Increase production of isoprenoids in saccharomyces cerevisiae by carotenoid optimization and screening
10131922 ยท 2018-11-20
Assignee
Inventors
Cpc classification
C12P5/007
CHEMISTRY; METALLURGY
International classification
C12P23/00
CHEMISTRY; METALLURGY
Abstract
The invention is for an increased isoprenoid production by carotenoid optimization in an expression system and the carotegenic gene for optimization may be geranylgeranyl diphosphate synthase (GGPPS), phytoene synthase (PSY1), conserved CRTI or mutated CRT1.sub.A393T, BT1 of S. cerevisae. The carotogenic gene from red yeast which includes Rhodosporidium spp. Rhodotorula spp, Sporidiobolus spp., Leucosporidium spp., Sporobolomyes spp. is selected.
Claims
1. A construct comprising carotenoid genes from red yeasts transformed in Saccharomyces cerevisiae host cell for increased beta-carotenoid production as a major fraction of total carotenoids, wherein the carotenoid genes of the red yeasts are geranylgeranyl diphosphate synthase (GGPPS), phytoene synthase (PSY1) and mutant phytoene desaturase (CRT 1) where said genes are optimized for expression in the Saccharomyces cerevisiae as set forth in SEQ ID NO: 1, 2 and 3; where the Saccharomyces cerevisiae host cell comprises a mutations in the TATA binding protein spt15 and the 3-hydroxy-3-methylglutaryl-Coenzyme A reductase (HMG1) and wherein the phytoene desaturase (CRT 1) gene is mutated CRT1 (A393T) as set forth in SEQ ID NO: 3.
2. The construct as claimed in claim 1, wherein the carotenoid genes are selected from Rhodosporidium spp.
3. The construct as claimed in claim 2, wherein the rhodosporidium is preferably Rhodosporidium toruloides.
4. The construct comprising of carotenoid genes in Saccharomyces cerevisiae as claimed in claim 1, wherein the S. cerevisiae is selected from S. cerevisiae ABC276, S. cerevisiae BY4741, S. cerevisiae CEN.PK21C, S. cerevisiae CEN.PK21D, S. cerevisiae S288C, and S. cerevisiae industrial strains.
5. The construct comprising of carotenoid genes in Saccharomyces cerevisiae as claimed in claim 4, wherein the S. cerevisiae is preferably S. cerevisiae ABC276 and S. cerevisiae CEN.PK21C.
6. The construct as claimed in claim 1, wherein the carotenoid genes are cloned in yeast centromeric plasmids.
7. The construct as claimed in claim 6, wherein the promotor is selected from CYC, TEF, GPD or TDH or a combination of these.
8. The construct as claimed in claim 7, wherein the promotor may be conserved or mutated.
9. The construct as claimed in claim 1, wherein the SPT15 mutants is selected from SPT15.sub.Arg98His, SPT15.sub.Ala100Val, SPT15.sub.Ala101Thr.
10. The construct as claimed in claim 1, wherein HMG1 is preferably truncated.
11. The construct as claimed in claim 1, wherein the carotenoid genes are geranylgeranyl diphosphate synthase (GGPPS), phytoene synthase (PSY1), mutated CRTI.sub.A393T of Rhodosporidium toruloids and BTSI of S. cerevisiae.
Description
BRIEF DESCRIPTION OF THE DRAWINGS AND FIGURES
(1)
(2)
(3) S. cerevisiae transformants produce orange color when transformed with pRS315-TEF-RtGGPPS, p416TEF-RtPSY1 and pRS314TEF-RtCRTI (2a) and white color when transformed with Empty vectorspRS315TEF, p416TEF and pRS314TEF (2b). Transformants were grown on SD-ura-leu-trp plates supplemented with appropriate amino acids at 30 C. for 3 days. After 3 days, photographs were taken. (B) Chemical extraction and analysis of carotenoids as given in methods of TEF.sub.GGPPS+TEF.sub.PSY1+TEF.sub.CRTI engineered strain after growth in 500 mL flasks containing 100 mL media for 5 days. Error bars represent the standard error mean of three flasks.
(4)
(5)
(6) Different promoter combination constructed strains in
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14) CEN.PK-1C strain was transformed with p416TEF-RtPSY1, pRS315GPD-RtCRTI.sub.(A393T) and either with pRS313TEF or pRS313TEF-tHMG1. Transformants were grown in minimal media supplemented with appropriate amino acids for overnight. And then reinoculated in fresh media till mid log phase. Yeast cells then harvested and dilution spotted on SD-ura-trp-his plates supplemented with appropriate amino acids at 0.2, 0.02, 0.002, 0.0002 O.D. Plates were incubated at 30 C. and photographs were taken after 3 days
(15)
(16)
(17)
(18)
(19) S. cerevisiae V1 assay strain was transformed with vector constructs pRS315TEF-tHMG1, pRS313TEF-spt15 mutants. (A) Transformants were grown in SD minimal media supplemented with appropriate amino acids at 30 C. for overnight, reinoculated in fresh media till mid log phase. Yeast cells then harvested and were dilution spotted at 0.2, 0.02, 0.002, 0.0002 O.D on SD-ura-leu-trp-his plates supplemented with appropriate amino acids respectively. Plates were incubated at 30 C. for 4 days and then photographs were taken. (B) The transformants were grown in 500 mL flasks containing 100 mL media for 3 days before extraction and HPLC analysis performed as described earlier.
(20)
(21) S. cerevisiae was transformed with vector constructs pRS315TEF-RtGGPPS, p416TEF-RtPSY1, pRS314TEF-RtCRTI. These transformants along with this constructs contains either empty vector pRS313TEF or pRS313TEF-tHMG1 or pRS313TEF-spt15 mutants. Transformants were grown in SD minimal media supplemented with appropriate amino acids at 30 C. for overnight. And then reinoculated in fresh media till mid log phase. Yeast cells then harvested and were dilution spotted at 0.2, 0.02, 0.002, 0.0002 O.D on SD-ura-leu-trp-his plates supplemented with appropriate amino acids respectively. Plates were incubated at 30 C. for 3 days and then photographs were taken.
(22)
(23) S. cerevisiae was transformed with vector constructs pRS315TEF-RtGGPPS, p416TEF-RtPSY1, pRS314TEF-RtCRTI. These transformants along with this constructs contains either empty vector pRS313TEF or pRS313TEF-tHMG1 or pRS313TEF-spt15 mutants. Cultures were grown in 500 mL flasks containing 100 mL media for 3 days before extraction.
(24)
(25) S. cerevisiae was transformed with vector constructs pRS315TEF-RtGGPPS, p416TEF-AtPS, pRS314TEF-RtCRTI. These transformants along with this constructs contains either empty vector pRS313TEF or pRS313TEF-tHMG1 or pRS313TEF-spt15 mutants. Transformants were grown in SD minimal media supplemented with appropriate amino acids at 30 C. for overnight. And then reinoculated in fresh media till mid log phase. Yeast cells then harvested and were dilution spotted at 0.2, 0.02, 0.002, 0.0002 O.D on SD-ura-leu-trp-his plates supplemented with appropriate amino acids respectively. Plates were incubated at 30 C. for 3 days and then photographs were taken.
(26)
(27)
(28)
(29)
(30)
DETAILED DESCRIPTION OF THE INVENTION
(31) Accordingly, the invention aims at increased isoprenoid production by carotenoid optimization.
(32) Expression system for increased expression of isoprenoid by optimizing the carotenoid genes may be selected but not restricted to S. cerevisiae ABC276, S. cerevisiae BY4741, S. cerevisiae CEN.PK2 1C, S. cerevisiae CEN.PK2 1D, S. cerevisiae S288C, S. cerevisiae industrial strains, Saccharomyces spp., Schizoaccharomyces spp., Pichia spp., Paffia spp., Kluyveromyces spp., Candida spp., Talaromyces spp., Brettanomyces spp., Pachysolen spp., Debaromyces spp., Hansula spp.
(33) The carotegenic gene for optimization may be geranylgeranyl diphosphate synthase (GGPPS), phytoene synthase (PSY1), conserved CRTI or mutated CRTI.sub.A393T, BTS1 of S. cerevisiae and monofunctional phytoene synthase (lycopene synthase) of Arabidopsis thaliana.
(34) The invention aims at increasing -farnesene of the alternate isoprenoid pathway by expressing farnesene synthase gene of Arabidopsos or any plant in S. cerevisiae.
(35) The carotogenic gene may be selected from red yeast which includes Rhodosporidium spp., Rhodotorula spp., Sporidiobolus spp., Leucosporidium spp., Sporobolomyes spp. and Arabidopsis spp. The rhodosporidium may be selected from Rhodosporidium toruloides, Rhodosporidium diobovatum, Rhodosporidium sphaerocarpum, Rhodosporidium kratochilovae.
(36) The carotogenic gene may be selected from Arabidopsis thaliana or plants having 50% homology with carotenoid genes of Arabidopsis.
(37) Codon optimization of the carotenoid genes of the Rhodosporidium spp. is done, using EnCor Biotechnology Inc. software and cloned in yeast centromeric plasmids. The yeast centromeric plasmids p416TEF, pRS313TEF, pRS314TEF, pRS315TEF as well as the same series with the CYC promoter were used for cloning and expression of carotenogenic genes.
(38) The promoter may be CYC, TEF, GPD or TDH or a combination of these. The promoter may be conserved or mutated or a combination.
(39) Further for the identification and reconstruction of the core carotenoid biosynthetic pathway, genes of Rhodosporidium toruloides were cloned into Saccharomyces cerevisiae, the RtGGPPS, RtPSY1 and RtCRTI cDNAs were cloned in yeast single copy (CEN) expression vectors under the TEF promoter and CYC as terminator. These genes were cloned in pRS315TEF, p416TEF and pRS314TEF respectively. These constructs were transformed in S. cerevisiae ABC276 strain and transformants were selected on SD-ura-leu-trp plates. HPLC analysis showed that expression of RtGGPPS, RtPSY1 and RtCRTI were able to produce -carotene (5105.08 g/g DCW), phytoene (2727.95 g/g DCW) and negligible amounts of lycopene (95.47 g/g DCW) based on comparison with retention time of available authentic carotenoid standards.
(40) For the identification of V1 assay strain the replacement of the RtGGPPS with the S. cerevisiae BTS1 was carried out.
(41) Further, gene mutations of SPT15 gene were carried out to increase flux through the isoprenoid pathway and to isolate mutants showing increase flux in the isoprenoid pathway.
(42) For overexpression of truncated HMG1 CoA reductase (tHMG1), the C-terminal catalytic region (1575 bp) was amplified from S. cerevisiae genomic DNA using tHMG1-FP and tHMG1-RP and the amplified tHMG1.
(43) Plasmid vectors, cloning of genes and preparation of transformants are according to the method described in standard biotechnology techniques.
(44) The method of increased isoprenoid flux in Saccharomyces comprises of the following steps:
(45) Codon optimization of the carotenoid genes of the Rhodosporidium spp. as per codon usage frequency of host strain.
(46) Optimization of the promotor for the expression of the carotenoid genes.
(47) Overexpression of HMG1 with or without truncated HMG1.
(48) Overexpression of upc2 with and without mutation
(49) Down regulation of ERG9
(50) The method of increased isoprenoid flux in Saccharomyces comprises of the following steps:
(51) Codon optimization of the carotenoid genes of the Rhodosporidium spp or a conserved gene of Saccharomyces BTS1 or a combination as per codon usage frequency of host strain.
(52) Optimization of the promotor for the expression of the carotenoid genes and identification of the V1 assay strain.
(53) Overexpression of HMG1 with or without truncated HMG1.
(54) Overexpression of upc2 with and without mutation
(55) Down regulation of ERG9
(56) The method of increased isoprenoid flux in Saccharomyces comprises of the following steps:
(57) Codon optimization of the carotenoid genes of the Rhodosporidium spp. or a conserved gene of Saccharomyces BTS1 or a combination as per codon usage frequency of host strain.
(58) Optimization of the promotor for the expression of the carotenoid genes and identification of the V1 assay strain.
(59) Cloning of native or mutant spt15 for increased flux in isoprenoid.
(60) Overexpression of HMG1 with or without truncated HMG1.
(61) Overexpression of upc2 with and without mutation.
(62) Down regulation of ERG9.
(63) The method of increased isoprenoid flux in Saccharomyces comprises of the following steps:
(64) Codon optimization of the carotenoid genes of the Rhodosporidium spp. or a conserved gene of Saccharomyces BTS1 or a combination as per codon usage frequency of host strain.
(65) Optimization of the promotor for the expression of the carotenoid genes and identification of the V1 assay strain.
(66) Cloning of mutant phytoene dehydrogenase (RtCRTI) for increased flux in isoprenoid.
(67) Overexpression of HMG1 with or without truncated HMG1
(68) Overexpression of upc2 with and without mutation
(69) Down regulation of ERG9
EXAMPLES
(70) The following examples are for the purpose of illustration of the invention and are not intended in any way to limit the scope of the invention.
Example 1: Plasmid Vectors, Cloning of Genes and Transformation
(71) The yeast centromeric plasmids p416TEF, pRS313TEF, pRS314TEF, pRS315TEF as well as the same series with the CYC promoter were used for cloning and expression of carotenogenic genes. pRS313TEF, pRS314TEF and pRS315TEF were constructed by excising the MCS and TEF promoter regions from p416TEF plasmid and cloning into pRS313, pRS314 and pRS315 respectively. The genes for GGPP synthase (RtGGPPS), Phytoene synthase (RtPSY1) and Phytoene dehyrogenase (RtCRTI) of R. toruloides were Codon optimized by using EnCor Biotechnology Inc. software and custom synthesized by GenScript USA Inc. and cloned in pRS315TEF, p416TEF, pRS314TEF respectively. RtGGPPS was cloned at the XbaI and BamHI sites of pRS315TEF to construct pRS315TEF-RtGGPPS, RtPSY1 was cloned at BamHI and XhoI sites of p416TEF to yield p416TEF-RtPSY1 while RtCRTI is cloned at BamHI and SalI site to construct pRS314TEF-RtCRTI. For overexpression of truncated HMG1 CoA reductase (tHMG1), the C-terminal catalytic region (1575 bp) was amplified from S. cerevisiae genomic DNA using tHMG1-FP and tHMG1-RP and the amplified PCR product was cloned at the BamHI and XmaI sites of pRS313TEF to construct pRS313TEF-tHMG1. For construction of p416CYC-RtPSY1, p416TEF-RtPSY1 is digested with SacI and BamHI to excise the TEF promoter and ligated with SacI and BamHI digested CYC1 promoter from p414CYC1 vector. pRS314CYC-RtCRTI was constructed similarly. pRS315CYC-RtGGPPS was constructed from pRS315TEF-RtGGPPS by digesting with XbaI and SacI to excise the TEF promoter and ligated with XbaI and SacI digested CYC1 promoter of p414CYC1 vector. SPT15 was amplified from S. cerevisiae ABC 276 strain by using the forward and reverse primers and cloned in the BamHI and XhoI sites of pRS313TEF. The cDNA for -Farnesene synthase (Locus AT4G16740 and clone no. U88221) from A. thaliana was obtained from TAIR database, USA. It was PCR amplified and subcloned in XbaI and BamHI site of pRS315TEF to make the construct pRS315TEF-AtFS. The cDNA for phytoene synthase from A. thaliana (Locus AT5G17320) was obtained from TAIR database, USA. It was PCR amplified and subcloned in BamHI and XhoI site of p416TEF to make construct p416TEF-AtPS. All these constructs were transformed into S. cerevisiae strain (ABC276) by Lithium acetate method (Sambrook et al., 1989). All the primers and plasmids constructed to perform the invention are indicated in Table 1 and Table 2 below.
(72) TABLE-US-00001 TABLE1 Listofoligonucleotidesandtheirsequences Oligomer Sequence(5-3) tHMG1F GATCGCGGATCCATGGACCAATTGGTGAAAACTGAAG tHMG1R CATGCGCCCGGGTTAGGATTTAATGCAGGTGACG SPT15F GATCGCGGATCCATGGCCGATGAGGAACGTTTAAAG SPT15R CATGCGCTCGAGTCACATTTTTCTAAATTCAC AtFSF GACGTTCTAGAATGCCTAAACGACAGGCTCAAC AtFSR GGCTCGGATCCTTAATTGAGTGGAAGAGGGTGG AtPSF ACGCATGGATCCATGTCTTCAAGCTTAGTAGCAAG AtPSR GGTCATATTTCTACTGGTTTGCCATCTTCTTCTG
(73) TABLE-US-00002 TABLE 2 Lists of plasmid used Plasmids Relevant features p416TEF-PSY1 p416 TEFp-PSY1-CYC1t pRS314TEF-CRTI pRS314 TEFp-CRTI-CYC1t pRS315TEF-RtGGPPS pRS315 TEFp-GGPPS-CYC1t pRS314TEF-RtCRTI(A393T) pRS314TEFp-CRTI.sub.A393T-CYC1t pRS313TEF-tHMG1 pRS313 TEFp-tHMG1-CYC1t pRS313TEF-SPT15 pRS313 TEFp-SPT15-CYC1t p416CYC-RtPSY1 p416 CYC1p-PSY1-CYC1t pRS314CYC-RtCRTI pRS314 CYC1p-CRTI-CYC1t pRS315CYC-RtGGPPS pRS315 CYC1p-GGPPS-CYC1t pRS314CYC-RtCRTI(A393T) pRS314CYCp-CRTI.sub.A393T-CYC1t pRS314GPD-RtCRTI(A393T) pRS314GPDp-CRTI.sub.A393T-CYC1t pRS313TEF-SPT15(R98H) pRS313 TEFp-SPT15.sub.R98H-CYC1t pRS313TEF-SPT15(A100T) pRS313 TEFp-SPT15.sub.A100T-CYC1t pRS313TEF-SPT15(A101V) pRS313 TEFp-SPT15.sub.A101V-CYC1t pRS315TEF-AtFS pRS315 TEFp-AtFS-CYC1t p416TEF-AtPS p416TEFp-AtPS-CYC1t
(74) Strains and Media:
(75) Escherichia coli strain DH5 was used as cloning host. S. cerevisiae strains CEN, PK2-1C-MAT , ura 3-52, trp 1-289, leu2-3_112, his31, MAL 2-8.sup.c, SUC2 and S. cerevisiae strain (ABC 276) which is a derivative of S288c strain with genotype MAT ura 3-52 leu21 his3200 trp1 lys2-801 GAL are used in this study. The strain was derived from tetrad analysis of diploids made between BJ5418 and BJ5458 strains which are obtained from the Beth Joan laboratory. These strains were maintained on yeast extract, peptone and dextrose (YPD) media. For culturing yeast-synthetic defined media (SD) containing yeast nitrogen base (YNB) without ammonium sulphate 0.15% (w/v) and amino acids supplemented with appropriate amino acids and 0.5% (w/v) ammonium sulphate and 2% (w/v) D-glucose is used.
(76) Extraction of Carotenoids and Analysis by HPLC:
(77) Extraction of carotenoids was carried out earlier (Moline et al., 2012) with some modifications. Essentially, yeast cells were grown in 100 mL SD media supplemented with appropriate amino acids and grown at 30 C. with shaking (250 rpm). After five days, cells were harvested and washed with deionized water and kept at 20 C. To the frozen pellet was added 3 mL of Dimethyl sulphoxide (DMSO), vortexed for 1 min and incubated at 55 C. in the water bath for 1 hour. 1 g 0.50-0.75 mm glass beads were added, and cells broken using glass bead beater. Cells were centrifuged to remove the cell debris. Acetone was added to the pellet, vortexed and centrifuged and the process repeated till the pellet becomes colorless. The acetone and DMSO fractions were mixed with an equal amount of Hexane. The colored hexane layer was collected after separation of two layers. The hexane layer was washed with distilled water and then with brine solution twice. The colored hexane layer was collected. The solvent was evaporated under rotary evaporator to dryness in dim light and was dissolved in 1 mL hexane for analysis by high performance liquid chromatography (HPLC). HPLC separation and quantification was performed on Waters system using C.sub.18-5 m intersil ODS-P, 2504.6 mm column (LCGC) using solvent acetonitrile:methanol:2-propanol (85:10:5 v/v) with flow rate 1 mL/min at 32 C. Separated carotenoids were detected by photodiode array detector. Quantification of carotenoids was done by using standard curve prepared for -carotene, lycopene and phytoene. Standards for -carotene and lycopene were obtained from Sigma Aldrich, India and phytoene were obtained from Carote Nature GmbH, Switzerland. Standards of -carotene, lycopene and phytoene were dissolved in hexane and the concentration of -carotene, lycopene were calculated using extinction coefficient (A.sup.1%) of 2590, 3450 in hexane respectively and the concentration of phytoene was calculated using extinction coefficient (A.sup.1%) of 750 in hexane/2% CH.sub.2Cl.sub.2. Concentration of -carotene, lycopene and phytoene in samples were expressed in g per g dry cell weight (g/g DCW). For calculating the dry cell weight, samples were kept at 80 C. in an oven for 48 hours and their dried weights were measured.
(78) In Vitro Mutagenesis:
(79) Random mutagenesis in vitro was performed on the purified plasmids by Hydroxlyamine as described earlier (Rose and Fink 1987). The average number of mutations obtained from hydroxylamine mutagenesis was approximately 1 per kb.
(80) Dilution Spotting for Growth and Colour Visualization:
(81) Yeast cells were grown overnight in SD media supplemented with appropriate amino acids, re-inoculated in fresh media at 0.1 O.D and grown to 0.6-0.8 O.D. Yeast cells were harvested, washed with deionized water and re-suspended at different dilutions. 10 l of different dilutions at 0.2, 0.02, 0.002 and 0.0002 O.D are spotted on SD plate supplemented with appropriate amino acids.
(82) Modelling of Phytoene Dehydrogenase:
(83) Modelling of phytoene dehydrogenase of R. toruloides was performed using Phyre2 (http://www.sbg.bio.ic.ac.uk/phyre2). Phytoene dehydrogenase from Pantoea ananatis (PDB Id-4DGK) was used as a template for modelling.
(84) Identification and Quantification of -Farnesene:
(85) S. cerevisiae ABC 276 was transformed with pRS315TEF-AtFS. Transformants were grown in SD media containing appropriate amino acids. Secondary culture was grown at 0.05 O.D and when O.D reaches to 0.6-0.8, culture was overlaid with 10% dodecane. After 48 hrs, the dodecane phase of the two-phase culture was collected by centrifugation of culture at 6000 rpm for 5 minutes. 1 uL of dodecane phase was subjected to GC-FID analysis. Samples were injected at a split ratio of 1:10. The oven temperature was initially held at 80 C. for 1 min and was increased at a rate of 10 C./min to 250 C. where it was held for 1 minute. Carrier gas was nitrogen. And the temperature of detector was maintained at 260 C. All the conditions used for GC analysis was followed from Wang et al., 2011. Standard curve of trans Farnesene was prepared using GC-FID. Trans -Farnesene (Cat. 73492) from Sigma Aldrich, India was used as standard.
(86) Sequence Accession Numbers:
(87) The codon optimized and custom synthesized genesGGPP synthase (RtGGPPS), Phytoene synthase (RtPSY1) and phytoene dehydrogenase (RtCRTI) were submitted to Genbank database and have the following accession numbers KU041640, KU041641 and KU041642 respectively.
Example 2: Identification and Reconstruction of the Core Carotenoid Biosynthetic Pathway Genes of Rhodosporidium toruloides into Saccharomyces cerevisiae
(88) As the red yeasts that includes R. toruloides are amongst the highest producers of -carotene, the core carotenoid pathway of R. toruloides was reconstructed in S. cerevisiae. The core pathway involves three enzymes-GGPP synthase, Phytoene synthase and Phytoene dehydrogenase. Expression of these genes has been predicted to produce -carotene in addition to torulene and -carotene (
(89) Using the genome sequence information from the genome sequence of this yeast that we recently described along with others (Kumar et.al, 2012; Zhu et.al., 2012) identified the putative genes that code for Geranylgeranyl diphosphate synthase (RtGGPPS), Phytoene synthase (RtPSY1) and Phytoene dehydrogenase (RtCRT1). The putative gene and protein sequences were retrieved and genes with ORF numbers as RtGGPPS (RHTO_02504), Phytoene synthase (RHTO_04605) and Phytoene dehydrogenase (RHTO_04602) were obtained.
(90) The GGPP synthase gene encodes a protein of 359 aa with 62% similarity (E-value 2e-112) to GGPPS from X. dendrorhous.
(91) The Phytoene synthase gene encodes a protein of 612 aa with 45% similarity (E-value 4e-76) to the phytoene synthase of X. dendrorhous.
(92) The predicted Phytoene dehydrogenase of R. toruloides is 610 aa in length (suppl Table 1)
(93) TABLE-US-00003 BLAST with BLAST with X. dendrorhous N. crassa No. of No. of E-value E-value Enzymes introns Exons Length Similarity Similarity GGPP 07 08 359aa 2e112 2e116 synthase 62% 73% (RtGGPPS) Phytoene 07 08 612aa 4e76 2e110 synthase 45% 54% (RtPSY1) Phytoene 09 10 610aa 2e176 3e174 dehydro- 68% 70% genase (RtCRTI)
(94) However, the protein appeared to have an extra N-terminal of 56 amino acids as compared to the phytoene dehydrogenase of X. dendrorhous and other phytoene dehydrogenases (Suppl
(95) As the genes contained multiple introns, and as R. toruloides has a high G-C content compared to S. cerevisiae, we opted to custom synthesize the cDNAs for these genes after codon optimization for expression in S. cerevisiae.
(96) The RtGGPPS, RtPSY1 and RtCRTI cDNAs were cloned in yeast single copy (CEN) expression vectors under the TEF promoter and CYC as terminator. These genes were cloned in pRS315TEF, p416TEF and pRS314TEF respectively. These constructs were transformed in S. cerevisiae ABC276 strain and transformants were selected on SD-ura-leu-trp plates. Expression of these genes produced a deep orange color in yeast (
(97) HPLC analysis showed that expression of RtGGPPS, RtPSY1 and RtCRTI were able to produce -carotene (5105.08 g/g DCW), phytoene (2727.95 g/g DCW) and negligible amounts of lycopene (95.47 g/g DCW) based on comparison with retention time of available authentic carotenoid standards (
Example 3: Effect of Different Promoter Combinations with RtGGPPS, RtPSY1 and RtCRTI on Pigmentation Levels
(98) To use colour of carotenoid as a visual screen for increasing the flux in the isoprenoid pathway, we needed a strain that would produce low level of carotenoids (hence less colour), but would show increased pigmentation if the flux in the pathway was be increased. To set about constructing such a strain in S. cerevisiae, RtGGPPS, RtPSY1, RtCRTI was cloned and expressed under the weak CYC promoter (and CYC terminator). A S. cerevisiae strain was separately transformed with different TEF and CYC promoter combination of RtGGPPS, RtPSY1, RtCRTI genes constructs. The transformants were spotted and a wide variation in color was observed (
Example 4: Increasing the Flux in the Isoprenoid Pathway by Over Expression of tHMG1 Fails to Increase Pigmentation Levels and Carotenoid Levels in the Different Strain Background: RtCRTI as the Possible Rate Limiting Step
(99) To check whether the low color producing strains could be used for identification of regulatory/flux determining genes of the isoprenoid pathway, the truncated catalytic domain of HMG1 (tHMG1) which is known to increase the flux in the pathway, was overexpressed in these different promoter combination strains. The overexpression of tHMG1 in these different strains did not show an increase in color despite an expected increase in flux in the isoprenoid pathway (
(100) HPLC analysis of TEF.sub.GGPPS+TEF.sub.PSY1+TEF.sub.CRTI strain containing either an empty vector or tHMG1 was carried out. Comparison of strains with and without over expression of tHMG1 revealed that with over expression of tHMG1, there is 2.84 fold increase in levels of phytoene, but only 1.77 fold increase in the levels of -carotene suggesting that the dehydrogenation/desaturation of phytoene is limiting is provided in table 3.
(101) TABLE-US-00004 TABLE 3 Yield of carotenoids in different background strains. -carotene Lycopene Phytoene conc. (ug/g conc. (ug/g conc. (ug/g Sr. no. Sample ID DCW) DCW) DCW) 1. TGGPPS + TPSY1 + TCRTI 5105.08 95.47 2727.95 2. TGGPPS + TPSY1 + TCRTI + pRS313TEF 5444.56 34.63 2770.32 3. TGGPPS + TPSY1 + TCRTI + TtHMG1 9673.1 60.97 7890.52 4. TGGPPS + TPSY1 + CCRTI 127.62 25.93 13357.80 5. TGGPPS + TPSY1 + CCRTI (A393T) 532.87 29.73 2896.80 6. TGGPPS + TPSY1 + TCRTI(A393T) + pRS313TEF 14727.03 95.60 6398.22 7. TGGPPS + TPSY1 + TCRTI(A393T) + TtHMG1 11475.52 51.70 8409.68 8. TPSY1 + GPDCRTI(A393T) + pRS313TEF 39.04 ND ND 9. TPSY1 + GPDCRTI(A393T) + TtHMG1 144.08 5.47 185.36
Example 5: Isolation of Catalytically Efficient Mutants of Phytoene Dehydrogenase by the Pigmentation Screen
(102) To increase phytoene desaturation, one possible approach that has been tried earlier (Verwaal et.al., 2006) is to increase the expression levels of RtCRTI either by increasing the copy number of the plasmid, or the promoter strength driving expression. However, as both these approaches tends to place a higher load on the cells capabilities, it was attempted to isolate more active mutants of the rate limiting phytoene dehyrogenase (RtCRTI). In vitro random mutagenesis of phytoene dehydrogenase in the plasmid pRS314CYC-RtCRTI (where Phytoene dehydrogenase was under the weak CYC promoter) was carried out. The library of CRTI mutants in this plasmid was directly transformed into the S. cerevisiae strain with TEF.sub.GGPPS+TEF.sub.PSY1 plasmids. Transformants were selected on SD-leu-ura-trp plates and screened on the basis of increased color as compared to the color of control strain with TEF.sub.GGPPS+TEF.sub.PSY1+CYC.sub.CRTI. A total of six mutants was initially picked up, and after isolation of the plasmids, and amplification through E. coli, and retransformation, three mutants could be confirmed to confer increase pigmentation to the strains. The plasmids were subjected to sequencing. Two mutants were found to have an Alanine 393 to Threonine mutation in the coding sequence, while one mutant was found to have an Alanine394 to Glycine mutation. Interestingly, all three mutants clustered in the same region. These mutants produce more color as compared to control S. cerevisiae strain with TEF.sub.GGPPS+TEF.sub.PSY1+CYC.sub.CRTI but less color as compared to S. cerevisiae strain with TEF.sub.GGPPS+TEF.sub.PSY1+TEF.sub.CRTI suggesting more active than wild type RtCRTI (
(103) Sequence analysis and conservation pattern of the Ala393 and Ala394 residues of phyotene dehydrogenase of R. toruloides with similar enzymes of other fungi and bacteria revealed that the residues were not conserved among bacteria and fungi (Suppl
(104) The phytoene dehydrogenase of R. toruloides was modeled on the crystal structure of Pantoea ananatis (PDB Id-4DGK). The residues Ala393 and Ala394 were, however, not present in active site. To see whether mutation has increased activity of CRTI, we quantitated carotenoids by HPLC. HPLC analysis showed that there is 4.6 fold decrease in levels of phytoene and 4.17 fold increase in -carotene levels with the mutant enzyme as compared to the wild type enzyme (
Example 6: A Pigmentation-Based Phenotypic Screen that Responds to Increased Flux in the Isoprenoid Pathway as Seen by Overexpression of tHMG1
(105) Since the RtCRTI enzyme was rate limiting with overexpression of tHMG1, the RtCRTI.sub.A393T mutant was included to optimize the genetic screen for increase in color with increase in the flux (with overexpression of tHMG1). The pRS313TEF-tHMG1 plasmid was transformed in different combination strain of pRS314CYC-RtCRTIA.sub.A393T.
(106) However, surprisingly, none of the combinations showed expected increase in color with tHMG1 (
(107) To determine whether the combination of plasmids used in the V1 assay strain behaved similarly in other S. cerevisiae strain backgrounds, industrially important strain of S. cerevisiae-CEN.PK-1C was examined and transformed it with V1 assay combination plasmids along with either pRS313TEF or pRS313TEF-tHMG1. Results (
Example 7: Isolation of Mutants in SPT15, the Global TATA Binding Protein Using the Phenotypic Pigmentation Screen Reveals Mutations in SPT15 that can Significantly Increase the Flux in the Isoprenoid Pathway
(108) To evaluate the screen for its ability to pickup new genes it was decided to examine if mutants in a global TATA binding protein (TBP), SPT15 could be isolated that could result in increased flux in isoprenoid pathway. SPT15 was cloned downstream of the TEF and subjected to random in vitro mutagenesis with hydroxylamine. The SPT15 mutant library was transformed into the yeast strain bearing the carotenogenic plasmids developed as the host for the phenotypic screen as described above. A total of 6 colonies were initially selected on the basis of enhanced color as compared to control background strain. Plasmids were isolated from these strains, purified and amplified through E. coli, retransformed into the yeast strain and spotted to confirm the phenotype (
(109) To confirm the increased flux through the pathway, the carotenoid levels of the three mutants with a control strain was compared, and also with strains bearing the wild type SPT15. It was observed that the R98H mutant showed a greater than 7-fold increase in -carotene with only a marginal increase in phytoene. In contrast the A100V and A101T mutants showed an approximately 3-fold increase in -carotene and a significant decrease in phytoene levels (
(110) It also examined whether combining the tHMG1 along with the spt15 mutants could lead to further enhancement in carotenoid levels. tHMG1 was combined with spt15.sub.(A101T) in the V1 assay strain but could not find any further increase with this combination (
(111) Strains with Non-Limiting Concentrations of GGPP also Show Elevated Levels of Carotenoids with the spt15 Mutants:
(112) The V1 assay strain was designed for the isolation of mutants that increase the flux in the isoprenoid pathway. However, considering that the strain was very limiting for GGPP (since it carried the native S. cerevisiae GGPP synthase under its own promoter), it was if the mutants isolated through the screen would also be able to confer increased flux under conditions where GGPP was not limiting. The transformed spt15 mutants in S. cerevisiae strain having RtGGPPS, RtPSY1, RtCRTI genes were expressed under the strong TEF promoter (and CYC terminator). These transformants were dilution spotted on SD plates. It has been observed that in this strain background, when tHMG1 is over expressed, the colour of the strain decreases despite the increase in the flux in the isoprenoid pathway. However, in the present study it was observed with over expression of spt15 mutants the colour did not decrease but rather a marginal increase in colour was observed with over expression of spt15 mutants (
(113) The results indicate that even though the strain background had limiting GGPP conditions, it was not a requirement for the increase in flux, and even high GGPP conditions could lead to further increase isoprenoids, with the mutants isolated through this screen.
Example 8: Spt15 Mutants, Yield Increased Levels of the Sesquiterpene, -Farnesene Level of Isoprenoid Expression Using the Expression Construct
(114) Levels of -farnesene was quantified which is synthesized from FPP. The farnesene synthase gene from Arabidopsis was overexpressed in S. cerevisiae and levels of farnesene in presence of SPT15 mutants was estimated.
(115) To investigate whether the isolated spt15 mutants were increasing the yield of only carotenoids through RtCRTI or if they were increasing the flux in the isoprenoid pathway in S. cerevisiae, we chose to examine an alternative isoprenoid, the sesquiterpene -Farnesene (which is produced from FPP in the isoprenoid pathway) in S. cerevisiae. We expressed the -Farnesene synthase gene of A. thaliana in S. cerevisiae ABC 276 strain and quantified the production of -Farnesene.
(116) Expression of the -Farnesene synthase gene of A. thaliana produced very little amounts of -Farnesene (0.29 g/L/O.D) but it was adequate to test the effects of the spt15 mutants. With over expression of either tHMG1 or any of the different spt15 mutants, the yield of -Farnesene increases upto 1.5 fold. tHMG1 also led to an approximately similar fold increase in -Farnesene. The maximum increase in -Farnesene was observed with over expression of spt15.sub.(A101T) (0.44 g/L/O.D) (Table 5).). The increase in the levels of -Farnesene with spt15 mutants suggests that they are increasing the flux in the isoprenoid pathway and their effects are not exclusive to the carotenoid pathway.
(117) TABLE-US-00005 TABLE 5 Yield of -Farnesene obtained in different strain backgrounds. T- TEF promoter, AtFS--Farnesene synthase from Arabidopsis thaliana Sr. no. Strain Background -Famesene(g/L/O.D) 1. T.sub.313 + T.sub.AtFS 0.29 0.02 2. T.sub.tHMG1 + T.sub.AtFS 0.38 0.04 3. T.sub.SPT15WT + T.sub.AtFS 0.24 0.04 4. T.sub.SPT15(R98H) + T.sub.AtFS 0.37 0.02 5. T.sub.SPT15(A100V) + T.sub.AtFS 0.39 0.05 6. T.sub.SPT15(A100V) + T.sub.AtFS 0.44 0.02
Example 9: V2 Assay Strain
(118) The expression of carotenogenic genes from R. toruloides (red yeast) results in the production of a mixture of carotenoids owing to the bifunctional nature of some of the enzymes. As the color of each of the different carotenoids is different, the presence of these mixture of carotenoids can interfere with correlations of increased pigmentation with increased flux in the isoprenoid pathway. Hence it was attempted to develop a strain that makes a single colored carotenoid which can be then used as a more reliable marker for flux. The present study aimed at producing one carotenoid in the yeast cell so that increase in its color will better reflect the increase in the flux in the isoprenoid pathway. Lycopene being the first colored product in the carotenoid pathway, for production of lycopene in S. cerevisiae, three genespRS315TEF-RtGGPPS, pRS314TEF-AtPS and pRS314TEF-RtCRTI were transformed. It has GGPP synthase (RtGGPPS) and phytoene dehydrogenase (RtCRTI) from R. toruloides and phytoene synthase (AtPS) from A. thaliana which lacks lycopene cyclase activity. (Most other phytoene synthases including the Phytoene synthase of R. toruloides are bifunctional in nature and in addition to the phytoene synthase activity also contain the lycopene cyclase activity). This strain produces Lycopene (128.518.07 g/g DCW) as the major carotenoid and does not produce -carotene. When this strain was validated with over expression of known flux increaser of the isoprenoid pathway, tHMG1, an increase in the colour had been observed. The increase in the colour suggests that this strain combination can be used as assay strain for indicating the flux in the isoprenoid pathway. (or for isolation of mutants that will increase the flux in the isoprenoid pathway). This is designated as V2 assay strain. This V2 assay strain when transformed with the spt15 mutants (isolated using V1 assay strain) and transformants were dilution spotted on SD plates. An increase in the colour with spt15 mutants was observed (
(119) Advantages:
(120) Developed a carotenoid-based visual genetic screen for increased isoprenoid flux in Saccharomyces cerevisiae.
(121) Rhodosporidium toruloides carotenogenic genes functionally expressed in S. cerevisiae with high yields of -carotene
(122) Catalytically efficient mutant of Phytoene dehydrogenase (RtCRTI A393T) isolated that yields higher -carotene levels
(123) Isolated novel mutants of global transcription factor SPT15 that increase the yield of isoprenoids and carotenoids.
(124) SPT15 mutants also show increase in the yield of alternative isoprenoid--Farnesene.
REFERENCES
(125) Ajikumar, P. K., Xiao, W. H., Tyo, K. E., Wang, Y., Simeon, F., Leonard, E., Mucha, O., Phon, T. H., Pfeifer, B., Stephanopoulos, G., 2010. Isoprenoid pathway optimization for taxol precursor overproduction in Escherichia coli. Science 330, 70-74 Alper, H., Moxley, J., Nevoigt, E., Fink, G. R., Stephanopoulos, G., 2006. Engineering yeast transcription machinery for improved ethanol tolerance and production. Science (New York, N.Y.) 314, 1565-8. Alper, H., Stephanopoulos, G., 2007. Global transcription machinery engineering: a new approach for improving cellular phenotype. Metabolic engineering 9, 258-67. Al-Babili, S., Hoa, T. T., Schaub, P., 2006. Exploring the potential of the bacterial carotene desaturase CrtI to increase the beta-carotene content in Golden Rice. Journal of experimental botany 57, 1007-14. Bleichenbacher, M., Tan, S., Richmond, T., 2003. Novel Interactions Between the Components of Human and Yeast TFIIA/TBP/DNA Complexes. Journal of Molecular Biology 332, 783793. Bohlmann, J., Keeling, C. I., 2008 Terpenoid biomaterials. Plant Journal 54, 656-669. Caniard A, Zerbe P, legrand S, Cohade A, Valot N, et al. (2012) discovery and functional characterization of two diterpene synthases for sclareol biosynthesis in Salvia sclarea (L.) and their relevance for perfume manufacture. BMC Plant Biol 12: 119. Chasman, D., Flaherty, K., Sharp, P., Kornberg, R., 1993. Crystal structure of yeast TATA-binding protein and model for interaction with DNA. Proceedings of the National Academy of Sciences 90, 8174-8178. Guo, W., Tang, H. and Zhang, L. (2014), Lycopene cyclase and phytoene synthase activities in the marine yeast Rhodosporidium diobovatum are encoded by a single gene crtYB. J. Basic Microbiol., 54: 1053-1061. doi: 10.1002/jobm.201300920 Hunter, W. N., 2007. The non-mevalonate pathway of isoprenoid precursor biosynthesis. Journal of Biological Chemistry 282, 21573-21577 Jiang Y; Proteau P; Poulter D; Ferro-Novick S., 1995. BTS1 encodes a geranylgeranyl diphosphate synthase in Saccharomyces cerevisiae. Journal of Biological Chemistry. 270, 21793-99. Kumar, S., Kushwaha, H., Bachhawat, A., Raghava, G., Ganesan, K., 2012. Genome sequence of the oleaginous red yeast Rhodosporidium toruloides MTCC 457. Eukaryotic cell 11, 1083-4. Li, Q., Sun, Z., Li, J., Zhang, Y., 2013. Enhancing beta-carotene production in Saccharomyces cerevisiae by metabolic engineering. FEMS microbiology letters 345, 94-101. Misawa, N., Nakagawa, M., Kobayashi, K., Yamano, S., Izawa, Y., Nakamura, K., Harashima, K., 1990. Elucidation of the Erwiniauredovora carotenoid biosynthetic pathway by functional analysis of gene products expressed in Escherichia coli. Journal of bacteriology 172, 6704-12. Molin, M., Libkind, D., van Broock, M., 2012. Production of torularhodin, torulene, and -carotene by Rhodotorula yeasts. Methods in molecular biology (Clifton, N.J.) 898, 275-83. Nacken, V., Achstetter, T., Degryse, E., 1996. Probing the limits of expression levels by varying promoter strength and plasmid copy number in Saccharomyces cerevisiae. Gene 175, 253260. Nelis, H. J., De Leenheer., A. P., 1991. Microbial sources of carotenoid pigments used in foods and feeds. J. Appl. Bacteriol. 70, 181-191 zaydin, B., Burd, H., Lee, T. S., Keasling, J. D., 2013. Carotenoid-based phenotypic screen of the yeast deletion collection reveals new genes with roles in isoprenoid production. Metabolic engineering 15, 174-83. Ro, D. K., Paradise, E. M., Ouellet, M., Fisher, K. J., Newman, K. L., Ndungu, J. M., Ho, K. A., Eachus, R. A., Ham, T. S., Kirby, J., Chang, M. C., Withers, S. T., Shiba, Y., Sarpong, R., Keasling, J. D., 2006. Production of the antimalarial drug precursorartemisinic acid in engineered yeast. Nature 440, 940-943. Rose M D, Fink G R. 1987. KAR1, a gene required for function of both intranuclear and extranuclear microtubules in yeast. Cell 48: 1047-1060. Schalk M (2011) Method for producing sclareol. US20110041218 A1. Firmenich S A Szappanos, B., Kova cs, K., Szamecz, B., Honti, F., Costanzo, M., Baryshnikova, A., Gelius-Dietrich, G., Lercher, M. J., Jelasity, M., Myers, C. L., Andrews, B. J., Boone, C., Oliver, S. G., Pa l, C., Papp, B., 2011. An integrated approach to characterize genetic interaction networks in yeast metabolism. Nat. Genet. 43, 656-662. Sambrook J, Fritsch E F, Maniatis T. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Press: Cold Spring, Harbor, N.Y. Schaub, P. et al., 2012. On the structure and function of the phytoene desaturase CRTI from Pantoeaananatis, a membrane-peripheral and FAD-dependent oxidase/isomerase. PloS one 7, e39550. Ukibe, K., Hashida, K., Yoshida, N., Takagi, H., 2009. Metabolic engineering of Saccharomyces cerevisiae for astaxanthin production and oxidative stress tolerance. Applied and environmental microbiology 75, 7205-11. Verwaal R, Wang J, Meijnen J-P, Visser H, Sandmann G, van den Berg J A, et al 2007; High-level production of beta-carotene in Saccharomyces cerevisiae by successive transformation with carotenogenic genes from Xanthophyllomycesdendrorhous. Appl Environ Microbiol 73:4342-50. Wriessnegger T and Pichler H., 2013. Yeast metabolic engineering: targeting sterol metabolism and terpenoid formation. ProgLipid Res. 52(3), 277-93. Yamano, S., T. Ishii, M. Nakagawa, H. Ikenaga, and N. Misawa. 1994. Metabolic engineering for production of beta-carotene and lycopene in Saccharomyces cerevisiae. Biosci. Biotechnol. Biochem. 58:1112-1114. Yuan, J., Ching, C. B., 2014. Combinatorial engineering of mevalonate pathway for improved amorpha-4,11-diene production in budding yeast. Biotechnology and bioengineering 111, 608-17. Zhao, H., Li, J., Han, B., Li, X., Chen, J., 2014. Improvement of oxidative stress tolerance in Saccharomyces cerevisiae through global transcription machinery engineering. Journal of Industrial Microbiology & Biotechnology 41, 869-878 Zhu, Z. et al., 2012. A multi-omic map of the lipid-producing yeast Rhodosporidiumtoruloides. Nature communications 3, 1112.