Highly efficient ethanol-fermentative yeast
10131917 ยท 2018-11-20
Assignee
Inventors
- Yoshiki Tsuchida (Saitama, JP)
- Ikumi Kurihara (Saitama, JP)
- Tomohiro Imai (Saitama, JP)
- Iku Koike (Saitama, JP)
Cpc classification
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N9/1022
CHEMISTRY; METALLURGY
International classification
Abstract
An object of the present invention is to obtain a fermentative yeast having a highly efficient ethanol production without introducing a foreign gene. A further object is to obtain a fermentative yeast that is resistant to proliferation inhibitors such as organic acids, which prevent the proliferation of the fermentative yeast. A yeast having an improved ethanol production ability was generated by introducing transaldolase and alcohol dehydrogenase genes by self-cloning to Meyerozyma guilliermondii that can produce ethanol effectively from pentose and hexose obtained by breeding, and further breeding the resultant yeast.
Claims
1. A highly efficient ethanol-fermentative yeast, the ethanol-fermentative yeast effectively producing ethanol from pentose and hexose, wherein the ethanol-fermentative yeast is a fermentative yeast having xylose utilization ability in a corn stover sugar solution improved by breeding a yeast deposited to National Institute of Technology (NITE) Patent Microorganisms Depositary under the accession number NITE ABP-01976 in a corn stover sugar solution, and wherein the fermentative yeast is deposited to NITE Patent Microorganisms Depositary under the accession number NITE BP-01966.
2. An ethanol-fermentative yeast deposited to National Institute of Technology and Evaluation (NITE) Patent Microorganisms Depositary under accession number NITE ABP-01966.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
DESCRIPTION OF EMBODIMENTS
(5) The yeast strain according to the present invention is described below.
EXAMPLES
(6) 1. Isolation of Strain
(7) Strains having a high ethanol production ability were selected by breeding of the parent strain (the strain N) of Meyerozyma guilliermondii using a sugar solution derived from rice straw. Rice straw from Kumagaya, Japan was immersed in an equal amount of a 25% ammonium solution at 80 C. for 3 hours and then ammonia was allowed to evaporate. The pH of the treated biomass was adjusted to 4 and then Acremonium cellulase (manufactured by Meiji Seika Pharma Co., Ltd.) was added to conduct enzymatic saccharification at 50 C. for 72 hours. The solid-liquid separation of the produced slurry was conducted by filter-pressing to collect the liquid. Using this liquid (hereinafter, also referred to as clear liquid), habituation in culture was conducted with addition of a mutagen for 19 months and strains with improved fermentation performance were selected. Strains having improved fermentation performance were selected based on the amount of ethanol produced after a certain period of time. A strain with high fermentation performance was deposited to NITE Patent Microorganisms Depositary, National Institute of Technology and Evaluation (Independent Administrative Institution) under the accession number NITE BP-01964.
(8) It has been confirmed, although it is not shown here, that the yeast strain BP-01964 is a strain that produces ethanol more than twice as much as the wild type does and that, not only the ability to utilize glucose, which is C6, but also the ability to utilize xylose, which is C5, is improved.
(9) Next, a yeast having an even higher ethanol production ability was obtained by introducing transaldolase and alcohol dehydrogenase genes into the yeast strain BP-01964 by self-cloning.
(10) Fermentation inhibitors such as organic acids, aldehyde, and phenol are produced as by-products when liquids derived from rice straw treated with ammonia is used and treated with a saccharification enzyme to obtain a sugar solution. In particular, acetic acid is present at a very high amount as much as about 1,000 mg/L and reduces the fermentation yield. Therefore, by suppressing the inhibition of fermentative yeast proliferation with acetic acid, the ethanol production efficiency can be further improved.
(11) Transaldolase is an enzyme that catalyzes metabolism from sedoheptulose-7-phosphate (S7P) and glyceraldehyde-3-phosphate (GAP) to erythrose-4-phosphate (E4P) and fructose 6-phosphate (F6P) in the pentose phosphate pathway, which is branched from the glycolysis. It has been confirmed that introduction of this enzyme increases the ethanol yield in the presence of the inhibitor acetic acid.
(12) The xylose reductase promoter was ligated in the upstream of the transaldolase. This is because transaldolase is considered to work efficiently when using the promoter of xylose reductase that functions in the xylose utilization.
(13) Alcohol dehydrogenase is an enzyme that can produce ethanol from acetaldehyde and that can convert aldehyde contained as an inhibitor in a rice straw sugar solution and reduce its toxicity.
(14) The GAPDH promoter was ligated in the upstream of the alcohol dehydrogenase. Since the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) prompter is a strong promoter that functions in the glycolysis, it is considered to be an efficient prompter for use as a promoter of alcohol dehydrogenase, which is an enzyme in the glycolysis.
(15) Therefore, generation of a recombinant fermentative yeast into which the 2 enzymes are introduced by genetic introduction can be expected to produce a yeast having a higher ethanol production ability.
(16) The genetic introduction was conducted by the following procedure. Amplify the gene to be transferred and a terminator region thereof (hereinafter, referred to as gene+terminator region) by PCR. Amplify by PCR the promoter region used for the introduction. These should be both amplified by PCR from the chromosomes of the strain of Meyerozyma guilliermondii used in the present invention.
(17) Clone the DNA fragments amplified by PCR into a commercially available vector for Escherichia coli by infusion in the order of promoter, gene+terminator region. Transform Escherichia coli with the cloned vector and amplify the vector. Obtain DNA fragments for homologous recombination by cutting out the promoter and gene+terminator region from the amplified vector with restriction enzymes or amplifying the promoter and gene+terminator region from the amplified vector by PCR.
(18) The xylose reductase promoter was amplified with the following primers of SEQ ID NO: 1 and SEQ ID NO: 2 and the transaldolase gene and the terminator region were amplified with the primers of the following SEQ ID NOs: 3 and 4.
(19) TABLE-US-00001 SEQIDNO:1: AAGGCTTGGGAACTTTCTTT SEQIDNO:2: AGCAATTGATGATTAATTTT SEQIDNO:3: ATGACCAATTCTCTTGAACA SEQIDNO:4: AAATTGTGCCGTGTCAAACT
(20) Specifically, the GAPDH prompter was amplified with the primers of the following SEQ ID NO: 5 and SEQ ID NO: 6 and the alcohol dehydrogenase gene and the terminator region were amplified with the primers of the following SEQ ID NOs: 7 and 8.
(21) TABLE-US-00002 SEQIDNO:5: GTTGTAGCGGAGGCTCAATT SEQIDNO:6: TGTATAATTTAAATGTGGGT SEQIDNO:7: ATGTCAATTCCAGAATCCAT SEQIDNO:8: CACCTTGGCTGGAAGTGCTG
(22) The homologous recombination of the obtained DNA fragments into the yeast strain was performed to obtain desired strains. Electroporation was used for the homologous recombination. The DNA fragments for the homologous recombination were the xylose reductase promoter, transaldolase+terminator, the GAPDH promoter, and alcohol dehydrogenase+terminator, in this order. Moreover, while the strains obtained by this method comprise introduced genes, they belong to a category to be treated as a non-modified yeast under the Cartagena Act because they are self-cloned.
(23) A yeast having a high ethanol production ability was isolated from the yeast strains in which genes have been introduced and deposited to NITE Patent Microorganisms Depositary to obtain the accession number NITE ABP-01976.
(24) Next, a yeast strain having a high fermentation yield in a sugar solution derived from corn stover was obtained by conducting 4 months habituation in culture in a sugar solution derived from corn stover and deposited to NITE Patent Microorganisms Depositary under the accession number BP-01966. The properties such as fermentation yield of the obtained yeast strain are described below.
(25) 2. Properties of the Yeast Strain
(26) 2.1 Fermentation Yield
(27) Fermentation tests of the parent strain and the strain according to the present invention were conducted. Plural enzymatically saccharified solutions having different sugar concentrations derived from corn stover treated with dilute sulphuric acid and adjusted to pH 6 were used and a liquid culture of the aforementioned strain was added so that the OD.sub.600 of the medium became 2.0. The concentrations of ethanol obtained after culturing at 30 C. for 96 hours and the fermentation yields calculated from the sugar concentration of the used saccharified solution were plotted. The result is shown in
(28) As shown in
(29) Furthermore, the ethanol production ability was compared.
(30) A strain that produces ethanol more than 2.5 times as much as the wild type does and even 1.2 times as much as the strain whose ethanol production ability is increased by breeding, as apparent from
(31) 2.2 Examination of Xylose Utilization Ability
(32) Next, rice straw was treated with an ammonium aqueous solution as described above and then Acremonium cellulase was added to conduct enzymatic saccharification at 50 C. for 72 hours. Fermentation was conducted using the produced slurry.
(33) The slurry fermenter has a jacket structure and the temperature was regulated by the circulation of warm water through the jacket part. Air ports are provided at the bottom and fermentation was conducted with continuously providing a predetermined amount of filtered air through the air ports at the bottom with agitation with impellers coupled with a motor.
(34) The change over time in amount of glucose, xylose, and ethanol contained in the slurry was analyzed. Glucose and xylose were measured by sampling and centrifuging the slurry and measuring the resultant supernatant by HPLC (manufactured by Tosoh Corporation: LC-8020). Ethanol was measured using GC-FID (manufactured by GL Sciences Inc.: GC390B) as described above. The result is shown in
(35) Glucose, which is C6, is consumed earlier, but as glucose in the slurry decreases, xylose, which is C5, is consumed to produce ethanol. Since the obtained yeast comprises both C5 and C6 utilization abilities, it can produce ethanol efficiently. Therefore, it is a strain that is also useful in industrial production.
(36) 2.3 Slurry Fermentation Ability, Clear Liquid Fermentation Ability
(37) A yeast that efficiently carries out fermentation both with slurry and with clear liquid in the bioethanol production is preferred. Therefore, the fermentation yields with slurry and with clear liquid were compared. The fermentation yield is calculated by the following equation.
Fermentation yield=amount of obtained ethanol (g/L)/amount of glucose+xylose contained in sugar solution at the onset of fermentation (g/L)/0.5114
(38) As illustrated in
(39) The yeast identified by the accession number ABP-01966 has a xylose utilization ability enhanced by breeding of the wild type Meyerozyma guilliermondii and can effectively produce ethanol both when using rice straw and when using corn stover as biomass, as described in the foregoing.
(40) As described in the foregoing, a yeast strain having a xylose utilization ability enhanced by breeding of the wild type Meyerozyma guilliermondii and an increased ethanol production ability by genetic recombination was obtained. Furthermore, the strain can effectively produce ethanol both when using rice straw and when using corn stover as biomass.