data in HepDES19 primary screen assay Example IC.sub.50 Example IC.sub.50 Example IC.sub.50 No. (μM) No. (μM) No. (μM) 1 0.14 25 1.05 56 29.55 1-A 0.14 27 7.68 57 0.09 1-B 0.14 28 2.80 58 0.52 2 2.48 29 0.21 59 20.21 3 0.15 30 0.13 60 4.84 4-A 0.53 31 0.78 61 0.144 4-B 5.23 33 0.31 62-A 1.013 5-A 1.36 34 16.02 62-B 1.325 5-B 11.16 35 13.89 63 1.81 6 1.95 37 8.97 64 5.5 7-A 15.43 38-A 5.29 65 6.5 7-B 19.66 38-B 0.76 66-B 13.184 8 1.34 39 9.01 67 14.132 9 2.46 40 1.61 68 10.099 10 0.79 41 12.76 69 10.739 11 0.57 42 0.61 70 17.2 12 1.07 43 0.25 70-A 19.8 13 0.69 44 0.57 70-B 2.144 14 20.41 45 13.20 71 9.304 15 10.33 46 16.01 72 14.4 19 22.15 47 0.04 73 15.4 20 0.70 48 7.68 F-1 >50 21 0.29 50 1.78 F-2 16.3 22 13.04 51 0.86 F-3 >50 23 21.08 53 22.0 24 1.14 55 0.12

Example 75: cccDNA Southern Blot Assay

[0741] HepDES19 cells were seeded at 4×10.sup.6 cells per T150 in the culture medium (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 [DMEM-F12, Gibco Cat. 11320-82], 10% Fetal Bovine Serum [FBS, Clontech Cat. 631101], 0.1 mM Non-Essential Amino Acids Solution [NEAA, Gibco Cat. 11140-050], 50 μg/mL Penicillin-Streptomycin [PS, Invitrogen Cat. 15140-163], 500 μg/mL Geneticin [G418, Invitrogen Cat. 10131-027]) in the absence of Tet for 8 days. These cells were seeded at the density of 1×10.sup.6 cells per well in 6-well plate. At 24 hrs after seeding, serial dilutions of compounds made with DMSO (Sigma, Cat. D2650) were further diluted with the same culture medium as described above before they were added to the cells to reach desired final compound concentrations and 1% DMSO concentration. After 5 days' compound treatment, the cells growing in one well from 6-well plate were re-suspended with 500 μL re-suspension buffer (50 mM tris[hydroxymethyl]amino methane pH 7.5), 10 mM ethylenediaminetetraacetic acid (EDTA), 50 μg/mL RNase A [Qiagen, Cat. 158922]. 500 μL of 1.2% sodium dodecyl sulfate (SDS) was then added into the re-suspended cells to lyse the cells. After 15 minutes' incubation, 700 μL precipitation buffer (3M cesium chloride, 1M potassium acetate, 0.67M acetic acid) was added and the lysate was incubated at 4° C. for 2 h. The lysate was centrifuged at 15000 revolutions per minute (RPM) at 4° C. for 15 minutes. The supernatant was collected and loaded onto Qiagen miniprep columns (QIAprep spin Mini prep kit, Cat. No. 27016). After centrifugation for 1 minute at 15000 RPM, the column was washed once with 750 μL wash buffer PE (QIAprep spin Mini prep kit, Cat. No. 27016). 80 μL of double distilled water was loaded to the columns to elute Hirt DNA.

[0742] Hirt DNA of each sample was loaded into 1.2% 1× tris-acetate electrophoresis (TAE) agarose gel and separated at 90 voltages for 3 hours. The gel was then treated in 50 mM NaAc—HAc, pH4.2 for 30 min at room temperature (RT), and then denatured by soaking in denaturation buffer (0.5 M sodium hydroxide, 1.5 M sodium chloride) at RT for 30-45 min. The gel was then treated with neutralization buffer (1M tris[hydroxymethyl]aminomethane pH7.4 and 1.5M NaCl) at RT for 30˜45 min.

[0743] The gel was transferred onto a pre-wet Nylon membrane (GE life science, Hybond N+) by capillary transfer method overnight, followed by UV crosslinking. The membrane was transferred into a hybridization tube, then rinsed with double distilled water at 60° C. for 5 min. 10 mL of hybridization buffer (Lab kits, China) was added, the resulting sample was rotated in hybridization oven at 60° C. for 1 hour. Digoxigenin (DIG)-labelled HBV probe was denatured at 95° C. for 10 minutes, and then 7 μL of denatured probe was added to the hybridization tube, which was rotated in hybridization oven at 60° C. overnight.

[0744] On the second day, the membrane was washed according to the procedure of DIG wash and block buffer set kit (Roche, Cat. 11 585 762 001), and then incubated with 50 mL antibody solution (Antibody anti-Digoxigenin-AP Fab fragment [Roche Cat. 11093274910] diluted in fresh 1×blocking buffer at 1:10,000) for 1 hour. The membrane was washed with 50 mL washing buffer (1×Maleic buffer with 0.3% Tween-20) for 15 minutes twice, and equilibrated with 20 mL detection buffer (0.1M tris[hydroxymethyl]aminomethane pH9.5, 0.1M sodium chloride) for 5 minutes. CDP-Star substrate (Roche, Cat. 12041677001) was added to the membrane for 5 minutes, and then the membrane was scanned by Bio-Rad Visualize Image System (Biorad, ChemiDoc-MP, Serial No. 731BR00916).

[0745] Results of cccDNA Southern Blot assay are given in FIG. 1. The results indicate that the compounds of this invention dose-dependently reduced cccDNA level in HepDES19 cells.

Example 76: Cryopreserved Primary Human Hepatocytes (PHH) Assay

[0746] This assay is used to confirm the anti-HBV effect of the compounds in HBV PHH infection assay. Cryopreserved PHH (BioreclamationIVT, Lot YJM) was thawed at 37° C. and gently transferred into pre-warmed InVitroGRO HT medium (BioreclamationIVT, Cat. S03317). The mixture was centrifuged at 70 relative centrifugal force (RCF) for 3 minutes at RT, and the supernatant was discarded. Pre-warmed InVitroGRO CP medium (BioreclamationIVT, Cat #S03316) was added to the cell pellet to gently re-suspend cells. The cells were seeded at the density of 5.8×10.sup.4 cells per well to collagen I coated 96-well plate (Gibco, Cat. A1142803) with the InVitroGRO CP medium. All plates were incubated at 37° C. with 5% CO.sub.2 and 85% humidity.

[0747] At 20 hours after plating, the medium was changed to PHH culture medium (Dulbecco's Modified Eagle Medium (DMEM)/F12 (1:1) (Gibco, Cat. 11320-033), 10% fetal bovine serum (Gibco Cat. 10099141), 100 U/mL penicillin, 100 μg/mL streptomycin (Gibco, Cat. 151401-122), 5 ng/mL human epidermal growth factor (Invitrogen Cat. PHG0311L), 20 ng/mL dexamethasone (Sigma, Cat. D4902) and 250 ng/mL human recombinant insulin (Gibco, Cat. 12585-014)). And the cells were incubated at 37° C. with 5% CO.sub.2 and 85% humidity for 4 hours. The medium was then changed to pre-warmed PHH culture medium containing 4% polyethylene glycol (PEG) MW8000 (Sigma, Cat. P1458-50ML) and 1% DMSO (Sigma, Cat. D2650). 5.8×10.sup.6 genomic equivalents of HBV were added into the medium.

[0748] At 24 hours post-infection, the cells were gently washed with PBS and refreshed with PHH culture medium supplemented with 1% DMSO, and 0.25 mg/mL Matrix gel (Corning, Cat. 356237) at 200 μL per well. All plates were immediately placed in at 37° C. CO.sub.2 incubator.

[0749] 24 hours later, serial dilutions of compounds made with DMSO were further diluted with the same culture medium (PHH culture medium supplemented with 1% DMSO and 0.25 mg/mL Matrix gel as described above) before they were added to the cells to reach desired final compound concentrations and 1% DMSO concentration. The medium containing the compounds were refreshed every three days.

[0750] At 9 days post-compound treatment, extracellular HBsAg level were measured with Chemiluminescence Immuno Assay (CLIA) kit (Autobio, HBsAg Quantitative CLIA). Extracellular HBV DNA was extracted by MagNA Pure 96 system (Roche) and then determined by quantitative PCR with the following primers and probe:

TABLE-US-00002 HBV-Forward Primer (SEQ ID NO: 1): AAGAAAAACCCCGCCTGTAA (5′ to 3′); HBV-Reverse Primer (SEQ ID NO: 2): CCTGTTCTGACTACTGCCTCTCC (5′ to 3′); HBV-Probe: 5′ + tetramethylrhodamine + SEQ ID NO: 3 + black hole quencher 2-3′, wherein SEQ ID NO: 3 is CCTGATGTGATGTTCTCCATGTTCAGC.

[0751] HBsAg IC.sub.50 and HBV DNA IC.sub.50 values were derived from the dose-response curve using 4 parameter logistic curve fit method. The compounds of formula (I) have HBsAg IC.sub.50<20 μM, particularly <1 μM; and HBV DNA IC.sub.50<50 μM. Test results of the compounds of this invention as well as the reference compounds in Cryopreserved PHH assay are given in Table 2 and Table 3.

TABLE-US-00003 TABLE 2 HBsAg IC.sub.50 data in Cryopreserved PHH assay Example HBsAg IC.sub.50 Example HBsAg IC.sub.50 Example HBsAg IC.sub.50 No. (μM) No. (μM) No. (μM) F-1 61.7 15 0.28 45 0.53 F-2 46.5 19 1.51 46 0.13 F-3 >100 21 5.10 47 0.24 1 0.13 23 7.11 50 10.24 1-A 0.72 23-B 6.89 51 0.94 1-B 0.08 24 4.83 53 4.01 2 0.19 25 0.93 55 9.50 3 12.53 28 1.92 57 0.14 4-A 6.34 29 0.90 58 0.57 4-B 0.51 30 7.29 62-A 4.22 5-B 1.78 33 0.68 63 5.36 6 0.86 38-A 0.46 66-B 4.78 8 0.12 38-B 0.88 67 2.77 10 2.72 39 5.74 69 2.01 11 12.47 40 7.12 70-B 4.79 12 0.21 42 0.58 72 7.41 13 1.27 43 0.22 73 6.77 14 19.25 44 0.04

TABLE-US-00004 TABLE 3 HBV DNA IC.sub.50 in Cryopreserved PHH assay Example No. IC.sub.50 (μM) Example 3 35.7