Multivalent Plant Immune Fusion Protein, Production Method Thereof and Its Use

20230053680 · 2023-02-23

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention belongs to the field of biotechnology, in particular to a multivalent fusion protein AB-NAC-189, method for producing the same, and uses thereof. The protein AB-NAC-189 is a fusion of a polypeptide segment AB, nascent polypeptide-associated complex (NAC), and a protein 189 corresponding to amino acids 1-189 from the N-terminal of protein HarpinEa. The fusion has the properties of a multivalent plant immune protein, thus it can effectively stimulate the hypersensitive response of tobacco leaves and has good thermal stability. While stimulating the immune response of plants, it can also improve the disease resistance of plants and promote plant growth. The AB-NAC-189 multivalent vaccine shows higher activity per unit concentration, and greater ability to promote growth of wheat and tobacco; meanwhile it can significantly promote chlorophyll synthesis in Goji berry, thereby improving the yield and quality of Goji berries.

    Claims

    1. A multivalent plant immune fusion protein, wherein, the fusion protein is a protein AB-NAC-189, which is a multivalent plant immune fusion protein produced by the fusion of the following: a polypeptide segment AB encoded by a Hpal.sub.Xoo gene derived from Xanthomonas oryzae pv.oryzae (Xoo), an alpha subunit of nascent polypeptide-associated complex (NAC) derived from Alternaria sp., and an amino acid sequence HrpN189 comprising amino acids 1-189 from an N-terminus of protein HrpN derived from Erwinia amylovora.

    2. The multivalent plant immune fusion protein of claim 1, wherein, the protein AB-NAC-189 comprises an amino acid sequence from: (1) an amino acid sequence as shown in SEQ ID NO: 1; or (2) an amino acid sequence that is 75% or more homologous to the amino acid sequence of SEQ ID NO: 1; or (3) an amino acid sequence having the same function as SEQ ID NO: 1, obtained from substitution and/or deletion and/or addition of one or more amino acids on the basis of the amino acid sequence of SEQ ID NO:1.

    3. A nucleic acid encoding the multivalent plant immune fusion protein of claim 1.

    4. The nucleic acid of claim 3, wherein the nucleic acid sequence is as shown in SEQ ID NO:2.

    5. A recombinant vector and a recombinant bacterium, wherein the recombinant vector and the recombinant bacterium comprise the nucleic acid of claim 3.

    6. A method of preparing a multivalent plant immune fusion protein, comprising inoculating the recombinant bacterium of claim 5 into a fermentation medium with an inoculum size of 1-10%, and IPTG is added, when OD.sub.600 reaches 0.6-1.8, to obtain a final concentration of 0.1-0.6 mM for low-temperature induction at 15-20° C. and 200 rpm for 16-20 h; wherein the fusion protein is a protein AB-NAC-189, which is a multivalent plant immune fusion protein produced by the fusion of the following: a polypeptide segment AB encoded by a Hpal.sub.Xoo gene derived from Xanthomonas oryzae pv.oryzae (Xoo), an alpha subunit of nascent polypeptide-associated complex (NAC) derived from Alternaria sp., and an amino acid sequence HrpN189 comprising amino acids 1-189 from an N-terminus of protein HrpN derived from Erwinia amylovora.

    7. A method of the multivalent plant immune fusion protein in promoting plant-growth or preparing plant-growth promoters, comprising taking the multivalent plant immune fusion protein to prepare a plant-growth promoter; wherein the fusion protein is a protein AB-NAC-189, which is a multivalent plant immune fusion protein produced by the fusion of the following: a polypeptide segment AB encoded by a Hpal.sub.Xoo gene derived from Xanthomonas oryzae pv.oryzae (Xoo), an alpha subunit of nascent polypeptide-associated complex (NAC) derived from Alternaria sp., and an amino acid sequence HrpN189 comprising amino acids 1-189 from an N-terminus of protein HrpN derived from Erwinia amylovora.

    8. The method of claim 7 comprising preparing a solution of the protein AB-NAC-189 with a final concentration of 0.125-50 μg/mL, performing foliar sprays or root irrigation with the solution or a mixture of the solution and chemical pesticides, pesticides, microbial fertilizers, soil conditioners, plant stimulants and plant extracts.

    9. A method of the recombinant vector and the recombinant bacterium of claim 5 in promoting plant-growth or preparing plant-growth promoters, comprising taking a multivalent plant immune fusion protein to prepare a plant-growth promoter; wherein the recombinant vector and the recombinant bacterium comprises a nucleic acid encoding the multivalent plant immune fusion protein.

    10. A nucleic acid encoding the multivalent plant immune fusion protein of claim 2.

    11. A recombinant vector and a recombinant bacterium, wherein the recombinant vector and the recombinant bacterium comprise the nucleic acid of claim 4.

    12. A method of preparing a multivalent plant immune fusion protein, comprising inoculating the recombinant bacterium of claim 5 into a fermentation medium with an inoculum size of 1-10%, and IPTG is added, when OD.sub.600 reaches 0.6-1.8, to obtain a final concentration of 0.1-0.6 mM for low-temperature induction at 15-20° C. and 200 rpm for 16-20 h; wherein the fusion protein is a protein AB-NAC-189, which is a multivalent plant immune fusion protein produced by the fusion of the following: a polypeptide segment AB encoded by a Hpal.sub.Xoo gene derived from Xanthomonas oryzae pv.oryzae (Xoo), an alpha subunit of nascent polypeptide-associated complex (NAC) derived from Alternaria sp., and an amino acid sequence HrpN189 comprising amino acids 1-189 from an N-terminus of protein HrpN derived from Erwinia amylovora; the protein AB-NAC-189 comprises an amino acid sequence from: (1) an amino acid sequence as shown in SEQ ID NO: 1; or (2) an amino acid sequence that is 75% or more homologous to the amino acid sequence of SEQ ID NO: 1; or (3) an amino acid sequence having the same function as SEQ ID NO: 1, obtained from substitution and/or deletion and/or addition of one or more amino acids on the basis of the amino acid sequence of SEQ ID NO:1.

    13. A method of the multivalent plant immune fusion protein of claim 2 in promoting plant-growth or preparing plant-growth promoters, comprising preparing a solution of the protein AB-NAC-189 with a final concentration of 0.125-50 μg/mL, performing foliar sprays or root irrigation with the solution or a mixture of the solution and chemical pesticides, pesticides, microbial fertilizers, soil conditioners, plant stimulants and plant extracts.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0043] FIG. 1 shows the PCR verification of the AB-NAC-189 gene,

    [0044] wherein: (A) M is the DNA marker; lane 1 is AB; (B) M is the DNA marker; lane 1 is NAC; (C) M is the DNA marker; lane 1 is 189; (D) M is the DNA marker; lane 1 is AB-NAC-189.

    [0045] FIG. 2 shows results of the Ni-NTA affinity chromatography of the AB-NAC-189 protein,

    [0046] wherein: M is protein marker; lane 1 is the cell lysate; lane 2 is the supernatant of the cell lysate; lane 3 is the pellet of the lysate; lane 4 is the breakthrough liquid; lane 5 is 50 mM imidazole eluate; lane 6 is 300 mM imidazole eluate.

    [0047] FIG. 3 shows the hypersensitive responses (HR) in tobacco leaves to AB, NAC, 189 and AB-NAC-189,

    [0048] wherein: (A) shows the hypersensitive response (HR) in tobacco leaves to AB; (B) shows the hypersensitive response (HR) in tobacco leaves to NAC; (C) shows the hypersensitive response (HR) in tobacco leaves to 189; (D) shows the hypersensitive response (HR) in tobacco leaves to AB-NAC-189. 1: 12.5 μg/mL; 2: 25 μg/mL; 3: 50 μg/mL; 4: 100 μg/mL; 5: water; 6: PBS; 7: EVP; 8: Proteinase K treatment for 1 h; 9: 100° C. treatment for 10 min; 10: 200 μg/mL.

    [0049] FIG. 4 shows the accumulation of chlorophyll in tobacco leaves after treatment with AB, NAC, 189 and AB-NAC-189, respectively,

    [0050] wherein on the horizontal axis, a denotes chlorophyll a; b denotes chlorophyll b; a+b denotes total chlorophyll. Each set of bars from left to right indicates the accumulation of chlorophyll in tobacco leaves after a 7-day treatment with EVP, AB, NAC, HrpN189 and AB-NAC-189, from left to right respectively.

    [0051] FIG. 5 shows the accumulation of chlorophyll in wolfberry leaves after treatment with AB, NAC, 189 and AB-NAC-189,

    [0052] wherein on the horizontal axis, a denotes chlorophyll a; b denotes chlorophyll b; a+b denotes total chlorophyll. Each set of bars from left to right indicates the accumulation of chlorophyll in Wolfberry leaves after a 10-day treatment with EVP, AB, NAC, HrpN189 and AB-NAC-189, respectively.

    [0053] FIG. 6 shows the changes in SA accumulation in tobacco after treatment with AB, NAC, 189 and AB-NAC-189, respectively,

    [0054] wherein: (A) shows the changes in SA accumulation in tobacco after treatment with AB; (B) shows the changes in SA accumulation in tobacco after treatment with NAC; (C) shows the changes in SA accumulation in tobacco after treatment with 189; (D) shows the changes in SA accumulation in tobacco after treatment with AB-NAC-189.

    [0055] FIG. 7 shows the growth of wheat seedlings after treatment with AB, NAC, 189 and AB-NAC-189, respectively,

    [0056] wherein: (A) shows the growth of wheat seedlings after treatment with AB; (B) shows the growth of wheat seedlings after treatment with NAC; (C) shows the growth of wheat seedlings after treatment with 189; (D) shows the growth of wheat seedlings after treatment with AB-NAC-189. The figures from left to right denote seed soaking treatments with EVP and protein of 0,5, 2.5, 5, 25 and 50 μg/mL, respectively.

    [0057] FIG. 8 shows the root length, plant height, fresh weight and dry weight of wheat seedlings after treatment with AB, NAC, 189 and AB-NAC-189, respectively,

    [0058] wherein: (A) shows the root length and plant height of wheat seedlings after treatment with AB; (B) shows the fresh weight and dry weight of wheat seedlings after treatment with AB; (C) shows the root length and plant height of wheat seedlings after treatment with NAC; (D) shows the fresh weight and dry weight of wheat seedlings after treatment with NAC; (E) shows the root length and plant height of wheat seedlings after treatment with 189; (F) shows the fresh weight and dry weight of wheat seedlings after treatment with 189; (G) shows the root length and plant height of wheat seedlings after treatment with AB-NAC-189; (H) shows the fresh weight and dry weight of wheat seedlings after treatment with AB-NAC-189.

    [0059] FIG. 9 shows the effect of the multivalent vaccine AB-NAC-189 in fruit yield of Goji,

    [0060] wherein, from left to right on the horizontal axis are samples treated with EVP, AB, NAC, HrpN189 and AB-NAC-189, respectively; the vertical axis designates the average fruit yield of Wolfberry per tree based on samples for each treatment.

    DESCRIPTION OF THE EMBODIMENTS

    [0061] In order to more apparently understand the objectives, technical means, and advantages of the present invention, the present invention is described hereafter through specific embodiments. It should be understood that, the description of the embodiments herein is merely for the purpose of explanation of the present invention, and does not limit the scope of the present invention.

    [0062] Unless otherwise specified, the experimental methods of the following embodiments are conventional methods; and unless otherwise specified, the experimental materials and reagents used in the following embodiments are commercially available.

    [0063] The AB-NAC-189 protein provided by the present invention can be either synthesized artificially based on the amino acid sequence, or obtained through biological expression of the encoding gene.

    [0064] The present invention will be further explained and described with reference to the accompanying figures and embodiments hereinafter.

    Embodiment 1: Construction of the Genetically Engineered Bacterium E. coli/AB-NAC-189

    [0065] The AB-NAC-189 protein provided by the present invention can be either synthesized artificially based on the amino acid sequence, or obtained through biological expression of the encoding gene. The later, i.e., method using gene expression will be explained and illustrated in this exemplary embodiment.

    (1) Gene Fusion

    [0066] {circle around (0)} Primer Sequences

    [0067] The primers used for the fusion of gene AB (as shown in SEQ ID NO: 3), gene NAC (as shown in SEQ ID NO: 4) and gene 189 (as shown in SEQ ID NO: 5) are AB FP, AB RP, NAC FP, NAC RP, and 189 FP and 189 RP, the sequences of which are as shown in the following table:

    TABLE-US-00001 SEQ ID Name Gene Sequence Remarks NO: AB FP CTTTAAGAAGGAGATATAcustom-character GCAACTCTCT Restriction site 6 GAACACCCAGTTCGGT G Nco I AB RP TTTCCGGTTCGTCCGGCAGTTCTTCGATACGCGG The italicized 7 GTTAGCcustom-character and underlined part is 20 bp (base pairs) of the linker (G.sub.4S).sub.3. NAC custom-character GCTAACCCGCGTAT The italicized 8 FP CGAAGAACTGCCGGACGAACCGGAAA and underlined part is 20 bp (base pairs) of the linker (G.sub.4S).sub.3. NAC AGACCAGAGGTGTTCAGAGAcustom-character The italicized RP custom-character custom-character GT and underlined 9 CTTCGATTTTAGCTTCACCGAAGATTAT part is 45 bp (base pairs) of the linker (G.sub.4S).sub.3. 189  custom-character TCTCTGAACACCTC The italicized FP TGGTCTGGGTGCTTCT and underlined 10 part is 20 bp (base pairs) of the linker (G.sub.4S).sub.3. 189 GTGGTGGTGGTGGTGGTGcustom-character TTTACCACC Restriction site 11 RP AGAAGAAGAACCCTGA Xho 1

    [0068] {circle around (2)} Gene Fusion

    [0069] The AB gene was amplified with primers AB FP and AB RP, using a sequence containing the AB gene as template; gene NAC was amplified with primers NAC FP and NAC RP, using a sequence containing the NAC gene as template; and gene 189 was amplified with primers 189 FP and 189 RP, using a sequence containing the 189 gene as template. Gene fusion was performed with the amplification products (The reaction was 50 μL comprising 18 μL of water, 3 μL of the target gene, 2 μL of the forward primer, 2 μL of the reverse primer and 25 μL of 2×PFU; an initial denaturation step was performed at 94° C. for 90 seconds followed by a separate denaturation step at 94° C. for 20 seconds, an annealing step at 60° C. for 20 seconds, and an extension step at 72° C. for 41 seconds; the three steps of denaturation, annealing and extension were cycled 10 times, and a final extension step was performed for 5 min.). The AB-NAC-189 gene was created using fusion PCR with primers AB FP and 189 RP. The results of PCR amplification is shown in FIG. 1.

    (2) Construction of an Engineered Bacterium

    [0070] The AB-NAC-189 gene was inserted between the restriction sites Nco I and Xho I of the pET28a(+) plasmid that contains a strong promoter T7, to construct a recombinant plasmid pET-28a-AB-NAC-189. This recombinant plasmid was transformed into E. coli BL21(DE3) as the host bacterium, and the positive clone was identified by PCR verification and gene sequencing as the successfully-constructed and genetically engineered bacterium E. coli/AB-NAC-189.

    Embodiment 2: Induced Expression of the Multivalent Fusion Protein AB-NAC-189

    [0071] The recombinant bacterial strain E. coli/AB-NAC-189 was inoculated into LB medium with 50 μg/mL kanamycin and cultured overnight at 37° C. and 200 rpm for 12 hours to obtain a seed solution;

    [0072] the seed solution was then inoculated into LB medium with 50 μg/mL kanamycin with an inoculum size of 5%, and kept being cultured at 37° C.; when OD.sub.600 reached 1.0, IPTG was added to give a final concentration of 0.3 mM for low-temperature induction at 18° C. and 200 rpm for 18 h; the yield of the AB-NAC-189 protein could reach 0.8 g/L fermentation broth.

    [0073] After inducing, bacterial cells were collected by centrifugation at 8000 rpm for 10 minutes, lysed, and centrifuged at 8000 rpm for 30 minutes; the supernatant was then filtered with a filtration membrane and fed into a Ni-NTA affinity chromatography column; once the protein sample in the tube was reduced by the volume of one column, the breakthrough material was taken; then the nickel column was washed with 4 column volumes of lysis buffer and eluted with 50 mM or 300 mM imidazole; and the eluate was collected. The results showed that the AB-NAC-189 protein could be eluted completely by 300 mM imidazole, giving a protein purity of around 90%. SDS-PAGE analysis was performed for the protein samples, and the results are shown in FIG. 2. It can be found that, the fusion protein AB-NAC-189 is shown clearly in lane 6 with a band size of about 48 kDa.

    Embodiment 3: Assay of the Hypersensitive Response (HR) in Tobacco Leaves to AB-NAC-189

    [0074] The AB, NAC, 189 and AB-NAC-189 protein products were diluted with PBS buffer respectively, and the following samples were prepared:

    (A-D) sample 1: 12.5 μg/mL AB, NAC, 189 and AB-NAC-189, respectively;
    (A-D) sample 2: 25 μg/mL AB, NAC, 189 and AB-NAC-189, respectively;
    (A-D) sample 3: 50 μg/mL AB, NAC, 189 and AB-NAC-189, respectively;
    (A-D) sample 4: 100 μg/mL AB, NAC, 189 and AB-NAC-189, respectively;
    (A-D) sample 9: 200 μg/mL AB, 200 μg/mL NAC protein, 100 μg/mL 189, and 100 μg/mL AB-NAC-189 protein, respectively, each heated in a water bath of 100° C. for 10 minutes;
    (A, B) sample 10: 200μm/mL AB and NAC, respectively;
    Negative Control 1 (sample 5): water;
    Negative Control 2 (sample 6): PBS buffer;
    Negative Control 3 (sample 7): lysis of E. coli with empty vector preparation (EVP);
    Negative Control 4 (sample 8): protein treated with Proteinase K for 1 h.

    [0075] The above-mentioned protein samples and control samples were injected into tobacco leaves in growing stage with an injection dose of 50 μL in each hole. The injected tobacco was placed in a plant incubator and incubated at 28° C. for 3 days to observe the size of the leaf spots in the leaves.

    [0076] As shown by the results of figure (D) in FIG. 3, AB-NAC-189 induced a strong hypersensitive response (HR) in tobacco leaves as obvious leaf spots appeared on the tobacco leaves after the injection of 12.5 μg/mL (0.32 μM) of the AB-NAC-189 protein; the biological activities of the AB-NAC-189 protein treated in a water bath of 100° C. for 10 minutes was not affected significantly as the treated protein still caused hypersensitive response (HR) in tobacco leaves, indicating an unaffected and stable spatial structure of the multivalent immunoprotein and its potential to be produced in large quantities and put into use. It is also demonstrated in FIG. 3 that, compared to their corresponding controls with the same mass concentration (AB: 2.02 μM, NAC: 0.94 μM, 189: 0.65 μM), AB and NAC did not cause significant leaf plots, while 189 and AB-NAC-189 did, with a larger area of leaf plots caused by AB-NAC-189. Considering that the molar concentration of AB-NAC-189 was the smallest, only half that of 189, it is indicated that the fusion protein AB-NAC-189 has an activity with a better cumulative effect, thus significantly stimulating the HR response in tobacco.

    Embodiment 4: Experiment on AB-NAC-189 Promoting Chlorophyll Synthesis in Tobacco

    [0077] 10 mL of 15 μg/mL AB, NAC, 189 and AB-NAC-189 protein products and negative control EVP were sprayed on three tobacco leaves at lower vertical position each, and samples were taken after 7 days to determine the accumulation of chlorophyll in tobacco. The contents of chlorophyll a and chlorophyll b of each sample were determined at A.sub.665 and A.sub.649, respectively, after adding 10 mL of 95% ethanol to 0.1 g of each sample and leaving them to stand still for 24 h protected from light.

    [0078] As shown by the results in FIG. 4, the accumulation of chlorophyll in tobacco after treatment with AB (2.42 μM), NAC (1.13 μM), 189 (0.78 μM) and AB-NAC-189 (0.39 μM) was approximately 1.3, 1.8, 1.5 and 1.9 times, respectively, as high as that of the corresponding negative control with the same mass concentration. As can be seen, AB-NAC-189, with the lowest molar concentration, only half that of 189, exhibited a more significant effect on promoting chlorophyll synthesis in tobacco, indicating that AB-NAC-189 has a significant and positive effect on the growth of tobacco.

    Embodiment 5: Experiment on AB-NAC-189 Promoting Chlorophyll Synthesis in Goji

    [0079] 3 mL of 10 μg/mL AB (1.61 μM), NAC (0.75 μM), 189 (0.52 μM) and AB-NAC-189 (0.26 μM) protein products and negative control EVP, were sprayed on five Wolfberry leaves of similar size each, with 3 parallel experiments in each group, and samples were taken after 10 days to determine the accumulation of chlorophyll in Goji. The contents of chlorophyll a and chlorophyll b of each sample were determined at A.sub.665 and A.sub.649, respectively, after adding 10 mL of 95% ethanol to 0.1 g of each sample and leaving them to stand still for 24 h, protected from light.

    [0080] As shown by the results in FIG. 5 and Table 1, the accumulation of chlorophyll in Wolfberry after treatment with AB, NAC, 189 and AB-NAC-189 was approximately 1.1, 1.15, 1.13 and 1.8 times as high as that of the negative controls, respectively. As can be seen, AB, NAC or 189 alone did not enhance the accumulation of chlorophyll in Goji berry significantly, while AB-NAC-189, with the lowest molar concentration, significantly promoted the synthesis of chlorophyll in Goji, thus improving the yield and quality of Goji berries, which makes it a good candidate plant vaccine for the growth and production of wolfberry, with a much better effect than protein AB, NAC or189.

    TABLE-US-00002 TABLE 1 Effects of AB-NAC-189 on chlorophyll synthesis in wolfberry leaves Total Ratio Chlorophyll a Chlorophyll b chlorophyll (×CK.sup.−1) Sample (mg/g FW) (mg/g FW) (mg/g FW) (%) EVP (CK) 2.351 ± 0.122 1.132 ± 0.049 3.483 ± 0.163 — AB 2.657 ± 0.161 1.174 ± 0.101 3.831 ± 0.219 110 NAC 2.727 ± 0.173 1.274 ± 0.105 4.001 ± 0.238 115 189 2.703 ± 0.167 1.233 ± 0.097 3.936 ± 0.234 113 AB-NAC-189 4.467 ± 0.207 1.762 ± 0.123 6.269 ± 0.295 180

    Embodiment 6: Changes of SA Accumulation after Treatment with AB-NAC-189

    [0081] Tobacco plants of comparable growth were selected and sprayed uniformly with AB, NAC, 189 and AB-NAC-189 protein products of 15 μg/mL on three tobacco leaves at lower vertical position, respectively, with EVP as a negative control. Samples were taken at different times after the treatment to determine the SA accumulation in tobacco leaves by UPLC-MS method.

    [0082] The results are shown in FIG. 6, demonstrating a rapid increase in SA accumulation in tobacco leaves after treatment with AB-NAC-189 (0.39 μM) with a peak of 3.59 μg/g, about 29.82 times the base level, reached in 24 h, followed by a rapid drop to the base level, and a second and third increase-followed-by-decrease occurring at about 60 h and 84 h, which indicates that AB-NAC-189 treatment elicited the SA pathway in tobacco. Meanwhile, compared with AB (2.42 μM), NAC (1.13 μM) and 189 (0.78 μM), which enhanced SA accumulation by approximately 2.25, 5.75 and 17.69 times, respectively, AB-NAC-189 demonstrated a stronger effect in eliciting the SA pathway, with SA accumulation being much bigger than the sum of that by treatment with AB, NAC and 189. According to analysis based on molar concentrations, i.e., SA accumulation elicited by each single molecule in tobacco leaves, AB-NAC-189 performed the best, with a value that was 3.37 times that of 189 which was the best among the remaining three, and 82 times that of AB which performed the worst, thus it is even more accurately demonstrated that AB-NAC-189 has a stronger capability of improving disease resistance in plants.

    Embodiment 7: Experiment on AB-NAC-189 Treatment Promoting Growth of Wheat Seedlings

    [0083] Wheat seeds were treated by soaking in AB, NAC, protein 189, protein AB-NAC-189 of different concentrations for 12 h each, and then sown in 96-well culture boxes to grow in hydroponic culture mode for 7 d before parameter were measured. The same treatment was performed using EVP as a negative control.

    [0084] The results are shown in FIGS. 7 and 8. It can be seen that compared with wheat treated with EVP, wheat treated with AB-NAC-189 exhibited root length up to 1.38 times, plant height up to 1.45 times, fresh weight up to 1.32 times, and dry weight up to 1.31 times. Moreover, compared with treatments with AB, NAC and 189, the promotion effect by AB-NAC-189 increased by about 10%, 5% and 6%, respectively, indicating a stronger growth-promoting effect on wheat by the fusion protein AB-NAC-189 than the monomeric proteins.

    Embodiment 8: Experiment on AB-NAC-189 Promoting Fruit Yield of Wolfberry

    [0085] 25 wolfberry trees of 6 years old with comparable growth, grown from the same sown seedlings, were selected for the experiment and divided into 5 groups with 5 trees in each group. Protein products AB, NAC, 189, and AB-NAC-189 and negative control EVP solution of 300 mL each (15 μg/mL) were sprayed twice in total, once between April and May (peak period of bud emergence and new branching) and once in June (period of continued growth of new branches, bud emergence, fruit set and young fruit expansion); the yield of Goji berries was determined during the harvesting season.

    [0086] As shown by the results in FIG. 9 and Table 2, the fruit yield of wolfberry treated with AB (2.42 μM), NAC (1.13 μM), 189 (0.78 μM) and AB-NAC-189 (0.39 μM) was 1.08, 1.15, 1.20 and 1.7 times as high as that of the negative control of the same mass concentration. As can be seen, there was no significant increase in fruit yield of wolfberry by treatment with AB, NAC or 189 alone. However, AB-NAC-189, with the lowest molar concentration, significantly promoted the yield of Goji berries with 70% increase in fresh weight of the fruit which was big and full, thus indicating that AB-NAC-189 is a promising candidate as a multivalent plant vaccine to improve yield and quality of Goji berries.

    TABLE-US-00003 TABLE 2 Effects of AB-NAC-189 on Goji berries Yield Ratio (×CK.sup.−1) Sample (kg/tree) (%) EVP (CK)  3.2 ± 0.31 — AB 3.46 ± 0.29 108 NAC 3.68 ± 0.27 115 189 3.84 ± 0.35 120 AB-NAC-189 5.44 ± 0.49 170

    [0087] The above embodiments are merely exemplary embodiments of the present invention described in details, and should not be considered as limiting the patent scope. It should be noted that, the above-mentioned embodiments may be carried out with a few deformation, combination and improvement by those skilled in the art in the present field within the conception of the present invention, all of which are within the protection scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the claims.