USE OF (BENZENESULFONAMIDO) BENZAMIDE COMPOUNDS FOR INHIBITING LIVER FIBROSIS

Abstract

The invention belongs to the technical field of medicines. In particular, the invention relates to use of (benzenesulfonamido) benzamide compounds for inhibiting liver fibrosis, or preventing and/or treating a liver injury, or improving a liver function, or preventing and/or treating a liver disease associated with liver fibrosis, for modulating (e.g. reducing) the content of collagen (e.g. type I collagen) in liver tissue, for modulating (e.g. inhibiting) the activity of COL1A1 promoter in a cell, and for modulating (e.g. inhibiting) expression level of a gene associated with liver fibrosis in a cell.

Claims

1-15. (canceled)

16. A method for inhibiting liver fibrosis, or preventing and/or treating a liver injury, or improving a liver function, or preventing and/or treating a liver disease associated with liver fibrosis in a subject, or for reducing the content of collagen in liver tissue of a subject, comprising administering an effective amount of a compound of Formula (I) to a subject in need thereof; ##STR00062## wherein R.sub.1 is selected from the group consisting of O(C.sub.1-C.sub.4alkyl), halogen, NHCO(C.sub.1-C.sub.4alkyl), CONH(C.sub.1-C.sub.4alkyl), O-(halo-C.sub.1-C.sub.4alkyl) and NO.sub.2; Z is COO(C.sub.1-C.sub.4alkyl) or ##STR00063## wherein R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H, O(C.sub.1-C.sub.4alkyl), halogen, halo-C.sub.1-C.sub.4alkyl, O-(halo-C.sub.1-C.sub.4alkyl), C.sub.1-C.sub.4alkyl and OH

17. (canceled)

18. A method for inhibiting the activity of COL1A1 promoter in a cell, or for inhibiting expression level of a gene associated with liver fibrosis in a cell, comprising administering an effective amount of a compound of Formula (I) to a cell in need thereof. ##STR00064## wherein R.sub.1 is selected from the group consisting of O(C.sub.1-C.sub.4alkyl), halogen, NHCO(C.sub.1-C.sub.4alkyl), CONH(C.sub.1-C.sub.4alkyl), O-(halo-C.sub.1-C.sub.4alkyl) and NO.sub.2; Z is COO(C.sub.1-C.sub.4alkyl) or ##STR00065## wherein R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H, O(C.sub.1-C.sub.4alkyl), halogen, halo-C.sub.1-C.sub.4alkyl, O-(halo-C.sub.1-C.sub.4alkyl), C.sub.1-C.sub.4alkyl and OH

19. (canceled)

20. The method according to claim 16, wherein R.sub.2, R.sub.3 and R.sub.4 are not H simultaneously.

21. The method according to claim 16, wherein R.sub.1 is at the meta- or para-position of SO.sub.2.

22. The method according to claim 16, wherein in Ring A, R.sub.1 is selected from the group consisting of OCH.sub.3, OCH.sub.2CH.sub.3, halogen, NHCOCH.sub.3, NHCOCH.sub.2CH.sub.3, CONHCH.sub.3, CONHCH.sub.2CH.sub.3, OCF.sub.3 and NO.sub.2.

23. The method according to claim 16, wherein in Ring B, Z is at the ortho- or meta-position of NH.

24. The method according to claim 16, wherein Z is ##STR00066## R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H, OCH.sub.3, OCH.sub.2CH.sub.3, halogen, halo-C.sub.1-C.sub.2alkyl, O-(halo-C.sub.1-C.sub.2alkyl), CH.sub.3, CH.sub.2CH.sub.3 and OH.

25. The method according to claim 16, wherein the compound has the structure of Formula (II): ##STR00067## wherein R.sub.1 is at the meta- or para-position of SO.sub.2; R.sub.1 is OCH.sub.3, F, NHCOCH.sub.3, OCF.sub.3 or NO.sub.2; R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H, F, Cl and OCF.sub.2H, and, R.sub.2, R.sub.3 and R.sub.4 are not H simultaneously.

26. The method according to claim 16, wherein Z is COOCH.sub.3.

27. The method according to claim 16, wherein the compound is selected from: ##STR00068## ##STR00069## ##STR00070## ##STR00071## ##STR00072##

28. The method according to claim 16, wherein the liver fibrosis is caused by a liver injury.

29. The method according to claim 16, wherein the liver injury is an acute liver injury or a chronic liver injury.

30. The method according to claim 16, wherein the liver injury is selected from the group consisting of a violence-caused liver injury, a drug-induced liver injury, a toxic liver injury and a pathological liver injury.

31. The method according to claim 30, wherein the violence-caused liver injury is an open liver injury or a closed liver injury.

32. The method according to claim 30, wherein the pathological liver injury is a liver injury caused by viral hepatitis, liver cancer or an autoimmune disease.

33. The method according to claim 16, wherein the liver disease associated with liver fibrosis is selected from the group consisting of: viral hepatitis, fatty liver, an autoimmune liver disease, drug-induced liver disease, toxic hepatopathy and liver cancer.

34. The method according to claim 33, wherein the viral hepatitis is Hepatitis A, Hepatitis B, Hepatitis C, Hepatitis D or Hepatitis E.

35. The method according to claim 16, wherein the collagen is type I collagen.

36. The method according to claim 16, wherein the subject is a mammal.

37. The method according to claim 16, wherein the subject is a human.

Description

DESCRIPTION OF THE DRAWINGS

[0372] FIG. 1 shows the results on luciferase activity after (benzenesulfonamido) benzamide compounds were applied to LX2COL cells in Example 1. The results showed that (benzenesulfonamido) benzamide compounds inhibited COL1A1 promoter to different extents.

[0373] FIG. 2 shows the results on luciferase activity after the compounds 16-4, 16-5 and 17-15 were applied to LX2COL cells in Example 2. In the figure, **represents p<0.01 compared to control group (administration concentration is 0). The results showed that the compounds 16-4, 16-5 and 17-15 inhibited COL1A1 promoter in a dose-dependent manner.

[0374] FIG. 3 shows the results on the expression level of mRNA of COL1A1, TGF-1, and MMP2 determined by real-time PCR assay, after the compounds 16-4, 16-5 and 17-15 were applied to TGF-1-induced LX2 cells in Example 3. The results showed that the compounds 16-4, 16-5 and 17-15 could significantly inhibit the expression level of mRNA of COL1A1, TGF-1 and MMP2.

[0375] FIG. 4 shows the results on the expression level of COL1A1, TGF-1, MMP2 and -SMA protein determined by Western blot assay, after the compounds 16-4, 16-5 and 17-15 were applied to TGF-1-induced LX2 cells in Example 3. The results showed that the compounds 16-4, 16-5, and 17-15 could significantly inhibit the expression level of COL1A1, TGF-1, MMP2 and -SMA protein.

[0376] FIG. 5 shows changes in body weight of mice in 16-4 administration group (FIG. 5A) and 17-15 administration group (FIG. 5B) in Example 4, wherein, relative body weight=body weight at Day 14body weight at Day 1. The results showed that 14 days after administration, no significant decrease in body weight occurred in these groups of mice, and no signs of intoxication were observed and no death occurred, indicating a relatively high drug safety.

[0377] FIG. 6 shows the HE staining results of the liver tissue slices of rats in control group (FIG. 6A), ANIT-induced group (FIG. 6B), 16-4 administration group (FIG. 6C) and 16-5 administration group (FIG. 6D) in Example 5. The results showed that compared to ANIT-induced group, 16-4 administration group and 16-5 administration group had the liver injury improved.

[0378] FIG. 7 shows the HE staining results of the liver tissue slices of rats in sham operation group (FIG. 7A), BDL model group (FIG. 7B) and 16-4 administration group (FIG. 7C), and the statistical chart on the double-blind scores of the HE staining of the animal tissues of each group (FIG. 7D) in Example 8. * represents p<0.05 compared to sham operation group; ** represents p<0.01 compared to sham operation group; # represents p<0.05 compared to BDL model group; ## represents p<0.01 compared to BDL model group. As shown in the figure, in the liver tissues of rats in sham operation group, the hepatocytes were arranged regularly, and the hepatic lobules were intact, without inflammatory cell infiltration and bile duct proliferation; the liver tissues of rats in BDL group had the pathological structure changed greatly, with significant bile duct proliferation and increased tissue necrosis; the rats in 16-4 administration group had the structure of liver tissues improved significantly, with significantly inhibited bile duct proliferation and significantly reduced tissue necrosis. The results showed that the compound 16-4 could significantly improve the pathological structure of the liver tissues in BDL rats.

[0379] FIG. 8 shows the Masson staining results of the liver tissue slices of rats in sham operation group (FIG. 8A), BDL model group (FIG. 8B) and 16-4 administration group (FIG. 8C), and the statistical chart on the double-blind scores of the Masson staining of the animal tissues of each group (FIG. 8D) in Example 9. ** represents p<0.01 compared to sham operation group; ## represents p<0.01 compared to BDL model group. As shown in the figure, the fibrosis increased significantly in the liver tissues of the BDL rats, and the administration of the compound 16-4, the fibrosis could be significantly inhibited in the liver tissues. The results showed that the compound 16-4 could significantly inhibit the production of myofibrils and inhibit liver fibrosis in BDL rats.

[0380] FIG. 9 shows the content of hydroxyproline in liver tissues of rats in sham operation group, BDL model group and 16-4 administration group in Example 9. ** represents p<0.01 compared to sham operation group; # represents p<0.05 compared to BDL model group. The results showed that compared to sham operation group, the content of hydroxyproline increased significantly in the liver tissues of BDL model rats; the compound 16-4 could significantly reduce the content of hydroxyproline in rat liver tissues. The results showed that the compound 16-4 could significantly inhibit the production of collagen fibrils and inhibit the occurrence of liver fibrosis.

[0381] FIG. 10 shows the expression levels of genes associated with liver fibrosis in rat liver tissues determined by real-time PCR method in Example 10. ** represents p<0.01 compared to sham operation group; # represents p<0.05 compared to BDL model group, ## represents p<0.01 compared to BDL model group. The results showed that compared to sham operation group, the expression levels of genes associated with liver fibrosis (COL1A1, TGF-1, MMP2, -SMA (ACTA2), TIMP1, TIMP2 and SPP1) increased significantly in the liver tissues of rats in BDL model group; the compound 16-4 significantly decreased the expression levels of genes associated with liver fibrosis.

[0382] FIG. 11 shows the results on the expression levels of the proteins associated with liver fibrosis in rat liver tissues determined by Western blot in Example 10. The results showed that the compound 16-4 could significantly inhibit the expression of COL1A1, TGF-1, MMP2 and -SMA.

[0383] INFORMATION ON THE SEQUENCE INVOLVED IN THE INVENTION IS AS FOLLOWS

TABLE-US-00002 SEQ ID NO: Description 1 COL1A1 promoter

[0384] Sequence Information

TABLE-US-00003 SEQ ID NO: 1: 2436 bp gtgggaaagcctggatgggaaacatatggggaggggcggggagctgcagg caggagcccttcttactacgaaaacccaagaagcaaggaagtggacaggt cactaaccctcatactaccaagccctgcggcaccctgccctagaccacca ctctaaatgtctgttccctccaaaaacaggacccctgtcgcctattaggg aggggttctcttggaactgacccacagtagggggcaggactttggtgggt tcaagaactgccatctcagcacctcagccccctagtcctgccctgcagtc gctggcactaggcgggggcagaccctgggccacaagttgctgccacatgg tcgggataattgatgaaggtccatccctccattgctgtctccagccctgc ctctctggaaactctatattttccctttaattatagcccctgcagtctcc ctctgctgccccacccgcaccgctcatcctggctgcccacggccagccgg ccagccgacgtggctccctccccttctgttccttttttttcccctttgcc ttcgttgcacaaaaccagctgggggagggcgtggagaggggcggggggag gcaatggaatcttggatggtttgggggaggcgggactccccgcttccacg tttgcagctctggagcacccggggtggggagctgcacaggagggagagaa atgaacagggcactgcaaggagacccccaggccttctctcagccctacag agtttctcaggacgaggtagattggggttgaggcagagccttgttggggg aatgggacatggaggaagaaaggacgtggagttctagagccatcttcctt agatatagcctgctgtccttcgggtccccagaccctttcagagtgtacag atgattctctctggttcctaaggcatagagcaatgaccgggattttcaag aaagagatgaggcagtgggaagtagcccctaaaacaaagtcaatcatcct ctgcagcccatcccacacccccaaaggaaagtttcacccagacacccaaa atatcccatacatccccaacactgagtccaggtacaactggagaaggggc tttatgcagctcccagaaagacacccctttagctaagtgccctccctcca cccaggttctctctggtttgactgtgctgggaaggagggtctctaagcag cccctggccacagccatggcaaacaaaactcttctctaagtcaccaatga tcacaggcctcccactaaaaatacttcccaactctggggtggaagagttt gggggatgaatttttaggggattgcaagccccaatccccacctctgtgtc cctagaatcccccacccctaccttggctgctccatcacccaaccaccaaa gctttcttctgcagaggccacctagtcatgtttctcaccctgcacctcag cctccccactccatctctcaatcatgcctagggtttggaggaaggcattt gattctgttctggagcacagcagaagaattgacatcctcaaaattaaaac tcccttgcctgcacccctccctcagatatctgattcttaatgtctagaaa ggaatctgtaaattgttccccaaatattcctaagctccatcccctagcca caccagaagacacccccaaacaggcacatctttttaattcccagcttcct ctgttttggagaggtcctcagcatgcctctttatgcccctcccttagctc ttgccaggatatcagagggtgactggggcacagccaggaggaccccctcc ccaacacccccaacccttccacctttggaagtctccccacccagctcccc agttccccagttccacttcttctagattggaggtcccaggaagagagcag aggggcacccctacccactggttagcccacgccattctgaggacccagct gcacccctaccacagcacctctggcccaggctgggctggggggctgggga ggcagagctgcgaagaggggagatgtggggtggactcccttccctcctcc tccccctctccattccaactcccaaattgggggccgggccaggcagctct gattggctggggcacgggcggccggctccccctctccgaggggcagggtt cctccctgctctccatcaggacagtataaaaggggcccgggccagtcgtc ggagcagacgggagtttctcctcggggtcggagcaggaggcacgcggagt gtgaggccacgcatgagcggacgctaaccccctccccagccacaaagagt ctacatgtctagggtctagacatgttcagctttgtggacctccggctcct gctcctcttagcggccaccgccctcctgacgcacggccaagaggaaggcc aagtcgagggccaagacgaagacagtaagtcccaaa

SPECIFIC MODES FOR CARRYING OUT THE INVENTION

[0385] The embodiments of the invention are illustrated in detail by reference to the following examples. However, it is understood by those skilled in the art that the examples are used only for the purpose of illustrating the invention, rather than limiting the protection scope of the invention. In the case where the concrete conditions are not indicated in the examples, the examples are carried out according to conventional conditions or the conditions recommended by the manufacturer. The agents or instruments of which the manufacturer are not indicated are regular products that can be purchased on the market.

EXAMPLE 1

[0386] In the example, the compounds listed in Table 1 were studied for their inhibitory effects on COL1A1 promoter by a cell screening model using COL1A1 promoter as target. The test compounds were prepared by the method as disclosed in CN patent application CN103183623A.

[0387] Experimental Procedure:

[0388] By reference to the method in CN patent application CN104232588A, a cell screening model using COL1A1 promoter as target was established, and LX2COL monoclonal cell line was obtained. After serum-free culture of LX2COL monoclonal cell line, cytokine TGF-1 was added for induction, and meanwhile a test compound (10 M) was added. Epigallocatechin gallate (EGCG) and all-trans-retinoic acid (atRA) were used as positive control drugs. The assay was carried out by using Luciferase Assay Kit, and the results were shown in FIG. 1.

[0389] The results showed that the test compounds inhibited COL1A1 promoter to different extents. At the same dose, the test compounds showed better inhibitory effects than the positive control compounds EGCG and atRA. It has been reported definitely that EGCG is a compound capable of inhibiting liver fibrosis; and it has also be demonstrated definitely that all-trans-retinoic acid (atRA) has an improved effect on liver fibrosis and liver cirrhosis, and has been subjected to clinical trial. The results above showed that (benzenesulfonamido) benzamide compounds could inhibit the activity of COL1A1 promoter.

EXAMPLE 2

[0390] In the example, the compounds 16-4, 16-5 and 17-15 were tested for their inhibitory effects on activity of COL1A1 promoter by a dual-luciferase reporter assay system.

[0391] Experimental Procedure:

[0392] At 37 C, 5% CO2, human hepatic stellate cells LX2 were cultured in DMEM medium containing 10% fetal bovine serum (Gibco). After the cells reached a confluence of about 95%, the cells were spread onto a 96-well plate at 210.sup.4 cells per well. After the cells reached a confluence of about 90%, the cells were subjected to serum-free culture in DMEM medium (Gibco) containing no fetal bovine serum for 24 h. LX2 cells were co-transfected with pGL4.17COL1A1 plasmid (constructed by reference to the method in CN patent application CN104232588A) and Renailla plasmid by using Lipo2000, and were induced by TGF-1 (2 ng/ml) 6 h after transfection; meanwhile, the compounds 16-4, 16-5 and 17-15 were added at a concentration of 1 mol/L, 5 mol/L and 10 mol/L, respectively, wherein at least 3 replicate wells were set for each experiment. The cells were further cultured for 24 h. In accordance with the operations described in the instruction of Dual-Glo Luciferase Assay System, the medium was discarded, and the cells were washed with PBS once. Cells were lysed by the addition of 1 PLB (20 L/well) (within 15 min), luciferase substrate (50 L/well) was added for assay, and a stop solution (50 L/well) was added for assay.

[0393] FIG. 2 showed the results. In the figure, ** represents p<0.01 compared to control group (administration concentration is 0). As shown in the figure, with the increase in the concentration of the compounds 16-4, 16-5 and 17-15, the relative luciferase activity reduced significantly. The results showed that the compounds 16-4, 16-5 and 17-15 could inhibit the activity of COL1A1 promoter in a dose-dependent manner.

EXAMPLE 3

[0394] In the example, the compounds 16-4, 16-5, and 17-15 were tested for in vitro activity against liver fibrosis.

[0395] 1. TGF-1-induced LX2 cells

[0396] In DMEM (Gibco) medium containing 10% fetal bovine serum, LX2 cells were cultured at 37 C, 5% CO2. The cells were spread on a 6-well plate at 110.sup.5 cells per well. After culture for 24 h, the original medium was discarded, the cells were washed with PBS once, and DMEM (Gibco) medium without 10% fetal bovine serum was added. After starvation culture for 24 h, TGF-1 (2 ng/ml), and the compounds 16-4, 16-5 and 17-15 (at a concentration of 1 mmol/L, 5 mmol/L and 10 mmol/L, respectively) were added, and control group (not induced by TGF-1) and TGF-1-induced group (with the addition of TGF-1 alone) were set. After further culture for 24 h, the samples were taken.

[0397] 2. Real-time PCR assay

[0398] In accordance with the TRizol method, the total RNA in LX2 cells were extracted, and in accordance with the operations described in the instruction of Roche Transcriptor First Strand cDNA Synthesis Kit, the total RNA of LX2 was reverse transcribed into cDNA. The cDNA obtained, sterile water, Roche FastStart Universal Probe Master (Rox) and ABI TaqMan probes (COL1A1, TGF-1, MMP2) were used to prepare a 20 L reaction system, which was analyzed by ABI 7500 Fast Real-Time PCR System.

[0399] FIG. 3 showed the results. In the figure, * represents p<0.05 compared to control group (LX2 cells that are not induced and activated); ** represents p<0.01 compared to control group (LX2 cells that are not induced and activated); # represents p<0.05 compared to TGF-1-induced group (administration concentration is 0); ## represents p<0.01 compared to TGF-1-induced group (administration concentration is 0). The results showed that the compounds 16-4, 16-5 and 17-15 could significantly inhibit the expression levels of mRNA of COL1A1, TGF-1 and MMP2.

[0400] 3. Western blot Assay

[0401] Proteins in LX2 cells were extracted with RAPI lysis solution (containing 1% PMSF), and the protein concentration was determined by BCA method. The sample was loaded at 20 g/20 L, subjected to polyacrylamide gel electrophoresis, transferred to a membrane, blocked with 5% skim milk, incubated with a primary antibody, washed with PBST, incubated with a secondary antibody, and imaged with ChemiImager 5500 imaging system. FIG. 4 showed the results. The results showed that the compounds 16-4, 16-5 and 17-15 could significantly inhibit the expression of COL1A1, TGF-1, MMP2 and -SMA protein.

EXAMPLE 4

[0402] In the example, the compounds 16-4 and 17-15 were tested for their safety in Kunming mice.

[0403] Kunming mice (with a body weight of 18-22 g) were randomly divided into control group, 16-4 administration group, and 17-15 administration group, with 4 mice for each group, administered at a dose of 0 mg/kg, 50 mg/kg, 500 mg/kg, 1000 mg/kg and 2000 mg/kg. At the first day of experiment, drugs were intragastrically administered to 16-4 administration group and 17-15 administration group, and normal saline was administered to control group. The body weight and physical conditions of mice (for example, being short of breath or not, having bleeding spots in skin or not, etc.) and whether mice died or not were recorded every day. After observation for 14 days, the mice were sacrificed.

[0404] FIGS. 5A and 5B showed changes in the body weight of mice in 16-4 administration group and 17-15 administration group, respectively, wherein relative body weight=body weight at Day 14body weight at Day 1. The results showed that 14 days after administration, no significant decrease in body weight occurred in these groups of mice, and no signs of intoxication were observed and no death occurred, indicating a relatively high drug safety.

EXAMPLE 5

[0405] In the example, the compounds 16-4 and 16-5 were tested for their protection against liver injury by using an alpha-naphthylisothiocyanate (ANIT)-induced liver injury model.

[0406] Kunming female mice (with a body weight of 22-25 g) were randomly divided into control group, ANIT-induced group, 16-4 (400 mg/kg) administration group, and 16-5 (400 mg/kg) administration group, with 10 mice for each group. Drugs were intragastrically administered to 16-4 administration group and 16-5 administration group for 5 days, and normal saline was administered to control group and ANIT-induced group; after starvation treatment for 12 h, ANIT-induced group, 16-4 administration group and 16-5 administration group were induced with ANIT (75 mg/kg by intragastrical administration), and meanwhile corn oil was intragastrically administered to control group. After further administration for 2 days (i.e. after induction with ANIT for 48 h), liver tissues were harvested, and subjected to pathological section and HE staining.

[0407] FIG. 6A-6D showed the HE staining results of the liver tissue slices of rats in control group, ANIT-induced group, 16-4 administration group and 16-5 administration group, respectively. As shown in the figure, compared to ANIT-induced group, 16-4 administration group and 16-5 administration group had the liver injury improved. The results showed that the compound 16-4 and 16-5 had the effect of relieving liver injury, and could be used in the treatment of liver injury.

EXAMPLE 6

[0408] In the example, SD rat bile duct ligation (BDL) model was prepared, to which drugs were administered.

[0409] SD male rats (with a body weight of 180-200 g) were randomly divided into sham operation group, BDL model group and 16-4 administration group, wherein sham operation group included 6 rats, BDL model group included 8 rats, and 16-4 administration group included 6 rats. Animals were fasted for 12 hours before surgery. After anesthetization with isoflurane, the abdomen of rat was opened under aseptic conditions, the liver was lifted, the duodenum was pulled aside, and 2-3 cm common bile duct was separate. Ligations were performed twice with silk thread No. 000 at the place proximal to duodenum and the place proximal to porta hepatis, respectively. The common bile duct was cut off at the middle of the two ligation places. After the liver was put back, the cut was sutured. In sham operation group, the abdomen was just opened, and then sutured. After recovery from anesthesia, the animals were subjected to normal diet, with free access to water. 2 days after surgery, the compound 16-4 (100 mg/kg) was intraperitoneally injected to 16-4 administration group, and normal saline was intraperitoneally injected to sham operation group and BDL model group, once a day. After administration for 14 days, samples such as urine, blood, bile, liver, kidney and ileum were collected from the animals after being fasted for 12 hours.

EXAMPLE 7

[0410] In the example, the compound 16-4 was studied for its effect on the liver function of BDL rat.

[0411] Blood samples were taken from rats of each group in Example 6, and the rats were fasted for 12 h before taking samples. The rats were anesthetized with 10% chloral hydrate, and blood was collected via aorta ventralis, on standing at room temperature for 1 h, and centrifuged at 3000 rpm for 5 min. The serum was tested for serum biochemical indexes. The results were shown in Table 2. The results showed that the compound 16-4 could reduce the activity of aspartate aminotransferase (AST), alkaline phosphatase (ALP), and -glutamyltransferase (-GGT), indicating that the compound 16-4 could improve the liver function of BDL rats.

TABLE-US-00004 TABLE 2 Effect of the compound 16-4 on serum liver function in BDL model rat control BDL 16-4 group Serum biochem- group model group (100 mg/kg) ical indexes (n = 6) (n = 8) (n = 6) alanine amino- 33.33 3.78 94.70 24.12** 68.20 11.86.sup.# transferase ALT (U/L) alkaline 241.17 66.41 476.30 77.19** 383.60 56.45.sup.# phosphatase ALP(U/L) -glutamyl- 0.17 0.41 44.90 8.16** 27.40 10.26.sup.# transferase -GGT (U/L) **p < 0.01, compared to control group; .sup.#p < 0.05, compared to BDL model group.

EXAMPLE 8

[0412] In the example, the compound 16-4 was studied for its effect on pathological structure of BDL rat liver.

[0413] The liver tissue samples were taken from rats of each group in Example 6, and the rats were fasted for 12 hours before taking samples. The rats were anesthetized with 10% chloral hydrate and the liver tissue was taken. The hepatic lobar tissue blocks were cut off and fixed in 4% neutral formaldehyde solution. By carrying out the steps such as dehydration, paraffin embedding, slicing and baking, paraffin slices were made. Hematoxylin-eosin (HE) staining solution was used for staining, and changes in pathological structure of rat liver tissue were observed.

[0414] FIG. 7A-7C showed the HE staining results of the liver tissue slices of rats in sham operation group, BDL model group and 16-4 administration group, respectively. FIG. 7D was the statistical chart on the double-blind scores of the HE staining of the animal tissues of each group. * represents p<0.05 compared to sham operation group; ** represents p<0.01 compared to sham operation group; # represents p<0.05 compared to BDL model group; ## represents p<0.01 compared to BDL model group.

[0415] The results showed that in the liver tissues of rats in sham operation group, the hepatocytes were arranged regularly, and the hepatic lobules were intact, without inflammatory cell infiltration and bile duct proliferation; the rats in BDL group had the pathological structure of liver tissues changed greatly, with significant bile duct proliferation and significantly increased tissue necrosis; the rats in 16-4 administration group had the structure of liver tissues improved significantly, with significantly inhibited bile duct proliferation and significantly reduced tissue necrosis. The results showed that the compound 16-4 could significantly improve the pathological structure of the liver tissues in BDL rats.

EXAMPLE 9

[0416] In the example, the compound 16-4 was studied for its inhibitory effect on liver fibrosis of BDL model rats.

[0417] (1) Masson staining is a collagen fibril-specific staining and can reflect the extent of liver fibrosis in liver tissue. The liver tissue samples were collected from rats of each group in Example 6, and paraffin slices were made. The paraffin slices were stained with Masson's staining solution, and the fibrosis in rat liver tissue was observed.

[0418] FIG. 8A-8C showed the Masson staining results of the liver tissue slices of rats in sham operation group, BDL model group and 16-4 administration group, respectively. FIG. 8D was the statistical chart on the double-blind scores of the Masson staining of the animal tissues of each group. ** represents p<0.01 compared to sham operation group; ## represents p<0.01 compared to BDL model group. The results showed that compared to sham operation group, the fibrosis increased significantly in the liver tissues of the BDL rats, and the compound 16-4 could significantly inhibit the fibrosis of liver tissues. The results showed that the compound 16-4 could significantly inhibit the production of myofibrils, and inhibit liver fibrosis in BDL rats.

[0419] (2) Hydroxyproline is specific to collagen fibrils, and the content of hydroxyproline can reflect the extent of liver fibrosis. Liver tissue samples (80-100 mg) were taken from the rats of each group in Example 6, and in accordance with the instruction of Hydroxyproline Assay Kit (purchased from Nanjing Jiancheng Bioengineering Institute), the content of hydroxyproline in the liver tissues was determined.

[0420] FIG. 9 showed the content of hydroxyproline in liver tissues of rats in each group. ** represents p<0.01 compared to sham operation group; # represents p<0.05 compared to BDL model group. The results showed that compared to sham operation group, the content of hydroxyproline increased significantly in the liver tissues of BDL model rats; the compound 16-4 could significantly reduce the content of hydroxyproline in rat liver tissues. The results showed that the compound 16-4 could significantly inhibit the production of collagen fibrils, and inhibit the occurrence of liver fibrosis in BDL rats.

EXAMPLE 10

[0421] In the example, the compound 16-4 was studied for its inhibitory effect on markers associated with liver fibrosis in liver tissues of BDL rats.

[0422] (1) Assay on expression of genes associated with liver fibrosis in liver tissues by PCR method.

[0423] Liver tissues (80-100 mg) were taken from the rats of each group in Example 6, and 1 mL TRizol was added. The tissues were homogenized in the condition of an ice bath, and centrifuged at 12000 rpm, 4 C. for 10 min. The supernatant was taken, and the total RNA was extracted. According to the operations described in the instruction of Roche Transcriptor First Strand cDNA Synthesis Kit, the total RNA of LX2 was reverse transcribed into cDNA. The cDNA obtained, sterile water, Roche FastStart Universal Probe Master (Rox) and ABI TaqMan probes were used to prepare a 20 L reaction system, which was analyzed by ABI 7500 Fast Real-Time PCR System.

[0424] FIG. 10 showed the expression levels of genes associated with liver fibrosis in the liver tissues of rats in sham operation group, BDL model group and 16-4 administration group. ** represents p<0.01 compared to sham operation group; # represents p<0.05 compared to BDL model group, ## represents p<0.01 compared to BDL model group. The results showed that compared to sham operation group, the expression levels of genes associated with liver fibrosis (COL1A1, TGF-1, MMP2, -SMA (ACTA2), TIMP1, TIMP2 and SPP1) increased significantly in the liver tissues of rats in BDL model group, the administration of the compound 16-4 could significantly reduce the expression of genes associated with liver fibrosis.

[0425] (2) Assay on expression of proteins associated with liver fibrosis in liver tissue by Western blot

[0426] Liver tissues (80-100 mg) were taken from the rats of each group in Example 6, and 1 mL RAPI lysis solution (containing 1% PMSF) was added. The tissues were homogenized in the condition of an ice bath, and centrifuged at 12000 rpm, 4 C. for 10 min. The supernatant was taken, and the protein concentration was determined by BCA method. The sample was loaded at a concentration of 50 g/20 L, subjected to polyacrylamide gel electrophoresis, transferred to a membrane, blocked with 5% skim milk, incubated with a primary antibody, washed with PBST, incubated with a secondary antibody, and imaged with Chemilmager 5500 imaging system.

[0427] FIG. 11 showed the expression levels of proteins associated with liver fibrosis in the liver tissues of rats in sham operation group, BDL model group and 16-4 administration group. The results showed that the compound 16-4 could significantly inhibit the expression of COL1A1, TGF-1, MMP2 and -SMA protein.

[0428] The experimental results showed that the compound 16-4 could improve the liver function and the pathological structure of liver in rats in BDL model group, reduce the liver fibrosis, and delay the occurrence and development of liver fibrosis.

[0429] Although the embodiments of the invention have been described in detail, a person skilled in the art would understand that according to all the disclosed teachings, details can be amended and modified, and these alterations all fall into the protection scope of the invention. The scope of the invention is defined by the attached claims and any equivalent thereof.