HLA-H, HLA-J, HLA-L, HLA-V AND HLA-Y AS THERAPEUTIC AND DIAGNOSTIC TARGETS

Abstract

The present invention relates to a method for producing a medicament for the treatment or prevention of a tumor in a subject or a diagnostic agent for the detection of a tumor in a subject comprising (A) determining the expression of at least one nucleic acid molecule and/or at least one protein or peptide in a sample obtained from said subject, wherein the at least one nucleic acid molecule is selected from nucleic acid molecules (a) encoding a polypeptide comprising or consisting of the amino acid sequence of any one of SEQ ID NOs 1 to 5, (b) comprising or consisting of the nucleotide sequence of any one of SEQ ID NOs 6 to 10, (c) encoding a polypeptide which is at least 85% identical, preferably at least 90% identical, and most preferred at least 95% identical to the amino acid sequence of (a), (d) consisting of a nucleotide sequence which is at least 95% identical, preferably at least 96% identical, and most preferred at least 98% identical to the nucleotide sequence of (b), (e) consisting of a nucleotide sequence which is degenerate with respect to the nucleic acid molecule of (d), (f) consisting of a fragment of the nucleic acid molecule of any one of (a) to (e), said fragment comprising at least 150 nucleotides, preferably at least 300 nucleotides, more preferably at least 450 nucleotides, and most preferably at least 600 nucleotides, and (g) corresponding to the nucleic acid molecule of any one of (a) to (f), wherein T is replaced by U, and wherein the at least one protein or peptide is selected from proteins or peptides being encoded by the nucleic acid molecule of any one of (a) to (g); and (B) producing a medicament capable of inhibiting the expression of the at least nucleic acid molecule and/or the at least one protein or peptide in the subject, if the at least one nucleic acid molecule and/or at least one protein or peptide is expressed in (A), and/or (B′) producing a diagnostic agent capable of detecting in vivo the sites of expression of the at least nucleic acid molecule and/or the at least one protein or peptide in the subject, if the at least one nucleic acid molecule and/or at least one protein or peptide is expressed in (A).

Claims

1. A method for producing a medicament for the treatment or prevention of a tumor in a subject or a diagnostic agent for the detection of a tumor in a subject comprising (A) determining the expression of at least one nucleic acid molecule and/or at least one protein or peptide in a sample obtained from said subject,  wherein the at least one nucleic acid molecule is selected from nucleic acid molecules (a) encoding a polypeptide comprising or consisting of the amino acid sequence of any one of SEQ ID NOs 1 to 5, (b) comprising or consisting of the nucleotide sequence of any one of SEQ ID NOs 6 to 10, (c) encoding a polypeptide which is at least 85% identical, preferably at least 90% identical, and most preferred at least 95% identical to the amino acid sequence of (a), (d) consisting of a nucleotide sequence which is at least 95% identical, preferably at least 96% identical, and most preferred at least 98% identical to the nucleotide sequence of (b), (e) consisting of a nucleotide sequence which is degenerate with respect to the nucleic acid molecule of (d), (f) consisting of a fragment of the nucleic acid molecule of any one of (a) to (e), said fragment comprising at least 150 nucleotides, preferably at least 300 nucleotides, more preferably at least 450 nucleotides, and most preferably at least 600 nucleotides, and (g) corresponding to the nucleic acid molecule of any one of (a) to (f), wherein T is replaced by U, and  wherein the at least one protein or peptide is selected from proteins or peptides being encoded by the nucleic acid molecule of any one of (a) to (g); and (B) producing a medicament capable of inhibiting the expression of the at least nucleic acid molecule and/or the at least one protein or peptide in the subject, if the at least one nucleic acid molecule and/or at least one protein or peptide is expressed in (A), and/or (B′) producing a diagnostic agent capable of detecting in vivo the sites of expression of the at least nucleic acid molecule and/or the at least one protein or peptide in the subject, if the at least one nucleic acid molecule and/or at least one protein or peptide is expressed in (A).

2. The method of claim 1, wherein the expression of (i) at least two nucleic acid molecules of the nucleotide sequences of SEQ ID NOs 6 to 10 or the nucleic acid molecules derived thereof as defined claim 1, (ii) at least two proteins of the amino acid sequence of any one of SEQ ID NOs 1 to 5 or the proteins or peptides derived thereof as defined claim 1, and/or (iii) at least one nucleic acid molecule of the nucleotide sequences of SEQ ID NOs 6 to 10 or the nucleic acid molecules derived thereof as defined claim 1 and at least one protein or peptide of the amino acid sequence of any one of SEQ ID NOs 1 to 5 or the proteins or peptides derived thereof as defined claim 1, is determined in step (A).

3. The method of claim 1 or 2, furthermore determining in step (A) the expression of at least one of the HLA class Ib genes HLA-E, HLA-F, and HLA-G and/or at least one protein or peptide produced from said MHC class Ib genes.

4. The method of any one of claims 1 to 3, furthermore determining in step (A) the expression of at least one of the HLA class I genes HLA-A, HLA-B, and HLA-C and/or at least one protein or peptide produced from said MHC class I genes.

5. The method of any one of claims 1 to 4, furthermore determining in step (A) the expression of at least one of the HLA class II genes HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRA, and HLA-DRB1 and/or at least one protein or peptide produced from said MHC class II genes.

6. The method of any one of claims 1 to 5, furthermore determining in step (A) the expression of at least one growth factor and/or at least one tumor marker and/or at least one protein being expressed during early pregnancy and in carcinoembryonic regression.

7. The method of claim 6, wherein the at least one growth factor is selected from the group consisting of epidermal growth factor (EGF), fibroblast growth factor (FGF), basic fibroblast growth factor (bFGF), growth differentiation factor-9 (GDF9), hepatocyte growth factor (HGF), hepatoma-derived growth factor (HDGF), keratinocyte growth factor (KGF), nerve growth factor (NGF), placental growth factor (PGF), platelet-derived growth factor (PDGF), stromal cell-derived factor 1 (SDF1), transforming growth factor, and vascular endothelial growth factor.

8. The method claim 6, wherein the at least one tumor marker is selected from the group consisting of somatostatin receptors, TSH receptors, tyrosin receptors, and PSMA.

9. The method of any one of claims 1 to 8, wherein (i) the medicament is or comprises a small molecule, an aptamer, a siRNA, a shRNA, a miRNA, a ribozyme, an antisense nucleic acid molecule, a CRISPR-Cas9-based construct, a CRISPR-Cpf1-based construct, a meganuclease, a zinc finger nuclease, or a transcription activator-like (TAL) effector (TALE) nuclease capable of inhibiting the expression of the at least one nucleic acid molecule, and/or (ii) the medicament is or comprises a small molecule, an antibody, a protein drug, or an aptamer capable of inhibiting the at least one protein or peptide,  wherein the protein drug is preferably an antibody mimetic, and  wherein the antibody mimetic is preferably selected from affibodies, adnectins, anticalins, DARPins, avimers, nanofitins, affilins, Kunitz domain peptides and Fynomers®, and/or (iii) the diagnostic agent is or comprises a small molecule, an aptamer, a siRNA, a shRNA, a miRNA, a ribozyme, an antisense nucleic acid molecule, a CRISPR-Cas9-based construct, a CRISPR-Cpf1-based construct, a meganuclease, a zinc finger nuclease, and a transcription activator-like (TAL) effector (TALE) nuclease capable of binding to the at least one expressed nucleic acid molecule, and/or (iv) the diagnostic agent is or comprises a small molecule, an antibody, a protein drug, or an aptamer capable of binding to the at least one expressed protein or peptide, wherein the protein drug is preferably an antibody mimetic, and wherein the antibody mimetic is preferably selected from affibodies, adnectins, anticalins, DARPins, avimers, nanofitins, affilins, Kunitz domain peptides and Fynomers®.

10. The method of claim 9, wherein the small molecule, antibody, protein drug, or aptamer being or comprised in the medicament is fused to a cytotoxic agent, wherein the cytotoxic agent is preferably a therapeutic radioisotope, more preferably .sup.177Lu, .sup.90Y, .sup.67Cu and .sup.225Ac, and/or small molecule, antibody, protein drug, or aptamer being the or comprised in the diagnostic agent is fused to an imaging agent, wherein the imaging agent is preferably a therapeutic radioisotope, more preferably .sup.67Ga, 44Sc, .sup.111In, .sup.99mTc, .sup.57Co, .sup.131I.

11. A medicament produced by the method of any one claims 1 to 10 for use in the treatment or prevention of a tumor in a subject.

12. A diagnostic agent produced by the method of any one claims 1 to 10 for use in the in vivo detection of tumor sites in a subject.

13. The diagnostic agent for use of claim 12, wherein the detection comprises scanning the entire body of the subject, wherein the scanning preferably employs a total-body positron emission tomography (PET) scanner.

14. The diagnostic agent for use of claim 12 or 13, wherein the detection comprises measuring the radiation dose uptake of the radioisotope into the tumor sites in a subject.

15. The diagnostic agent for use of claim 14, wherein based on the measured radiation dose uptake a therapeutically effective amount of a medicament is to be determined, wherein the medicament is preferably produced by the method of any one claims 1 to 10.

Description

[0112] The figures show.

[0113] FIG. 1: Summary of the protein sequences of HLA-A, HLA-B, HLA-C, HLA-E, HLA-F isoforms, HLA-G, HLA-H and HLA-J in the region of the alpha 2 and 3 domains, the transmembrane domains and the corresponding connecting peptide with the cytoplasmatic region. The consensus sequence is highlighted in grey above the aligned sequences. Differences in the HLA peptide sequences are also highlighted in grey. The predicted alpha 3 differs from the other HLA genes and is highlighted in grey. The peptide sequence for the generation of the unique HLA-J antibody is depicted as brown arrow, named “JULY Antibody”.

[0114] FIG. 2: Evidence of HLA-J protein expression by western blot analysis in ovarian cancer, breast cancer and bladder cancer tissue from patients as well as placental tissue. The examples illustrate the invention.

[0115] The examples illustrate the invention.

EXAMPLE 1

Imaging of Cancer Cells by Using Radionuclide-Labelled Anti-HLA-Antibodies

[0116] The example describes the generation of a personalized anti-tumor therapy with the aid of radionuclide labelled antibodies also denoted as theranostics. It also describes an in vivo method for detecting and treating tumor and metastases in patients via positron emission tomography (PET) and computed tomography (CT).

[0117] In a first step, the individual and unique HLA expression pattern (adult and/or embryonic and/or former “pseudogenes”) of the tumor and metastases are visualized with anti-HLA antibodies labelled to a diagnostical radionuclide. After the determination of the HLA expression pattern and evaluating cancer cell distribution and tumor burden, a therapeutic, personalized anti-HLA antibody mixture labelled to a therapeutical radionuclide is applied. Therapy response and success can be monitored with the anti-HLA antibodies labelled to the diagnostical radionuclide, which have been applied in the first step.

[0118] In order to minimize radiation exposure and maximize the therapeutic effect of the applied radio-labelled anti-HLA-antibody, uptake kinetics, it is advantageous to determine the HLA status previous to therapy.

[0119] PET/CT imaging is performed with the whole-body scanner “Explorer Total Body Scanner™” (United Imaging, Shanghai) in order to determine HLA expression pattern. Compared to other PET/CT-Scanner this system has a 40-times higher sensitivity with a 30 second total measuring time. It detects lesions that express an HLA having a size of 2.8 mm with a 6-times higher imaging resolution. The whole-body scanner also lowers the radiation burden to patients and minimizes side effects.

[0120] The antibodies, which are applied in order to detect HLA class Ib and Iw genes, which are solely expressed on tumor cells e.g. anti-HLA-G antibodies (named “LILLY1” and “LILLY2”) and anti-HLA-J antibody (named “JULY”). These antibodies are generated against peptide sequences which are unique for each HLA class Ib and Iw gene in order to minimize cross reactivity to other HLA genes (BioGenes, Berlin, Germany). The HLA-J antibody has been generated against the c-terminal end of the unique alpha 3 and transmembrane domain of HLA-J (FIG. 1). The peptide sequence includes 22 amino acids spanning the alpha3 domain, the connecting peptide and the n-terminal end of the transmembrane domain.

EXAMPLE 2

Detection of HLA-J Protein Expression

[0121] In order to proof the existence of the protein of HLA-J western blot analysis has been performed in ovarian cancer, breast cancer and bladder cancer tissue from patients and placenta (n=1). 20 μg of protein tissue lysates were separated in a 10% SDS-PAGE gel under denatured conditions and transferred wet to a nitrocellulose membrane. After incubation with the specific anti-HLA-J antibody “JULY”, purple precipitates have been observed after incubation with an anti-rabbit antibody coupled with HPR, followed by the application of TMB substrate. Western blot analysis revealed the existence of a HLA-J protein with the observed size of approximately 55 kDa (FIG. 2). The calculated protein size of HLA-J is around 26.7 kDa. Regarding the ovarian cancer tissue sample, further bands can be detected at around 100 kDa. These findings might indicate that HLA-J mainly exists in a dimer and tetramer conformations, caused by cysteine residues which can create disulfide bonds.

EXAMPLE 3

Labelling of Anti-HLA-J JULY-mAb and Anti-HLA-G LILLY-mAb With .SUP.68.Gallium for Imaging

[0122] In order to fully evaluate cancer cell distribution, the HLA-J antibody JULY and the anti-HLA-G LILLY were labelled to the diagnostic radionuclide, Gallium-68.

[0123] Gallium-68, an amphoteric element, was derived from a Ge-68/Ga-68 generator system from the parent nuclide germanium-68 with a long half-life of 288 days according to the current state of knowledge (Zhernosekov et al., J Nucl Med 2007 October; 48(10):1741-8). In order to obtain radio-chemically pure gallium-68, cation exchange post-processed to Ge-68/Ga-68 generator has been performed enabling the collection of pure gallium-68 within 10 minutes (Mueller et al., Recent Results Cancer Res. 2013; 194:77-87). Since gallium-68 itself has a half-life of approximately 68 minutes fast labelling has to be carried out. Gallium-68 was labelled to JULY and LILLY with the chelator DOTA (1,4,7,10-tetraazacyclododecane-N,N′,N″,N″′-tetraacetic acid) based on the cassette-based synthesis system click chemistry (EZAG, Berlin, Germany). This system provides an automated, fast and GMP compliant production method for the generation of radiopharmaceuticals. The quality, sterility, endotoxin testing as well as chemical and radio-chemical purity were tested according to the monographs from the European Pharmacopeia, V.8.0 (European Pharmacopoeia (Ph. Eur.) Vol 8 (2013-2016) European Directorate of Quality of Medicines). Biodistribution, binding affinity and dosimetry were checked in vivo in cell lines as well on fresh-frozen tissue slides from patients.

[0124] The requirements for Lutetium-177 labelled JULY and LILLY therapies are similar to Lutetium-177 PSMA treatment (Baum et al., Nuklearmediziner 2015; 38(02): 145-152). Kidney protection was performed according to the bad berka protocol (Schuchardt et al., Recent Results Cancer Res. 2013; 194:519-36).

EXAMPLE 4

Labelling of Anti-HLA-J JULY-mAb and Anti-HLA-G LILLY With .SUP.177.Lutetium for Therapy

[0125] Lutetium-177 is a lower energy beta emitting radionuclide with a mean penetration range of 650 μm in soft tissue and a half-life of 6.72 days. The small range of this beta emitting radionuclide, but 50× greater ranger to alpha emitting radionuclides makes lutetium-177 an optimal therapeutical radionuclide. The emission of low energy gamma doses enables its imaging and distribution analysis via PET/CT. It is generated by the indirect production route over ytterbium-176 according to the patent DE102011051868A1. Labelling of the antibodies JULY and LILLY was performed as described in Repetto-Llamazares et al, PLoS One. 2014; 9(7).

[0126] The quality, sterility, endotoxin testing as well as chemical and radio-chemical purity were tested according to the monographs from the European Pharmacopeia, V.8.0 (European Pharmacopoeia (Ph. Eur.) Vol 8 (2013-2016) European Directorate of Quality of Medicines). Biodistribution, binding affinity and dosimetry were checked in cell lines as well on fresh-frozen tissue slides from patients.

EXAMPLE 5

Biodistribution of Anti-HLA-J JULY-mAb and Anti-HLA-G Lilly-mab Radiolabelled .SUP.68.Gallium In Vivo After Systemic Application Via Intravenous Injection Into the Tail Vein and Instillation Into the Bladder in BBN Induced Bladder Cancer Carcinogenesis Animal Models

[0127] Experimental Animal Set Up

[0128] Bladder cancer was induced with the bladder specific carcinogen N-butyl-N-(4-hydroxybutyl) nitrosamine (BBN) in C57BU6/c mice (Charles River Laboratories International, Inc, Wilmington, Mass.) according to George et al (Transl Oncol. 2013 June; 6(3): 244-255). In brief, animals were divided into two groups (n=27-30/group). Group 1 served as the control, which received only tap water, whereas Group 2 was treated with BBN. The BBN (TCI America, Portland, Oreg.) carcinogen was supplied ad libitum at 0.05% in drinking water to mice from 8 to 20 weeks of age. Water consumption was recorded to determine BBN intake and compared between groups. Body weights were measured at multiple time points between 8 and 32 weeks of age. Animals were monitored for tumor progression and survival and were killed after 32 weeks to obtain bladder and organ weights

[0129] Biodistribution with Anti-HLA-J JULY-mAb and Anti-HLA-G Lilly-Mab Radiolabelled .sup.68Gallium:

[0130] Biodistribution was assessed in animals which had successfully developed bladder cancer as well as in tumor-free mice. Animals were intravesically injected with 6.66 MBq of Gallium-68 labelled anti-HLA-J JULY-mAb or Gallium-68 labelled anti-HLA-G Lilly-mab in 100 μL of PBS. Forty-five and 90 min after injection, mice were sacrificed and organs were prepared for measurement of Gallium-68 labelled anti-HLA-J JULY-mAb or Gallium-68 labelled anti-HLA-G Lilly-mAb accumulation in a γ-counter. Uptake was expressed as percentage of injected activity per gram of tissue. Bladders were isolated and split in half with one portion processed for histology and immunohistochemistry and the other flash frozen for RNA isolation.

[0131] A second set up was performed in order to determine the systemic biodistribution by applying the Gallium-68 labelled anti-HLA-J JULY-mAb or Gallium-68 labelled anti-HLA-G Lilly-mAb systemic via intravenous injection into the tail vein. Forty-five and 90 min after injection, mice were sacrificed and organs were prepared for measurement of Gallium-68 labelled anti-HLA-J JULY-mAb or Gallium-68 labelled anti-HLA-G Lilly-mAb accumulation in a γ-counter. Uptake was expressed as percentage of injected activity per gram of tissue. Bladders were isolated and split in half with one portion processed for histology and immunohistochemistry and the other flash frozen for RNA isolation.

[0132] Biodistribution was monitored with a PET-CT scanner.

[0133] Radioimmunotherapy with Anti-HLA-J JULY-mAb and Anti-HLA-G Lilly-mAb Radiolabelled .sup.177Lutetium:

[0134] Radioimmunotherapy was performed with tumor-bearing mice and divided into 9 groups consisting of 10 animals each. These groups received 0.925 MBq of Lutetium-177 anti-HLA-J JULY-mAb or Lutetium-177 anti-HLA-G LILLY-mAb in 100 μL of PBS intravesically at 1 h, 7 d, or 14 d after BBN induction or 0.37 MBq of Lutetium-177 anti-HLA-J JULY-mAb or 68-Gallium anti-HLA-G LILLY-mAb in 100 μL of PBS at 1 h or 7 d after BBN induction, or 40 pg mitomycin C in 40 μL of 0.9% NaCl at 1 h or 7 d, after BBN induction, or 2 μg of unlabeled Lutetium-177 anti-HLA-J JULY-mAb or Lutetium-177 anti-HLA-G LILLY-mAb at 1 h after BBN induction. The control group received PBS intravesically at 1 h after BBN induction. During therapy, mice were anesthetized (90 min).

[0135] A second set up was performed by applying Lutetium-177 anti-HLA-J JULY-mAb or 68-Gallium anti-HLA-G LILLY-mAb systemic via intravenous injection into the tail vein. Tumor bearing mice were divided into 9 groups consisting of 10 animals each. These groups received 0.925 MBq of Lutetium-177 anti-HLA-J JULY-mAb or Lutetium-177 anti-HLA-G LILLY-mAb in 100 μL of PBS intravenous at 1 h, 7 d, or 14 d after BBN induction or 0.37 MBq of Lutetium-177 anti-HLA-J JULY-mAb or 68-Gallium anti-HLA-G LILLY-mAb in 100 μL of PBS at 1 h or 7 d after BBN induction, or 40 μg mitomycin C in 40 μL of 0.9% NaCl at 1 h or 7 d, after BBN induction, or 2 μg of unlabeled Lutetium-177 anti-HLA-J JULY-mAb or Lutetium-177 anti-HLA-G LILLY-mAb at 1 h after BBN induction. The control group received PBS intravesically at 1 h after tumor cell inoculation. During therapy, mice were anesthetized (90 min).

[0136] Radioimmunotherapy was monitored with a PET-CT scanner.

[0137] Histopathologic Evaluation and Tissue Microarray Preparation

[0138] To assess bladder histopathology, urinary bladders were first excised, cut in half longitudinally, and fixed in 10% buffered formalin. Formalin-fixed bladders were then paraffin embedded, sectioned, and stained with hematoxylin and eosin following standard protocols. Stained slides were histopathologically graded by an expert pathologist (S.S.S.), and bladders were categorized into normal or cancerous, invasive or muscleinvasive, bladders. These were then reviewed to mark the area for tumor for the construction of tissue microarrays. Tissue microarrays were made using 0.6-mm cylindrical cores punched out from the original paraffin blocks using a manual tissue arrayer (Beecher Instruments, Silver Spring, Md.). Triplicate cores from individual blocks were made to enhance the representative reproducibility. Thus, a total of 540 cores representing 180 female mice were used to generate five master blocks. Five-micrometer sections were cut from these blocks and placed on charged slides (Fisher Scientific, Houston, Tex.) and stained appropriately. Briefly, these slides were deparaffinized, rehydrated, and pretreated by either microwave or proteinase K for antigen retrieval. Immunohistochemical staining was then performed using corresponding antibodies. The staining procedure was based on an indirect biotin-avidin system with a universal biotinylated Ig secondary antibody, DAB substrate, and hematoxylin counterstain. A negative control slide was obtained after either omitting the primary antibody or incubating with an irrelevant antibody (mouse monoclonal Ig).

[0139] Tumor Cell Proliferation by Ki-67 Staining

[0140] Using the tissue microarrays generated above, sections were also stained for Ki-67 antigen assessed by immunohistochemistry using a monoclonal MIB-1 antibody (clone MIB-1, mouse IgG1, 1:100 from Dako North America Inc, Carpinteria, Calif.) that was incubated for 25 minutes in a TechMate 500 Plus (Dako North America Inc) and visualized with DAB. Images were captured using the Vectra scanner using the CRI multispectral camera with a ×20 magnification objective (Caliper, Hopkinton, Mass.) for the entire tissue section. Image analysis was done using InForm 1.2 software. InForm was trained to count the Ki-67-positive cells in representative fields for each tissue section. From the images, areas of tissue other than urothelia were masked using Image-Pro Plus software (Media Cybernetics Inc, Bethesda, Md.). The percentage of positively stained cells was calculated using images for the entire section of tissue.

[0141] Apoptosis Assays

[0142] Cell death was detected in situ by enzymatic labeling of DNA strand breaks using terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assays as described previously. For negative controls, the terminal deoxynucleotidyl transferase was substituted by deionized water, while sections that were pretreated with 1.0 g/ml DNase I (DN 25; Sigma-Aldrich, St Louis, Mo.) were used for the positive controls. Images were captured using Vectra scanner as described above, and percentage of TUNEL-positive cells was determined using InForm 1.2 and Image-Pro Plus software.

[0143] HLA Immunohistochemistry

[0144] For immunohistochemical staining of HLA-J and HLA-G, rabbit polyclonal antibodies against HLA-J and HLA-G (BioGenes, Berlin, Germany) were used. Assessment of HLA-J and HLA-G expression was performed by a pathologist (S.S.S.) blinded to the tissue treatment using a modified version of Allred scoring. A composite score, ranging from 0 to 9, was obtained by multiplying the percentage grade by the intensity. HLA-J and -G expression scores were grouped as negative (0), low (<6), and high (≥6).

[0145] Analyses of HLA mRNA Expression

[0146] Bladder specimens obtained from male mice were powdered and homogenized with QlAshredder columns (Qiagen, Hilden, Germany) and total RNA was extracted with the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's recommendations. RNA was quantitated by quantitative real-time polymerase chain reaction (qPCR) analyses using TaqMan primer and probes. All extracts were tested for sufficient high-quality RNA content by quantification with real time PCR (RT-qPCR) of the constitutively expressed gene Calmodulin 2 gene (CALM2) which is known as a stable reference/housekeeper gene. For a detailed analysis of gene expression by RT-qPCR methods, primers flanking the region of interest and a fluorescently labeled probe hybridizing in-between were utilized. RNA-specific primer/probe sequences were used to enable RNA-specific measurements by locating primer/probe sequences across exon/exon boundaries. In case multiple isoforms of the same gene existed, primers were selected to amplify all relevant or selected splice variants as appropriate. All primer pairs were checked for specificity by conventional PCR reactions. Specific primers have been generated against HLA-H, J, L and G (Table 1).

TABLE-US-00001 Gen For_Primer Probe Rev-Primer HLA-G- GGCCGGAGTATTGGGAAGA CAAGGCCCACGCACAGACTGA GCAGGGTCTGCAGGTTCATT Ex3 CA HLA-G CTGCGGCTCAGATCTCCAA CGCAAGTGTGAGGCGGCCAAT CAGGTAGGCTCTCCTTTGTT Ex4 CAG HLA-G CACCACCCTGTCTTTGACT ACCCTGAGGTGCTGGGCCCTG AGTATGATCTCCGCAGGGTA Ex5 ATGAG GAAG HLA-G CATCCCCATCATGGGTATC TGCTGGCCTGGTTGTCCTTGC CCGCAGCTCCAGTGACTACA Ex6 G A HLA-G GACCCTCTTCCTCATGCTG CATTCCTTCCCCAATCACCTT CATCCCAGCCCCTTTTCTG Ex8 AAC TCCTGTT HLA-G TTCATCGCCATGGGCTACG CGACACGCAGTTCGTGCGGTT ATCCTCGGACACGCCGAGT Ex3-5 C HLA-G CCGAACCCTCTTCCTGCTG CGAGACCTGGGCGGGCTCCC GCGCTGAAATACCTCATGGA Ex2/3 C HLA-H GAGAGAACCTGCGGATCGC AGCGAGGGCGGTTCTCACACC CCACGTCGCAGCCATACAT Ex2/3 ATG HLA-H GAGAGAACCTGCGGATCGC ACCAGAGCGAGGGCGGTTCTC CGGGCCGGGACATGGT ACAC KRT5 CGCCACTTACCGCAAGCT TGGAGGGCGAGGAATGCAGAC ACAGAGATGTTGACTGGTCC TCA AACTC KRT20 GCGACTACAGTGCATATTA TTGAAGAGCTGCGAAGTCAGA CACACCGAGCATTTTGCAGT CAGACAA TTAAGGATGCT T CALM2 GAGCGAGCTGAGTGGTTGT TCGCGTCTCGGAAACCGGTAG AGTCAGTTGGTCAGCCATGC G C T HLA-L CCTGCTCCGCTATTACAAC CGAGGCCGGTATGAACAGTTC CGTTCAGGGCGATGTAATCC Ex2/3 CA GCCTA HLA-L GCTGTGGTTGCTGCTGCG AGAAAAGCTCAGGCAGCAATT CATAGTCCTCTTTACAAGTA Ex5/6 GTGCTCAG TCATGAGATG HLA-L TCCTCTTCTGCTCAGCTCT CTCTCCCTTCCCTGAGTTGTA GCTTTATAGATCCATGAGTT Ex7 CCTA GTAATCCTAGCACT TGCATTA HLA-J CAAGGGGCTGCCCAAGC CATCCTGAGATGGGTCACACA CCTCCTAGTCTTGGAACCTT Ex4/5 TTTCTGGAA GAGAAGT

[0147] The above primers and probes correspond to SEQ ID NOs 36 to 83. For instance the forward primer, the probe and the reverse primer of HLA-G Exon 3 are SEQ ID NOs 36, 37, and 38, respectively.

[0148] Results

[0149] Treatment with the bladder specific carcinogen BBN resulted in 70% tumor growth. Forty-five and 90 min after intravesical instillation of Gallium-68 labelled anti-HLA-J JULY-mAb or Gallium-68 labelled anti-HLA-G Lilly-mAb (6.66 MBq in 100 μL), the uptake of the radioimmunoconjugate in the different organs was analyzed via quantification of .sup.68Gallium activity. As presumed, locoregional intravesical application of Gallium-68 labelled anti-HLA-J JULY-mAb or Gallium-68 labelled anti-HLA-G Lilly-mAb ensured excellent retention of the therapeutic compound in the bladder with negligible systemic activity. These data suggest low systemic toxicity, as confirmed after the sacrifice of animals surviving more than 300 d without any signs of disease.

[0150] To monitor therapeutic response and efficacy after intravesical Lutetium-177 anti-HLA-J JULY-mAb and Lutetium-177 anti-HLA-G LILLY-mAb treatment, PET-CT images of tumors were recorded at different time points before and after therapy. After the application of Lutetium-177 anti-HLA-J JULY-mAb and Lutetium-177 anti-HLA-G LILLY-mAb treatment 14 d after BBN induction, both complete eradication and decrease of tumor burden could be observed. Additionally, light emissions from tumors of selected mice were quantified over ROIs before and after therapy using Simple PCI software. Light emissions of intravesical tumors of mice treated with Lutetium-177 anti-HLA-J JULY-mAb or Lutetium-177 anti-HLA-G LILLY-mAb treatment, (0.925 MBq) at 7 d after BBN induction, indicate complete or partial remission of intravesical tumors.

[0151] Mice that were treated with PBS or unlabeled anti-HLA-J JULY-mAb and anti-HLA-G LILLY-mAb treatment 1 h after tumor cell instillation reached a median survival of 41 and 89 d, respectively. Groups that underwent Lutetium-177 anti-HLA-J JULY-mAb and Lutetium-177 anti-HLA-G LILLY-mAb treatment therapy with 0.37 or 0.925 MBq 1 h after BBN induction both showed a significantly longer median survival of more than 300 d (P<0.001) and did not develop any tumor. A disease-free survival was observed in 90% of the animals.

EXAMPLE 6

Biodistribution of Anti-HLA-J JULY-mAb and Anti-HLA-G Lilly-mAb Radiolabelled .SUP.68.Gallium and Therapy With These Antibodies Radiolabelled Lutetium-177 After Instillation Into the Bladder of an Advanced, Muscle-Invasive Bladder Cancer Patient Not Responding to Neoadjuvant Platium Based Chemotherapy

[0152] Biodistribution was performed with Gallium-68 labelled anti-HLA-J JULY-mAb and Gallium-68 labelled anti-HLA-G Lilly-mAb antibodies in patients suffering from advanced, muscle-invasive bladder cancer which did not respond to neoadjuvant platium based chemotherapy. Instillation was applied according to the EAU urology guidelines (Roupret et al., Eur Urol. 2018 January; 73(1):111-122). Biodistribution was monitored with a whole-body PET-CT scanner. Molecular imaging with PET-CT revealed that .sup.68Gallium labelled anti-HLA-J JULY-mAb and anti-HLA-G Lilly-mAb majorly targeting muscle-invasive bladder cancer with a simultaneously very low uptake to the surrounding healthy bladder tissue. This data indicates low systemic toxicity of anti-HLA-J JULY-mAb and anti-HLA-G LILLY-mAb, resulting in an effective anti-tumor therapy.

[0153] For radioimmunotherapy patients received lutetium-177 labelled anti-HLA-J JULY-mAb and anti-HLA-G LILLY-mAb. Instillation was applied according to the EAU urology guidelines (Roupret et al., Eur Urol. 2018 January; 73(1):111-122). The advantage of an instillation therapy with lutetium-177 labelled anti-HLA-J JULY-mAb and anti-HLA-G LILLY-mAb compared to its systemic application via the venous system is the systemic lower radiotoxical burden as well as preservation of the kidney function. All patients had a histological proven muscle-invasive bladder cancer. Instillation therapy response was monitored with an whole body PET-CT scanner. Reconstruction was performed using the iterative reconstruction algorithm implemented by the manufacturer including attenuation and scatter correction based on the low dose CT. For quantitative analysis, the dynamic list mode data were reconstructed as 6 images of 300 s. Mean standardized uptake value (SUV) were measured in fixed size volumes of interest (VOIs) in the bladder as well as in all organs.

[0154] HLA-J and HLA-G positive bladder cancer were detected. No adverse side effects were observed. The acquired images obtained with the Lutetium-177 labelled anti-HLA-J JULY-mAb and anti-HLA-G LILLY-mAb were similar to the previously obtained images using Gallium-68 labelled anti-HLA-J JULY-mAb and Gallium-68 labelled anti-HLA-G Lilly-mAb antibodies. PET-CT Images were taken at different time points in order to evaluate the therapeutic response. It could be observed that patients showed response to anti-HLA-J and anti-HLA-G radioimmunotherapy by a decrease in tumor size as well as pathological complete response.

EXAMPLE 7

Biodistribution of Anti-HLA-J JULY-mAb and Anti-HLA-G Lilly-mAb Radiolabelled .SUP.68.Gallium and Therapy With These Antibodies Radiolabelled Lutetium-177 Intravenously Injected Into an Advanced, Muscle-Invasive Bladder Cancer Patient Not Responding to Neoadjuvant Platium Based Chemotherapy

[0155] Biodistribution was performed with Gallium-68 labelled anti-HLA-J JULY-mAb and Gallium-68 labelled anti-HLA-G Lilly-mAb antibodies in patients suffering from advanced, muscle-invasive bladder cancer which did not respond to neoadjuvant platium based chemotherapy. Intravenous injection was applied according to the EAU urology guidelines (Roupret et al., Eur Urol. 2018 January; 73(1):111-122).

[0156] Biodistribution was monitored with a whole-body PET-CT scanner. Molecular imaging with PET-CT revealed that .sup.68Gallium labelled anti-HLA-J JULY-mAb and anti-HLA-G Lilly-mAb majorly targeting muscle-invasive bladder cancer with a simultaneously very low uptake to other organs. This data indicates low systemic toxicity of anti-HLA-J JULY-mAb and anti-HLA-G LILLY-mAb, resulting in an effective anti-tumor therapy.

[0157] For radioimmunotherapy patients received lutetium-177 labelled anti-HLA-J JULY-mAb and anti-HLA-G LILLY-mAb. Intravenous injection was applied according to the EAU urology guidelines (Roupret et al., Eur Urol. 2018 January; 73(1):111-122). All patients had a histological proven muscle-invasive bladder cancer. Radioimmunotherapy response was monitored with a whole body PET-CT scanner. Reconstruction was performed using the iterative reconstruction algorithm implemented by the manufacturer including attenuation and scatter correction based on the low dose CT. For quantitative analysis, the dynamic list mode data were reconstructed as 6 images of 300 s. Mean standardized uptake value (SUV) were measured in fixed size volumes of interest (VOIs) in the bladder as well as in all organs.

[0158] HLA-J and HLA-G positive bladder cancer were detected as well as different metastatic sides with a simultaneously very low uptake to other organs. No adverse side effects were observed. The acquired images obtained with the Lutetium-177 labelled anti-HLA-J JULY-mAb and anti-HLA-G LILLY-mAb were similar to the previously obtained images using Gallium-68 labelled anti-HLA-J JULY-mAb and Gallium-68 labelled anti-HLA-G Lilly-mAb antibodies. PET-CT Images were taken at different time points in order to evaluate the therapeutic response. It could be observed that patients showed response to anti-HLA-J and anti-HLA-G radioimmunotherapy by a decrease in tumor size as well as pathological complete response. In addition, metastases did also decrease in size and number. Some patients showed total pathological complete response to the applied radioimmunotherapy by a total absence of any metastases or tumor.

EXAMPLE 8

Biodistribution of Anti-HLA-J JULY-mAb and Anti-HLA-G Lilly-mAb Radiolabelled .SUP.68.Gallium and Therapy With These Antibodies Radiolabelled Lutetium-177 After Instillation Into the Bladder of a Non Muscle Invasive Bladder Cancer Patient Refractory to BCG Instillation

[0159] Biodistribution was performed with Gallium-68 labelled anti-HLA-J JULY-mAb and Gallium-68 labelled anti-HLA-G Lilly-mAb antibodies in patients suffering from advanced, non-muscle-invasive bladder cancer which did not respond to neoadjuvant platium based chemotherapy. Instillation was applied according to the EAU urology guidelines (Roupret et al., Eur Urol. 2018 January; 73(1):111-122). Biodistribution was monitored with a whole-body PET-CT scanner. Molecular imaging with PET-CT revealed that .sup.68Gallium labelled anti-HLA-J JULY-mAb and anti-HLA-G Lilly-mAb majorly targeting muscle-invasive bladder cancer with a simultaneously very low uptake to the surrounding healthy bladder tissue. This data indicates low systemic toxicity of anti-HLA-J JULY-mAb and anti-HLA-G LILLY-mAb, resulting in an effective anti-tumor therapy.

[0160] For radioimmunetherapy patients received lutetium-177 labelled anti-HLA-J JULY-mAb and anti-HLA-G LILLY-mAb. Instillation was applied according to the EAU urology guidelines (Roupret et al., Eur Urol. 2018 January; 73(1):111-122). The advantage of an instillation therapy with lutetium-177 labelled anti-HLA-J JULY-mAb and anti-HLA-G LILLY-mAb compared to its systemic application via the venous system is the systemic lower radiotoxical burden as well as preservation of the kidney function. All patients had a histological proven non-muscle-invasive bladder cancer. Instillation therapy response was monitored by whole body PET-CT scanner. Reconstruction was performed using the iterative reconstruction algorithm implemented by the manufacturer including attenuation and scatter correction based on the low dose CT. For quantitative analysis, the dynamic list mode data were reconstructed as 6 images of 300 s. Mean standardized uptake value (SUV) were measured in fixed size volumes of interest (VOls) in the bladder as well as in all organs.

[0161] HLA-J and HLA-G positive bladder cancer were detected, but not in any other organ. No adverse side effects were observed. The acquired images obtained with the Lutetium-177 labelled anti-HLA-J JULY-mAb and anti-HLA-G LILLY-mAb were similar to the previously obtained images using Gallium-68 labelled anti-HLA-J JULY-mAb and Gallium-68 labelled anti-HLA-G Lilly-mAb antibodies. PET-CT Images were taken at different time points in order to evaluate the therapeutic response. It could be observed that patients showed response to anti-HLA-J and anti-HLA-G radioimmunotherapy by a decrease in tumor size as well as pathological complete response.

EXAMPLE 9

Biodistribution of Anti-HLA-J JULY-mAb and Anti-HLA-G Lilly-mAb Radiolabelled .SUP.68.Gallium and Therapy With These Antibodies Radiolabelled Lutetium-177 Intravenously Injected to a Non Muscle Invasive Bladder Cancer Patient Refractory to BCG Instillation

[0162] Biodistribution was performed with Gallium-68 labelled anti-HLA-J JULY-mAb and Gallium-68 labelled anti-HLA-G Lilly-mAb antibodies in patients suffering from advanced, non-muscle-invasive bladder cancer which did not respond to BCG treatment. Intravenous injection was applied according to the EAU urology guidelines (Roupret et al., Eur Urol. 2018 January; 73(1):111-122). Biodistribution was monitored with a whole-body PET-CT scanner. Molecular imaging with PET-CT revealed that .sup.68Gallium labelled anti-HLA-J JULY-mAb and anti-HLA-G Lilly-mab majorly targeting non-muscle-invasive bladder cancer with a simultaneously very low uptake to other organs. This data indicates low systemic toxicity of anti-HLA-J JULY-mAb and anti-HLA-G LILLY-mAb, resulting in an effective anti-tumor therapy.

[0163] For radioimmunotherapy patients received lutetium-177 labelled anti-HLA-J JULY-mAb and anti-HLA-G LILLY-mAb. Intravenous injection was applied according to the EAU urology guidelines (Roupret et al., Eur Urol. 2018 January; 73(1):111-122). All patients had a histological proven non-muscle-invasive bladder cancer. Radioimmunotherapy response was monitored with a whole-body PET-CT scanner. Reconstruction was performed using the iterative reconstruction algorithm implemented by the manufacturer including attenuation and scatter correction based on the low dose CT. For quantitative analysis, the dynamic list mode data were reconstructed as 6 images of 300 s. Mean standardized uptake value (SUV) were measured in fixed size volumes of interest (VOIs) in the bladder as well as in all organs.

[0164] HLA-J and HLA-G positive bladder cancer were detected as well as different metastatic sides with a simultaneously very low uptake to other organs. No adverse side effects were observed. The acquired images obtained with the Lutetium-177 labelled anti-HLA-J JULY-mab and anti-HLA-G LILLY-mab were similar to the previously obtained images using Gallium-68 labelled anti-HLA-J JULY-mAb and Gallium-68 labelled anti-HLA-G Lilly-mab antibodies. PET-CT Images were taken at different time points in order to evaluate the therapeutic response. It could be observed that patients showed response to anti-HLA-J and anti-HLA-G radioimmunotherapy by a decrease in tumor size as well as pathological complete response. In addition, metastases did also decrease in size and number. Some patients showed total pathological complete response to the applied radioimmunotherapy by a total absence of any metastases or tumor.