PREDICTING A TREATMENT RESPONSE IN INFLAMMATORY BOWEL DISEASE
20220364171 · 2022-11-17
Inventors
- Séverine VERMEIRE (Haasrode, BE)
- Bram VERSTOCKT (Kampenhout, BE)
- Marc FERRANTE (Sint-Katelijne-Waver, BE)
Cpc classification
C12Q2600/106
CHEMISTRY; METALLURGY
G01N33/564
PHYSICS
C12Q1/6883
CHEMISTRY; METALLURGY
G01N2800/52
PHYSICS
International classification
C12Q1/6883
CHEMISTRY; METALLURGY
C07K16/24
CHEMISTRY; METALLURGY
C07K16/28
CHEMISTRY; METALLURGY
Abstract
In general the present invention concerns a method for predicting the therapeutic outcome of a treatment of in inflammatory bowel disease for anti-TNF agents, anti-α.sub.4β.sub.7-integrin agents and/or anti-IL-12/23 agents. The method defines which the agents are likely to provide the best healing effect for a particular patients affected by an inflammatory bowel disease. In particular the method predicts the therapeutic outcome of a treatment of anti-TNF agents in inflammatory bowel disease.
Claims
1.-21. (canceled)
22. A method of determining to which treatment a patient suffering of inflammatory bowel diseases is likely to respond or of determining to which treatment a patient suffering of inflammatory bowel diseases is likely to respond best, the method comprising: (i) (a) detecting expression of the genes of a first group consisting of CELSR3, HAAO, FAM135B, F2RL2, CMPK2, SLC28A2, RET, CHP2, PITX1 and GSTT1 in a biological sample from a patient and expression of the genes of a second group consisting of FCER2, CTSL, PTGFRN, GPRC5C, SLAMF7, NR4A2, GNG2, RHOC, SULT1A1, DSC2, NEDD4L, ENGASE, GSN, GNLY, CLEC10A, HLA_DRB5, BAG3, ASGR2, HLA_DRB1 and PTK2 in a biological sample from the patient, and (b) detecting expression of the genes of a third group consisting of FAM129A, ELM01, TRIP13, PTAR1, ASAH1, SKAP2, HAUS1, C3orf67, SEC14L6, ATP6V0D1, ABCG1, ERAP1, ERV3_1, APOL6 and STON2 in a biological sample from the patient (c) detecting expression of the TREM1 gene in a biological sample from the patient (d) comparing the expression level of the genes to a reference expression level, wherein downregulation of TREM1 expression indicates the future anti-TNF healers or identifies a patient who is likely to respond to treatment with a TNF antagonist, wherein a different expression level of each of the genes of the first group of genes and of each of the genes of the second group of genes compared to a reference expression level indicates the future anti-IL-12/23 pathway healers or identifies a patient who is likely to respond to treatment with a IL-12/23 pathway antagonist, and wherein a different expression level of each of the genes the third group of genes compared to a reference expression level indicates the future anti-α.sub.4β.sub.7-integrin healers or identifies a patient who is likely to respond to treatment with a α.sub.4β.sub.7-integrin antagonist, or (ii) (a′) detecting expression of the genes of a first group consisting of CELSR3, HAAO, FAM135B, F2RL2, CMPK2, SLC28A2, RET, CHP2, PITX1 and GSTT1 in a biological sample from a patient and expression of the genes of a second group consisting of FCER2, CTSL, PTGFRN, GPRC5C, SLAMF7, NR4A2, GNG2, RHOC, SULT1A1, DSC2, NEDD4L, ENGASE, GSN, GNLY, CLEC10A, HLA_DRB5, BAG3, ASGR2, HLA_DRB1 and PTK2 in a biological sample from the patient, and (b′) detecting expression of the genes of a third group consisting of PIWIL1, MAATS1, RGS13 and DCHS2 in a biological sample from the patient. (c′) detecting expression of the TREM1 gene in a biological sample from the patient. (d′) comparing the expression level of the genes to a reference expression level, wherein downregulation of TREM1 expression indicates the future anti-TNF healers or identifies a patient who is likely to respond to treatment with a TNF antagonist, wherein a different expression level each of the genes of the first group of genes and of each of the genes of the second group of genes compared to a reference expression level indicates the future anti-IL-12/23 pathway healers or identifies a patient who is likely to respond to treatment with a IL-12/23 pathway antagonist, and wherein a decreased expression level of each of the genes the third group of genes compared to a reference expression level indicates the future anti-α.sub.4β.sub.7-integrin healers or identifies a patient who is likely to respond to treatment with a α.sub.4β.sub.7-integrin antagonist.
23. The method according to claim 22, wherein the method comprises: (i) (a) detecting expression of the genes of a first group consisting of CELSR3, HAAO, FAM135B, F2RL2, CMPK2, SLC28A2, RET, CHP2, PITX1 and GSTT1 in a colonic tissue sample and expression of the genes of a second group consisting of FCER2, CTSL, PTGFRN, GPRC5C, SLAMF7, NR4A2, GNG2, RHOC, SULT1A1, DSC2, NEDD4L, ENGASE, GSN, GNLY, CLEC10A, HLA_DRB5, BAG3, ASGR2, HLA_DRB1 and PTK2 in a blood sample from the patient; and (b) detecting expression of the genes of a third group consisting of FAM129A, ELM01, TRIP13, PTAR1, ASAH1, SKAP2, HAUS1, C3orf67, SEC14L6, ATP6V0D1, ABCG1, ERAP1, ERV31, APOL6 and STON2 in a blood sample from the patient (c) detecting expression of the TREM1 gene in a blood sample from the patient (d) comparing the expression level of the genes to a reference expression level, wherein downregulation of TREM1 expression indicates the future anti-TNF healers or identifies a patient who is likely to respond to treatment with a TNF antagonist, wherein a different expression level each of the genes of the first group of genes and of each of the genes of the second group of genes compared to a reference expression level indicates the future anti-IL-12/23 pathway healers or identifies a patient who is likely to respond to treatment with a IL-12/23 pathway antagonist and wherein a different expression level of each of the genes the third group of genes compared to a reference expression level indicates the future anti-α.sub.4β.sub.7-integrin healers or identifies a patient who is likely to respond to treatment with a α.sub.4β.sub.7-integrin antagonist, or (ii) (a′) detecting expression of the genes of a first group consisting of CELSR3, HAAO, FAM135B, F2RL2, CMPK2, SLC28A2, RET, CHP2, PITX1 and GSTT1 in a colonic tissue sample and expression of the genes of a second group consisting of FCER2, CTSL, PTGFRN, GPRC5C, SLAMF7, NR4A2, GNG2, RHOC, SULT1A1, DSC2, NEDD4L, ENGASE, GSN, GNLY, CLEC10A, HLA_DRB5, BAG3, ASGR2, HLA_DRB1 and PTK2 in a blood sample from the; and (b′) detecting expression of the genes of a third group consisting of PIWIL1, MAATS1, RGS13 and DCHS2 in sample of colonic tissue sample from the patient (c′) detecting expression of the TREM1 gene in a blood sample from the patient (d′) comparing the expression level of the genes to a reference expression level, wherein downregulation of TREM1 expression indicates the future anti-TNF healers or identifies a patient who is likely to respond to treatment with a TNF antagonist, wherein a different expression level each of the genes of the first group of genes and of each of the genes of the second group of genes compared to a reference expression level indicates the future anti-IL-12/23 pathway healers or identifies a patient who is likely to respond to treatment with a IL-12/23 pathway antagonist and wherein a decreased expression level of each of the genes the third group of genes compared to a reference expression level indicates the future anti-α.sub.4β.sub.7-integrin healers or identifies a patient who is likely to respond to treatment with a α.sub.4β.sub.7-integrin antagonist.
24. The method according to claim 22, wherein the method comprises: (a) detecting expression of the genes of a first group consisting of CELSR3, HAAO, FAM135B, F2RL2, CMPK2, SLC28A2, RET, CHP2, PITX1 and GSTT1 in a colonic mucosal biopsy sample and expression of the genes of a second group consisting of FCER2, CTSL, PTGFRN, GPRC5C, SLAMF7, NR4A2, GNG2, RHOC, SULT1A1, DSC2, NEDD4L, ENGASE, GSN, GNLY, CLEC10A, HLA_DRB5, BAG3, ASGR2, HLA_DRB1 and PTK2 in CD14+ monocytes from the patient; and (b) detecting expression of the genes of a third group consisting of FAM129A, ELM01, TRIP13, PTAR1, ASAH1, SKAP2, HAUS1, C3orf67, SEC14L6, ATP6V0D1, ABCG1, ERAP1, ERV31, APOL6 and STON2 in CD14+ monocytes from the patient (c) detecting expression of the TREM1 gene in a whole blood cell sample from the patient (d) comparing the expression level of the genes to a reference expression level, wherein downregulation of TREM1 expression indicates the future anti-TNF healer or identifies a patient who is likely to respond to treatment with a TNF antagonist, wherein a different expression level of each of the genes the first group of genes and of each of the genes of the second group of genes compared to a reference expression level indicates the future anti-IL-12/23 pathway healers or identifies a patient who is likely to respond to treatment with a IL-12/23 pathway antagonist, and wherein a different expression level of each of the genes the third group of genes compared to a reference expression level indicates the future anti-α.sub.4β.sub.7-integrin healer or identifies a patient who is likely to respond to treatment with a α.sub.4β.sub.7-integrin antagonist, or (ii) (a′) detecting expression of the genes of a first group consisting of CELSR3, HAAO, FAM135B, F2RL2, CMPK2, SLC28A2, RET, CHP2, PITX1 and GSTT1 in a colonic mucosal biopsy sample and expression of the genes of a second group consisting of FCER2, CTSL, PTGFRN, GPRC5C, SLAMF7, NR4A2, GNG2, RHOC, SULT1A1, DSC2, NEDD4L, ENGASE, GSN, GNLY, CLEC10A, HLA_DRB5, BAG3, ASGR2, HLA_DRB1 and PTK2 in CD14+ monocytes from the patient; and (b′) detecting expression of the genes of a third group consisting of PIWIL1, MAATS1, RGS13 and DCHS2 in a colonic mucosal biopsy sample from the patient (c′) detecting expression of the TREM1 gene in a whole blood cell sample of the patient. (d′) comparing the expression level of the genes to a reference expression level, wherein downregulation of TREM1 expression indicates the future anti-TNF healer or identifies a patient who is likely to respond to treatment with a TNF antagonist, wherein a different expression level of each of the genes the first group of genes and of each of the genes of the second group of genes compared to a reference expression level indicates the future anti-IL-12/23 pathway healers or identifies a patient who is likely to respond to treatment with a IL-12/23 pathway antagonist and wherein a decreased expression level of each of the genes the third group of genes compared to a reference expression level indicates the future anti-α.sub.4β.sub.7-integrin healers or identifies a patient who is likely to respond to treatment with a α.sub.4β.sub.7-integrin antagonist.
25. The method according to claim 22, wherein the expression of the genes or the expression product of the genes in a sample obtained from the patient is a nucleic acid molecule selected from the group consisting of mRNA and cDNA mRNA or polypeptides derived therefrom.
26. The method according to claim 22, wherein the expression of the genes in a sample obtained from the patient is detected by measuring mRNA.
27. The method according to claim 22, wherein the inflammatory bowel disease is ulcerative colitis.
28. The method according to claim 22, wherein the inflammatory bowel disease is Crohn's disease.
29. The method according to claim 22, wherein the patient is a human.
30. The method according to claim 22, wherein the sample analysed for gene expression is obtained from the patient prior to any administration of any of the antagonists to the patient.
31. The method according to claim 22, wherein the sample analysed for gene expression is obtained from the patient after an initial treatment with a selected TNF, α.sub.4β.sub.7-integrin or IL-12/23 antagonists to the patient.
32. The method according to claim 22, wherein each sample is from the patient removed sample or biopsy sample and the analysis is in vitro.
33. The method according to claim 22, wherein a TNF antagonist is infliximab or adalimumab.
34. The method according to claim 22, wherein a α.sub.4β.sub.7-integrin antagonist is an anti-α.sub.4β.sub.7-integrin antibody therapy that blocks action of α.sub.4β.sub.7-integrin by preventing Integrin α.sub.4β.sub.7 forming a complex with the T-cell surface Cd4.
35. The method according to claim 22, wherein a α.sub.4β.sub.7-integrin antagonist is an anti-α.sub.4β.sub.7-integrin antibody therapy that blocks the action of α.sub.4β.sub.7-integrin by preventing α.sub.4β.sub.7-integrin of interacting with MadCAM-1.
36. The method according to claim 22, wherein a α.sub.4β.sub.7-integrin antagonist is an antibody of the group consisting of a Natalizumab, Vedolizumab, Etrolizumab and AMG-18.
37. The method according to claim 22, wherein an IL-12/23 pathway antagonist is an anti-P40 antibody.
38. The method according to claim 22, wherein an IL-12/23 pathway antagonist is ustekinumab.
39. The method according to claim 22, wherein each sample is a from the patient removed sample or is a biopsy sample and the analysis is in vitro.
40. A monoclonal anti-TNF antibody or an antigen-binding fragment thereof for use in the treatment of an inflammatory bowel disease, comprising claim 22 identifying the patient as more likely to respond to a therapy comprising the monoclonal anti-TNF antibody or an antigen-binding fragment thereof and administering the monoclonal anti-TNF antibody or an antigen-binding fragment thereof when the level of mRNA expression measured indicate the patient is a future anti-TNF healer.
41. A monoclonal anti-α.sub.4β.sub.7-integrin antibody or an antigen-binding fragment thereof for use in the treatment of an inflammatory bowel disease, comprising claim 22 identifying the patient as more likely to respond to a therapy comprising the monoclonal anti-α.sub.4β.sub.7-integrin antibody or an antigen-binding fragment thereof and administering the monoclonal anti-α.sub.4β.sub.7-integrin antibody or an antigen-binding fragment thereof when the level of mRNA expression measured indicate the patient is a future anti-α.sub.4β.sub.7-integrin healer.
42. A monoclonal directed against IL12 and IL23 or an antibody binds to the p-40 subunit of both IL-12 and IL-23 or the antigen-binding fragment thereof for use in the treatment of an inflammatory bowel disease, comprising claim 22 identifying the patient as more likely to respond to a therapy comprising the monoclonal antibody or an antigen-binding fragment thereof and administering the monoclonal antibody or an antigen-binding fragment thereof when the level of mRNA expression measured indicate the patient is a future anti-IL-12/23 pathway healer.
Description
DRAWING DESCRIPTION
Brief Description of the Drawings
[0556] The present invention will become more fully understood from the detailed description given herein below and the accompanying drawings which are given by way of illustration only, and thus are not limitative of the present invention, and wherein:
[0557]
[0558]
[0559]
[0560]
[0561]
[0562]
[0563] ′Figures
[0564]
[0565]
[0566]
[0567]
[0568]
[0569]
[0570]
[0571]
[0572]
[0573]
″ FIGURES
[0574]
[0575]
[0576]
[0577]
[0578]
[0579]
[0580]
′″ FIGURES
[0581]
[0582] Visual representation of the top 5 baseline differentially expressed genes in mucosal biopsies of patients responding and not responding to vedolizumab therapy. log FC=log fold change; FDR p value=false discovery rate corrected p value. KRT23=keratin 23; TMEM35=Transmembrane protein 35; DCHS2=dachsous cadherin-related 2; CLDN8=claudin 8; IFI6=interferon alpha inducible protein 6
[0583]
[0584] Visual representation of the enrichment scores for the individual cells types identified being differentially represented between vedolizumab non-remitters (A) and remitters (B), according to deconvolution techniques on the initial baseline transcriptome..sup.21
[0585]
[0586] Receiver operating characteristic (ROC) statistics predicting vedolizumab induced endoscopic remission based on the colonic 4-gene predictive panel in an independent Belgian-Spanish validation cohort
[0587]
[0588] Immunohistochemical PIWIL1 staining in inflamed IBD colon (original magnification (OM)×100) (A). Immunohistochemical MAATS1 (C3orf15) staining in inflamed IBD colon (OM×100) (B). Immunohistochemical DCHS2 staining in inflamed IBD colon (OM×200) (C). Immunohistochemical RGS13 staining in inflamed IBD colon (OM×200) (D).
[0589]
[0590] Visual representation of the differential gene expression in mucosal biopsies of patients responding and not responding to vedolizumab therapy of the 4 genes included in the predictive panel.
[0591] log FC=log fold change; FDR p value=false discovery rate corrected p value.
[0592] PIWIL1=Piwi-like protein 1; MAATS1=MYCBP associated and testis expressed 1; DCHS2=dachsous cadherin-related 2; RGS13=Regulator of G-protein signaling 13
[0593]
[0594] Immunohistochemical PIWIL1 staining in regenerating colonic epithelium (original magnification (OM)×50).
LEGENDS TO THE TABLES IN THIS APPLICATION
[0595] Table 1 demonstrates the disease characteristics of the whole blood, anti-TNF treated cohort.
[0596] Table 2 demonstrates the correlation between the overall TREM1 expression level and the expression of the different transcripts in whole blood.
[0597] Table 1′ demonstrates the baseline disease characteristics of all included patients n=number of patients; y=years; IQR=interquartile range; CD=Crohn's disease
[0598] Table 2′ demonstrates the enriched pathways among the inferred feature sets in the blood monocytes. Pathway enrichment was performed using Ingenuity Pathway Analysis.
[0599] Table 3′ demonstrates the enriched pathways among the inferred feature sets in the colonic mucosa. Pathway enrichment was performed using Ingenuity Pathway Analysis).
[0600] Table 4′ demonstrates the colonic signature biological response
[0601] Table 1″—Summary of the functional relevance of the top ranked hubs identified in each of the cohorts. Hubs were defined as the class discriminating features (protein coding genes) with the highest number of downstream targets in cell type and cohort specific networks. Hubs with over-represented biological processes among their downstream targets are indicated.
[0602] Table 2″—Summary of the identified biomarkers and associated accuracies in the different cohorts. Accuracies were determined by an ensemble classifier built using multiple individual classifiers.
[0603] Table 3″: Clinical features of all included patients
[0604] Table 4″: Relationship between the weights assigned to every sample in each latent factor (LF) and vedolizumab induced endoscopic remission in ulcerative colitis. Multiple regression was used to calculate the relationships between the LFs and endoscopic outcome. For the trait of endoscopic remission—1 stands for observed endoscopic remission; 0—stands for no observed endoscopic remission. Only LFs with weight contributions to all the samples in their respective cohorts were considered for further downstream analysis.
[0605] Table 5″: Relationship between the weights assigned to every sample in each latent factor (LF) and vedolizumab induced endoscopic remission in Crohn's disease. Multiple regression was used to calculate the relationships between the LFs and endoscopic outcome. For the trait of endoscopic remission—1 stands for observed endoscopic remission; 0—stands for no observed endoscopic remission. Only LFs with weight contributions to all the samples in their respective cohorts were considered for further downstream analysis.
[0606] Table 6″: Relationship between the weights assigned to every sample in each latent factor (LF) and anti-TNF induced endoscopic remission in ulcerative colitis. Multiple regression was used to calculate the relationships between the LFs and endoscopic outcome. For the trait of endoscopic remission—1 stands for observed endoscopic remission; 0—stands for no observed endoscopic remission. Only LFs with weight contributions to all the samples in their respective cohorts were considered for further downstream analysis.
[0607] Table 7″: Relationship between the weights assigned to every sample in each latent factor (LF) and anti-TNF induced endoscopic remission in Crohn's disease. Multiple regression was used to calculate the relationships between the LFs and endoscopic outcome. For the trait of endoscopic remission—1 stands for observed endoscopic remission; 0—stands for no observed endoscopic remission. Only LFs with weight contributions to all the samples in their respective cohorts were considered for further downstream analysis.
[0608] Table 8″: Variance contributions of the -omic layers to the MOFA identified latent factors (LF) in the vedolizumab treated ulcerative colitis cohort.
[0609] Table 9″: Variance contributions of the -omic layers to the MOFA identified latent factors (LF) in the vedolizumab treated Crohn's disease cohort.
[0610] Table 10″: Variance contributions of the -omic layers to the MOFA identified latent factors (LF) in the anti-TNF treated ulcerative colitis cohort.
[0611] Table 11″: Variance contributions of the -omic layers to the MOFA identified latent factors (LF) in the anti-TNF treated Crohn's disease cohort.
[0612] Table 12″—Summary of the prominent -omic layers contributing to the explanatory latent factors (LF) in the different cohorts. The -omic layer with the highest variance contribution to the explanatory LF was considered as the dominant one.
[0613] Table 13″: Tabular summary of the co-occurrence of the features discovered in each of the cohorts and across cell-/tissue-types. 1 indicates the presence of the feature in the corresponding dataset and 0 its absence.
[0614] CD=Crohn's disease, UC=ulcerative colitis
[0615] Table 14″: Correlation between the discriminatory features and C-reactive protein levels. The correlation was determined by using the psych package in R.
[0616] Table 15″: Adjacency matrices representing the interactions in binary format between the discriminatory features in each of the cohorts and their downstream protein targets. Interactions between the nodes are indicated as being present (1) or absent (0).
[0617] CD=Crohn's disease, UC=ulcerative colitis, VDZ=vedolizumab Table 16″: Sources of the interaction networks corresponding to the proteins targeted by the feature sets distinguishing responders and non-responders in each of the cohorts.
[0618] Table 17″: List of over-represented gene ontology based biological process terms within the set of proteins targeted by the features distinguishing responders and non-responders in each of the cohorts. Gene Ontology terms were retrieved from UniProt.
[0619] CD=Crohn's disease, UC=ulcerative colitis, VDZ=vedolizumab; IFXADM=Anti-TNF agents
[0620] Table 18″: Reactome pathways enriched among the set of features distinguishing responders and non-responders in the vedolizumab and anti-TNF cohorts. 1 indicates the enrichment of the pathway in the corresponding dataset and 0 indicates no enrichment. CD=Crohn's disease, UC=ulcerative colitis, VDZ=vedolizumab; IFXADM=Anti-TNF agents
[0621] Table 37″ provides an oOverview of antibodies used for fluorescence activated cell sorting
[0622] Table 20″provides an overview of all proteins measured with the Proximity Extension Technology.
[0623] Table 1′″provides the clinical characteristics of the inception cohort, validation cohort 2 and 4
[0624] Table 2′″demonstrates the accuracy of the 4-gene signature in vedolizumab and anti-TNF treated patients
[0625] Table 3′″provides details of the forward (Fw) and reverse (Rev) primers used for the beta actin qPCR analysis, including the amplicon length, melt temperature (Tm), 5′-3′ sequence and NCBI accession number.
[0626] Table 4′″: provides details of target-specific TaqMan Primers.
[0627] Table 5′″: provide an overview of primary antibodies immunohistochemistry
[0628] Table 6′″: provides the clinical features of the anti-TNF treated cohort
[0629] Table 7′″: provides the baseline differentially expressed genes between vedolizumab responders and non-responders selected based on a nominal 0.005 significance level.
[0630] Table 8′″: provides a gene set enrichment analysis (GSEA) results focused on the leukocyte migration and cell adhesion gene ontology (GO) gene sets, derived from the MSigDB. All gene sets are enriched in the non-responder group.
Abbreviations in this Application
[0631] ADM adalimumab
[0632] AUC area under the curve
[0633] CD Crohn's disease
[0634] CLDN8 claudin 8
[0635] DCHS2 dachsous cadherin-related 2
[0636] FDR false discovery rate
[0637] GO gene ontology
[0638] GSEA gene set enrichment analysis
[0639] IBD inflammatory bowel disease
[0640] IEC intra-epithelial cell
[0641] IF16 interferon alpha inducible protein 6
[0642] IFX infliximab
[0643] IL interleukin
[0644] IPA ingenuity pathway analysis
[0645] IQR inter quartile range
[0646] ITGA4 integrin subunit alpha 4
[0647] ITGB7 integrin subunit beta 7
[0648] KRT23 keratin 23
[0649] LR likelihood ratio
[0650] MadCAM-1 mucosal vascular addressin cell adhesion molecule 1
[0651] MAATS1 MYCBP associated and testis expressed 1
[0652] NPV negative predictive value
[0653] PIWIL1 piwi-like protein 1
[0654] PPV positive predictive value
[0655] qPCR real-time polymerase chain reaction
[0656] RGS13 regulator of G protein signaling 13
[0657] RNA ribonucleic acid
[0658] ROC receiver operating characteristics
[0659] SNP single nucleotide polymorphism
[0660] TMEM35 transmembrane protein 35
[0661] TNF tumour necrosis factor
[0662] UC ulcerative colitis
[0663] Tables to this application
TABLE-US-00001 TABLE 1 Disease characteristics of the whole blood, anti-TNF treated cohort. Crohn's Ulcerative disease colitis Characteristic n = 24 n = 30 Sex, women, n(%) 12 (50.0) 18 (60.0) Endoscopic assessment after initiated therapy, n (%) Endoscopic remission 13 (54.2) 10 (33.3) No endoscopic remission 11 (45.8) 20 (66.7) Anti -TNF agent, n (%) Infliximab 10 (41.7) 12 (40.0) Adalimumab 14 (58.3) 18 (60.0) Age. Years median (!QR) 31.9 (26.5-51.5) 43.5 (29.6-55.7) Disease duration.years, median (!QR) 7.8 (2.1-22.2) 5.1 (1.7-17.0) (-reactive protein, mg,/L median (!QR) 5.7 (0.9-8.5) 3.9 (1.1-24.6) Faecal calprotectin, μg/g, median (!QR) 1190 (328-1800) 1361 (804-1800) Albumin, g/L, median (!QR) 42.3 (392-45.2) 43.6 (39.4-45.5) Body Mass Index, kg/m.sup.2, median (!QR) 22.1 (20.4-25.1) 21.6 (19.7-25.9) Disease location Crohn's disease, n(%) Ileal disease (Ll) 6 (25.0) N.A Colonic disease (L2) 6 (25.0) Ileocolonic disease (L3) 12 (50.0) Upper GI involvement (L4) 1 (4.2) Disease location ulcerative colitis, n (%) Proctitis (El) 3 (10.0) Left - sided colitis (E2) 19 (63.3) Extensive colitis (E3) 8 (26.7) Disease behaviour Crohn's disease, n(%) Non stricturing non- penetrating (Bl) 15 (62.5) N.A Stricturing (B2) 6 (25.0) Penetrating (B3) 3 (12.5) Perianal disease (p) 4 (16.7) Previous IBO related surgery (resection, 10 (41.7) N.A stricturoplasty) Concomitant medication, n (%) To picalor systemic steroids 8 (33.3) 8 (26.7) Immunomodulators 12 (50.0) 6 (20.0) Previous biological agents, n (%) Any 8 (33.3) 10 (33.3) Infliximab 4 (16.7) 2 (6.6) Adalimumab 4 (16.7) 3 (10.0) Vedolizumab 4 (16.7) 7 (23.3) Ustekinumab 3 (12.5) N.A Smoking, n (%) Never 16 (66.6) 18 (60.0) Active 4 (16.7) 5 (16.7) Former 4 (16.7) 7 (23.3)
TABLE-US-00002 TABLE 2 Correlation between the overall TREM1 expression level and the expression of the different transcripts in whole blood. Overall Overall TREM1 TREM1 signal signal TREM1-mb TREM1-sv TREM1-mb ρ = 0.55 (p = 1.6 × 10−5) TREM1-sv ρ = 0.52 ρ = 0.73 (p = 1.0 × 10−4) (p = 3.5 × 10−9) TREM1-x2 ρ = 0.72 ρ = 0.78 ρ = 0.78 (p = 2.3 × 10−9) (p = 9.9 × 10−12) (p = 4.8 × 10−11)
TABLE-US-00003 TABLE 1 Baseline disease characteristics of all included patients Sex, women, n (%) 44 (68.8) Disease duration, y, median (IQR) 16.5 (9.7-23.6) Age at initiation of ustekinumab, y, median (IQR) 39.3 (31.6-50.9) C-reactive protein, mg/L, median (IQR) 10.8 (4.6-19.0) Faecal calprotectin, μg/g, median (IQR) 1260.3 (257.9-1800) Serum albumin, g/L, median (IQR) 40.6 (38.1-42.5) Harvey Bradshaw Index, median (IQR) 9.0 (7.0-11.0) Simple Endoscopic Score for Crohn's disease, 11.5 (8.0-18.0) median (IQR) Previous biological therapy, n (%) Previous anti-TNF exposure 63 (98.4) Previous vedolizumab exposure 51 (81.3) Disease location, n (%) Ileal disease (L1) 19 (29.7) Colonic disease (L2) 5 (7.8) Ileocolonic disease (L3) 40 (62.5) Upper GI involvement (L4) 11 (17.2) Disease behaviour, n (%) Inflammatory (B1) 19 (29.7) Stricturing (B2) 29 (45.3) Penetrating (B3) 16 (25.0) Perianal disease (p) 25 (39.1) History of CD-related surgery, n (%)* 42 (65.6) Concomitant medication, n (%) Corticosteroids Topical steroids 7 (10.9) Systemic steroids 13 (20.3) Immunomodulators 1 (1.6) Smoking status, n (%) Active smoking 16 (25.0) Previously smoking 18 (28.1) Never smoked 30 (46.9) n = number of patients; y = years; IQR = interquartile range; CD = Crohn's disease
TABLE-US-00004 TABLE 2 Enriched pathways among the inferred feature sets in the blood monocytes. Pathway enrichment was performed using Ingenuity Pathway Analysis. 50% decrease in Endoscopic faecal calprotectin response by week 8 after 6 months Benjamini-Hochberg corrected p-value OX40 Signaling Pathway 0.00158489 5.37032E−07 Antigen Presentation Pathway 0.0060256 1.99526E−06 Allograft Rejection Signaling 0.006345654 2.75423E−06 Cdc42 Signaling 0.0107519 2.5704E−05 Role of NFAT in Regulation of 0.017519 0.0002884 the Immune Response Th1 and Th2 Activation 0.0144544 0.00040738 Pathway CXCR4 Signaling 0.03235937 / Graft-versus-Host Disease / 0.00056234 Signaling IL-4 Signaling / 0.00758578 Neuroinflammation Signaling / 0.00891251 Pathway Dendritic Cell Maturation / 0.01202264 Type I Diabetes Mellitus / 0.012022644 Signaling Chemokine Signaling / 0.04073803
TABLE-US-00005 TABLE 3 Enriched pathways among the inferred feature sets in the colonic mucosa. Pathway enrichment was performed using Ingenuity Pathway Analysis). 50% decrease in Endoscopic faecal calprotectin response by week 8 after 6 months Benjamini-Hochberg corrected p-value Agranulocyte Adhesion and 5.7544E-06 / Diapedesis Granulocyte Adhesion and 0.000660693 / Diapedesis Hepatic Fibrosis/Hepatic Stellate 0.028840315 / Cell Activation Role of IL-17A in Arthritis 0.038904514 / Role of IL-17A in Psoriasis 0.047863009 /
TABLE-US-00006 TABLE 4 Colonic signature biological response CELSR3 HAAO FAM135B F2RL2 CMPK2 SLC28A2 RET CHP2 PITX1 GSTT1 Monocyte CD14 biological response FCER2 CTSL PTGFRN GPRC5C SLAMF7 NR4A2 GNG2 RHOC SULT1A1 DSC2 Monocyte CD14 endoscopic response NEDD4L ENGASE GSN GNLY CLEC10A HLA_DRB5 BAG3 ASGR2 HLA_DRB1 PTK2
TABLE-US-00007 TABLE 1 Number of features Number of discriminating downstream Size of positive or target Cell or feature negative Top proteins Expression tissue sub-network endoscopic feature in the trend in Drug Disease type (nodes; edges) outcome hubs network responders Vedolizumab Ulcerative CD4 32; 26 7 SMAD7* 13 ↑ colitis TNF* 6 ↑ Vedolizumab Crohn's CD14 79; 70 15 EGR1* 33 ↑ disease NFKB1A* 14 ↑ Anti-TNF Ulcerative Colon 94; 103 15 JUN (AP-1) 53 ↑ agents colitis CD4 20; 23 3 SOCS3* 18 ↑ CD14 68; 58 13 EGR1* 33 ↓ Anti-TNF Crohn's CD4 17; 21 11 CXCR4 11 ↑ agents disease CD14 35; 43 12 TNFAIP3* 8 ↑ *indicates the hubs whose downstream targets are enriched with Gene Ontology Biological Processes
TABLE-US-00008 TABLE 2 Latent Dominant -omic Predictive Cohort Factor (s) layer biomarkers Accuracy Vedolizumab LF 5 Genomics FAM129A, ELM01, TRIP13 84.2% Ulcerative PTAR1, ASAH1 colitis Vedolizumab LF 3 Genomics SKAP2, HAUS1, C3orf67, 77.2% Crohn's SEC14L6, ATP6V0D1 disease LF 8 Monocyte ABCG1, ERAP1, ERV3_1 98.0% transcriptomics APOL6, STON2 Anti-TNF LF 2 CD4.sup.+ T cell ELOVL4, FGL2, CTSW, 92.0% agents transcriptomics DDX11, LYZ Ulcerative colitis Anti-TNF LF 2-LF9 Genomics TRAPPC4, CDKAL1, 81.3% agents ACVRL1, TSPAN14, PCNP Crohn's LF 5-LF 16 Monocyte CITED4, CLEC5A, SGK1, 98.0% disease transcriptomics ALOX4AP, SGK223
TABLE-US-00009 TABLE 3 Anti-TNF treated Vedolizumab treated Anti-TNF treated Vedolizumab treated UC cohort UC cohort CD cohort CD cohort n = 55 n = 61 n = 69 n = 70 Sex, women, n (%) 27 (49.1) 31 (50.8) 33 (47.8) 42 (60.0) Disease duration, y, median (IQR) 3.0 (1.4-11.2) 10.4 (5.0-16.6) 5.4 (1.2-20.4) 14.9 (5.0-25.3) Age at inclusion, y, median (IQR) 41.0 (28.0-53.5) 45.9 (35.8-57.0) 34.8 (22.9-50.8) 41.7 (32.1-50.3) C-reactive protein, mg/L, median (IQR) 6.0 (1.9-21.8) 2.7 (1.0-11.5) 6.5 (2.7-26.9) 4.4 (1.9-13.2) Serum albumin, g/L, median (IQR) 42.4 (39.9-44.1) 42.3 (39.6-44.7) 41.0 (38.4-44.4) 42.2 (39.7-44.7) Previous biological therapy, n (%) Previous anti-TNF exposure 11 (20.4) 47 (77.0) 19 (27.5) 55 (78.6) Previous vedolizumab exposure 5 (9.1) 0 (0.0) 5 (7.2) 0 (0.0) Disease location, n (%) Ileal disease (L1) N.A. N.A. 21 (30.4) 13 (18.6) Colonic disease (L2) 14 (20.3) 11 (15.7) Ileocolonic disease (L3) 34 (49.3) 46 (65.7) Upper GI involvement (L4) 5 (7.2) 8 (11.4) Disease behaviour, n (%) Inflammatory (B1) N.A. N.A. 34 (49.3) 28 (40.0) Stricturing (B2) 18 (26.1) 25 (35.7) Penetrating (B3) 17 (24.6) 17 (24.3) Perianal disease (p) 15 (21.7) 34 (48.6) Disease extent, n (%) Proctitis (E1) 12 (21.8) 8 (13.1) N.A. N.A. Left-sided colitis (E2) 28 (50.9) 29 (47.5) Pancolitis (E3) 15 (27.3) 24 (39.3) Concomitant medication, n (%) Corticosteroids Topical steroids 11 (20.0) 24 (39.3) 9 (13.0) 18 (25.7) Systemic steroids 10 (18.2) 11 (18.0) 6 (8.7) 10 (14.3) Immunomodulators 15 (27.3) 4 (6.7) 21 (30.9) 7 (10.0) Smoking status, n (%) Active smoking 5 (9.1) 2 (3.3) 14 (20.3) 13 (18.6) Previously smoking 11 (20.0) 21 (34.4) 13 (18.8) 17 (24.3) Never smoked 39 (70.9) 38 (62.3) 42 (60.9) 40 (57.1) Type of anti-TNF therapy, n (%) Adalimumab 19 (34.5) N.A. 35 (49.3) N.A. Infliximab 35 (65.5) 35 (50.7) Favorable endoscopic outcome, n (%) 20 (36.4) 38 (62.3) 38 (55.1) 33 (47.1) n = number of patients; IQR = interquartile range; N.A. = not applicable; UC = ulcerative colitis; CD = Crohn's disease
TABLE-US-00010 TABLE 4 ID LF1 LF2 LF3 LF4 LF5 LF6 LF7 LF8 227 −2.612 −0.213 0.070 −0.323 −1.678 −0.061 0.228 −0.109 9823 −2.564 −1.036 −0.294 −0.214 −0.541 −0.087 −0.332 −0.161 2949 −1.942 −0.338 −0.658 2.486 −3.123 −0.331 −0.794 0.368 5561 −2.487 −0.505 0.160 −0.083 −0.778 −0.346 −0.713 0.114 7062 −2.213 0.258 0.430 −2.204 −1.736 0.121 −0.721 −0.055 7936 −2.273 −1.379 0.258 −1.107 −0.858 0.056 −0.203 −0.199 8537 −2.251 2.156 −0.060 −0.623 −1.577 −0.026 0.584 −0.326 9516 −2.641 −0.727 0.946 −0.133 −0.157 0.166 3.009 −0.102 9652 −2.389 −0.261 0.511 1.250 −1.466 −0.237 −0.011 −0.006 9893 2.663 0.236 −4.536 0.202 1.194 −0.582 0.515 −0.270 12378 −2.160 2.634 0.856 0.374 1.659 0.130 −0.168 −0.019 12637 −1.954 0.202 0.525 0.369 −5.408 0.078 0.242 −0.014 12688 −1.799 −0.730 0.471 −0.741 16.107 −0.143 0.406 0.120 4748 −2.538 −0.132 0.006 −0.075 −1.905 −1.078 −0.675 0.535 5468 −3.067 1.261 −0.129 0.487 0.063 −0.418 −0.617 0.075 5520 −2.510 −1.171 −0.035 −0.350 −1.213 0.609 −0.154 −0.095 7270 −2.513 −1.130 0.011 1.493 −1.666 −0.523 0.404 0.175 7682 −2.646 −1.118 0.035 −0.389 −0.327 −0.160 −0.452 −0.120 8554 −2.364 −0.960 0.021 −0.702 −1.318 0.974 0.411 −3.352 8646 −2.150 0.481 0.010 −0.327 −2.524 −0.747 −0.187 −0.397 11057 6.928 0.268 0.420 1.869 0.664 −0.317 0.133 −0.070 11615 24.304 0.307 0.309 −1.455 −1.672 −0.216 −0.368 −0.020 12204 −0.824 0.361 0.178 0.429 0.576 3.723 −0.253 0.085 12484 −3.743 1.985 −0.080 −0.608 −2.902 −0.083 0.584 −0.119 12755 −3.825 −0.709 −0.153 −0.544 0.523 −0.173 −0.590 −0.056 12942 9.386 −1.132 0.756 1.009 0.851 −0.159 0.187 −0.129 287 −2.015 2.036 0.000 0.024 −2.694 0.000 −0.325 −0.825 687 −2.837 −0.188 0.000 −0.027 −0.257 0.000 1.219 2.042 2500 −2.312 −0.201 0.000 −0.020 −1.166 0.000 −2.255 −0.099 2634 −2.792 −0.552 0.000 0.029 −1.225 0.000 0.265 −0.328 3678 −2.944 0.947 0.000 −0.014 −0.174 0.000 2.073 2.454 4439 −2.568 0.033 0.000 −0.013 −1.292 0.000 0.064 0.747 4928 −2.396 0.806 0.000 −0.038 −1.388 0.000 −0.982 −0.942 5283 −2.031 0.153 0.000 −0.040 −1.959 0.000 0.812 0.728 5513 −2.563 −0.341 0.000 0.025 −1.041 0.000 0.019 −0.093 6009 −2.486 −0.491 −0.001 −0.094 −0.292 0.000 −1.882 −1.303 6772 −2.585 −2.557 0.000 −0.005 −1.089 0.002 1.319 −1.329 6962 −2.563 0.407 0.000 −0.048 −0.965 0.000 3.139 −2.390 7120 −2.414 −0.478 0.000 −0.063 −0.380 0.000 −1.768 −0.519 7154 −2.535 0.689 0.000 −0.040 −0.289 0.000 −0.603 −0.812 7495 −3.001 −0.132 0.000 0.029 0.177 0.000 0.010 −1.756 7915 −2.278 −0.276 0.000 −0.035 −1.447 0.000 −0.117 0.610 7976 −2.408 3.225 0.000 0.031 −1.157 0.000 0.374 −2.791 7987 −2.641 1.427 0.000 −0.044 −0.237 0.000 −1.281 1.149 8051 −2.652 −0.856 0.000 −0.010 0.088 0.000 0.975 −0.371 8747 −2.381 −0.397 0.000 −0.031 −1.208 0.000 −1.738 −1.202 8798 −2.370 0.426 0.000 −0.045 −0.927 0.000 −1.980 −0.120 8978 −2.582 0.357 0.000 −0.019 −1.071 0.000 −0.773 1.587 9732 −2.557 −0.193 0.000 0.027 −1.242 0.000 −0.293 −0.872 10833 0.018 −0.208 0.009 −0.783 0.455 −0.908 0.284 0.928 11128 1.925 1.220 0.004 −0.783 2.517 0.257 −0.649 −0.999 11383 3.588 −0.191 0.062 0.145 −0.327 −2.482 −0.072 −0.537 11508 5.928 −0.077 −0.005 −0.795 1.943 −1.204 −0.835 0.537 11605 0.326 −1.318 −0.011 −0.368 −4.526 2.909 −0.073 1.073 12129 −1.760 0.384 0.025 −0.777 0.763 −0.473 0.088 1.012 12194 0.598 −0.042 0.002 4.617 1.463 −0.427 −0.097 −0.133 12792 12.090 0.184 0.014 −0.347 −1.458 0.372 0.355 0.654 12505 −2.319 0.175 −0.868 −0.470 −2.726 −0.486 0.733 0.882 12874 1.603 −0.628 0.194 −0.017 0.720 −1.388 −0.737 −0.153 8724 −2.397 −0.142 0.477 0.452 −1.259 −0.130 0.076 0.010 12135 −2.214 0.026 0.187 0.272 0.945 −0.179 −0.522 0.124 R2 0.050 −0.089 −0.140 0.124 −0.251 0.123 −0.078 −0.074 P-value 0.700 0.496 0.282 0.340 0.051 0.344 0.551 0.573 Endoscopic_im- ID LF9 LF10 LF11 LF12 LF13 LF14 provement 227 0.838 0.524 −0.093 −0.130 −0.007 0.533 0.000 9823 0.640 −0.691 0.109 −0.553 0.266 −0.184 1.000 2949 0.215 −0.127 4.487 −0.707 0.059 1.277 1.000 5561 −0.859 −0.306 −1.601 0.022 −0.016 0.764 1.000 7062 −0.272 −0.440 1.298 0.415 −0.043 1.148 1.000 7936 −0.287 −0.736 1.415 2.667 0.215 −0.141 1.000 8537 1.659 −0.160 −0.096 0.442 0.172 0.042 1.000 9516 −0.206 −0.451 0.949 −1.959 0.016 −0.162 0.000 9652 −0.231 −0.319 −1.009 −0.222 −0.072 0.042 1.000 9893 −0.779 0.943 −0.321 0.446 −0.141 −0.242 1.000 12378 −0.519 0.153 1.301 0.720 −0.221 −0.011 0.000 12637 −0.960 0.718 −0.427 0.111 0.318 −0.296 1.000 12688 −0.612 0.150 −0.001 −0.138 0.059 0.101 0.000 4748 0.531 0.391 0.029 0.315 NA NA 0.000 5468 0.090 1.847 −1.797 −1.422 0.068 0.721 1.000 5520 −0.619 0.146 0.431 −1.683 NA NA 1.000 7270 4.676 0.115 0.525 −0.104 NA NA 0.000 7682 0.546 −1.769 −0.808 −0.758 −0.126 0.322 0.000 8554 −0.345 −0.402 0.100 0.647 NA NA 1.000 8646 −0.267 −0.344 −0.267 0.128 NA NA 1.000 11057 −0.218 −6.901 −0.948 1.708 0.063 0.120 1.000 11615 −0.185 0.212 0.353 −1.010 0.121 0.032 1.000 12204 0.461 0.929 −0.629 −0.236 −0.223 −0.066 1.000 12484 −0.199 −0.546 −0.100 −2.011 NA −0.044 0.000 12755 0.836 −0.845 −0.686 −0.917 −0.127 0.336 1.000 12942 0.164 5.299 −0.565 2.400 −0.231 0.385 1.000 287 0.000 0.032 0.000 −0.015 NA NA 1.000 687 0.000 −0.076 0.001 0.001 NA NA 0.000 2500 0.000 −0.446 0.000 −0.046 NA NA 1.000 2634 −0.001 0.517 0.000 0.042 NA NA 1.000 3678 0.000 0.281 −0.002 0.029 NA NA 1.000 4439 0.000 −0.146 0.000 −0.015 NA NA 1.000 4928 0.000 −0.304 0.001 −0.009 NA NA 0.000 5283 0.000 −0.538 0.001 −0.034 NA NA 1.000 5513 −0.001 0.385 −0.002 0.020 NA NA 1.000 6009 0.000 −1.128 0.006 −0.040 NA NA 1.000 6772 0.000 −0.121 0.007 −0.013 NA NA 0.000 6962 0.000 −0.440 0.002 −0.006 NA NA 1.000 7120 0.000 −0.579 0.001 −0.024 NA NA 1.000 7154 0.000 −0.475 0.002 −0.019 NA NA 0.000 7495 0.001 0.004 0.000 −0.002 NA NA 1.000 7915 0.000 −0.339 0.000 −0.011 NA NA 0.000 7976 0.000 0.090 −0.001 −0.009 NA NA 0.000 7987 0.000 −0.644 0.001 −0.025 NA NA 1.000 8051 0.000 −0.377 0.001 −0.005 NA NA 0.000 8747 0.000 −0.254 0.001 −0.006 NA NA 1.000 8798 0.000 −0.737 0.001 −0.050 NA NA 0.000 8978 0.000 −0.076 −0.001 0.003 NA NA 0.000 9732 0.000 −0.127 −0.001 −0.003 NA NA 1.000 10833 −1.137 −0.424 0.179 0.564 NA NA 1.000 11128 1.201 −0.616 −0.499 0.918 NA NA 0.000 11383 −0.953 0.900 0.146 0.047 NA NA 1.000 11508 0.414 −0.083 −0.226 −0.836 NA NA 0.000 11605 −1.103 −0.715 0.609 1.077 NA NA 1.000 12129 −0.233 −0.577 −0.429 0.145 NA NA 0.000 12194 −1.673 −0.760 −0.318 −0.100 NA NA 1.000 12792 0.139 −0.373 0.092 −0.539 NA NA 0.000 12505 0.143 −0.311 −0.474 1.177 −0.064 0.130 1.000 12874 0.168 0.896 0.258 −0.041 0.053 NA 0.000 8724 −0.437 −0.316 −0.524 −0.590 0.006 −0.213 1.000 12135 −0.036 −0.322 0.191 −0.171 −0.143 −5.712 0.000 R2 −0.273 0.023 −0.040 0.193 0.231 0.340 P-value 0.033 0.860 0.758 0.136 0.277 0.104
TABLE-US-00011 TABLE 5 ID LF1 LF2 LF3 LF4 LF5 LF6 LF7 LF8 2863 0.351 0.467 −2.259 −0.736 −0.255 −0.226 0.059 0.041 4550 −3.102 −0.514 −1.490 −0.753 0.009 0.274 −0.312 −0.641 8030 −3.808 0.117 −1.572 1.619 −0.060 0.471 −0.032 0.446 426 −3.802 0.770 −1.998 −0.607 −3.954 0.364 0.256 0.777 2737 −2.801 −0.106 −1.550 1.461 0.275 0.280 −0.656 −0.347 6365 −2.712 0.009 −2.013 0.215 0.212 0.553 −0.275 0.520 7298 −1.967 −0.593 −1.935 0.576 0.114 0.094 −0.412 −0.744 10739 −3.842 0.814 −1.919 −2.840 0.580 −0.070 −0.417 0.376 10795 0.082 −0.569 12.126 1.169 −0.017 0.045 −0.013 0.013 10899 0.714 0.341 1.573 −0.184 −0.071 0.178 −2.965 −0.447 11157 −0.193 −0.155 −2.617 1.463 0.034 0.516 −0.679 0.486 11193 −1.685 −0.473 −2.837 0.438 −0.104 0.582 0.004 −0.683 11440 0.503 −0.561 −2.694 0.022 0.303 0.068 −0.619 −0.603 488 0.131 −2.458 −1.694 1.015 0.014 0.227 0.724 0.182 1628 0.449 −0.807 −1.985 0.516 0.050 0.046 1.404 −0.140 1706 −1.858 −0.911 −2.013 0.111 −0.186 0.862 0.025 −1.027 1856 2.387 −0.752 9.442 −6.895 −0.177 −0.026 −0.240 −2.159 2372 −0.797 −0.262 −1.967 −0.097 −0.057 0.739 −0.450 0.150 4699 −3.342 −0.089 −1.250 0.204 0.148 0.229 0.182 −1.659 5587 −0.246 −1.809 −1.453 −0.388 0.241 0.134 −1.797 0.484 6490 −5.336 −0.466 1.200 0.154 0.274 0.407 3.230 3.985 7129 −2.125 −0.582 −0.901 −0.338 0.624 0.360 0.086 0.164 7413 0.541 −3.127 −0.985 −0.372 −0.242 0.243 0.064 −0.189 8304 −1.474 −0.916 −1.315 −0.112 −1.049 −0.578 0.026 0.658 8462 −0.992 −0.475 0.465 0.984 −0.006 0.166 −0.553 −0.753 10038 −1.705 −1.272 −2.063 −0.435 1.880 0.983 0.096 0.674 10147 0.519 −1.294 −1.441 −0.276 −0.576 −0.668 0.051 −0.018 10283 3.646 −0.566 −6.490 1.592 0.296 0.037 0.592 −0.699 10825 0.234 −0.434 −1.522 0.242 0.108 0.516 0.056 0.067 11820 −3.240 0.676 9.835 −1.295 0.172 0.582 0.682 3.162 11952 0.059 0.121 −1.733 −0.314 0.140 −2.148 −0.396 0.296 12128 3.575 0.955 −8.548 −0.471 0.458 0.184 0.055 −1.899 12138 −0.902 0.416 1.870 −0.210 0.381 0.182 −0.074 2.019 12601 17.634 −0.224 1.577 0.957 0.189 0.531 1.259 2.502 12674 0.166 0.266 0.523 −0.140 −0.242 −5.334 0.016 0.591 13035 1.934 0.154 7.906 0.405 0.276 −0.044 −0.159 0.157 13244 1.524 0.877 −3.141 1.103 0.827 0.022 1.463 −9.039 158 −1.898 −1.668 −1.145 0.265 −1.002 0.383 −1.203 −0.591 608 −0.283 −1.792 −1.386 0.301 −0.777 −0.412 0.123 0.206 2630 −0.432 −1.535 −1.092 −0.455 1.318 −0.028 0.263 −0.033 2769 −3.922 −0.693 −1.453 −0.909 −1.011 −0.075 −1.204 −0.663 2852 −1.583 −1.257 −1.180 0.174 1.005 0.664 0.868 0.461 2958 −0.210 −1.046 −1.440 0.195 −0.512 −0.113 −2.182 1.338 3089 −2.047 −1.717 −1.155 0.188 1.792 0.080 2.671 1.169 3623 −1.411 −1.539 −1.358 −0.889 1.951 0.505 0.062 0.289 3930 −2.048 −0.925 −1.476 −0.022 2.661 0.400 −2.371 1.526 4173 −0.673 −1.222 −1.961 0.220 2.076 −0.717 −1.079 0.261 4698 −2.338 −1.482 −1.541 0.367 −0.498 0.337 0.025 0.587 4929 −2.212 −1.432 −1.002 0.265 −1.630 0.122 1.501 1.135 5476 −1.957 −1.870 −0.901 0.273 −1.208 0.173 −1.405 0.951 5559 −0.259 −2.017 −1.153 0.210 −0.506 −0.051 −2.009 −0.931 6086 0.043 −1.477 −1.378 0.205 1.191 −0.145 −1.460 −0.727 6103 −0.877 −0.646 −1.764 −0.005 1.885 0.072 −2.276 −0.619 7052 −0.958 −0.767 −1.791 0.072 1.878 0.710 −0.333 0.329 7505 −1.206 −1.590 −1.384 0.092 1.040 0.475 1.845 −0.319 7690 −1.636 −1.312 −1.028 −0.082 1.751 0.209 0.562 0.580 7691 −1.930 −1.868 −1.147 0.029 0.698 −0.507 0.010 1.495 7855 −3.716 −1.032 −1.310 0.244 −1.781 −0.436 1.387 0.112 8431 −0.630 −1.133 −1.749 0.430 2.079 0.213 −0.242 −1.751 9415 −1.474 0.109 2.645 −0.685 0.048 0.111 1.215 0.171 10409 0.352 3.014 5.624 −0.501 0.545 0.866 0.033 −1.646 10777 6.417 −0.081 0.081 1.488 0.694 0.957 −0.007 0.688 11463 0.187 2.112 −1.798 −0.109 0.607 −1.843 −0.166 0.555 11641 1.110 2.912 −1.523 −0.709 −0.422 1.401 −0.037 3.778 11655 0.493 0.317 −1.081 0.341 −0.095 0.027 2.155 0.074 11766 0.364 −0.029 2.004 −1.031 −0.077 0.062 −3.626 −0.237 11881 0.374 0.048 −0.150 −0.149 0.173 −0.028 3.674 −0.418 12011 0.003 −3.983 −0.406 −0.010 −0.480 −0.743 0.048 −0.100 12316 −0.229 2.237 3.984 0.149 −1.293 1.496 0.007 −1.467 12459 −0.072 −0.085 3.196 −1.043 0.073 0.070 0.757 0.149 R2 0.048 −0.141 −0.157 0.119 0.018 0.052 −0.005 −0.159 P- 0.692 0.243 0.195 0.325 0.882 0.670 0.964 0.188 value ID LF9 LF10 LF11 LF12 LF13 LF14 LF15 2863 0.305 −0.995 0.722 −0.561 −1.078 0.252 −4.360 0 4550 1.020 0.404 −0.077 −0.111 −1.308 −0.034 −0.135 1 8030 −0.051 0.183 −0.446 −0.485 −0.784 −1.745 −0.243 0 426 0.009 0.034 0.324 0.320 −0.933 0.192 1.009 1 2737 0.977 −0.473 0.073 1.321 −0.609 0.317 0.245 0 6365 −1.947 0.131 −0.790 0.393 −0.831 −0.150 −0.349 1 7298 −2.164 0.146 0.567 0.479 −0.641 −0.132 0.358 0 10739 0.065 −0.264 0.553 −0.301 −0.774 −0.205 0.667 0 10795 −0.072 0.022 0.350 0.216 −2.179 0.061 0.035 0 10899 0.041 0.619 0.131 −2.844 2.432 0.486 0.585 0 11157 0.287 0.191 −0.639 0.548 −0.661 −0.022 −0.178 0 11193 0.855 0.113 −0.828 0.787 0.855 −0.227 −0.617 0 11440 −0.354 −0.410 0.516 0.893 −3.428 0.543 0.543 1 488 0.073 0.291 −0.303 1.475 −0.568 0.748 1.066 0 1628 −0.176 −0.814 −0.368 −1.165 −0.584 0.301 −0.188 0 1706 −3.365 0.058 1.123 0.398 −0.369 −0.572 0.127 1 1856 −0.218 −0.116 0.829 −0.065 0.223 −0.362 0.315 0 2372 −3.515 −0.513 0.229 −0.154 −0.473 −0.284 −0.042 1 4699 −0.121 −0.283 0.113 −1.094 −1.169 −0.143 0.139 1 5587 0.616 −0.207 2.322 −0.941 −0.609 −1.922 −0.354 0 6490 −0.890 0.120 −0.477 −2.496 −1.221 0.586 0.149 0 7129 1.684 −0.495 1.815 0.000 −1.246 1.341 0.027 1 7413 0.186 0.277 1.879 −0.119 −0.946 −1.176 2.887 1 8304 −2.101 −0.189 −2.812 −0.024 −0.939 0.670 0.436 1 8462 −0.598 0.293 0.310 0.203 −1.016 −0.055 0.176 1 10038 −0.737 0.594 −1.700 −0.331 −0.385 1.058 0.125 1 10147 0.788 −0.742 −0.086 0.035 −0.800 −0.047 0.706 1 10283 0.720 −0.704 0.314 −0.278 13.825 0.012 0.179 1 10825 0.110 −0.919 −2.188 −3.501 −1.128 −0.015 0.370 1 11820 −1.010 0.730 −1.131 1.613 5.676 0.297 −0.249 0 11952 0.391 0.328 1.544 −0.470 1.339 −0.104 −1.611 1 12128 0.617 0.050 0.197 −0.036 −3.467 −0.100 0.182 0 12138 1.354 0.200 −0.049 0.034 −2.397 0.095 0.217 0 12601 0.145 0.350 −0.844 0.993 0.001 0.014 −0.306 1 12674 0.458 −0.430 −0.734 −0.010 −1.854 0.069 0.494 0 13035 −0.008 −0.551 0.590 0.466 1.278 −0.107 0.536 1 13244 0.366 0.011 0.375 −0.419 −0.539 0.259 0.575 1 158 0.001 0.047 0.000 0.001 −0.892 0.000 0.000 0 608 0.001 −0.018 0.000 0.001 −0.525 0.000 0.000 1 2630 −0.002 −0.302 −0.001 0.000 −0.890 0.001 0.000 1 2769 −0.004 0.380 −0.001 −0.002 −0.679 0.000 0.000 0 2852 0.001 −0.001 −0.001 0.000 −0.741 0.000 0.000 0 2958 0.001 −0.410 0.000 0.001 −0.915 0.000 0.000 0 3089 0.000 0.396 0.000 0.000 −0.608 0.000 −0.001 1 3623 0.002 0.224 0.000 0.000 −0.723 −0.001 0.000 0 3930 0.002 0.220 0.000 0.000 −0.677 0.000 0.000 1 4173 0.002 −0.081 0.001 0.000 −0.376 0.000 0.001 0 4698 0.001 0.420 0.000 0.000 −0.479 0.000 −0.001 1 4929 0.001 0.257 0.000 0.000 −1.063 0.000 0.000 0 5476 0.002 0.232 0.000 0.000 −0.835 0.000 −0.001 1 5559 0.001 −0.357 0.000 0.001 −0.628 0.000 0.000 0 6086 0.001 −0.582 0.000 0.000 −0.571 0.000 −0.001 1 6103 0.000 −0.450 0.000 0.000 −0.467 0.000 0.000 1 7052 0.003 −0.219 0.000 0.000 −0.553 0.000 0.000 0 7505 −0.001 −0.033 −0.001 0.000 −0.797 0.000 −0.001 0 7690 −0.001 −0.124 0.000 0.000 −0.888 0.000 0.000 1 7691 0.001 0.383 0.000 0.000 −0.579 0.000 −0.001 1 7855 −0.001 0.430 −0.001 0.000 −0.641 0.000 −0.001 1 8431 0.002 −0.426 −0.001 0.000 −0.524 0.000 −0.001 1 9415 0.738 0.010 0.335 −1.004 0.085 2.473 1.799 0 10409 0.153 −0.026 −0.983 0.214 3.123 −3.175 0.400 0 10777 0.620 −0.020 −0.633 −0.133 1.690 0.339 −1.112 0 11463 −1.163 −0.026 1.249 −0.065 4.973 2.003 1.324 0 11641 0.251 0.024 0.163 0.224 −1.125 −0.473 −1.077 0 11655 0.059 −0.065 0.446 −0.173 5.367 −0.414 0.820 0 11766 0.095 −0.049 −0.077 3.037 1.026 1.573 0.111 1 11881 −0.286 0.078 −0.464 1.292 0.315 0.031 −0.924 1 12011 0.245 0.050 0.313 0.197 3.686 −0.374 −0.029 0 12316 0.380 0.048 −0.496 −0.170 0.533 2.166 1.045 1 12459 0.244 0.056 −2.492 1.334 0.837 −1.886 −0.406 0 R2 −0.158 −0.052 0.007 0.051 −0.049 0.146 0.104 P- 0.193 0.670 0.956 0.674 0.689 0.228 0.390 value * = Endoscopic remission
TABLE-US-00012 TABLE 6 LF1 LF2 LF3 LF4 LF5 LF6 LF7 LF8 LF9 LF10 LF11 LF12 LF13 LF14 LF15 1.3 0.0005 −0.0002 −0.0771 −0.0003 0.0001 0.0644 −0.0005 0.0003 0.0003 0.0004 NA NA −0.0090 0.0002 0 1.2 0.0001 −0.0004 −1.5738 0.0002 0.0004 0.0664 −0.0007 −0.0001 0.0001 0.0003 NA NA 0.0003 0.0000 1 1.3 0.0003 0.0004 −1.5222 0.0011 0.0001 0.0568 −0.0026 −0.0005 −0.0009 0.0002 NA NA −0.0260 −0.0005 1 1.4 −0.0234 −0.9551 0.7069 0.2537 0.7710 0.1267 −0.4931 −0.9769 2.1486 −0.0830 0.4952 0.0645 −0.4808 −0.1989 0 1.2 −1.1162 0.3452 −1.4871 0.0543 −0.5874 0.0979 0.0659 0.0240 1.1795 −0.1716 1.3374 NA −0.2017 −0.0160 0 1.3 0.0000 −0.0001 −0.5494 0.0003 0.0002 0.0700 −0.0005 0.0000 −0.0003 0.0002 NA NA −0.0052 0.0000 0 1.4 0.0001 0.0001 −0.5215 −0.0003 −0.0004 0.0777 0.0007 0.0005 0.0002 0.0001 NA NA 0.0054 0.0000 1 1.4 −0.0003 0.0001 0.0106 0.0005 −0.0006 −0.0289 −0.0006 −0.0002 0.0000 0.0001 NA NA −0.0060 0.0002 1 1.2 −0.0003 −0.0001 −1.4938 −0.0002 0.0008 0.0866 −0.0009 −0.0004 −0.0001 −0.0001 NA NA −0.0137 −0.0003 1 1.3 0.0064 −0.0784 −1.1556 −1.4151 0.2896 0.0508 0.3608 0.2423 −1.7521 −0.8247 0.4460 0.2005 −3.0759 −0.1960 0 1.2 3.0497 0.5460 −1.4887 −1.7992 0.8908 0.2040 −0.1347 1.4749 −1.0829 0.2892 NA NA −0.2874 0.3448 1 1.2 −0.0001 −0.0004 −1.0991 −0.0001 0.0004 0.0936 −0.0007 −0.0006 0.0014 0.0001 NA NA −0.0080 −0.0005 0 1.3 −0.0007 −0.0004 −0.8424 0.0006 −0.0004 0.0555 −0.0009 −0.0005 0.0000 0.0002 NA NA −0.0077 0.0001 0 1.3 −0.0001 0.0002 −0.5456 0.0002 0.0006 −0.3167 0.0016 −0.0009 0.0007 0.0000 NA NA 0.0332 0.0002 0 1.4 −0.0002 0.0004 −0.4269 −0.0006 0.0002 −0.3469 0.0045 0.0000 0.0011 −0.0005 NA NA 0.0582 −0.0001 0 1.4 2.0316 −0.0359 −0.3986 3.5765 0.5415 −1.0002 −0.3330 −0.1636 −0.1681 0.0057 NA NA 0.1763 −1.2483 0 1.4 0.0002 −0.0003 −0.5070 0.0001 0.0006 0.1167 −0.0008 0.0000 0.0007 0.0003 NA NA −0.0062 −0.0004 0 1.3 −0.0005 −0.0003 −0.5079 0.0004 −0.0002 0.0555 −0.0014 −0.0005 0.0005 0.0002 NA NA −0.0077 0.0000 1 1.3 0.0001 −0.0001 −0.6650 0.0006 0.0003 0.0829 −0.0018 −0.0005 0.0000 0.0000 NA NA −0.0141 −0.0003 0 1.4 0.0000 0.0000 −0.6076 −0.0004 0.0002 −0.1194 0.0015 −0.0003 0.0008 −0.0001 NA NA 0.0124 0.0000 0 1.4 0.0002 0.0002 0.1603 −0.0003 0.0000 −0.0397 0.0007 0.0008 −0.0009 −0.0001 NA NA −0.0030 0.0000 1 1.2 0.0002 −0.0002 −1.4678 0.0003 0.0009 0.0492 −0.0006 −0.0003 −0.0002 0.0001 NA NA −0.0141 −0.0004 1 1.3 −0.0003 −0.0003 −1.0010 0.0002 −0.0001 0.0723 −0.0013 −0.0003 0.0001 0.0001 NA NA −0.0114 0.0001 0 1.4 −0.0002 0.0002 0.2470 −0.0013 −0.0003 −0.1682 0.0022 0.0003 0.0010 −0.0002 NA NA 0.0236 0.0003 1 1.3 −0.0005 −0.0005 −1.0524 0.0003 0.0000 −0.0837 0.0013 −0.0002 0.0011 0.0004 NA NA 0.0148 0.0004 0 1.4 −0.0005 −0.0002 −0.2712 0.0006 0.0000 0.0934 −0.0005 −0.0002 −0.0001 0.0002 NA NA −0.0070 0.0001 1 1.3 −0.0533 1.3686 −1.1999 −0.8468 −0.2763 0.1436 0.0432 −0.0115 0.1172 −0.3391 0.6898 −0.9841 5.0796 −0.1132 1 1.2 −0.0634 1.9727 −1.0041 0.5381 −1.9784 −0.0136 0.0322 0.1907 −1.5757 −0.5731 −0.2276 0.8325 −0.2363 −0.8291 0 1.3 −0.0001 −0.0004 −1.3443 −0.0001 0.0005 0.0976 −0.0010 −0.0002 0.0002 0.0002 NA NA −0.0119 0.0001 1 1.3 0.0000 −0.0003 −0.7000 0.0002 0.0003 0.1008 0.0002 −0.0001 −0.0002 0.0000 NA NA −0.0098 0.0000 0 1.3 −0.0476 −0.1825 −0.9309 0.0496 −2.2545 0.6324 0.0549 0.1852 0.6129 0.2149 −0.0063 0.0492 0.0608 0.7924 0 −0.4 −0.1083 −0.1214 1.2137 −0.1197 −1.4563 0.7550 0.1090 −0.7889 0.1529 0.2146 NA −3.0377 0.0624 −0.9715 0 −0.2 −2.3877 −0.1773 −0.5165 1.7600 0.3733 1.2657 −0.0451 1.2144 −0.3345 −0.0591 NA NA −0.2153 −2.6085 0 1.4 −0.0741 0.1651 0.5111 0.1997 0.4572 −1.0591 −5.3544 −0.3748 −0.4254 −0.0659 0.4517 −0.3886 0.1237 0.1859 1 −8.7 0.0229 0.2332 −0.2680 2.0546 −0.4987 0.2180 −0.0891 −0.0744 −0.1318 −0.0461 NA NA −0.1460 1.9151 1 −4.4 1.0760 0.0189 −0.2979 −3.2580 −0.6061 −0.6507 −0.1300 −0.5437 −0.3992 −0.1340 NA NA 0.1016 −3.0659 0 1.6 −4.0276 −0.2449 0.2949 −0.9688 −1.5791 −1.2861 −0.1350 −0.6237 −1.4166 0.1120 NA NA −0.0366 1.6773 0 1.1 −0.0498 −0.3401 −0.1717 0.1835 −0.8683 1.5232 0.1101 1.3572 −0.9751 −0.1699 −0.2981 0.1064 0.0862 0.1680 0 1.2 −0.0460 −7.2270 0.5807 0.2942 0.0585 0.9622 0.1109 0.7600 −0.6694 −0.2605 −0.3273 0.2484 0.3275 −0.0488 1 −1.8 −3.3253 0.2353 −0.1187 −0.9833 2.2811 0.1181 0.1985 0.6957 0.0990 0.2323 NA NA 0.2834 −0.4775 0 1.2 −0.0460 0.2792 −0.1175 0.1276 0.0508 −1.1744 −0.0130 −0.3056 −0.3946 −0.2199 −0.1280 0.2342 0.4192 0.0756 0 0.1 −0.0248 0.0818 0.4584 −0.0404 −0.0542 0.1387 −0.1866 0.1852 0.0323 5.3884 −0.0841 0.4700 −0.2316 −0.1484 0 1.2 −0.1121 0.2444 1.6120 −0.1644 −0.0938 0.6370 0.2790 1.0513 −1.0150 −0.3925 −0.4563 −1.3927 −0.1475 0.6688 0 2.2 0.2437 0.0913 0.7605 1.4226 −0.9547 −0.6853 0.1692 −0.0926 0.1027 0.1072 NA NA 0.0085 0.1420 1 1.4 −0.1041 1.0921 2.3911 0.2968 1.2370 −0.4285 0.7010 0.8171 −0.9773 −0.4065 −0.3061 −0.3258 −0.4137 0.0672 0 0.3 −0.0380 0.0467 ###### 0.2996 0.8821 1.3686 −0.0973 0.7370 1.4209 0.0724 −1.2162 0.0999 0.1454 0.0281 0 1.2 −0.0119 0.3473 1.3175 0.0609 0.9598 1.1139 −0.0700 −4.2244 0.0370 −0.0918 −0.3937 0.4785 −0.1592 0.2683 0 1.3 −0.0705 0.7913 1.1672 0.4102 0.5131 −2.8439 1.7720 −0.4831 −1.0932 −0.2408 −0.3010 0.6789 −0.0248 0.0991 0 1.2 0.0030 −1.7178 −0.1692 −0.2837 −0.8568 −0.2905 −0.3240 −0.5163 0.6668 −0.2445 0.1758 1.0153 0.0456 −0.0198 1 −23.6 −0.0700 0.6366 0.5211 0.1650 0.0819 −0.1602 0.5734 0.3342 −0.4146 −0.4776 0.1047 0.0168 −0.0785 0.0780 0 0.8 −0.0286 0.0253 2.8252 −0.3363 −0.4345 −0.7354 −0.2637 −0.1533 2.5915 −0.1780 −0.7898 0.2335 −0.2528 −0.2388 1 0.9 −0.0067 −0.6106 3.5841 −0.3427 0.8155 −1.4132 0.5047 0.0999 0.7847 −0.0291 −0.9797 0.4178 −0.1908 −0.0553 1 1.1 0.0317 2.5989 2.8101 0.2057 1.1203 1.8133 0.5176 1.1069 −0.6948 −0.4111 −0.7006 1.6598 −0.1109 −0.1577 0 −0.2 1.5875 −0.7774 0.0189 −1.0454 1.8129 −0.3624 −0.3025 −0.1678 −0.5344 0.0196 NA NA 0.0587 2.1804 0 1.8 0.9526 0.4213 −2.0907 0.3068 0.1867 −0.7847 0.1870 0.4209 0.6713 0.0318 2.5091 −0.5047 0.0214 −0.0014 1 0.1 0.1975 −0.2062 0.0323 0.0177 −0.0446 −0.1244 −0.2052 0.0495 0.1950 −0.0603 0.2147 −0.0018 0.2020 0.1347 0.5 0.1480 0.1310 0.8150 0.8980 0.7470 0.3650 0.1330 0.7200 0.1540 0.6620 0.3373 0.9935 0.1390 0.3270 * = Endoscopic remission
TABLE-US-00013 TABLE 7 LF8 LF9 LF10 LF11 LF12 LF13 LF14 LF15 LF16 LF17 LF18 LF19 LF20 LF21 −0.13 −1.0655 0.0004 −0.0001 0.0001 NA NA −0.0003 −0.0005 0.0000 NA 0.0000 0.0002 NA 1 0.18 −0.9945 −0.0001 −0.0003 −0.0002 NA NA 0.0001 −0.0002 −0.0002 NA −0.0004 0.0001 NA 0 −0.36 −1.2829 −0.0014 −0.0004 −0.0009 NA NA −0.0003 0.0012 0.0001 NA 0.0009 0.0001 NA 0 −0.09 −1.1664 −0.0002 −0.0001 −0.0003 NA NA 0.0001 0.0005 0.0000 NA 0.0000 0.0000 NA 1 0.69 −0.9659 −0.6857 0.0629 0.4525 NA NA −0.4935 −0.8644 0.8301 NA −0.5158 2.6816 NA 0 0.44 −0.3847 −0.7390 0.7145 0.3756 −0.7884 1.2173 −0.2850 2.9499 0.1687 −0.0587 0.1267 −0.2870 −0.3209 0 −0.31 −1.4948 −1.0498 −2.8897 0.0304 −0.4199 0.0747 0.7711 −0.9647 −0.5248 0.3931 −1.0751 −0.0432 −0.1870 1 0.46 −1.1302 −0.4967 0.8120 −0.2666 NA NA −0.0731 −0.4687 −0.7250 NA 3.2179 −0.4825 NA 1 −0.10 −0.8123 −0.4796 0.6374 −0.1975 NA NA 0.4449 0.9334 0.0733 NA −1.6412 −1.3094 NA 0 −0.53 −1.4447 −2.0167 1.6603 0.7312 −1.1717 −1.0437 −0.1610 −0.0593 0.5134 0.0162 0.6920 −0.1829 −0.3992 1 −0.53 −1.0596 0.0001 −0.0003 −0.0007 NA NA 0.0000 −0.0004 −0.0001 NA 0.0001 0.0003 NA 0 0.58 −0.8939 0.0005 0.0003 −0.0003 NA NA −0.0002 0.0002 0.0004 NA −0.0005 0.0002 NA 1 1.09 −0.7523 −3.3496 −1.2362 0.0969 0.2402 −1.3002 −0.7260 −0.5881 −0.2630 −4.4986 −0.1508 0.0576 0.2127 1 −0.46 −1.4550 0.9717 −0.0208 0.0628 0.4153 −0.2110 0.1518 −0.7275 0.1285 0.3430 −0.1190 0.0742 0.3411 1 −0.50 −1.3333 0.0005 0.0000 −0.0005 NA NA −0.0002 −0.0001 0.0001 NA 0.0000 0.0003 NA 0 −0.94 −0.8281 −0.0005 −0.0002 −0.0005 NA NA 0.0000 0.0004 0.0002 NA −0.0003 0.0001 NA 0 −0.93 −1.0619 −2.6753 −2.6890 −10.0013 −0.0553 0.3335 −0.4459 −0.2001 −1.6829 0.3316 −1.0388 0.0752 0.1066 0 −0.35 −0.7838 1.5200 1.6013 1.1265 0.9643 −0.2442 0.3450 0.8661 −0.7480 −0.0456 −0.2642 0.2646 −0.2143 1 −0.11 −1.1000 0.5101 1.0776 0.4054 0.6806 −0.2101 1.0115 −0.0863 −0.4039 0.2189 1.3330 −0.4786 0.4537 1 −0.75 −1.1438 −0.0004 −0.0003 −0.0006 NA NA 0.0003 0.0001 −0.0002 NA 0.0007 0.0001 NA 0 −0.58 −0.7059 −0.0001 −0.0002 0.0006 NA NA 0.0000 −0.0001 −0.0002 NA −0.0003 0.0001 NA 0 −0.32 −0.8475 −0.4928 0.7024 0.4201 NA NA 0.3201 −2.0278 −0.3487 NA 0.2459 −0.4683 NA 1 −1.58 −1.2599 −0.0043 0.0082 −4.6757 NA NA 0.0018 0.0147 −0.0617 NA 0.0364 −0.0179 NA 0 −0.60 −1.1165 −0.0020 0.0036 3.7329 NA NA −0.0007 −0.0013 0.1267 NA −0.0074 −0.0012 NA 0 −0.62 −1.2382 0.0007 0.0003 0.0009 NA NA −0.0005 0.0003 0.0006 NA −0.0002 0.0002 NA 1 −0.25 −1.1152 −0.0001 0.0002 0.0001 NA NA −0.0001 −0.0003 0.0001 NA 0.0000 0.0000 NA 0 −0.78 −0.1123 4.8370 −0.9087 1.0102 −0.8367 −0.2083 0.0095 0.0091 0.4612 0.4946 0.5069 −0.1351 0.1281 0 −0.57 −0.9683 −0.0004 −0.0004 −0.0012 NA NA −0.0002 −0.0002 −0.0001 NA 0.0006 0.0002 NA 1 0.05 −1.2958 −1.5998 −3.3128 −0.2725 NA NA 0.6233 0.4254 −0.5007 NA −0.2111 0.1739 NA 0 0.06 −0.9454 −1.1361 0.8879 0.7020 −0.5309 0.1104 0.5221 −0.3278 0.2310 −0.0873 −0.0221 −0.2594 0.3665 0 −3.94 2.0603 0.0004 −0.0008 1.7260 NA NA 0.0005 0.0092 0.7718 NA 0.0274 −0.0068 NA 0 −0.23 −0.6989 0.0000 0.0001 0.0003 NA NA −0.0002 0.0005 −0.0002 NA 0.0006 0.0001 NA 0 2.16 2.4730 0.6370 −0.3090 −0.7059 NA NA −0.5477 −0.5773 0.0265 NA −1.1842 −0.3751 NA 1 0.58 0.0063 0.5013 0.4893 0.2564 NA NA 1.3168 0.0606 −1.1926 NA −0.1919 1.2841 NA 0 −0.52 −1.0384 0.0003 0.0003 −0.0004 NA NA 0.0000 0.0003 0.0004 NA 0.0002 0.0002 NA 0 −0.60 −0.8615 −0.0001 0.0000 0.0002 NA NA −0.0001 0.0002 0.0003 NA −0.0003 0.0001 NA 1 −0.86 −1.0056 −0.0002 0.0001 −0.0001 NA NA −0.0002 0.0002 0.0001 NA 0.0003 0.0001 NA 1 −1.05 2.2650 −0.4772 0.3809 −0.0447 −0.5909 −0.9023 0.5977 −0.9736 0.6487 0.0421 −0.5154 0.4914 −0.3444 1 −0.40 −1.3260 −3.9472 0.3884 0.7955 0.0727 −2.0010 2.0954 0.1590 2.6226 0.2451 0.7849 −0.1379 −0.2074 0 −0.57 −2.9982 −2.4609 2.4095 0.2554 0.2964 0.4693 −2.5146 −0.2499 0.2804 −0.2214 0.0939 −0.1148 −0.2861 1 0.68 0.3402 −0.3872 0.1055 0.0675 NA NA 0.0015 1.7510 1.0939 NA 0.3737 −0.3013 NA 0 7.70 0.3498 0.0004 −0.0005 −0.6107 NA NA 0.0010 0.0031 −0.1426 NA 0.0087 −0.0020 NA 1 1.06 0.4635 −0.9050 −0.3898 −0.3701 NA NA 0.1511 −1.1379 0.2515 NA 0.3973 −0.4331 NA 1 1.23 12.0198 −0.3782 1.0512 0.5078 0.1859 2.4513 0.0449 −0.5293 −0.2711 −0.2043 0.3021 −0.2013 −0.1588 1 0.37 −0.2502 0.5712 1.3420 −4.5686 −0.5416 −1.1736 2.0088 1.2550 −0.5547 −0.4223 0.9265 0.1416 −0.3990 1 −0.06 1.1362 −0.2150 0.2570 −0.0893 NA NA −0.0913 0.3859 0.4874 NA 1.9796 −0.3562 NA 1 −0.38 −1.7879 0.8948 0.4178 −0.5749 NA NA −0.5049 −0.8034 −0.9075 NA −0.9886 1.8059 NA 1 0.29 −0.5132 −0.3914 0.6647 0.3593 NA NA 0.2104 0.4256 0.6320 NA −0.2573 0.7161 NA 1 −0.70 0.8566 1.6224 0.2506 −0.9982 NA NA 0.2745 0.5925 −0.8857 NA −0.3552 −0.1142 NA 0 0.79 −0.5415 −0.8498 −2.5259 0.4881 0.4328 0.8364 0.7550 0.0296 −0.9278 0.0123 0.1001 0.1259 −0.2476 1 −0.60 −0.3650 −0.2905 −0.0512 −0.6415 −0.0682 −0.0383 −0.2986 −0.9179 2.0054 0.2084 0.7068 0.3643 −0.0931 1 −5.55 3.1902 0.0109 −0.0189 −3.0709 NA NA −0.0009 −0.0094 0.1030 NA −0.0078 0.0214 NA 1 −0.50 −1.8686 −0.0050 0.0083 −3.1003 NA NA −0.0003 −0.0033 −2.6155 NA −0.0230 −0.0013 NA 0 −0.12 −0.0772 −0.6854 0.3003 0.8149 NA NA −0.0190 0.6278 −0.5377 NA 0.0148 0.2127 NA 1 −0.01 −1.0528 0.3664 0.2201 0.4967 NA NA −0.2511 −1.1761 −0.1006 NA −1.1162 −3.2650 NA 0 1.06 −1.3482 0.3135 −2.1930 0.3140 0.4224 0.9803 0.1261 −0.1612 −0.8296 0.0136 −0.0489 −0.1196 −0.3487 1 −0.95 −1.4507 3.0651 1.3884 −1.0154 0.7140 0.3134 −1.2719 0.5091 3.1311 −0.0805 −2.8353 −0.0846 −0.1052 1 −0.86 −0.2576 0.3737 −0.2376 −1.3131 NA NA −0.4174 1.4257 −0.5199 NA −0.4053 −0.0390 NA 0 −1.06 12.1430 4.4910 0.1009 0.2154 0.6651 −0.5935 0.1190 0.0007 0.2277 0.4380 0.7631 0.0011 0.8869 1 −0.07 −3.6470 2.1785 1.5038 −0.2582 0.2246 0.2257 0.1405 −0.5706 0.5513 0.4398 0.7799 0.1964 0.9424 0 −1.41 2.0627 −1.3872 −0.8062 1.2210 0.1897 −0.1009 −0.9688 −0.6420 −0.9602 0.5106 −0.1875 −0.1635 −0.2265 1 −0.34 0.7758 −2.5132 −1.4033 3.7513 0.6468 0.9315 −0.3926 1.4862 −0.9600 −0.0248 −1.8116 0.4234 0.1220 1 0.62 −1.9197 −0.2983 1.1532 0.2476 0.2393 −0.3394 0.6279 −0.5883 −0.5737 0.1359 −0.0774 −0.2618 −0.3510 1 −0.36 −2.7296 1.9929 −0.8686 0.8273 −0.6502 0.1133 −0.1410 −0.4138 −0.6330 0.0016 −1.3996 −0.0937 −0.1552 1 1.54 −4.9226 0.0318 3.8192 0.5531 0.5636 2.0236 0.0601 0.1436 −0.4260 −0.4011 0.4416 0.1913 0.2049 1 3.16 2.7551 0.4895 −0.6657 1.2019 0.3243 −2.0970 −1.9554 0.6722 0.5185 1.9875 2.6677 0.0445 0.1644 1 −0.25 −3.5416 4.4666 −3.5602 1.3178 −1.5877 0.5184 0.1228 0.0728 −1.0598 0.2278 −0.5587 0.1155 0.1297 0 0.19 0.1986 −0.0543 0.1399 0.1078 0.4662 −0.0131 −0.1413 −0.2229 0.0067 −0.1357 0.1119 0.0579 −0.2671 0.13 0.1070 0.6630 0.2590 0.3850 0.0124 0.9470 0.2540 0.0699 0.9570 0.4910 0.3670 0.6420 0.1690 * = Endoscopic remission
TABLE-US-00014 TABLE 8 CD14 CD4 Colonic transcriptomics transcriptomics transcriptomics Genomics Proteomics LF1 0.105273974 0.088385213 0.003020753 0.950280698 0.00059792 LF2 9.79E−06 0.021578921 0.359994242 7.53E−09 0.014131716 LF3 0.168740926 0.180140734 7.54E−07 7.11E−10 4.14E−07 LF4 0.04953133 0.021118877 0.169837798 3.60E−09 0.000186971 LF5 0.020767421 0.015356318 0.001364137 0.175277505 0.012267772 LF6 0.203808131 3.80E−06 0.011145948 1.38E−09 6.04E−07 LF7 0.007917863 0.027104104 0.018025908 9.59E−09 0.129881764 LF8 0.049873998 0.075545791 0.008884538 8.64E−09 0.037829629 LF9 0.005778834 0.089055019 0.06924577 5.07E−09 7.45E−07 LF10 0.002831743 0.019490559 0.019680736 0.061263467 0.002262467 LF11 0.033345742 0.026426239 0.036621108 5.25E−09 5.47E−06 LF12 0.026443226 0.036596012 0.027253031 3.21E−09 7.14E−05 LF13 0.000284343 0.073086147 4.22E−05 1.04E−10 9.70E−08 LF14 0.033559388 0.002761335 0.004343051 1.94E−09 1.65E−07
TABLE-US-00015 TABLE 9 CD14 CD4 Colonic Ileal transcriptomics transcriptomics transcriptomics Genomics transcriptomics Proteomics LF1 0.020150505 0.003058299 0.000846118 0.334258023 0.495806409 2.11E−06 LF2 0.107734145 0.046613838 0.00479919 0.452931764 3.11E−06 5.80E−06 LF3 6.09E−06 0.046999362 0.004739375 0.524176396 0.022252521 4.05E−06 LF4 0.026229796 8.00E−06 0.497343231 3.51E−09 0.018303664 0.00165458 LF5 0.037831659 0.105712983 0.004057203 7.20E−09 0.015250092 0.12256421 LF6 0.004332774 0.238432617 0.007804865 0.033322902 1.53E−06 2.62E−06 LF7 0.073274257 0.016133792 0.101671539 9.49E−09 0.010775876 0.05717292 LF8 0.074763911 4.27E−06 0.019791162 0.012119188 0.030863568 0.02554424 LF9 1.75E−06 0.029411629 0.002378223 5.12E−09 0.126107277 3.47E−06 LF10 0.1039055 2.22E−06 1.56E−07 0.045663968 2.99E−07 7.12E−07 LF11 3.40E−06 0.111258636 0.003463474 4.79E−09 0.034760745 1.05E−06 LF12 0.100361605 0.00477009 0.027440728 4.67E−09 0.003723176 7.69E−07 LF13 0.011756012 0.020174663 0.008019835 0.089616176 0.003114438 0.00333921 LF14 0.035499941 0.021397798 0.044367602 2.61E−09 0.00313375 6.84E−07 LF15 0.011464998 0.06266972 0.009527294 3.02E−09 0.004044323 1.26E−06
TABLE-US-00016 TABLE 10 CD14 CD4 Colonic transcriptomics transcriptomics transcriptomics Genomics Proteomics LF1 0.442632084 5.33E−06 0.007531549 0.982202051 1.57E−06 LF2 0.005086355 0.325089094 0.02583928 3.20E−09 3.66E−07 LF3 0.00333871 0.014214092 0.334368288 1.89E−09 1.28E−06 LF4 0.045498059 0.000311435 1.76E−06 0.108273583 0.009734834 LF5 0.102532335 0.050208257 0.004298854 4.27E−09 1.61E−06 LF6 0.026804598 0.011217684 0.107876292 3.61E−09 6.60E−07 LF7 2.14E−06 0.086136381 0.030769008 1.21E−09 0.000171567 LF8 2.81E−06 0.048805876 0.05816833 4.01E−09 2.60E−06 LF9 0.013884364 0.069446956 0.005171907 1.23E−09 9.22E−07 LF10 0.045592335 0.031843017 0.007515848 3.18E−09 1.12E−06 LF11 0.055844894 1.26E−05 0.025234355 6.19E−10 3.42E−07 LF12 0.077704623 2.22E−06 0.002306699 9.74E−10 2.81E−07 LF13 1.86E−06 0.076106163 7.50E−07 6.86E−10 5.18E−07 LF14 0.015243691 8.77E−05 0.043536692 4.86E−09 4.46E−05 LF15 0.014899092 0.026819286 0.013584118 1.15E−09 4.99E−07
TABLE-US-00017 TABLE 11 CD14 CD4 Colonic Ileal transcriptomics transcriptomics transcriptomics Genomics transcriptomics Proteomics LF1 1.75E−06 8.67E−06 6.98E−08 2.84E−09 0.004638137 0.954307756 LF2 2.32E−06 0.022701945 0.078441858 0.834271439 0.005266775 2.41E−05 LF3 0.048774509 4.66E−06 0.007605199 0.01058122 0.345318237 1.91E−07 LF4 0.008617638 0.017423723 5.74E−08 0.359833042 3.51E−10 0.007421826 LF5 0.1812121 0.148223702 0.018473985 3.41E−09 0.002591473 3.64E−08 LF6 0.029239849 2.84E−06 0.247929687 3.67E−09 0.06754099 9.45E−08 LF7 0.134358638 1.11E−05 0.166522802 5.21E−09 0.002596748 0 LF8 1.85E−06 0.190583538 0.016226277 0.078432602 0.004980627 0.000157842 LF9 2.60E−06 0.026639018 0.012440982 0.104642669 0.006781351 0 LF10 0.024241853 2.92E−06 7.17E−08 5.66E−09 0.12481585 0 LF11 1.97E−06 0.022741538 7.25E−08 4.23E−09 0.078348768 4.25E−08 LF12 0.035699754 0.003652557 0.037520329 6.94E−09 0.02318372 9.93E−08 LF13 0.092620236 4.45E−06 0.001607794 1.13E−09 0.001651592 2.45E−08 LF14 2.00E−06 0.087368741 0.003380707 8.43E−10 0.000214822 0 LF15 0.012721971 0.065161833 3.13E−08 1.29E−09 0.004013418 6.60E−09 LF16 0.063446827 0.012745593 2.79E−08 2.83E−09 0.00257053 1.68E−08 LF17 0.011917856 2.73E−06 0.03637788 2.23E−09 0.02768804 9.90E−10 LF18 3.63E−06 0.068279999 5.20E−08 2.73E−09 9.33E−05 0 LF19 0.031015424 1.57E−06 8.06E−08 2.99E−09 0.028866491 1.09E−08 LF20 0.033015328 0.021404602 4.49E−08 8.99E−10 0.001514128 7.05E−09 LF21 1.96E−06 0.030069691 1.56E−09 1.14E−10 1.45E−11 0.000439666
TABLE-US-00018 TABLE 12 Drug Disease Latent Factor Dominant -omic layer Vedolizumab Ulcerative LF 5 Genomics colitis LF 9-LF 12 CD4.sup.+ T cell transcriptomics Vedolizumab Crohn's LF 3 Genomics disease LF 8 Monocyte transcriptomics LF9 Ileal tissue transcriptomics Anti-TNF Ulcerative LF2 CD4.sup.+ T cell transcriptomics agents colitis LF 3-LF Colonic tissue 8-LF 14 transcriptomics LF 10 Monocyte transcriptomics Anti-TNF Crohn's LF 2-LF9 Genomics agents disease LF 5-LF 16 Monocyte transcriptomics LF 8 CD4.sup.+ T cell transcriptomics
TABLE-US-00019 TABLE 13 Anti-TNF Anti-TNF Anti-TNF Anti-TNF Anti-TNF Vedolizumab - Vedolizumab - Vedolizumab - agents - UC - agents - UC - agents - agents - agents - CD - UC - CD4 T cell CD- CD14 CD- Ileal CD4 T cell Colonic UC - CD14 CD - CD14 CD4 T cell transcrip- transcrip- transcrip- transcrip- transcrip- transcrip- transcrip- transcrip- Feature tomics tomics tomics tomics tomics tomics tomics tomics NPDC1 1 0 0 0 0 0 0 0 KRT73 1 0 0 0 0 0 0 0 ERAP2 1 0 1 1 0 0 0 1 AFAP1 1 0 0 0 0 0 0 0 MOB1B 1 0 0 0 0 0 0 0 TP53INP1 1 0 0 0 0 0 0 0 IGFBP3 1 0 0 0 0 0 0 0 NKG7 1 0 0 1 0 0 0 0 PLEK 1 0 0 0 0 0 0 0 LRRC16A 1 0 0 0 0 0 0 0 NLRP2 1 0 1 0 1 0 0 0 RNF207 1 0 0 0 0 0 0 0 ZNF879 1 0 0 0 0 0 0 0 CCL5 1 0 0 0 0 0 0 0 RPS17 1 0 0 0 0 0 0 0 NELL2 1 0 0 0 0 0 0 0 FAM118A 1 0 0 0 0 0 0 0 CD101 1 0 0 0 0 0 0 0 TNF 1 0 0 0 0 0 0 0 RPS26 1 0 0 0 0 0 0 0 PAXIP1_AS2 1 0 0 0 0 0 0 0 SMAD7 1 0 0 0 0 0 0 0 BLK 1 0 0 0 0 0 0 0 GNLY 1 0 0 1 0 0 0 1 MDGA1 1 0 0 1 0 0 0 1 MIDN 1 0 0 0 0 0 0 0 IFIT3 1 0 0 0 0 0 0 0 NCF2 1 0 0 0 0 0 0 0 CPT1A 1 0 0 1 0 0 0 0 DACT1 1 0 0 0 0 0 0 0 STON2 0 1 0 0 0 0 0 0 ABCG1 0 1 0 0 0 1 0 0 ERAP1 0 1 0 0 0 0 0 0 APOL6 0 1 0 0 0 0 0 0 ERV3_1 0 1 0 0 0 0 0 0 ANKH 0 1 0 0 0 0 0 0 ARHGEF17 0 1 0 0 0 0 0 0 TRIB3 0 1 0 0 0 0 0 0 MAFF 0 1 0 0 0 1 0 0 RIMKLB 0 1 0 0 0 0 0 0 PLB1 0 1 1 0 0 0 0 0 PCDH12 0 1 0 0 0 0 0 0 SLC7A5 0 1 0 0 0 0 0 1 PRMT6 0 1 0 0 0 0 0 0 ID1 0 1 0 0 0 0 0 0 ZNF844 0 1 0 0 0 0 0 0 RPH3A 0 1 0 0 0 1 0 0 HLA_DQB1 0 1 0 1 1 0 1 0 KCNN4 0 1 0 0 0 0 0 0 CDC42EP1 0 1 0 0 0 0 0 0 SPATA20 0 1 0 0 0 1 0 0 CCR1 0 1 0 0 0 0 0 0 GPR183 0 1 0 0 0 1 0 0 EMR3 0 1 0 0 0 0 0 0 SPTBN5 0 1 0 0 0 0 0 0 PVRL2 0 1 0 0 0 0 0 0 SOD2 0 1 0 0 0 0 0 0 PPP1R15B 0 1 0 0 0 0 0 0 CDKN1B 0 1 0 0 0 0 0 0 EIF4A3 0 1 0 0 0 0 0 0 ABCA1 0 1 0 0 0 1 1 1 DDIT3 0 1 0 0 0 0 0 0 FCGR3A 0 1 0 0 0 0 0 0 RASD1 0 1 0 0 1 0 0 0 HSPE1 0 1 0 0 0 0 0 0 NFKBIA 0 1 0 0 0 0 0 0 MAP3K7CL 0 1 0 0 0 0 0 0 FAM26F 0 1 0 0 0 0 1 0 EMR1 0 1 0 0 0 0 0 0 RRAD 0 1 0 0 0 0 1 0 ANKRD28 0 1 0 0 0 0 0 0 FOSL1 0 1 0 0 0 0 0 0 H1F0 0 1 0 0 0 0 0 0 KIF23 0 1 0 0 0 0 0 0 CDK11A 0 1 0 0 0 0 0 0 KLF9 0 1 0 0 0 0 1 0 PIM2 0 1 0 0 0 0 0 0 DNAJA4 0 1 0 0 0 0 0 0 JUP 0 1 0 0 0 1 0 0 APOBEC3A 0 1 0 0 0 0 0 0 GSTM4 0 1 0 0 0 0 0 0 LILRA3 0 1 0 0 0 0 0 0 EGR1 0 1 0 0 0 1 0 0 HSPD1 0 1 0 0 0 0 0 0 PDK4 0 1 0 0 0 1 0 0 OLR1 0 1 0 0 0 0 0 0 SFMBT1 0 1 0 0 0 0 0 0 NRP1 0 1 0 0 0 1 0 0 CC2D2A 0 1 0 0 0 0 0 0 LIF 0 1 0 0 0 1 0 0 CKS2 0 1 0 0 0 0 0 0 IL1R2 0 1 0 0 0 0 1 0 C15orf38 0 1 0 0 0 0 0 0 HLA_DRB5 0 1 1 0 0 1 0 0 PHLDA1 0 1 0 0 0 1 0 0 G0S2 0 1 0 0 0 0 1 0 INSIG1 0 1 0 0 0 0 0 0 IL8 0 1 0 0 1 1 0 0 TRIB1 0 1 0 0 0 0 0 0 LYZ 0 1 0 1 0 0 0 0 MFGE8 0 1 0 0 0 0 1 0 SEMA6B 0 1 0 0 0 0 1 0 ZNF83 0 1 0 0 0 0 0 0 DHCR7 0 1 0 0 0 0 0 0 VSTM1 0 1 0 0 0 0 0 0 MAFB 0 1 0 0 0 0 0 0 PRDX2 0 1 0 0 0 0 0 0 FCER2 0 1 0 0 0 1 0 0 EGR3 0 1 0 0 0 0 0 0 EMP1 0 1 0 0 0 0 0 0 S1PR3 0 1 0 0 0 0 1 0 SEH1L 0 1 0 0 0 0 0 0 C3AR1 0 1 0 0 0 0 0 0 HLA_DQA2 0 1 0 0 0 0 1 0 PROK2 0 1 0 0 0 0 1 0 LIPA 0 1 0 0 0 1 0 0 FCGR2B 0 1 0 0 0 0 0 0 LMNA 0 1 0 0 0 0 1 0 SDC3 0 1 0 0 0 0 0 0 MRPL41 0 1 0 0 0 0 0 0 TMTC1 0 1 0 0 0 0 0 0 TRIM66 0 1 0 0 0 0 0 0 CXCL13 0 0 1 0 1 0 0 0 HLA_G 0 0 1 0 0 0 0 0 HLA_DOB 0 0 1 0 0 0 0 0 TRPM6 0 0 1 0 0 0 0 0 HLA_DQB2 0 0 1 0 1 0 0 0 PDE4C 0 0 1 0 0 0 0 0 SCNN1B 0 0 1 0 0 0 0 0 PI15 0 0 1 0 1 0 0 0 ESPL1 0 0 1 0 0 0 0 0 LCT 0 0 1 0 0 0 0 0 SLC4A4 0 0 1 0 0 0 0 0 CEACAM7 0 0 1 0 0 0 0 0 CCL13 0 0 1 0 0 0 0 0 FAM189A1 0 0 1 0 0 0 0 0 C17orf78 0 0 1 0 0 0 0 0 AMPD1 0 0 1 0 0 0 0 0 LDHD 0 0 1 0 0 0 0 0 STEAP3 0 0 1 0 0 0 0 0 TNFSF11 0 0 1 0 0 0 0 0 SMLR1 0 0 1 0 0 0 0 0 ABCA4 0 0 1 0 0 0 0 0 CA4 0 0 1 0 0 0 0 0 SELL 0 0 1 0 0 0 0 0 AIFM3 0 0 1 0 0 0 0 0 SLC16A10 0 0 1 0 0 0 0 0 TFPI2 0 0 1 0 0 0 0 0 CCL19 0 0 1 0 0 0 0 0 SLC5A12 0 0 1 0 0 0 0 0 GREM2 0 0 1 0 1 0 0 0 NDRG4 0 0 1 0 0 0 0 0 REG3G 0 0 1 0 0 0 0 0 CUBN 0 0 1 0 0 0 0 0 CTD_2228K2_5 0 0 1 0 0 0 0 0 NXPE4 0 0 1 0 1 0 0 0 PKIB 0 0 1 0 0 0 0 0 SLC26A2 0 0 1 0 0 0 0 0 FSIP2 0 0 1 0 0 0 0 0 ADORA2B 0 0 1 0 0 0 0 0 MUC12 0 0 1 0 0 0 0 0 CYR61 0 0 1 0 0 0 0 0 COL22A1 0 0 1 0 0 0 0 0 KCNJ16 0 0 1 0 0 0 0 0 CLC 0 0 1 0 0 0 0 0 WNT11 0 0 1 0 0 0 0 0 CA1 0 0 1 0 1 0 0 0 ABCC2 0 0 1 0 0 0 0 0 DPEP1 0 0 1 0 0 0 0 0 AKR1B15 0 0 1 0 0 0 0 0 GJB3 0 0 1 0 0 0 0 0 DEFB1 0 0 1 0 0 0 0 0 CA7 0 0 1 0 1 0 0 0 VSIG2 0 0 1 0 0 0 0 0 CA12 0 0 1 0 0 0 0 0 HMGCS2 0 0 1 0 0 0 0 0 MT1H 0 0 1 0 0 0 0 0 MYEOV 0 0 1 0 0 0 0 0 FAM134B 0 0 1 0 0 0 0 0 DHRS9 0 0 1 0 0 0 1 0 SLC13A1 0 0 1 0 0 0 0 0 CNGA1 0 0 1 0 0 0 0 0 DUOX2 0 0 1 0 0 0 0 0 DAB1 0 0 1 0 0 0 0 0 CA9 0 0 1 0 0 0 0 0 GPR15 0 0 1 0 0 0 0 1 TMPRSS15 0 0 1 0 0 0 0 0 SLC26A3 0 0 1 0 0 0 0 0 CA2 0 0 1 0 0 0 0 0 PIGZ 0 0 1 0 0 0 0 0 ITGA11 0 0 1 0 0 0 0 0 GSTT1 0 0 1 0 0 0 0 0 SDR16C5 0 0 1 0 0 0 0 0 CXCL11 0 0 1 0 0 0 0 0 TM4SF4 0 0 1 0 0 0 0 0 FMO1 0 0 1 0 0 0 0 0 C10orf99 0 0 1 0 0 0 0 0 REG1B 0 0 1 0 0 0 0 0 ATP10B 0 0 1 0 0 0 0 0 SLC16A9 0 0 1 0 0 0 0 0 FAM151A 0 0 1 0 0 0 0 0 SLC9A2 0 0 1 0 0 0 0 0 SFRP2 0 0 1 0 1 0 0 0 CLCA4 0 0 1 0 0 0 0 0 NAT8 0 0 1 0 0 0 0 0 PTPRR 0 0 1 0 0 0 0 0 SLC9A3 0 0 1 0 0 0 0 0 ENPP7 0 0 1 0 0 0 0 0 RGS13 0 0 1 0 0 0 0 0 MS4A10 0 0 1 0 0 0 0 0 CYP2B6 0 0 1 0 0 0 0 0 APOC3 0 0 1 0 0 0 0 0 GSTA1 0 0 1 0 0 0 0 0 GSTA2 0 0 1 0 0 0 0 0 SULT2A1 0 0 1 0 0 0 0 0 AADAC 0 0 1 0 0 0 0 0 DEFA5 0 0 1 0 0 0 0 0 CCL18 0 0 1 0 0 0 0 0 C12orf36 0 0 1 0 1 0 0 0 LYPD8 0 0 1 0 0 0 0 0 SLC30A10 0 0 1 0 0 0 0 0 ZG16 0 0 1 0 1 0 0 0 CEACAM1 0 0 1 0 0 0 0 0 MMP1 0 0 1 0 1 0 0 0 TRIM31 0 0 1 0 0 0 0 0 TSPAN1 0 0 1 0 0 0 0 0 CCL25 0 0 1 0 0 0 0 0 OASL 0 0 1 0 0 0 0 0 DHDH 0 0 1 0 0 0 0 0 AKR1C1 0 0 1 0 0 0 0 0 RETNLB 0 0 1 0 1 0 0 0 CKB 0 0 1 0 1 0 0 0 ELOVL4 0 0 0 1 0 0 0 0 DDX11 0 0 0 1 0 0 0 0 FGL2 0 0 0 1 0 0 0 0 CTSW 0 0 0 1 0 0 0 0 DST 0 0 0 1 0 0 0 0 RPL21 0 0 0 1 0 0 0 1 ZBTB16 0 0 0 1 0 0 0 0 HBB 0 0 0 1 1 0 0 0 SLC7A8 0 0 0 1 0 0 0 1 SMDT1 0 0 0 1 0 0 0 0 PARVB 0 0 0 1 0 0 0 0 MARCKSL1 0 0 0 1 0 0 0 0 DPYSL4 0 0 0 1 0 0 0 0 ENTPD1 0 0 0 1 0 0 0 0 GOLGA8B 0 0 0 1 0 0 0 0 FCN1 0 0 0 1 0 0 0 0 RPS4Y1 0 0 0 1 0 0 1 0 SOCS3 0 0 0 1 0 0 0 0 SLAMF7 0 0 0 1 0 0 0 0 FOSB 0 0 0 1 1 0 0 0 SESN1 0 0 0 1 0 0 0 0 FKBP5 0 0 0 1 0 0 0 0 FADS2 0 0 0 1 1 1 1 0 PLAT 0 0 0 0 1 0 0 0 CDH3 0 0 0 0 1 0 0 0 MESDC1 0 0 0 0 1 0 0 0 PTPRCAP 0 0 0 0 1 0 0 0 TMEM160 0 0 0 0 1 0 0 0 SLC13A2 0 0 0 0 1 0 0 0 PHGR1 0 0 0 0 1 0 0 0 LEPREL1 0 0 0 0 1 0 0 0 ZNF219 0 0 0 0 1 0 0 0 JUND 0 0 0 0 1 0 0 0 TCN1 0 0 0 0 1 0 0 0 KLK10 0 0 0 0 1 0 0 0 IER5L 0 0 0 0 1 0 0 0 HES4 0 0 0 0 1 0 0 0 SFRP1 0 0 0 0 1 0 0 0 AMN 0 0 0 0 1 0 0 0 UGT2B17 0 0 0 0 1 0 0 0 PLN 0 0 0 0 1 0 0 0 TPO 0 0 0 0 1 0 0 0 FAM135B 0 0 0 0 1 0 0 0 AHNAK2 0 0 0 0 1 0 0 0 B3GNT7 0 0 0 0 1 0 0 0 GLDN 0 0 0 0 1 0 0 0 IL1RN 0 0 0 0 1 0 0 0 CTSE 0 0 0 0 1 0 0 0 SERPINB3 0 0 0 0 1 0 0 0 VSIG1 0 0 0 0 1 0 0 0 C4B 0 0 0 0 1 0 0 0 AOX1 0 0 0 0 1 0 0 0 CLDN5 0 0 0 0 1 0 0 0 THBS2 0 0 0 0 1 0 0 0 SOX18 0 0 0 0 1 0 0 0 SLC6A14 0 0 0 0 1 0 0 0 HIC1 0 0 0 0 1 0 0 0 AZGP1 0 0 0 0 1 0 0 0 CYP1B1 0 0 0 0 1 0 0 0 PLA2G2A 0 0 0 0 1 0 0 0 MT_ATP8 0 0 0 0 1 1 0 0 GREM1 0 0 0 0 1 0 0 0 CFD 0 0 0 0 1 0 0 0 APOE 0 0 0 0 1 0 0 0 SOCS1 0 0 0 0 1 0 0 0 CCL11 0 0 0 0 1 0 0 0 CHI3L2 0 0 0 0 1 0 0 0 VIP 0 0 0 0 1 0 0 0 REG3A 0 0 0 0 1 0 0 0 JUN 0 0 0 0 1 0 0 0 MMP7 0 0 0 0 1 0 0 0 HCAR3 0 0 0 0 1 0 1 0 L1TD1 0 0 0 0 1 0 0 0 SERPINB7 0 0 0 0 1 0 0 0 GUCA2A 0 0 0 0 1 0 0 0 MT1G 0 0 0 0 1 0 0 0 SLC15A1 0 0 0 0 1 0 0 0 DEFA6 0 0 0 0 1 0 0 0 GAS1 0 0 0 0 1 0 0 0 MEDAG 0 0 0 0 1 0 0 0 AQP8 0 0 0 0 1 0 0 0 FAP 0 0 0 0 1 0 0 0 NTN1 0 0 0 0 1 0 0 0 MUC2 0 0 0 0 1 0 0 0 KCNJ10 0 0 0 0 1 0 0 0 AC142381_1 0 0 0 0 1 0 0 0 ADM 0 0 0 0 1 0 0 0 ST3GAL1 0 0 0 0 1 0 0 0 PYY 0 0 0 0 1 0 0 0 CNN1 0 0 0 0 1 0 0 0 TRIM40 0 0 0 0 1 0 0 0 CTSG 0 0 0 0 1 0 0 0 LY6D 0 0 0 0 1 0 0 0 LILRA5 0 0 0 0 1 0 0 0 SST 0 0 0 0 1 0 0 0 DMBT1 0 0 0 0 1 0 0 0 GBP3 0 0 0 0 1 0 0 0 TNIP3 0 0 0 0 1 0 0 0 CXCL9 0 0 0 0 1 0 0 0 IL24 0 0 0 0 1 0 0 0 FOS 0 0 0 0 1 0 0 0 IL11 0 0 0 0 1 0 0 0 CCL21 0 0 0 0 1 0 0 0 WNT2 0 0 0 0 1 0 0 0 NOS2 0 0 0 0 1 0 0 0 MASP1 0 0 0 0 1 0 0 0 EGF 0 0 0 0 1 0 0 0 SAA1 0 0 0 0 1 0 0 0 CD8A 0 0 0 0 1 0 0 0 GABRP 0 0 0 0 1 0 0 0 CXCL5 0 0 0 0 1 0 0 0 TNC 0 0 0 0 1 0 0 0 NAF1 0 0 0 0 0 1 0 0 MAP7D3 0 0 0 0 0 1 0 0 GPR155 0 0 0 0 0 1 0 0 NRG1 0 0 0 0 0 1 0 0 SPRY1 0 0 0 0 0 1 0 0 C1QB 0 0 0 0 0 1 0 0 LYPD3 0 0 0 0 0 1 0 0 SLFN5 0 0 0 0 0 1 1 0 ADCY3 0 0 0 0 0 1 0 0 PDE4B 0 0 0 0 0 1 1 0 CEP44 0 0 0 0 0 1 0 0 MSR1 0 0 0 0 0 1 0 0 PLA2G16 0 0 0 0 0 1 0 0 CPED1 0 0 0 0 0 1 0 0 ICOSLG 0 0 0 0 0 1 0 0 TUBG2 0 0 0 0 0 1 0 0 SNAI1 0 0 0 0 0 1 0 0 CCL20 0 0 0 0 0 1 0 0 IL6 0 0 0 0 0 1 0 0 OSM 0 0 0 0 0 1 0 0 CCR2 0 0 0 0 0 1 1 0 APOBEC3B 0 0 0 0 0 1 0 0 LGALS2 0 0 0 0 0 1 0 0 ANPEP 0 0 0 0 0 1 0 0 BHLHE40 0 0 0 0 0 1 0 0 NR4A1 0 0 0 0 0 1 0 1 CXCR4 0 0 0 0 0 1 0 1 MTRNR2L12 0 0 0 0 0 1 0 0 PPBP 0 0 0 0 0 1 0 0 TMEM176B 0 0 0 0 0 1 0 0 ARL4C 0 0 0 0 0 1 0 0 RGS1 0 0 0 0 0 1 0 0 NBPF14 0 0 0 0 0 1 0 0 TAGAP 0 0 0 0 0 1 0 0 ACKR3 0 0 0 0 0 1 0 0 COLEC12 0 0 0 0 0 1 0 0 CLU 0 0 0 0 0 1 1 0 SULT1A2 0 0 0 0 0 1 0 0 GRASP 0 0 0 0 0 1 0 0 SIK1 0 0 0 0 0 1 0 0 NR4A2 0 0 0 0 0 1 0 0 CLEC5A 0 0 0 0 0 0 1 0 SGK223 0 0 0 0 0 0 1 0 SGK1 0 0 0 0 0 0 1 0 CITED4 0 0 0 0 0 0 1 0 ALOX5AP 0 0 0 0 0 0 1 0 ALOX15B 0 0 0 0 0 0 1 0 RAPH1 0 0 0 0 0 0 1 0 DNAJB1 0 0 0 0 0 0 1 0 MMP19 0 0 0 0 0 0 1 0 STEAP4 0 0 0 0 0 0 1 0 TLR7 0 0 0 0 0 0 1 0 SEL1L3 0 0 0 0 0 0 1 0 NFXL1 0 0 0 0 0 0 1 0 PPP1R16B 0 0 0 0 0 0 1 0 KIAA0226L 0 0 0 0 0 0 1 0 KCNJ15 0 0 0 0 0 0 1 0 UNC5B 0 0 0 0 0 0 1 0 ZNF714 0 0 0 0 0 0 1 0 HSPA1A 0 0 0 0 0 0 1 0 ADK 0 0 0 0 0 0 1 0 CAMKK1 0 0 0 0 0 0 1 0 TTC39B 0 0 0 0 0 0 1 0 GPRIN3 0 0 0 0 0 0 1 0 DUSP2 0 0 0 0 0 0 1 0 LPAR6 0 0 0 0 0 0 1 0 CX3CR1 0 0 0 0 0 0 1 0 ADAMTS2 0 0 0 0 0 0 1 0 CCL2 0 0 0 0 0 0 1 0 TNFAIP3 0 0 0 0 0 0 1 0 CACNB4 0 0 0 0 0 0 1 0 TBKBP1 0 0 0 0 0 0 1 0 TPST1 0 0 0 0 0 0 1 0 NT5C3B 0 0 0 0 0 0 1 0 CD69 0 0 0 0 0 0 1 0 IFIT5 0 0 0 0 0 0 1 0 LOXHD1 0 0 0 0 0 0 1 0 FPR2 0 0 0 0 0 0 1 0 HSPA6 0 0 0 0 0 0 1 0 CD180 0 0 0 0 0 0 1 0 HES1 0 0 0 0 0 0 1 0 CTC_534A2_2 0 0 0 0 0 0 1 0 GBP1 0 0 0 0 0 0 1 0 BAG3 0 0 0 0 0 0 1 0 IFFO2 0 0 0 0 0 0 1 0 TUBA1A 0 0 0 0 0 0 1 0 PLP2 0 0 0 0 0 0 1 1 FAM20A 0 0 0 0 0 0 1 0 CCL3L1 0 0 0 0 0 0 1 0 MGLL 0 0 0 0 0 0 1 0 UAP1L1 0 0 0 0 0 0 1 0 THBS1 0 0 0 0 0 0 1 0 EGR2 0 0 0 0 0 0 1 0 SH3PXD2B 0 0 0 0 0 0 1 0 DUSP6 0 0 0 0 0 0 0 1 SBNO2 0 0 0 0 0 0 0 1 ATHL1 0 0 0 0 0 0 0 1 ZNF514 0 0 0 0 0 0 0 1 PC 0 0 0 0 0 0 0 1 PDGFB 0 0 0 0 0 0 0 1 GAS7 0 0 0 0 0 0 0 1 KLF11 0 0 0 0 0 0 0 1 COL18A1 0 0 0 0 0 0 0 1 SDK2 0 0 0 0 0 0 0 1 DCHS1 0 0 0 0 0 0 0 1 TMEM8A 0 0 0 0 0 0 0 1 KRT72 0 0 0 0 0 0 0 1 CCDC163P 0 0 0 0 0 0 0 1 ZNF772 0 0 0 0 0 0 0 1 NR4A3 0 0 0 0 0 0 0 1 JUNB 0 0 0 0 0 0 0 1 DDX3Y 0 0 0 0 0 0 0 1 SYNM 0 0 0 0 0 0 0 1
TABLE-US-00020 TABLE 14 feature CRPcorr CRPcorr.pval CRPcorr.adjpval ENPP7 −0.41 0.08 1 CLC 0.38 0.11 1 MYEOV −0.38 0.11 1 AKR1C1 −0.36 0.13 1 SLC16A10 −0.35 0.14 1 C10orf99 0.34 0.16 1 SLC16A9 0.34 0.16 1 APOC3 −0.32 0.18 1 NLRP2 0.3 0.22 1 ITGA11 0.28 0.24 1 KCNJ16 −0.28 0.25 1 SMLR1 −0.26 0.28 1 AIFM3 0.26 0.28 1 COL22A1 0.26 0.29 1 C17orf78 −0.25 0.31 1 ABCC2 −0.24 0.31 1 AADAC −0.25 0.31 1 DHDH −0.25 0.31 1 MMP1 −0.23 0.33 1 CA12 0.23 0.34 1 CCL19 0.23 0.35 1 REG3G −0.23 0.35 1 LCT −0.22 0.37 1 FAM134B −0.21 0.38 1 CA9 −0.22 0.38 1 ADORA2B 0.21 0.39 1 DPEP1 −0.2 0.41 1 SDR16C5 −0.19 0.43 1 TM4SF4 −0.19 0.43 1 PLB1 −0.19 0.43 1 DAB1 −0.18 0.45 1 FAM189A1 0.18 0.46 1 STEAP3 0.18 0.46 1 CCL18 −0.18 0.46 1 ABCA4 −0.18 0.47 1 AKR1B15 −0.18 0.47 1 CYR61 −0.17 0.48 1 WNT11 −0.17 0.48 1 MS4A10 −0.17 0.49 1 SLC30A10 −0.17 0.49 1 TMPRSS15 −0.16 0.5 1 SULT2A1 −0.17 0.5 1 RETNLB 0.17 0.5 1 MT1H −0.15 0.53 1 RGS13 0.15 0.53 1 CCL25 −0.15 0.53 1 DUOX2 −0.15 0.54 1 SLC5A12 −0.15 0.55 1 CA2 −0.14 0.56 1 CEACAM1 −0.14 0.56 1 TRIM31 −0.14 0.56 1 PI15 −0.14 0.57 1 PKIB −0.14 0.57 1 LDHD −0.13 0.58 1 CLCA4 −0.13 0.58 1 GSTA1 −0.14 0.58 1 SLC4A4 −0.13 0.59 1 SFRP2 0.13 0.6 1 TRPM6 −0.13 0.61 1 GSTT1 0.12 0.61 1 GREM2 0.12 0.63 1 CXCL13 −0.11 0.64 1 HMGCS2 0.12 0.64 1 FMO1 −0.11 0.66 1 PTPRR −0.11 0.66 1 GSTA2 −0.11 0.66 1 PDE4C −0.1 0.68 1 GJB3 0.1 0.68 1 C12orf36 0.1 0.68 1 CUBN −0.1 0.69 1 SLC9A2 −0.1 0.69 1 CCL13 −0.1 0.7 1 CA1 −0.09 0.7 1 NAT8 −0.1 0.7 1 ERAP2 −0.09 0.72 1 DEFBI −0.09 0.72 1 GPR15 0.09 0.72 1 ZG16 −0.09 0.72 1 AMPD1 0.08 0.73 1 NXPE4 0.08 0.73 1 TSPAN1 −0.08 0.73 1 CEACAM7 0.07 0.78 1 FAM151A 0.07 0.78 1 CA4 −0.06 0.79 1 TFPI2 −0.06 0.79 1 CKB 0.06 0.8 1 SLC9A3 −0.05 0.83 1 LYPD8 −0.05 0.85 1 MUC12 −0.04 0.86 1 CNGA1 0.04 0.86 1 ESPL1 −0.04 0.87 1 SLC13A1 −0.04 0.87 1 PIGZ 0.04 0.88 1 SCNN1B 0.03 0.89 1 TNFSF11 −0.03 0.89 1 DEFA5 0.03 0.89 1 REG1B 0.03 0.91 1 CYP2B6 −0.03 0.91 1 SELL −0.01 0.95 1 FSIP2 0.02 0.95 1 CA7 −0.02 0.95 1 SLC26A2 −0.01 0.96 1 CXCL11 −0.01 0.96 1 ATP10B 0.01 0.97 1 OASL 0.01 0.98 1 NDRG4 0 0.99 1 VSIG2 0 0.99 1 SLC26A3 0 0.99 1 DHRS9 0 1 1
TABLE-US-00021 TABLE 15 Cohort Anti- Anti- Anti- Anti- Anti- Anti- Anti- Anti- Anti- Anti- Anti- Anti- Anti- TNF TNF TNF TNF TNF TNF TNF TNF TNF TNF TNF TNF TNF UC UC UC UC UC UC UC UC UC UC UC UC UC Feature Target NLRP2 HIC1 THBS2 IL11 IL1RN JUND WNT2 JUN APOE VIP EGF FOS SOCS1 PYCARD 1 0 0 0 0 0 0 0 0 0 0 0 0 IKBKB 1 0 0 0 0 0 0 0 0 0 0 0 0 ACKR3 0 1 0 0 0 0 0 0 0 0 0 0 0 STAT3 0 1 0 0 0 0 0 0 0 0 0 0 0 CD47 0 0 1 0 0 0 0 0 0 0 0 0 0 IL6ST 0 0 0 1 0 0 0 0 0 0 0 0 0 IL1R2 0 0 0 0 1 0 0 0 0 0 0 0 0 IL1R1 0 0 0 0 1 0 0 0 0 0 0 0 0 SOX4 0 0 0 0 0 1 0 0 0 0 0 0 0 F3 0 0 0 0 0 1 0 0 0 0 0 0 0 CLU 0 0 0 0 0 1 0 0 0 0 0 1 0 ITGAV 0 0 0 0 0 1 0 0 0 0 0 0 0 CCL5 0 0 0 0 0 1 0 1 0 0 0 0 0 GADD45A 0 0 0 0 0 1 0 0 0 0 0 0 0 PLAUR 0 0 0 0 0 1 0 1 0 0 0 1 0 MYB 0 0 0 0 0 0 1 1 0 0 0 0 0 LRP6 0 0 0 0 0 0 0 1 0 0 0 0 0 CDKN1A 0 0 0 0 0 0 0 1 0 0 0 0 0 NQO1 0 0 0 0 0 0 0 1 0 0 0 1 0 PLAT 0 0 0 0 0 0 0 1 0 0 0 0 0 VCAM1 0 0 0 0 0 0 0 1 0 0 0 0 0 PDHA1 0 0 0 0 0 0 0 1 0 0 0 1 0 ATF3 0 0 0 0 0 0 0 1 0 0 0 0 0 MYC 0 0 0 0 0 0 0 1 0 0 0 1 0 CTSL 0 0 0 0 0 0 0 1 0 0 0 0 0 GCLC 0 0 0 0 0 0 0 1 0 0 0 0 0 TXN 0 0 0 0 0 0 0 1 0 0 0 0 0 APP 0 0 0 0 0 0 0 1 0 0 0 0 0 UGT2B15 0 0 0 0 0 0 0 1 0 0 0 0 0 SMAD7 0 0 0 0 0 0 0 1 0 0 0 1 0 ETS2 0 0 0 0 0 0 0 1 0 0 0 0 0 GJA1 0 0 0 0 0 0 0 1 0 0 0 0 0 VEGFA 0 0 0 0 0 0 0 1 0 0 0 0 0 RHOB 0 0 0 0 0 0 0 1 0 0 0 0 0 TNC 0 0 0 0 0 0 0 1 0 0 0 0 0 NAT1 0 0 0 0 0 0 0 1 0 0 0 1 0 EGFR 0 0 0 0 0 0 0 1 0 0 1 0 0 EZR 0 0 0 0 0 0 0 1 0 0 0 1 0 VDR 0 0 0 0 0 0 0 1 0 0 0 1 0 CD82 0 0 0 0 0 0 0 1 0 0 0 0 0 TIMP2 0 0 0 0 0 0 0 1 0 0 0 0 0 FAS 0 0 0 0 0 0 0 1 0 0 0 1 0 PTN 0 0 0 0 0 0 0 1 0 0 0 0 0 ABCB1 0 0 0 0 0 0 0 1 0 0 0 0 0 MMP2 0 0 0 0 0 0 0 1 0 0 0 0 0 MAT2A 0 0 0 0 0 0 0 1 0 0 0 0 0 CYP2J2 0 0 0 0 0 0 0 1 0 0 0 0 0 TFF1 0 0 0 0 0 0 0 1 0 0 0 0 0 VIM 0 0 0 0 0 0 0 1 0 0 0 0 0 CCND1 0 0 0 0 0 0 0 1 0 0 0 2 0 HEY1 0 0 0 0 0 0 0 1 0 0 0 0 0 POLD2 0 0 0 0 0 0 0 1 0 0 0 0 0 IGF1 0 0 0 0 0 0 0 1 0 0 0 0 0 NR3C1 0 0 0 0 0 0 0 1 0 0 0 1 0 MGP 0 0 0 0 0 0 0 1 0 0 0 0 0 CREB1 0 0 0 0 0 0 0 1 0 0 0 0 0 FOS 0 0 0 0 0 0 0 1 0 0 0 0 0 ATF2 0 0 0 0 0 0 0 1 0 0 0 1 0 CREBBP 0 0 0 0 0 0 0 1 0 0 0 0 0 ABL1 0 0 0 0 0 0 0 1 0 0 0 0 0 NFE2L2 0 0 0 0 0 0 0 1 0 0 0 0 0 EP300 0 0 0 0 0 0 0 1 0 0 0 1 0 SMAD4 0 0 0 0 0 0 0 1 0 0 0 1 0 TCF7L2 0 0 0 0 0 0 0 1 0 0 0 0 0 SMAD3 0 0 0 0 0 0 0 1 0 0 0 0 0 TCF4 0 0 0 0 0 0 0 1 0 0 0 0 0 SORL1 0 0 0 0 0 0 0 0 1 0 0 0 0 VIPR1 0 0 0 0 0 0 0 0 0 1 0 0 0 ERBB2 0 0 0 0 0 0 0 0 0 0 1 0 0 BCL2L1 0 0 0 0 0 0 0 0 0 0 0 1 0 HSPH1 0 0 0 0 0 0 0 0 0 0 0 1 0 MAF 0 0 0 0 0 0 0 0 0 0 0 1 0 GSTP1 0 0 0 0 0 0 0 0 0 0 0 1 0 SP3 0 0 0 0 0 0 0 0 0 0 0 1 0 CDH1 0 0 0 0 0 0 0 0 0 0 0 1 0 CTNNB1 0 0 0 0 0 0 0 0 0 0 0 1 0 STAT1 0 0 0 0 0 0 0 0 0 0 0 1 0 JUN 0 0 0 0 0 0 0 0 0 0 0 1 0 IFNGR1 0 0 0 0 0 0 0 0 0 0 0 0 1 MAP3K5 0 0 0 0 0 0 0 0 0 0 0 0 1 JAK1 0 0 0 0 0 0 0 0 0 0 0 0 1 IRAK1 0 0 0 0 0 0 0 0 0 0 0 0 1 RASA1 0 0 0 0 0 0 0 0 0 0 0 0 1
TABLE-US-00022 TABLE 16 Feature.Uniprot ID Target.Uniprot ID Feature.gene_name Target.gene_name Stimulatory? Inhibitory? Q9NX02 Q9ULZ3 NLRP2 PYCARD 0 0 Q9NX02 O14920 NLRP2 IKBKB 0 0 Q96A56 Q9GZQ8 TP53INP1 MAP1LC3B 1 0 Q96A56 P60520 TP53INP1 GABARAPL2 1 0 P13501 P51681 CCL5 CCR5 1 0 P13501 P32246 CCL5 CCR1 1 0 P01375 P20333 TNF TNFRSF1B 1 0 P01375 P31749 TNF AKT1 1 0 P01375 P42336 TNF PIK3CA 1 0 P01375 Q15628 TNF TRADD 0 1 P01375 Q13490 TNF BIRC2 0 0 P01375 P19438 TNF TNFRSF1A 1 0 O15105 O43318 SMAD7 MAP3K7 1 0 O15105 Q13233 SMAD7 MAP3K1 0 1 O15105 Q9Y3F4 SMAD7 STRAP 1 0 O15105 O75807 SMAD7 PPP1R15A 1 0 O15105 Q15796 SMAD7 SMAD2 1 1 O15105 Q9NYJ8 SMAD7 TAB2 1 0 O15105 P62136 SMAD7 PPP1CA 1 0 O15105 Q13485 SMAD7 SMAD4 1 0 O15105 P84022 SMAD7 SMAD3 1 1 O15105 Q04771 SMAD7 ACVR1 1 0 O15105 Q9HAU4 SMAD7 SMURF2 1 0 O14879 Q9UHD2 IFIT3 TBK1 0 0 O15105 P01106 SMAD7 MYC 1 0 O15105 P09601 SMAD7 HMOX1 0 0
TABLE-US-00023 TABLE 17 Number of Number of nodes with nodes in BPGO term feature in feature Set Feature Biological Process Gene Ontology (BPGO) term sub-network sub-network IFXADM_UC_CD4 SOCS3 cytokine-mediated_signaling_pathway_[GO:0019221] 18 7 IFXADM_UC_CD4 SOCS3 post-translational_protein_modification_[GO:0043687] 18 6 IFXADM_UC_CD4 SOCS3 interleukin-35-mediated_signaling_pathway_[GO:0070757] 18 4 IFXADM_UC_CD4 SOCS3 receptor_signaling_pathway_via_JAK-STAT_[GO:0007259] 18 4 VDZ_UC_CD4 SMAD7 protein_deubiquitination_[GO:0016579] 13 6 VDZ_UC_CD4 SMAD7 transforming_growth_factor_beta_receptor_signaling_pathway_[GO:0007179] 13 5 VDZ_UC_CD4 SMAD7 regulation_of_transforming_growth_factor_beta_receptor_signaling_path- 13 4 way_[GO:0017015] VDZ_UC_CD4 TNF I-kappaB_kinase/NF-kappaB_signaling_[GO:0007249] 6 4 VDZ_UC_CD4 TNF tumor_necrosis_factor-mediated_signaling_pathway_[GO:0033209] 6 4 VDZ_UC_CD4 SMAD7 negative_regulation_of_trans- 13 4 forming_growth_factor_beta_receptor_signaling_pathway_[GO:0030512] VDZ_UC_CD4 TNF cytokine-mediated_signaling_pathway_[GO:0019221] 6 4 VDZ_CD_CD14 NFKBIA interleukin-1-mediated_signaling_pathway_[GO:0070498] 14 6 VDZ_CD_CD14 EGR1 negative_regulation_of_apoptotic_process_[GO:0043066] 33 12 VDZ_CD_CD14 EGR1 cytokine-mediated_signaling_pathway_[GO:0019221] 33 8 VDZ_CD_CD14 NFKBIA negative_regulation_of_transcription_by_RNA_polymerase_II_[GO:0000122] 14 7 VDZ_CD_CD14 EGR1 negative_regulation_of_gene_expression_[GO:0010629] 33 6 VDZ_CD_CD14 NFKBIA positive_regulation_of_NF-kappaB_transcrip- 14 5 tion_factor_activity_[GO:0051092] VDZ_CD_CD14 NFKBIA stress-activated_MAPK_cascade_[GO:0051403] 14 4 VDZ_CD_CD14 NFKBIA cellular_response_to_tumor_necrosis_factor_[GO:0071356] 14 4 VDZ_CD_CD14 NFKBIA cellular_response_to_lipopolysaccharide_[GO:0071222] 14 4 IFXADM_UC_CD14 EGR1 negative_regulation_of_apoptotic_process_[GO:0043066] 33 12 IFXADM_UC_CD14 EGR1 cytokine-mediated_signaling_pathway_[GO:0019221] 33 8 IFXADM_UC_CD14 EGR1 negative_regulation_of_gene_expression_[GO:0010629] 33 6 IFXADM_UC_CD14 EGR1 aging_[GO:0007568] 33 5 IFXADM_CD_CD14 TNFAIP3 positive_regulation_of_transcription_by_RNA_polymerase_II_[GO:0045944] 8 6 IFXADM_CD_CD14 TNFAIP3 TRIF-dependent_toll-like_receptor_signaling_pathway_[GO:0035666] 8 4 IFXADM_CD_CD14 TNFAIP3 I-kappaB_kinase/NF-kappaB_signaling_[GO:0007249] 8 4 IFXADM_CD_CD14 TNFAIP3 inflammatory_response_[GO:0006954] 8 4 IFXADM_UC_COLON JUN positive_regulation_of_transcription_by_RNA_polymerase_II_[GO:0045944] 53 23 IFXADM_UC_COLON JUN negative_regulation_of_transcription_by_RNA_polymerase_II_[GO:0000122] 53 19 IFXADM_UC_COLON JUN positive_regulation_of_transcription,_DNA-templated_[GO:0045893] 53 14 IFXADM_UC_COLON FOS negative_regulation_of_transcription_by_RNA_polymerase_II_[GO:0000122] 24 13 IFXADM_UC_COLON FOS positive_regulation_of_transcription_by_RNA_polymerase_II_[GO:0045944] 24 11 IFXADM_UC_COLON JUN response_to_hypoxia_[GO:0001666] 53 10 IFXADM_UC_COLON JUN positive_regulation_of_gene_expression_[GO:0010628] 53 10 IFXADM_UC_COLON JUN cytokine-mediated_signaling_pathway_[GO:0019221] 53 10 IFXADM_UC_COLON JUN regulation_of_transcription_by_RNA_polymerase_II_[GO:0006357] 53 10 IFXADM_UC_COLON FOS positive_regulation_of_transcription,_DNA-templated_[GO:0045893] 24 8 IFXADM_UC_COLON JUN aging_[GO:0007568] 53 7 IFXADM UC COLON JUN positive_regulation_of_protein_phosphorylation_[GO:0001934] 53 7 IFXADM_UC_COLON FOS negative_regulation_of_apoptotic_process_[GO:0043066] 24 7 IFXADM_UC_COLON JUN positive_regulation_of_epithelial_cell_proliferation_[GO:0050679] 53 5 IFXADM_UC_COLON JUN cellular_response_to_hydrogen_peroxide_[GO:0070301] 53 5 IFXADM_UC_COLON FOS positive_regulation_of_neuron_apoptotic_process_[GO:0043525] 24 4 IFXADM_UC_COLON JUN positive_regulation_of_phosphorylation_[GO:0042327] 53 4 IFXADM_UC_COLON JUN negative_regulation_of_mitotic_cell_cycle_[GO:0045930] 53 4 IFXADM_UC_COLON JUN beta-catenin-TCF_complex_assembly_[GO:1904837] 53 4 IFXADM_UC_COLON FOS response_to_estradiol_[GO:0032355] 24 4 IFXADM_UC_COLON JUN xenobiotic_metabolic_process_[GO:0006805] 53 4 IFXADM_UC_COLON JUN SMAD_protein_signal_transduction_[GO:0060395] 53 4 IFXADM_UC_COLON JUN fat_cell_differentiation_[GO:0045444] 53 4 Set Feature Biological Process Gene Ontology (BPGO) term P-value Adj. Pval IFXADM_UC_CD4 SOCS3 cytokine-mediated_signaling_pathway_[GO:0019221] 9.37E−06 2.34E−04 IFXADM_UC_CD4 SOCS3 post-translational_protein_modification_[GO:0043687] 7.22E−06 1.73E−04 IFXADM_UC_CD4 SOCS3 interleukin-35-mediated_signaling_pathway_[GO:0070757] 3.45E−08 6.90E−08 IFXADM_UC_CD4 SOCS3 receptor_signaling_pathway_via_JAK-STAT_[GO:0007259] 1.50E−06 1.35E−05 VDZ_UC_CD4 SMAD7 protein_deubiquitination_[GO:0016579] 2.59E−07 1.55E−06 VDZ_UC_CD4 SMAD7 transforming_growth_factor_beta_receptor_signaling_pathway_[GO:0007179] 8.77E−07 7.02E−06 VDZ_UC_CD4 SMAD7 regulation_of_transforming_growth_factor_beta_receptor_signaling_path- 1.75E−08 1.75E−08 way_[GO:0017015] VDZ_UC_CD4 TNF I-kappaB_kinase/NF-kappaB_signaling_[GO:0007249] 1.75E−07 6.98E−07 VDZ_UC_CD4 TNF tumor_necrosis_factor-mediated_signaling_pathway_[GO:0033209] 2.17E−07 1.08E−06 VDZ_UC_CD4 SMAD7 negative_regulation_of_trans- 3.77E−06 6.41E−05 forming_growth_factor_beta_receptor_signaling_pathway_[GO:0030512] VDZ_UC_CD4 TNF cytokine-mediated_signaling_pathway_[GO:0019221] 6.72E−05 3.23E−03 VDZ_CD_CD14 NFKBIA interleukin-1-mediated_signaling_pathway_[GO:0070498] 1.56E−09 1.5624E−09 VDZ_CD_CD14 EGR1 negative_regulation_of_apoptotic_process_[GO:0043066] 3.16E−07 6.3245E−07 VDZ_CD_CD14 EGR1 cytokine-mediated_signaling_pathway_[GO:0019221] 9.76E−05 0.00204928 VDZ_CD_CD14 NFKBIA negative_regulation_of_transcription_by_RNA_polymerase_II_[GO:0000122] 9.88E−05 0.00217378 VDZ_CD_CD14 EGR1 negative_regulation_of_gene_expression_[GO:0010629] 0.000119 0.00333989 VDZ_CD_CD14 NFKBIA positive_regulation_of_NF-kappaB_transcrip- 1.5E−05 0.0001351 tion_factor_activity_[GO:0051092] VDZ_CD_CD14 NFKBIA stress-activated_MAPK_cascade_[GO:0051403] 5.84E−07 2.3378E−06 VDZ_CD_CD14 NFKBIA cellular_response_to_tumor_necrosis_factor_[GO:0071356] 7.19E−05 0.00143882 VDZ_CD_CD14 NFKBIA cellular_response_to_lipopolysaccharide_[GO:0071222] 0.000193 0.00657612 IFXADM_UC_CD14 EGR1 negative_regulation_of_apoptotic_process_[GO:0043066] 3.16E−07 3.1622E−07 IFXADM_UC_CD14 EGR1 cytokine-mediated_signaling_pathway_[GO:0019221] 9.76E−05 0.00117101 IFXADM_UC_CD14 EGR1 negative_regulation_of_gene_expression_[GO:0010629] 0.000119 0.00178922 IFXADM_UC_CD14 EGR1 aging_[GO:0007568] 0.000726 0.03630687 IFXADM_CD_CD14 TNFAIP3 positive_regulation_of_transcription_by_RNA_polymerase_II_[GO:0045944] 0.00011 0.00253128 IFXADM_CD_CD14 TNFAIP3 TRIF-dependent_toll-like_receptor_signaling_pathway_[GO:0035666] 2.13E−08 2.1254E−08 IFXADM_CD_CD14 TNFAIP3 I-kappaB_kinase/NF-kappaB_signaling_[GO:0007249] 7.98E−07 3.193E−06 IFXADM_CD_CD14 TNFAIP3 inflammatory_response_[GO:0006954] 0.000308 0.01294716 IFXADM_UC_COLON JUN positive_regulation_of_transcription_by_RNA_polymerase_II_[GO:0045944] 4.35E−08 8.70E−08 IFXADM_UC_COLON JUN negative_regulation_of_transcription_by_RNA_polymerase_II_[GO:0000122] 8.27E−08 2.48E−07 IFXADM_UC_COLON JUN positive_regulation_of_transcription,_DNA-templated_[GO:0045893] 2.17E−05 1.96E−04 IFXADM_UC_COLON FOS negative_regulation_of_transcription_by_RNA_polymerase_II_[GO:0000122] 2.81E−08 2.81E−08 IFXADM_UC_COLON FOS positive_regulation_of_transcription_by_RNA_polymerase_II_[GO:0045944] 8.07E−05 1.61E−03 IFXADM_UC_COLON JUN response_to_hypoxia_[GO:0001666] 4.39E−07 1.76E−06 IFXADM_UC_COLON JUN positive_regulation_of_gene_expression_[GO:0010628] 0.000117 3.27E−03 IFXADM_UC_COLON JUN cytokine-mediated_signaling_pathway_[GO:0019221] 0.000125 3.75E−03 IFXADM_UC_COLON JUN regulation_of_transcription_by_RNA_polymerase_II_[GO:0006357] 0.000142 4.84E−03 IFXADM_UC_COLON FOS positive_regulation_of_transcription,_DNA-templated_[GO:0045893] 0.000227 1.16E−02 IFXADM_UC_COLON JUN aging_[GO:0007568] 0.000152 5.64E−03 IFXADM UC COLON JUN positive_regulation_of_protein_phosphorylation_[GO:0001934] 0.000207 9.71E−03 IFXADM_UC_COLON FOS negative_regulation_of_apoptotic_process_[GO:0043066] 0.000442 3.71E−02 IFXADM_UC_COLON JUN positive_regulation_of_epithelial_cell_proliferation_[GO:0050679] 9.07E−05 2.09E−03 IFXADM_UC_COLON JUN cellular_response_to_hydrogen_peroxide_[GO:0070301] 0.000148 5.34E−03 IFXADM_UC_COLON FOS positive_regulation_of_neuron_apoptotic_process_[GO:0043525] 3.57E−05 3.92E−04 IFXADM_UC_COLON JUN positive_regulation_of_phosphorylation_[GO:0042327] 4.23E−05 5.50E−04 IFXADM_UC_COLON JUN negative_regulation_of_mitotic_cell_cycle_[GO:0045930] 4.23E−05 5.93E−04 IFXADM_UC_COLON JUN beta-catenin-TCF_complex_assembly_[GO:1904837] 7.52E−05 1.35E−03 IFXADM_UC_COLON FOS response_to_estradiol_[GO:0032355] 0.000357 2.11E−02 IFXADM_UC_COLON JUN xenobiotic_metabolic_process_[GO:0006805] 0.000396 3.09E−02 IFXADM_UC_COLON JUN SMAD_protein_signal_transduction_[GO:0060395] 0.000441 3.62E−02 IFXADM_UC_COLON JUN fat_cell_differentiation_[GO:0045444] 0.000441 3.66E−02
TABLE-US-00024 TABLE 18 Reactome_path- Reactome_path- VDZ.sub.— VDZ.sub.— VDZ.sub.— IFXADM.sub.— IFXADM.sub.— IFXADM.sub.— IFXADM.sub.— IFXADM.sub.— way_id way_name UC_cd4 CD_cd14 CD_ileum UC_colon UC_cd4 UC_cd14 CD_cd4 CD_cd14 R-HSA- Interleukin-10 — 1 — — — 1 — 1 6783783 signaling R-HSA- Translocation of — 1 — — — — — — 202430 ZAP-70 to Immunological synapse R-HSA- Phosphorylation — 1 — — — — — — 202427 of CD3 and TCR zeta chains R-HSA- PD-1 signaling — 1 — — — — — — 389948 R-HSA- Deregulated CDK5 — 1 — — — — — — 8862803 triggers multiple neurodegenerative pathways in Alzheimer's disease models R-HSA- Neurodegenerative — 1 — — — — — — 8863678 Diseases R-HSA- Costimulation by — 1 — — — — — — 388841 the CD28 family R-HSA- Generation of — 1 — — — — — — 202433 second messenger molecules R-HSA- Interferon Signaling — 1 — — — — — — 913531 R-HSA- Reversible hydration — — 1 — — — — — 1475029 of carbon dioxide R-HSA- G alpha (i) — — 1 1 — 1 — — 418594 signalling events R-HSA- Transport of — — 1 — — — — — 425393 inorganic cations/ anions and amino acids/ oligopeptides R-HSA- Chemokine — — 1 1 — 1 — — 380108 receptors bind chemokines R-HSA- Biological — — 1 — — — — — 211859 oxidations R-HSA- Erythrocytes take — — 1 — — — — — 1237044 up carbon dioxide and release oxygen R-HSA- O2/CO2 exchange — — 1 — — — — — 1480926 in erythrocytes R-HSA- SLC-mediated — — 1 — — — — — 425407 transmembrane transport R-HSA- Visual — — 1 — — — — — 2187338 phototransduction R-HSA- Interferon gamma — — 1 — — — — — 877300 signaling R-HSA- Phase II - — — 1 — — — — — 156580 Conjugation of compounds R-HSA- Glutathione — — 1 — — — — — 156590 conjugation R-HSA- Interleukin-4 and — — — 1 — 1 — — 6785807 Interleukin-13 signaling R-HSA- Peptide ligand- — — — 1 — 1 — — 375276 binding receptors R-HSA- GPCR ligand — — — 1 — 1 — — 500792 binding R-HSA- Signaling by — — — 1 — 1 — — 449147 Interleukins R-HSA- Binding and — — — 1 — — — — 2173782 Uptake of Ligands by Scavenger Receptors R-HSA- Class A/1 — — — 1 — 1 — — 373076 (Rhodopsin-like receptors) R-HSA- Initial — — — 1 — — — — 166663 triggering of complement R-HSA- Activation of — — — 1 — — — — 1592389 Matrix Metalloproteinases R-HSA- Regulation of — — — 1 — — — — 381426 Insulin-like Growth Factor (IGF) transport and uptake by Insulin-like Growth Factor Binding Proteins (IGFBPs) R-HSA- Activation of the — — — 1 — — — — 450341 AP-1 family of transcription factors R-HSA- Interleukin-6 — — — — — 1 — — 6783589 family signaling R-HSA- IL-6-type cytokine — — — — — 1 — — 6788467 receptor ligand interactions R-HSA- Scavenging by — — — — — 1 — — 3000480 Class A Receptors R-HSA- Plasma lipoprotein — — — — — 1 — — 174824 assembly, remodeling, and clearance R-HSA- Regulation of — — — — — — — 1 3371453 HSF1-mediated heat shock response
TABLE-US-00025 TABLE 19 Catalog Target Fluorophore Company number CD3 APC Thermo Fisher 17-0038 Scientific CD4 BB515 BD 564419 Biosciences CD8 APC- Thermo Fisher 47-0087 eFluor780 Scientific CD14 PerCP-Cy5.5 Thermo Fisher 45-0149 Scientific CD19 PE Thermo Fisher 12-0199-80 Scientific CD45 AF700 Thermo Fisher 56-9459 Scientific
TABLE-US-00026 TABLE 20 T cell surface glycoprotein CD6 isoform (CD6) Q8WWJ7 INFLAMMATION T-cell surface glycoprotein CD5 (CD5) P06127 INFLAMMATION T-cell surface glycoprotein CD8 alpha chain (CD8A) P01732 INFLAMMATION Thymic stromal lymphopoietin (TSLP) Q969D9 INFLAMMATION TNF-beta (TNFB) P01374 INFLAMMATION TNF-related activation-induced cytokine (TRANCE) O14788 INFLAMMATION TNF-related apoptosis-inducing ligand (TRAIL) P50591 INFLAMMATION Transforming growth factor alpha (TGF-alpha) P01135 INFLAMMATION Tumor necrosis factor (Ligand) superfamily, member 12 (TWEAK) O43508 INFLAMMATION Tumor necrosis factor (TNF) P01375 INFLAMMATION Tumor necrosis factor ligand superfamily member 14 (TNFSF14) O43557 INFLAMMATION Tumor necrosis factor receptor superfamily member 9 (TNFRSF9) Q07011 INFLAMMATION Urokinase-type plasminogen activator (uPA) P00749 INFLAMMATION Vascular endothelial growth factor A (VEGF-A) P15692 INFLAMMATION
TABLE-US-00027 TABLE 21 Latent Dominant - Predictive Cohort Factor (s) omic layer biomarkers Accuracy Vedolizumab LF 5 Genomics FAM129A, 84.2% Ulcerative ELM01, colitis TRIP13 PTAR1, ASAH1 Vedolizumab LF 3 Genomics SKAP2, 77.2% Crohn's Monocyte HAUS1, disease transcriptomics C3orf67, SEC14L6, ATP6V0D1 LF 8 ABCG1, 98.0% ERAP1, ERV3_1 APOL6, STON2 Anti-TNF LF 2 CD4.sup.+ T cell ELOVL4, 92.0% agents transcriptomics FGL2, CTSW, Ulcerative DDX11, LYZ colitis Anti-TNF LF 2-LF9 Genomics TRAPPC4, 81.3% agents CDKAL1, Crohn's ACVRL1, disease TSPAN14, PCNP CITED4, CLEC5A, SGK1, LF 5-LF Monocyte ALOX5AP, 98.0% 16 transcriptomics SGK223
TABLE-US-00028 TABLE 1 Clinical characteristics of the inception cohort, validation cohort 2 and 4 INCEPTION COHORT VALIDATION 2 DISCOVERY + RNA - VALIDATION 4 VALIDATION 1 Sequencing qPCR n = 31 n = 16 n = 37 Diagnosis, n, % Ulcerative colitis 20 (64.5) 7 (43.8) 30 (81.1) Crohn's disease 11 (35.5) 9 (56.3) 7 (18.9) Gender, n women, % 17 (54.8) 44.2 (26.0-55.8) 38.2 (31.0-48.0) Age, years, (median, 45.3 (29.6-56.3) 7 (43.8) 25 (67.6) IQR) Disease duration, 8.4 (4.0-15.3) 3.7 (1.6-20.7) 6.9 (1.7-11.7) years, (median, IQR) Disease location*, n, % L1 0 (0) 0 (0) 0 (0) L2 2 (18.2) 4 (44.4) 3 (42.9) L3 9 (81.8) 5 (56.6) 4 (57.1) L4 modifier 2 (18.2) 2 (22.2) 0 (0) E1 3 (15.0) 1 (14.3) 8 (26.7) E2 10 (50.0) 2 (28.6) 9 (30.0) E3 7 (35.0) 4 (57.1) 13 (43.3) Disease behavior*, n, % B1 6 (54.5) 4 (44.4) 6 (85.7) B2 3 (27.3) 2 (22.2) 0 (0.0) B3 2 (18.2) 3 (33.3) 1 (14.3) perianal 5 (45.5) 2 (22.2) 2 (28.6) involvement Steroid use during induction, n, % Topical 10 (32.3) 5 (31.3) 15 (40.1) Systemic 8 (25.8) 6 (37.5) 7 (16.2) Previous anti-TNF exposure, n, % naïve 10 (32.3) 4 (25.0) 26 (70.3) exposed 21 (67.7) 12 (75.0) 13 (29.7) C-reactive protein, 2.0 (0.9-6.7) 3.8 (1.4-7.2) 1.8 (0.7-6.0) mg/L, (median, IQR) Endoscopic remission, n, % Yes 19 (61.3) 5 (31.1) 14 (37.8) No 12 (38.7) 11 (68.9) 23 (62.2) n = number of patients; IQR = interquartile range *Montreal classification.sup.53
TABLE-US-00029 TABLE 2 Accuracy of the 4-gene signature in vedolizumab and anti-TNF treated patients Discovery Validation Validation Validation Anti-TNF dataset dataset 1 dataset 2 dataset 3 dataset RNA-seq RNA-seq RNA-seq Microarray RNA-seq n = 20 n = 11 n = 16 n = 13 n = 20 9 NR, 11 R 3 NR, 8 R 11 NR, 5 R 9 NR, 4 R NR 12, R 8 Accuracy 80.0% 100.0% 81.3% 76.9% 55.0% Sensitivity 81.8% 100.0% 66.7% 100.0% 75.0% Specificity 77.8% 100.0% 90.0% 70.0% 41.7% Positive 81.8% 100.0% 80.0% 50.0% 46.2% predictive value Negative 77.8% 100.0% 81.8% 100.0% 71.4% predictive value Positive 3.7 ∞ 6.67 3.3 1.3 likelihood ratio Negative 0.2 0 0.3 0 0.6 likelihood ratio NR = non responder; R = responder; n = number of patients
TABLE-US-00030 TABLE 3 Details of the forward (Fw) and reverse (Rev) primers used for the beta actin qPCR analysis, including the amplicon length, melt temperature (Tm), 5′-3′ sequence and NCBI accession number. Amplicon Accession Fw/Rev Length Tm (° C.) Sequence (5’-3’) Gene number Reference Fw 108 59.9 ACAATGTGGCCGAGGACTTT Beta Actin NM_001101.3 Own design Rev 59.7 TGGGGTGGCTTTTAGGATGG primer BLAST
TABLE-US-00031 TABLE 4 Details of target-specific TaqMan Primers. Gene Target-specific primer Company PIWIL1 Hs01041737_m1 ThermoFisher Scientific MAATS1 Hs00398573_m1 ThermoFisher Scientific DCHS2 Hs03006670_m1 ThermoFisher Scientific RGS13 Hs00243182_m1 ThermoFisher Scientific
TABLE-US-00032 TABLE 5 Overview primary antibodies immunohistochemistry Dilution Incubation primary details primary Protein antibody Primary antibody antibody PIWIL1 1:2000 rabbit polyclonal anti-PIWIL1 Ab - HPA018798 - Sigma Aldrich 30 min at RT MAATS1 1:800 mouse monoclonal anti-MAATS1/C3orf15 Ab - MA5-26540 - Invitrogen 30 min at RT DCHS2 1:400 rabbit polyclonal anti-DCHS2 Ab - HPA064159 - Sigma Aldrich 30 min at RT RGS13 1:200 rabbit polyclonal anti-RGS13 Ab - HPA044952 - Sigma Aldrich 30 min at RT Ab = antibody; RT = room temperature
TABLE-US-00033 TABLE 6 Clinical features of the anti-TNF treated cohort Diagnosis, n, % Ulcerative colitis 12 (60.0) Crohn's disease 8 (40.0) Gender, n women, % 12 (60.0) Age, years, (median, IQR) 33.7 (21.6-48.0) Disease duration, years, 1.4 (0.2-4.8) (median, IQR) Disease location*, n, % L1 0 (0.0) L2 1 (16.7) L3 5 (83.3) L4 modifier 1 (16.7) E1 0 (0.0) E2 11 (83.3) E3 3 (21.4) Disease behavior*, n, % B1 3 (50.0) B2 3 (50.0) B3 0 (0.0) perianal involvement 1 (16.7) Steroid use during induction, n, % Topical 3 (15.0) Systemic 7 (35.0) Immunomodulators during 1 (5.0) induction, n, % C-reactive protein, mg/L, 5.1 (1.4-14.2) (median, IQR) Endoscopic remission, n, % GO Leukocyte 0.006 0.017 migration GO Leukocyte 0.032 0.090 adhesion to vascular endothelial cells GO Cellular 0.038 0.060 Extravasation GO Leukocyte Cell Cell 0.089 0.098 adhesion GO integrin mediated 0.117 0.145 signalling pathway GO Integrin binding 0.171 0.166 GO cell adhesion 0.201 0.221 molecule binding GO cell substrate 0.232 0.208 adhesion FDR = false discovery rate
TABLE-US-00034 TABLE 7 Baseline differentially expressed genes between vedolizumab responders and non-responders selected based on a nominal 0.005 significance level. FDR Base Nominal adjusted Gene Mean log2FoldChange pvalue pvalue KRT23 16.71808585 −2.024205179 1.09E−08 0.000168888 TMEM35 22.00731444 1.023871908 5.24E−07 0.004044778 DCHS2 14.21680319 1.568224721 2.75E−06 0.014128976 CLDN8 90.06084218 4.396104381 4.96E−06 0.019127255 IFI6 334.6292867 −0.74725992 6.36E−06 0.019615927 APOBEC3A 70.46242613 −1.681358164 2.93E−05 0.075378873 PCOLCE2 7.461678684 2.224767485 3.85E−05 0.084915322 CXCL6 367.0654431 −1.860149522 5.42E−05 0.096168704 P2RX2 3.988036794 2.337362091 5.61E−05 0.096168704 HEPHL1 7.197847735 −2.712063282 6.93E−05 0.106875332 GZMB 179.6966807 −1.235947978 0.000105257 0.126064653 CCL3 110.8862223 −1.370797965 0.000106858 0.126064653 DCBLD1 335.8001475 −0.433965692 0.000109094 0.126064653 IL18RAP 88.25256523 −0.945525735 0.000114389 0.126064653 IL32 1239.138654 −0.516138001 0.000191042 0.196506067 RGS13 26.71377804 1.005581305 0.000209322 0.196608037 C16orf89 27.46766449 0.798707147 0.000216627 0.196608037 RASGRP4 66.48234435 −0.86694788 0.000229439 0.196667853 GLRA2 12.88014457 2.035443889 0.000259165 0.207049407 NCF2 451.2453884 −0.812766366 0.000276283 0.207049407 PPP1R3C 50.46721132 0.777591784 0.000281809 0.207049407 PTGER1 5.95195593 −1.818433719 0.000319712 0.209795607 AFF3 85.79594968 0.720825474 0.000327476 0.209795607 SERPINA9 5.578816375 3.073114165 0.000328424 0.209795607 ITPRIPL2 719.9640658 −0.322518253 0.000339937 0.209795607 SHC1 1492.183764 −0.276223273 0.000370729 0.212595281 MAATS1 16.84982693 1.359399253 0.000393874 0.212595281 PRF1 175.5627542 −0.778342102 0.000408969 0.212595281 RIPK2 223.2224243 −0.488962188 0.000415642 0.212595281 C7 206.9021406 1.132514881 0.000431099 0.212595281 VASN 134.7232446 −0.923967057 0.000469609 0.212595281 LILRB2 378.0288889 −1.034543392 0.00050092 0.212595281 OCA2 5.77409323 1.797972428 0.00050103 0.212595281 GDF6 5.727696335 1.73964914 0.000509621 0.212595281 HMG20A 436.3906394 0.224406505 0.000515674 0.212595281 ARRB2 608.6137097 −0.453860183 0.000518642 0.212595281 MMP1 3428.229662 −2.00236066 0.000527115 0.212595281 IFNG 39.99709331 −1.72185823 0.00053709 0.212595281 C21orf88 75.04395766 2.489433131 0.000537379 0.212595281 CEBPB 427.6936466 −0.897826636 0.000657776 0.24482901 CSF2 22.91065713 −1.739282902 0.000659524 0.24482901 ZNF587B 108.0999501 0.322149108 0.000668663 0.24482901 PIWIL1 1.671388529 3.855039524 0.000682457 0.24482901 EVA1B 59.27235971 −0.927452555 0.000698197 0.24482901 SLC13A2 65.21677719 1.487452862 0.000751791 0.254142023 HSD11B1 70.37426993 −1.04799772 0.000783544 0.254142023 SHISA3 12.42272354 1.422845205 0.000796262 0.254142023 NTRK3 10.77519023 1.203351121 0.00079719 0.254142023 S100A3 32.14898349 −1.151271376 0.000810185 0.254142023 NPTX2 112.143113 −1.739417902 0.000823586 0.254142023 CMIP 1060.938128 −0.24995589 0.000847772 0.256475996 WBSCR27 13.62748883 1.304689938 0.000930061 0.275959815 APOL1 3402.486088 −0.800049872 0.000968958 0.282076494 LILRA5 142.3459388 −1.210971756 0.001013086 0.289461169 TENM2 4.012797652 2.203730979 0.001039446 0.29159288 TBC1D1 837.9063125 −0.229263126 0.00112296 0.299758073 KCNH2 74.39915275 0.642044407 0.001154201 0.299758073 HSPA12B 77.76903555 −0.768198612 0.001154923 0.299758073 PFKFB4 177.1101779 −0.634147022 0.001188816 0.299758073 SOX18 75.69686921 −1.037860294 0.001217785 0.299758073 FCGR2A 590.6782548 −1.007841239 0.001242733 0.299758073 OSCAR 51.81121286 −0.694437399 0.00124279 0.299758073 RP11-812E19.9 21.33158313 −1.080040039 0.001243239 0.299758073 MMP3 4282.898556 −1.863898029 0.001298899 0.299758073 ADNP2 329.918377 0.193727231 0.001305613 0.299758073 PDPN 555.8842075 −0.933770736 0.001322834 0.299758073 PTAFR 604.2748337 −0.609657379 0.001323439 0.299758073 PLAU 1885.135502 −1.002161766 0.001329836 0.299758073 MMP14 2445.673642 −0.525351269 0.001344761 0.299758073 HCAR2 118.6397201 −1.66801409 0.001360294 0.299758073 FFAR2 158.9609359 −1.263390496 0.001379404 0.299758073 SLC43A2 499.956189 −0.49681542 0.001422941 0.301417508 GNAI1 286.2872531 −0.361791712 0.001436971 0.301417508 GBP5 1201.697296 −1.045603479 0.001458182 0.301417508 KRTAP13-2 7.313850486 4.807195155 0.001478671 0.301417508 ZNF525 93.38275607 0.443027871 0.001579396 0.301417508 CLGN 10.73315268 1.037888533 0.001585583 0.301417508 WARS 7144.39929 −0.830127459 0.001626954 0.301417508 PXDN 1131.818794 −0.620587799 0.001628192 0.301417508 NRCAM 80.95633993 −1.163930343 0.001639771 0.301417508 TBX2 211.9814703 −0.576759114 0.00165562 0.301417508 CCR1 328.7571071 −0.766553241 0.001700304 0.301417508 GPRASP1 96.65151048 0.437566455 0.001703022 0.301417508 TIMM10 242.7560124 0.413713665 0.001710192 0.301417508 FCN3 84.27508311 −1.407743033 0.001752829 0.301417508 DRAXIN 3.824098101 −1.486830398 0.001762212 0.301417508 RAB31 1034.096128 −0.515186815 0.001763017 0.301417508 IL7R 1452.388087 −0.626916046 0.001778229 0.301417508 FAM26F 223.730022 −0.927787816 0.00179398 0.301417508 CA1 2884.818511 2.076657265 0.001794694 0.301417508 PRELP 149.2603821 1.068878913 0.001826146 0.301417508 RGS3 603.1198191 −0.313215009 0.001894436 0.301417508 GSDMC 13.68277036 −1.325067842 0.001897953 0.301417508 TYMP 1464.768981 −0.696167395 0.001937775 0.301417508 MYO1F 606.4251332 −0.532393196 0.001947213 0.301417508 EDN1 151.1367903 −0.485183623 0.00195317 0.301417508 MT2A 754.0649999 −0.800885696 0.001957318 0.301417508 CD300C 38.64801845 −0.687888133 0.001965729 0.301417508 CNTN1 34.82071639 1.202507422 0.001979141 0.301417508 SLC9A9 151.5146286 0.390117741 0.00198252 0.301417508 APOL2 1380.803074 −0.61816297 0.001991339 0.301417508 GLT1D1 30.55404476 −1.335459397 0.001992649 0.301417508 KIAA2022 8.39545959 1.110659808 0.002032918 0.303055283 KANK4 11.99966942 1.242845228 0.002050125 0.303055283 EMR2 368.7178652 −0.826542898 0.002062402 0.303055283 CHMP4C 264.8618808 0.501371898 0.00211717 0.307508524 CXXC4 27.2122769 0.522500707 0.002132569 0.307508524 PDGFB 178.670281 −0.620897944 0.002153947 0.307715287 PRKCDBP 113.3674965 −0.794751614 0.002195238 0.310736989 HCAR3 166.6445715 −1.797143179 0.002252748 0.312805681 MEFV 69.9932486 −1.079552144 0.002255787 0.312805681 ITIH1 3.765114851 1.801203883 0.002270674 0.312805681 ZNF180 96.81099378 0.284407631 0.00232086 0.31688978 ACSL1 769.3567693 −0.629204746 0.002375655 0.321526177 SERPINH1 1448.642851 −0.435782479 0.002401686 0.322222743 KCNJ15 74.21697188 −1.388441195 0.00247467 0.329152443 FPR2 152.2665921 −1.561931781 0.002610446 0.343491034 PML 856.7650377 −0.450426176 0.002626997 0.343491034 CRIP3 9.858462532 1.131413542 0.002653799 0.344079565 PAK3 14.29951182 0.871163812 0.002741388 0.352095927 S100A8 516.1026144 −1.44896929 0.002761268 0.352095927 AGTRAP 303.5954041 −0.366155738 0.002851262 0.357943211 NRBF2 254.2046332 −0.217973831 0.00285909 0.357943211 LCN8 2.661740817 4.526324201 0.002886973 0.357943211 LCP2 700.8022057 −0.529213276 0.002903855 0.357943211 CD97 1624.920088 −0.29376518 0.002923122 0.357943211 RNF149 966.8684308 −0.385556934 0.003016884 0.359954883 FAM20C 554.4572542 −0.729110504 0.003027376 0.359954883 IL6 137.4603638 −1.872812541 0.003039422 0.359954883 MAMDC2 77.14364178 1.077587002 0.00304496 0.359954883 FRMD5 42.45662616 −0.551789098 0.003056199 0.359954883 PRSS23 1269.574378 −0.518664008 0.003105654 0.36300863 ADAMTS2 404.6682717 −0.823644527 0.003170801 0.363452743 CXCR2 198.0697661 −1.504911179 0.003175255 0.363452743 CGNL1 107.0674399 0.554566817 0.003210693 0.363452743 SLC26A7 7.979381157 1.155365714 0.003215226 0.363452743 MAPK4 8.790190651 1.599861787 0.003274881 0.363452743 GPR68 145.2882826 −0.63197975 0.003320694 0.363452743 CCDC85B 70.38711199 −1.072235946 0.003334462 0.363452743 TFB2M 208.4541531 0.305081722 0.003341185 0.363452743 FPR3 538.077495 −0.491211879 0.003355985 0.363452743 IL10 27.97631112 −0.748586007 0.00336366 0.363452743 GZMH 45.67425824 −0.978458514 0.003368575 0.363452743 TWIST1 22.06253863 −1.168607671 0.003429279 0.367432956 KYNU 313.5307864 −0.887143876 0.003465275 0.368729158 P2RY6 118.969069 −0.682542667 0.003508725 0.370795351 DUOXA1 41.78447289 1.164986485 0.003605027 0.375315993 THNSL1 71.40192978 0.481084394 0.003614439 0.375315993 GAS1 52.07464884 −1.302056746 0.003624479 0.375315993 AJAP1 22.61295569 −0.903346358 0.003684437 0.376071973 TARBP1 393.023524 0.273797525 0.003688553 0.376071973 ECEL1 6.278329523 −1.744911015 0.003711289 0.376071973 TRPM5 25.12588897 0.868271644 0.003729277 0.376071973 TAP1 4573.546961 −0.432425555 0.003804006 0.381116896 XIRP1 5.95863417 −1.915459539 0.003852525 0.381611932 SPON2 436.7821724 −0.682099861 0.003868974 0.381611932 RND3 742.3046393 −0.304031374 0.003883147 0.381611932 PI15 236.0123091 −1.64216232 0.003944315 0.383224026 GBP1 2082.256606 −0.688433984 0.003961081 0.383224026 CDC25B 1152.129405 −0.457393671 0.003974065 0.383224026 COL19A1 14.0999984 1.161531971 0.004058959 0.383658079 UCN2 15.82232094 −1.706643873 0.004067746 0.383658079 KIAA1199 892.9038839 −1.464035577 0.004114575 0.383658079 FAM65C 246.6649576 −0.805227997 0.004122964 0.383658079 TNFAIP6 103.975943 −1.23855828 0.004124454 0.383658079 SPI1 442.2024738 −0.606434313 0.004127762 0.383658079 IL22 12.11840649 −1.555283495 0.004226837 0.39051419 LOX 233.7338087 −0.500770995 0.00427652 0.392752577 CLEC4E 72.03668222 −1.087601128 0.004314872 0.392778101 HSD3B2 9.889031223 2.615679647 0.004327713 0.392778101 HAL 17.07758535 −1.177931464 0.004384927 0.395643489 GAPT 86.19781481 0.577299495 0.004463871 0.396779869 SNAP29 538.2244988 −0.205047055 0.004487674 0.396779869 SEC22A 156.8551614 0.214707333 0.004515121 0.396779869 SPHK1 149.208726 −0.854051265 0.004534048 0.396779869 FCGR3A 666.4526877 −0.819413262 0.004563509 0.396779869 CENPF 452.425366 0.363691565 0.004563724 0.396779869 KLF10 769.779455 −0.301948619 0.004608633 0.396779869 TWIST2 6.123232934 −1.243975465 0.004640758 0.396779869 CYP27C1 11.76547844 0.875786123 0.004652416 0.396779869 TMEM132A 295.0309403 −0.774756412 0.004654686 0.396779869 CEBPD 375.6933995 −0.854411874 0.004682067 0.396920927 TNFAIP3 1311.603345 −0.535092443 0.004740862 0.398333069 TMEM255A 37.62852252 0.840794889 0.004750359 0.398333069 FHL1 1126.475823 0.526990709 0.004880715 0.407051615 MNDA 354.0706377 −0.921457857 0.004912218 0.40747638
TABLE-US-00035 TABLE 8 Gene set enrichment analysis (GSEA) results focused on the leukocyte migration and cell adhesion gene ontology (GO) gene sets, derived from the MSigDB. All gene sets are enriched in the non-responder group. Nominal FDR corrected GO gene set p-value p-value GO Leukocyte 0.006 0.017 migration GO Leukocyte 0.032 0.090 adhesion to vascular endothelial cells GO Cellular 0.038 0.060 Extravasation GO Leukocyte Cell Cell 0.089 0.098 adhesion GO integrin mediated 0.117 0.145 signalling pathway GO Integrin binding 0.171 0.166 GO cell adhesion 0.201 0.221 molecule binding GO cell substrate 0.232 0.208 adhesion FDR = false discovery rate