Method of producing oligomer affinity pairs
10127349 ยท 2018-11-13
Assignee
Inventors
Cpc classification
International classification
Abstract
The invention provides methods to identify pRNA- and pDNA oligomer affinity pairs. Affinity pairs comprised of nucleic acid oligomers which demonstrate no cross-reactivity (orthogonal) are designed using software and empirically verified by thermodynamic study and lateral flow testing. The design software uses a semi-random algorithm to build such sequences of nucleic acid oligomers based on user-input parameters for affinity strength and orthogonal stringency. These pairs can be applied for use in multi-analyte solid support and lateral flow diagnostic tests.
Claims
1. A method of producing a set of oligomer affinity pairs for detection of targets using a lateral flow substrate, comprising the steps of: a) acquiring: i. a first set of user-controlled variables relating to stability of resulting oligomer affinity pairs comprising: a minimum percentage of guanine and cytosine (% GC minimum) within each oligomer affinity pair, and a maximum percentage of guanine and cytosine (% GC maximum) within each oligomer affinity pair, ii. a second set of one or more user-controlled variables relating to stringency of non-specific cross-interactions selected from the group consisting of: G-A mismatches counted as matches between oligomer affinity pairs, G-T mismatches counted as matches between oligomer affinity pairs, iii. a third set of one or more user-controlled variables relating to stringency of non-specific cross-interactions selected from the group consisting of: maximum consecutive matches in the oligomer affinity pairs, maximum consecutive matches of guanine and cytosine within consecutive matches in the oligomer affinity pairs, and minimum mismatches between maximum consecutive matches in the oligomer affinity pairs, and iv. user-selected sequence length; b) initiating a cumulative list of non-compliant sequences, wherein sequences identified as inconsistent with the first set of user-controlled variables or third set of one or more user-controlled variables are referred to the cumulative list of non-compliant sequences; c) generating a candidate sequence by adding a nucleic acid monomer to another nucleic acid monomer or to an existing sequence of nucleic acid monomers; d) determining if the candidate sequence is identical to a sequence on the cumulative list of non-compliant sequences, and: i. if the candidate sequence is not identical to a sequence on the cumulative list of non-compliant sequences, proceeding to step (e), or ii. if sequences have not been referred to the cumulative list of non-compliant sequences, proceeding to step (e), or iii. if the candidate sequence is identical to a sequence on the cumulative list of non-compliant sequences, then removing the nucleic acid monomer most recently added to the candidate sequence, and returning to step (b), or iv. if the addition of each monomer A, C, G, and T results in a candidate sequence identical to a sequence on the cumulative list of non-compliant sequences, discarding the candidate sequence and returning to step (b); e) generating a complementary sequence for the candidate sequence; f) evaluating the candidate sequence and its complementary sequence for compliance with the first set of user-controlled variables, wherein said evaluating comprises: calculating a percentage of guanine and cytosine (% GC) for the candidate sequence or the complement sequence using the formula:
% GC=[total number of guanine and cytosine in the candidate or complement sequence100%]/sequence length, and evaluating if the % GC is within a range defined in the first set of user-controlled variables for % GC maximum and % GC minimum; g) based on said evaluating, if the candidate sequence and its complementary sequence have a % GC within the range defined in the first set of user-controlled variables, proceeding to step (i); or h) based on said evaluating, if the candidate sequence or its complementary sequence have a % GC outside of the range defined in the first set of user-controlled variables, referring the candidate sequence and its complementary sequence to the cumulative list of non-compliant sequences, removing the nucleic acid monomer most recently added to the candidate sequence, and returning to step (b); i) determining whether any oligomer affinity pairs have been previously produced for the set of oligomer affinity pairs and: i. if oligomer affinity pairs have not been produced for the set of oligomer affinity pairs and the candidate sequence and the complementary sequence have the user-selected sequence length, proceeding to step (n), or ii. if oligomer affinity pairs have not been produced for the set of oligomer affinity pairs and the candidate sequence and the complementary sequence have fewer monomers than the user-selected sequence length, returning to step (b), or iii. if oligomer affinity pairs have been previously produced for the set of oligomer affinity pairs, proceeding to step (j); j) evaluating the candidate sequence and its complementary sequence against sequences of oligomers within the set of oligomer affinity pairs for compliance with the third set of one or more user-controlled variables, wherein said evaluating comprises: i. counting maximum consecutive matches using the second set of one or more user-controlled variables, ii. counting the consecutive matches of guanine and cytosine within consecutive matches, iii. counting the minimum mismatches between stretches of maximum consecutive matches, and iv. comparing the respective maximum and minimum values in the third set of one or more user-controlled variables to counted maximum consecutive matches, consecutive matches, and minimum mismatches; k) based on said evaluating, if the candidate sequence and its complementary sequence have counted maximum consecutive matches, consecutive matches, and minimum mismatches within the respective maximum and minimum values of the third set of one or more user-controlled variables and the candidate sequence and the complementary sequence have the user-selected sequence length, proceeding to step (n); or l) based on said evaluating, if the candidate sequence and its complementary sequence have counted maximum consecutive matches, consecutive matches, and minimum mismatches within the respective maximum and minimum values of the third set of one or more user-controlled variables and the candidate sequence and the complementary sequence have fewer monomers than the user-selected sequence length, returning to step (b); or m) based on said evaluating, if the candidate sequence or its complementary sequence has counted maximum consecutive matches, consecutive matches, and minimum mismatches that are not within the respective maximum and minimum values of the third set of one or more user-controlled variables, performing the following: i. referring the candidate sequence and complementary sequence to the cumulative list of non-compliant sequences, removing the nucleic acid monomer most recently added to the candidate sequence, and returning to step (b), or ii. if the addition of each monomer A, C, G, and T results in a candidate sequence identical to a sequence on the cumulative list of non-compliant sequences, discarding the candidate sequence and returning to step (b), wherein all of the above steps are performed on a suitably programmed computer; n) synthesizing a first oligomer having the candidate sequence and a second oligomer having the complementary sequence, wherein the first oligomer and the second oligomer constitute an oligomer affinity pair within an oligomer affinity pair set, wherein the first oligomer and the second oligomer are comprised of 3-deoxypyranosyl nucleic acid (pDNA) or pyranosyl nucleic acid (pRNA), and wherein the first oligomer and the second oligomer preferentially hybridize to each other and not to naturally occurring DNA or RNA; o) repeating steps (b) through (n) to produce additional oligomer affinity pairs comprising additional first oligomers and additional second oligomers having sequences in compliance with the first set of user-controlled variables and third set of one or more user-controlled variables; p) attaching first oligomers of the first oligomer affinity pair and the additional oligomer affinity pairs to a lateral flow substrate, wherein the lateral flow substrate is selected from the group consisting of membranes, microfluidic channels, microspheres, magnetic beads, color beads, microarrays, microtiterplates, microchips, nylon surfaces, gold surfaces, polystyrene surfaces, and nanoparticles; q) exposing the lateral flow substrate to target complexes, wherein each target complex comprises a target oligomer having a target oligomer sequence selected from at least a portion of the second oligomers of the oligomer affinity pairs, wherein the target oligomers of the target complexes hybridize to corresponding first oligomers attached to the lateral flow substrate, and wherein the oligomers of each oligomer affinity pair preferentially hybridize to each other; and r) detecting a target by detecting hybridization of the target oligomer to its corresponding first oligomer.
2. The method of claim 1, further comprising the step of: experimentally validating at least one oligomer affinity pair.
3. The method of claim 2, wherein the oligomer affinity pair is experimentally validated by determining melting temperatures for the oligomer affinity pair.
4. The method of claim 2, wherein the oligomer affinity pair is experimentally validated by performing a lateral flow test.
5. The method of claim 1, wherein the step of exposing the lateral flow substrate to target complexes further comprises amplifying the target oligomer with at least one chimeric primer, said chimeric primer comprising a sequence selected from the second oligomers of the first oligomer affinity pair and the additional oligomer affinity pairs.
6. The method of claim 1, wherein oligomer affinity pairs in the set of oligomer affinity pairs comprise: a first oligomer having a sequence of CTTCCATT and a second oligomer having a sequence of AATGGAAG; or a first oligomer having a sequence of TCTCTCAT and a second oligomer having a sequence of ATGAGAGA; or a first oligomer having a sequence of TGTAGTCA and a second oligomer having a sequence of TGACTACA; or a first oligomer having a sequence of TTTTTTTTC and a second oligomer having a sequence of GAAAAAAAA; or a first oligomer having a sequence of CAGATAGA and a second oligomer having a sequence of TCTATCTG; or a first oligomer having a sequence of ACATCACA and a second oligomer having a sequence of TGTGATGT; or a first oligomer having a sequence of GTAAGTTG and a second oligomer having a sequence of CAACTTAC; or a first oligomer having a sequence of CAAGAATC and a second oligomer having a sequence of GATTCTTG; or a first oligomer having a sequence of GAACAAAC and a second oligomer having a sequence of GTTTGTTC.
7. A method of producing a set of oligomer affinity pairs for detection of targets using a lateral flow substrate, comprising the steps of: a) acquiring: i. a first set of user-controlled variables relating to stability of resulting oligomer affinity pairs comprising: a minimum predicted duplex melting temperature within each oligomer affinity pair, and a maximum predicted duplex melting temperature within each oligomer affinity pair, ii. a second set of one or more user-controlled variables relating to stringency of non-specific cross-interactions selected from the group consisting of: G-A mismatches counted as matches between oligomer affinity pairs, G-T mismatches counted as matches between oligomer affinity pairs, iii. a third set of one or more user-controlled variables relating to stringency of non-specific cross-interactions selected from the group consisting of: maximum consecutive matches in the oligomer affinity pairs, maximum consecutive matches of guanine and cytosine within consecutive matches in the oligomer affinity pairs, and minimum mismatches between maximum consecutive matches in the oligomer affinity pairs, and iv. user-selected sequence length; b) initiating a cumulative list of non-compliant sequences, wherein sequences identified as inconsistent with the first set of user-controlled variables or third set of one or more user-controlled variables are referred to the cumulative list of non-compliant sequences; c) generating a candidate sequence by adding a nucleic acid monomer to another nucleic acid monomer or to an existing sequence of nucleic acid monomers; d) determining if the candidate sequence is identical to a sequence on the cumulative list of non-compliant sequences, and: i. if the candidate sequence is not identical to a sequence on the cumulative list of non-compliant sequences, proceeding to step (e), or ii. if sequences have not been referred to the cumulative list of non-compliant sequences. proceeding to step (e). or iii. if the candidate sequence is identical to a sequence on the cumulative list of non-compliant sequences, then removing the nucleic acid monomer most recently added to the candidate sequence, and returning to step (b), or iii. if the addition of each monomer A, C, G, and T results in a candidate sequence identical to a sequence on the cumulative list of non-compliant sequences, discarding the candidate sequence and returning to step (b); e) generating a complementary sequence for the candidate sequence; f) evaluating the candidate sequence and its complementary sequence for compliance with the first set of user-controlled variables, wherein said evaluating comprises: calculating a predicted melt temperature (Tm) for the candidate sequence or the complement sequence using the formula:
1/Tm=R/H ln(C/2)+S/H, wherein R is 8.3145 J/mol K, H is a sum of nearest neighbor values for enthalpy in the candidate sequence. S is a sum of nearest neighbor values for entropy in the candidate sequence, and C is the selected concentration, and comparing the predicted Tm against the range defined by the first set of user-controlled variables; g) based on said evaluating, if the candidate sequence and its complementary sequence have a predicted Tm within the range defined in the first set of user-controlled variables, proceeding to step (i); or h) based on said evaluating, if the candidate sequence or its complementary sequence have a predicted Tm outside of the range defined in the first set of user-controlled variables, referring the candidate sequence and its complementary sequence to the cumulative list of non-compliant sequences, removing the nucleic acid monomer most recently added to the candidate sequence, and returning to step (b); i) determining whether any oligomer affinity pairs have been previously produced for the set of oligomer affinity pairs and: i. if oligomer affinity pairs have not been produced for the set of oligomer affinity pairs and the candidate sequence and the complementary sequence have the user-selected sequence length, proceeding to step (n), or ii. if oligomer affinity pairs have not been produced for the set of oligomer affinity pairs and the candidate sequence and the complementary sequence have fewer monomers than the user-selected sequence length, returning to step (b), or iii. if oligomer affinity pairs have been previously produced for the set of oligomer affinity pairs, proceeding to step (j); j) evaluating the candidate sequence and its complementary sequence against sequences of oligomers within the set of oligomer affinity pairs for compliance with the third set of one or more user-controlled variables, wherein said evaluating comprises: i. counting maximum consecutive matches using the second set of one or more user-controlled variables, ii. counting the consecutive matches of guanine and cytosine within consecutive matches, iii. counting the minimum mismatches between stretches of maximum consecutive matches, and iv. comparing the respective maximum and minimum values in the third set of one or more user-controlled variables to counted maximum consecutive matches, consecutive matches, and minimum mismatches; k) based on said evaluating, if the candidate sequence and its complementary sequence have counted maximum consecutive matches, consecutive matches, and minimum mismatches within the respective maximum and minimum values of the third set of one or more user-controlled variables and the candidate sequence and the complementary sequence have the user-selected sequence length, proceeding to step (n); or l) based on said evaluating, if the candidate sequence and its complementary sequence have counted maximum consecutive matches, consecutive matches, and minimum mismatches within the respective maximum and minimum values of the third set of one or more user-controlled variables and the candidate sequence and the complementary sequence have fewer monomers than the user-selected sequence length, returning to step (b); or m) based on said evaluating, if the candidate sequence or its complementary sequence has counted maximum consecutive matches, consecutive matches, and minimum mismatches that are not within the respective maximum and minimum values of the third set of one or more user-controlled variables, performing the following: i. adding referring the candidate sequence and complementary sequence to the cumulative list of non-compliant sequences, removing the nucleic acid monomer most recently added to the candidate sequence, and returning to step (b), or ii. if the addition of each monomer A, C, G, and T results in a candidate sequence identical to a sequence on the cumulative list of non-compliant sequences, discarding the candidate sequence and returning to step (b), wherein all of the above steps are performed on a suitably programmed computer; n) synthesizing a first oligomer having the candidate sequence and a second oligomer having the complementary sequence, wherein the first oligomer and the second oligomer constitute an oligomer affinity pair within an oligomer affinity pair set, wherein the first oligomer and the second oligomer are comprised of 3-deoxypyranosyl nucleic acid (pDNA) or pyranosyl nucleic acid (pRNA), and wherein the first oligomer and the second oligomer preferentially hybridize to each other and not to naturally occurring DNA or RNA; o) repeating steps (b) through (n) to produce additional oligomer affinity pairs comprising additional first oligomers and additional second oligomers having sequences in compliance with the first set of user-controlled variables and third set of one or more user-controlled variables; p) attaching first oligomers of the first oligomer affinity pair and the additional oligomer affinity pairs to a lateral flow substrate, wherein the lateral flow substrate is selected from the group consisting of membranes, microfluidic channels, microspheres, magnetic beads, color beads, microarrays, microtiterplates, microchips, nylon surfaces, gold surfaces, polystyrene surfaces, and nanoparticles; q) exposing the lateral flow substrate to target complexes, wherein each target complex comprises a target oligomer having a target oligomer sequence selected from at least a portion of the second oligomers of the oligomer affinity pairs, wherein the target oligomers of the target complexes hybridize to corresponding first oligomers attached to the lateral flow substrate, and wherein the oligomers of each oligomer affinity pair preferentially hybridize to each other; and r) detecting a target by detecting hybridization of the target oligomer to its corresponding first oligomer.
8. The method of claim 7, further comprising the step of: experimentally validating at least one oligomer affinity pair.
9. The method of claim 8, wherein the oligomer affinity pair is experimentally validated by determining melting temperatures for the oligomer affinity pair.
10. The method of claim 8, wherein the oligomer affinity pair is experimentally validated by performing a lateral flow test.
11. The method of claim 7, wherein the step of exposing the lateral flow substrate to target complexes further comprises amplifying the target oligomer with at least one chimeric primer, said chimeric primer comprising a sequence selected from the second oligomers of the first oligomer affinity pair and the additional oligomer affinity pairs.
12. The method of claim 7, wherein oligomer affinity pairs in the set of oligomer affinity pairs comprise: a first oligomer having a sequence of CTTCCATT and a second oligomer having a sequence of AATGGAAG; or a first oligomer having a sequence of TCTCTCAT and a second oligomer having a sequence of ATGAGAGA; or a first oligomer having a sequence of TGTAGTCA and a second oligomer having a sequence of TGACTACA; or a first oligomer having a sequence of TTTTTTTTC and a second oligomer having a sequence of GAAAAAAAA; or a first oligomer having a sequence of CAGATAGA and a second oligomer having a sequence of TCTATCTG; or a first oligomer having a sequence of ACATCACA and a second oligomer having a sequence of TGTGATGT; or a first oligomer having a sequence of GTAAGTTG and a second oligomer having a sequence of CAACTTAC; or a first oligomer having a sequence of CAAGAATC and a second oligomer having a sequence of GATTCTTG; or a first oligomer having a sequence of GAACAAAC and a second oligomer having a sequence of GTTTGTTC.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
(14) The present invention relates to oligomer affinity pairs suitable for solid phase-based tests and methods of producing affinity pairs. In one embodiment, the invention comprises a method for designing oligomer affinity pairs lacking non-specific cross-interaction which are suitable for multi-analyte tests which may or may not require spatially separate zones for each analyte. The invention further comprises specific oligomer affinity pairs for use in multi-analyte lateral flow tests.
Definitions
(15) The term chimeric oligomer or chimera refers to an oligomer that comprises at least two sequences, each sequence consisting of a different type of nucleic acid. For example, a chimeric oligomer may comprise DNA and pDNA, DNA and pRNA, pDNA and pRNA, RNA and pDNA, RNA and pRNA, or any combination of pRNA and pDNA with either DNA or RNA. In some embodiments a chimeric oligomer has a structure X-(L).sub.s-Y, wherein s=0 or 1, L is a linking group compatible with oligonucleotide synthesis, and X and Y are independently pRNA, pDNA, DNA, RNA, LNA (lock nucleic acids) or PNA (peptide nucleic acids). In some embodiments the DNA and RNA contain one or more modified bases that hybridize to DNA and RNA but not to pDNA and pRNA. Modified bases have been disclosed in U.S. Pat. Nos. 6,485,906 and 7,045,610 which are incorporated by reference in their totality.
(16) The term affinity pair refers to a set of molecules which bind to one another with a relatively higher affinity than to other molecules in an assay system. Oligomer affinity pairs refer to oligomers of RNA, DNA, pRNA, or pDNA, which bind to one another with a relatively higher affinity than to other molecules in an assay system. Oligomer affinity pairs may be partially or totally complementary in sequence. Members of an affinity pair may consist of the same nucleic acid as one another, or a different nucleic acid. One or more members of an oligomer affinity pair may be a chimeric oligomer.
(17) The term 3-deoxypyranosyl nucleic acid or pDNA refers to a polymer that forms a pairing system which is orthogonal to naturally occurring DNA or other naturally occurring nucleic acids. pDNA preferentially hybridizes with complementary pRNA or pDNA versus natural DNA or RNA.
(18) The term pyranosyl nucleic acid or pRNA refers to a polymer that forms a pairing system which is orthogonal to naturally occurring RNA or other naturally occurring nucleic acids. pRNA preferentially hybridizes with complementary pRNA or pDNA versus natural DNA or RNA.
(19) The term lateral flow testing refers to assay systems which involve the movement of a fluid over an immobile surface, wherein the fluid may contain an analyte and the immobile surface includes a surface capable of preferentially binding the analyte. Lateral flow testing may include lateral flow immunoassays, nucleic acid lateral flow immunoassays (NALFIA), and nucleic acid lateral flow assays (NALF), as well as other types of assays known in the art.
(20) The term solid support refers to a solid surface that can be used in diagnostic assays, including microfluidic channels, microspheres, magnetic beads, color beads, microarrays, microtiterplates, microchips, filters support, nylon-, gold-, polystyrene-surfaces, nanoparticles and the like.
(21) Method for Generating Sets of Affinity Pairs
(22) In one embodiment, the present invention comprises an algorithm for generating sets of affinity pairs which avoid non-specific cross-interaction. The affinity pairs may be nucleic acid oligomers. In some embodiments, the invention further comprises functional testing for non-specific cross-interactions after affinity pair candidates have been generated using the algorithm.
(23) In an embodiment of the invention, user-controlled variables are defined, for example by querying a user and acquiring parameters from a user for one or more of the user-controlled variables. The user-controlled variables are then defined in the algorithm according to user input. The user-defined variables may include parameters relating to the stability of matched affinity pairs, such as 1) length, 2) % G-C minimum, and 3) % G-C maximum. The user-defined variable may also include parameters relating to the stringency for non-specific cross-interactions, such as 1) Count G-A as match, 2) Count G-T as match, 3) Maximum Matches in a Row, 4) Maximum Number of G-C Matches within Maximum Matches in a Row, and 5) Minimum Number of Mismatches between Two or More Maximum Matches in a Row.
(24) In an embodiment of the invention, the user-controlled variables also include a parameter describing whether or not the affinity pairs are designed for immobilization on a solid support. If this variable is TRUE, the design algorithm ignores the cross-interactions among those oligomers arbitrarily bound to the membrane.
(25) In an embodiment of the invention, the user-controlled variables also include a parameter describing a user-specified length for the oligomers. The user-specified lengths of the oligomers in an oligomer affinity pair may be the equal or unequal.
(26) In an embodiment of the invention, a violates parameters list or VP list is assembled by the algorithm. A new VP list is initiated for each set of affinity pairs generated, and the algorithm refers any sequence which is inconsistent with the user-controlled variables to the VP list. The VP list represents a semi-random approach to generating candidate sequences which may be more efficient than random sequence generation.
(27) In a further embodiment, the algorithm includes a step for evaluating whether the addition of a base causes the sequence to be in violation of the user-controlled parameters. If the addition of a base causes the sequence to be in violation of the user-controlled parameters, the program removes that base and randomly selects a different base to continue generating the sequence.
(28) In a further embodiment, the method includes a step for allowing promiscuity of base-pairing in the oligomer affinity pair outside of Watson Crick pairing rules. The promiscuity can be recognized as a base match or ignored. Ignoring non-Watson-Crick base pairs loosens the design parameters to generate a larger set of affinity pairs at the expense of possible cross-interactions among non-complementary sequences.
(29) Exemplary Methods
(30) In one embodiment, the invention comprises a method which includes the following steps:
(31) I) Generate a first sequence conforming to user-controlled parameters using the following steps:
(32) A) Randomize a first base to initiate a sequence;
(33) B) Analyze the first sequence to see if it is listed in the VP list: if the sequence is not listed in the VP list, then continue to I.C; if the sequence is listed in the VP list, then remove the most recently added base and add a different random base and return to I.B; if all possible bases have been added, the subsequence is also added to the VP list, then return to I.A;
(34) C) Analyze the sequence for user-defined variables: if the sequence does not violate the user-defined variable parameters, then continue to I.D; if the sequence violates the user-defined variable parameters, add the sequence to the VP list, then remove the most recently added base and add a different random base and return to I.B; if all possible bases have been added, the subsequence is also added to the VP list, then return to I.A;
(35) D) Generate a complement to the sequence, and analyze the complement to see if it is listed in the VP list: if the complement is not listed in the VP list, then continue to I.E; if the complement is listed in the VP list, return to I.A;
(36) E) Analyze the complement for user-defined variables: if the complement does not violate the user-defined variable parameters, then continue to I.F; if the complement does violate the user-defined variable parameters, add the sequence and the complement to the VP list and return to I.A;
(37) F) Extend sequences: if the user-specified length for oligomers has not been reached, add another random base to the first sequence and go to I.B if the user-specified length for oligomers has been reached, go to Section II.
II) Generate additional sequences conforming to the user-defined variable parameters, which do not cross-react with the sequence of Section I using the following steps:
(38) A) Following the procedure in Section 1, generate additional sequences using the same VP list used in Section I; 1) If the user-controlled variable describing whether or not the affinity pairs are designed for immobilization on a solid support is TRUE, ignore the interactions of those oligomers which are arbitrarily designated as being bound to a solid support in Section I.C;
(39) B) If sequences pass both self-complement analysis as well as the VP list generated for the first sequence and any subsequent sequences, output the resulting sequences.
(40) In one embodiment, the invention comprises a method which includes the following steps:
(41) I) Load user-controlled variable parameters;
(42) II) Generate the first sequence (and complement) conforming to the parameters in Section I using the following steps:
(43) A) Randomize the first base B) Analyze the sequence to see if it's in an existing set of sequences violating parameters in Section I (the Violating Parameters, or VP list); if not, then continue to II.C; if it has been previously determined the sequence is not allowed, then remove the last added base and add another random base 1) If analysis in II.B shows the sequence to be violating parameters and all possible bases have been added and determined to be violating the parameters, the subsequence is also added to the VP list C) Once the sequence passes II.B, it is analyzed for other parameters defined in Section I 1) If analysis in II.C demonstrates parameter violation, it is added to the VP list D) Once the sequence passes II.C, its complement is analyzed for other parameters in Section I 1) If analysis in II.D demonstrates parameter violation, it is added to the VP list E) Add another random base and go to Step II.B until the length set in Section I is achieved
II) Generate additional sequences (and complements) conforming to the parameters in Section I using the following steps: A) Following the procedure in Section II generate additional sequences B) Sequences added must pass both self-complement analysis as well as with existing sequences in the list previously generated 1) Note that there is a user-controlled parameter to ignore interactions of those oligomers which are arbitrarily designated as being bound to a solid support 2) The VP list quickly determines if possibilities are exhausted by keeping track of any subsequences which do not conform to parameters set in Section I
(44) In one embodiment, the invention comprises a method which includes the following steps: a) collecting user-controlled parameters; b) selecting a base at random to grow a first sequence; c) determining whether the first sequence is included on a VP list; d) removing the most recently added base of the first sequence, adding a different randomly selected base to the first sequence, and returning to step (c), if it is determined that the first sequence is on the VP list; e) analyzing the first sequence to determine whether it meets the user-controlled parameters if it is determined that the first sequence is not on the VP list; f) adding the first sequence to the VP list if it is determined that the first sequence violates the user-controlled parameters; g) adding a randomly selected base to the first sequence if it is determined that the first sequence does not violate the user-controlled parameters; h) repeating steps (b) through (g) if the first sequence is less than a user-specified length; i) generating a complement to the first sequence if the first sequence is equal to the user-specified length; j) determining whether the complement is included on a VP list; k) adding the first sequence to the VP list if it is determined that the complement is on the VP list; l) analyzing the complement to determine whether it meets the user-controlled parameters if it is determined that the complement is not on the VP list; m) adding the first sequence to the VP list if it is determined that the complement violates the user-controlled parameters; and n) generating a second sequence using steps (b)-(m) to generate a second sequence.
(45) The present invention also provides methods for validating the oligomer affinity pairs generated by the methods described above, which may be software-generated oligomer affinity pairs. One method for validating oligomer affinity pairs includes determining melting temperatures (T.sub.m) for all possible duplexes, non-specific cross-interactions as well as self-interactions. Using the resulting data, the original software-generated set of oligomer affinity pairs can be then interrogated to reject the pairs that have failed to meet user-set criteria for the lowest acceptable margin for T.sub.m of specific duplexes and the highest acceptable margin for T.sub.m of non-specific duplexes. If necessary, the pairs that have met the criteria can be run through the design algorithm as a starting set to generate replacement pairs.
(46) In another embodiment, the method for validating oligomer affinity pairs is a lateral flow test. In this method, one of the strands from each pair is bound in a specific arrangement on a lateral flow strip. The other strand from each pair, in combination with appropriate labeling strategy, is then brought into contact with the test strip one at the time to determine which solid phase-bound strands can interact with each solution phase strands.
(47) The invention also contemplates the use of other methods, such as array based systems, to validate affinity pairs.
(48) Software Calculations
(49) % GC Calculation
(50) The methods of producing oligomer affinity pairs provided by the present invention include the use of user-defined variable parameters to create stringency and stability among the oligomer affinity pairs. In one embodiment, the method uses user-controlled variable parameters to limit acceptable total % GC content for the user-specified length of the oligomer, as calculated using Equation 1, wherein N.sub.Gi is a guanosine at position i, N.sub.Ci is a cytidine at position i, and n is the user-specified length of oligomer.
(51)
(52) After each base addition at length i until total length n, the % GC.sub.i content is calculated and verified to be within the user defined parameters as represented by Equation 2.
minimum % GC% GC.sub.imaximum % GC(2)
(53) If % GC.sub.i is found to be outside of the parameters established in Equation 2, then the last added nucleotide is removed and neither G nor C is allowed to be added to the nucleotide.
(54) T.sub.m Calculation
(55) In one embodiment, the method uses user-controlled variable parameters to limit the final T.sub.m (melt temperature) of the oligomers. By establishing a user-controlled T.sub.m range, the software creates and lengthens an oligomer until the user-defined minimum T.sub.m is achieved. T.sub.m is calculated by adding the nearest neighbor values for enthalpy and entropy (Equations 3 and 4, respectively), and manipulating the sum of enthalpy (H) and entropy (S) at a given concentration (C) as in Equation 5, where R is the gas constant. Once the minimum T.sub.m is achieved, the T.sub.m at oligo length i is verified to be less than the user-defined maximum T.sub.m; if true, the oligo is complete but if false and the last nucleotide added was a G or C, then A or T is added and the T.sub.m recalculated using Equations 3-5 and if Equation 6 is satisfied then the oligo is complete, and if not, the oligo is discarded.
(56)
Method for Detecting a Nucleic Acid Target Sequence in a Lateral Flow Experiment
(57) In another embodiment, the present invention provides methods for detecting a nucleic acid target sequence. pRNA and pDNA affinity pairs may be designed and validated using the method described above, and the affinity pairs used in a lateral flow analysis to detect a target sequence. Lateral flow (immuno)assays are currently used for qualitative, semiquantitative and quantitative monitoring. Applications include tests of pathogens, drugs, hormones, metabolites in biomedical, veterinary, food, feed and environmental settings.
(58) In one embodiment, the method for detecting a nucleic acid target sequence comprises the steps of: a) designing a pRNA or pDNA affinity pair with a desired T.sub.m and specificity; b) amplifying a target sequence with at least one chimeric primer, said chimeric primer comprising a pRNA or pDNA sequence of at least one member of said affinity pair; c) capturing said amplified target on a solid support comprising an immobilized pRNA or DNA sequence complementary to said pRNA or chimeric pDNA sequence in said chimeric primer; and d) detecting said amplified target.
Example 1
(59) Synthesis of pRNA and pDNA
(60) pRNAs are polymers composed of nucleoside monomeric units in which the natural ribofuranose sugar of RNA has been replaced with an isomeric ribopyranose sugar. The adjacent monomeric bases are connected to one another at their respective 2 and 4 positions through a phosphodiester linkage analogous to natural nucleic acids. The rigid conformation of the sugar rings and internucleoside linkages account for the remarkable stability of pRNA:pRNA duplexes. Methods for the preparation of pRNA are described in Eschenmoser et al., 1993, and U.S. Pat. No. 6,613,894, each of which is hereby incorporated herein by reference in its entirety.
(61) pDNAs are polymers composed of nucleoside monomeric units in which the natural ribofuranose sugar of RNA has been replace with an isomeric 3-deoxyribopyranose sugar. Similar to pRNAs, the adjacent monomeric bases are connected to one another at their respective 2 and 4 positions through a phosphodiester linkage analogous to natural nucleic acids. Methods for the preparation of pDNA were disclosed in U.S. Pat. No. 6,696,555, which is hereby incorporated herein by reference in its entirety.
(62) pRNA and pDNA can be additionally modified with various functional groups such as biotin, fluorescent labels and spacers using appropriate DNA synthesis solid supports, phosphoramidites or other reactive intermediates. Examples of such reagents can be found in the Glen Research catalog.
(63) Chimeric pRNA/DNA or pDNA/DNA
(64) Chimeric pRNA/DNA or pDNA/DNA are polymers composed of both pRNA and DNA or pDNA and DNA monomeric units.
(65) Chimeric polymers were assembled in blocks of pRNA, pDNA and DNA on a DNA synthesizer using properly protected pRNA, pDNA phosphoramidites described in U.S. Pat. No. 6,613,894 and U.S. Pat. No. 6,696,555 as well as standard DNA phosphoramidites. The blocks were connected either directly via a phosphodiester bond or via a spacer such spacer 9 using commercially available Spacer 9 phosphoramidite (Glen Research). pDNA-DNA chimeras were deprotected using standard concentrated ammonia deprotection conditions. pRNA-DNA chimeras were deprotected using gaseous ammonia (100-110 psi) at room temperature for 16 hrs to avoid pRNA degradation. All chimeric polymers were isolated using standard DMT-on purification followed by detritylation and DMT-off reverse phase HPLC purification.
(66) Immobilization of pRNA and pDNA Affinity Pairs
(67) Immobilization of a member of an affinity pair on nitrocellulose can be effected by various means. In the present example, a T.sub.20 DNA tail was incorporated into the pRNA or pDNA oligomer to create a chimera which could be striped on the membrane then subjected to irradiation by ultraviolet light to cross-link the thymidine units on the T.sub.20 tails, where the cross-linked products are immobilized. In other examples, oligomers have been conjugated to proteins, polystyrene particles, and other amine-functionalized polymers (aminodextran, poly-lysine, polyethyleneimine); these conjugates are striped on the nitrocellulose membrane and were held immobile within the nitrocellulose matrix by electrostatic forces when dried. Methods for conjugation of pRNA/pDNA to proteins and other amine-containing compounds are described in Hermanson, 1996.
(68) Lateral Flow Detection
(69) In order to detect hybridization of specific affinity pairs, nanoparticles doped with either a fluorescent or visible dye were employed. The particles were coated with a protein which binds biotin (eg, Neutravidin) and the bead was combined with a biotinylated oligomer complementary to a binding site on the nitrocellulose. Detection of nanoparticles with the visible dye can be achieved by the naked eye or by employing a color-saturation instrument. Detection of nanoparticles with the fluorescent dye can be achieved by ultraviolet illumination and detecting the fluorescent response either by the naked eye or by an instrument which detects the fluorescent emission. Europium chelate preparation and nanoparticle doping have been disclosed in US 2006/0166376 and U.S. Pat. No. 4,784,912.
Example 2
(70) 1. Synthesis and Purification
(71) All pDNA, pRNA, pRNA-L-pDNA and pDNA-L-DNA oligonucleotides were synthesized on an ABI 3900 DNA synthesizer. In the case of some chimera oligomers, a linker compatible with synthesis was used. All oligomers and chimeras containing pRNA were deblocked with gaseous NH.sub.3.
(72) Unmodified, detritylated pDNA oligonucleotides were purified by reverse-phase HPLC using 5-40% acetonitrile in triethylammonium bicarbonate (pH 8) ramped over minutes. Pure product fractions were collected and evaporated to dryness. The resulting pellet was dissolved in water and quantified by UV-Vis spectrophotometry.
(73) The T.sub.20-tailed and biotinylated oligonucleotides were purified twice by reverse-phase HPLC. First, oligonucleotides with DMT-protecting group were purified using 5-40% acetonitrile in 100 mM triethylammonium bicarbonate buffer (ramped over 20 minutes), and the pure fractions were evaporated to dryness. The resulting DMT-on oligonucleotide was then deprotected by addition of 300 L 80% acetic acid in water and allowed to react for 2 hours, then diluted to 3 mL volume using water and neutralized with 325 L triethylamine. The detritylated product was then purified a second time by reverse-phase HPLC using 4-25% acetonitrile in 100 mM triethylammonium bicarbonate (ramped over 20 minutes) and the pure fractions were evaporated to dryness. The pellets were dissolved in water and quantified by UV-Vis spectrophotometry.
(74) 2. Melting Experiments
(75) Unmodified oligonucleotide solutions were prepared at 5 M in buffer (50 mM Tris-HCl, 200 mM NaCl, pH 7.0). The samples were denatured at 70 C. then cooled to 0 C. with a blanket of dry air. The temperature was raised by 1 C./min from 0 to 70 C. and the T.sub.m estimated at the midpoint between annealed and dissociated portions of the resulting absorbance curve.
(76) 3. Striping Experiment
(77) Each of the biotinylated pDNA oligonucleotides were conjugated with NeutrAvidin-coated polystyrene nanoparticles doped with a fluorescent europium chelate by incubating for 15 minutes 200 L 10 mM Tris-HCl (pH 8), 10 L 5 M biotinylated pDNA, and 20 L 1% (w/v) NeutrAvidin-coated europium chelate-doped nanoparticles. Biotinylated DNA was then added to saturate the Neutravidin binding sites. 20 L of the resulting nanoparticle suspensions were diluted with 775 l buffer (50 mM Tris-HCl, 3% deoxycholate, 1% casein, 1% PEG8000, pH 8).
(78) pDNA-T20 oligonucleotides were prepared as a 200 M solution in 60 mM triethylammonium bicarbonate (pH 8) and striped using a BioDot striping instrument at a density of 0.6 L/cm on Millipore HF pre-backed cards with a membrane length of 36 mm. Each of the 9 pDNA-T20 was striped at 3.3 mm distance from the next line. The dried membranes were irradiated with UV light for 7.5 minutes, fixed with an absorbent pad, and cut into 3-5 mm strips.
(79) The striped membranes were immersed, upright, directly into a well containing 40 L of the nanoparticle suspension, and after 15 minutes added 50 L buffer (50 mM Tris-HCl, 200 mM NaCl. pH 7).
Example 3
(80) This example demonstrates the preparation of the pDNA-Anchor striped card and pDNA fluorescent beads. It also describes a method for the lateral flow evaluation of 9 pDNA affinity ligand pairs.
(81) pDNAAnchor Conjugate Preparation
(82) pDNA oligonucleotides were synthesized on an ABI 3900 automated synthesizer using hexanol solid support. The 4 end of the pDNA was modified with an MMT-C12-amine moiety. The oligonucleotide was deprotected and cleaved from the solid support using ammonium hydroxide then concentrated to remove ammonia. The cleaved oligonucleotide was allowed to detritylate overnight in triethylammonium acetate (pH 5) buffer then purified by reverse phase HPLC using triethylammonium bicarbonate buffer. The fraction containing purified amine-modified pDNA was dried in a Speed Vac concentrator.
(83) Purified amine-tailed pDNA was dissolved in DMSO and treated with phenylene diisothiocyanate (PDITC) and TEA. The crude PDITC-activated pDNA was precipitated using 2% NaClO.sub.4 in acetone, centrifuged, and dried. The product pellet was dissolved in HPLC buffer and purified by reverse phase HPLC and then desalted.
(84) Purified, desalted pDNA-PDITC was reacted with an anchor, which may include proteins, peptides, aminodextrans, amine-containing beads, nucleic acids, or other molecules reactive towards pDNA-PDITC (Urdea et al., 1988; and Hermanson, 1996). Reaction conditions are typically pDNA-PDITC, an aqueous solution of the anchor, and sodium borate (pH 9) buffer; ratios of pDNA-PDITC to anchor can range from approximately 1:1000 to 1000:1, depending on the number of amine groups in the anchor. Reaction mixtures are purified by molecular weight cut-off (MWCO) filters subjected to centrifugation; MWCO filters are chosen as appropriate to the final molecular weight of the product. The retentate of the MWCO filter is washed with water or buffer and quantified by UV-Vis spectroscopy.
(85) pDNAFluorescent Bead Preparation
(86) Each of the biotinylated pDNA oligonucleotides were conjugated with NeutrAvidin-coated polystyrene nanoparticles doped with a fluorescent europium chelate by incubating for 15 minutes 200 L 10 mM Tris-HCl (pH 8), 10 L 5 M biotinylated pDNA, and 20 L 1% (w/v) NeutrAvidin-coated europium chelate-doped nanoparticles. Biotinylated DNA was then added to saturate the Neutravidin binding sites. 20 L of the resulting nanoparticle suspensions were diluted with 775 L buffer (50 mM Tris-HCl, 3% deoxycholate, 1% casein, 1% PEG8000, pH 8).
(87) Negative Control beads were prepared using a DNA-biotin conjugate which saturated the available NeutrAvidin binding sites.
(88) pDNAAnchor Striped Card Preparation
(89) pDNA-PDITCAnchor conjugates are dissolved in triethylammonium bicarbonate buffer at any nucleic acid concentration (typically 100 nM to 500 M) and striped on a nitrocellulose membrane in any density range desired. Striped cards are dried by dessication or in a vacuum oven. Striped cards may be blocked with an appropriate blocking solution, if desired.
(90) pDNA Cross-Reactivity Study
(91) Each of the 9 pairs of pDNA-PDITCAnchors shown in Table 1 was striped individually, then a 4 mm strip was screened using beads of each of the complementary 9-pairs. That is, for each of the pDNA sequences shown in Table 1, the dxay sequence was conjugated to an anchor then striped on the nitrocellulose; the dxay sequence was prepared as a fluorescent bead conjugate. For each dxay sequence, 10 strips were prepared and run with each of the 9 dxay bead (and one control) suspensions to check for non-complementary cross-reactivity.
(92) TABLE-US-00001 TABLE1 pDNAoligopolymersconjugatedtoananchor forattachmenttonitrocellulose. d9a8 CTTCCATT d9b8 AATGGAAG d14a8 TCTCTCAT d14b8 ATGAGAGA d15a8 TGTAGTCA d15b8 TGACTACA d17a9 TTTTTTTTC d17b9 GAAAAAAAA d18a8 CAGATAGA d18b8 TCTATCTG d20a8 ACATCACA d20b8 TGTGATGT d22a8 GTAAGTTG d22b8 CAACTTAC d23a8 CAAGAATC d23b8 GATTCTTG d24a8 GAACAAAC d24b8 GTTTGTTC
Results
(93)
Example 4
(94) This example demonstrates a) the use of a chimera pRNA-pDNA; and b) the detection of a strand displacement amplified amplicon in a nucleic acid lateral flow (NALF) assay.
(95) Strand Displacement Amplification
(96) Mycobacterium tuberculosis (MTB) amplicon was obtained using isothermal Strand Displacement Amplification (SDA) method with the combination of the following primers:
(97) TABLE-US-00002 L1: [SEQIDNO:1] GCATTATAGTACCTGTCTCCTCAGCACTGAGATCCCCT 6a6-E001: [SEQIDNO:2] *CAGTAG-(spacer9)- TTGAATAGTCGGTTACTTCCTCAGCGCGTACTCGACC ForwardBumperPrimer1: [SEQIDNO:3] CGCTGAACCGGAT ReverseBumperPrimer1: [SEQIDNO:4] TGGACCCGCCAAC *pRNAsequenceisshowninbold N.BbvCIAenzymecleavagesitesareunderlined.
(98) Amplifications were performed on samples containing M. tuberculosis target DNA (from strain SBRI10) in 10 l final volume in a Rotor-Gene 3000 thermocycler (Corbett Research). Each sample contained 36 mM K.sub.2HPO.sub.4, pH 7.6, 3.75 mM MgCl.sub.2, 0.25 mM each dNTPs (dATP, dGTP, dCTP and dTTP), 10 ng of human genomic DNA, 50 nM forward primer, 500 nM reverse primer, 50 nM each bumper primer, 4 U Bst DNA polymerase, 4 U BbvC1B (New England Biolabs) diluted in Diluent A (New England Biolabs). After addition of all the above components, including the two enzymes at room temperature, reaction tubes were placed directly in the thermocycler and were incubated at 45 C. for 45 min.
(99) Real-Time Amplification Detection
(100) To ensure specific amplification, the resulting asymmetric amplicon was detected in a real time format using fluorescent detection probe MTB GG1 (TCCGTA*TGGTG-X-FAM, where A* is a super A base and X is an EndoIV linker; [SEQ ID NO:5-FAM]) and Rotor-Gene 3000 real time rotary analyzer (
(101) Immobilization of pRNAs on a Solid Support
(102) pRNA itself does not bind avidly to nitrocellulose. For irreversible binding of pRNA to nitrocellulose. T.sub.20-pRNA chimeric oligonucleotide was used, sequence 6b6 4-CTACTG. Reagents were spotted onto nitrocellulose HF135 (Whatman) in 0.25 l volume, containing 25 pmol of pRNA (amount of each carrier varied). The reagents were allowed to dry for 1 hour. For covalent attachment of T.sub.20, dry spotted nitrocellulose was cross-linked under UV light using a gel transilluminator (300 nm) for 5 min. Nitrocellulose cards were cut into strips and used in NALF assay.
(103) Amplicon Detection in Nucleic Acids Lateral Flow (NALF) Assay
(104) For amplicon detection in NALF assay two biotinilated probes specific for non-coding strand of MTB amplicon were used.
(105) TABLE-US-00003 [SEQIDNO:6] Probe1:Biotin-ATGGTGGATAACG [SEQIDNO:7] Probe2:Biotin-GTGGATAACGTCTT*, whereT*issuperT
(106) Resulting amplicon and a hybridized probe were analyzed in dipstick lateral flow format. Biotinylated amplicons were incubated with Streptavidin-Europium beads for 30 min, diluted in 40 l of NALF buffer (50 mM Tris, 3% sodium deoxycholate, 1% casein, 1% PEG 8000, pH=8.0) and tested in dipstick assay with HF135 nitrocellulose strips with immobilized 6b6 pRNA. 6b6 pRNA is complementary to the pRNA part of 6a6-E001 amplification primer. The results were visualized under UV light (
Example 5
(107) This example demonstrates the detection of amplified target in a NALF format using colored beads.
(108) Detection was performed similarly to the method described in Example 4 and lines were observed visually as shown in
(109) TABLE-US-00004 TABLE 2 Manufacturing description of colorimetric beads used. Color Supplier Catalog Number Description dark blue Bangs Labs DC02B 330 nm 10% solids black Seradyn 41400605020250 226 nm 2.5% solids blue Seradyn 83100720020250 294 nm 2.5% solids red Seradyn 83200720020250 294 nm 2.5% solids
Neutravidin-Coupling Procedure:
(110) 15 mg beads were washed with 100 mM MES buffer (2-(N-morpholino)ethanesulfonic acid, pH 4-5) using centrifugation to isolate beads and resuspended with sonication. Beads were activated using a solution of 1.9 mg EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide) and 0.9 mg sulfo-NHS (N-hydroxysulfosuccinimide) in 1 mL 100 mM MES buffer for 1.5 h at room temperature. The reaction mixture was concentrated by centrifugation and the supernatant removed. To the resulting beads was added 750 L of 0.667 mg/mL Neutravidin in 100 mM MES buffer and reacted overnight. The reaction mixture was washed five times with 2 mM Tris-HCl (pH 7).
Example 6
(111) This example demonstrates the hybridization of pDNA with pRNA.
(112) Melting experiments between pRNA and pDNA strands illustrate the relative stabilities of pRNA and pDNA duplexes. Experimental conditions used are 5 M oligomers in various buffers with an initial elevated temperature to denature the duplexes, then cooled to 5 C. and ramped to 65 or 70 C. at a rate of 0.5 C./min. Oligomers consisted of duplexes of pXNA1-pXNA2, wherein pXNA1 is CAGTAG, and pXNA2 is CTACTG; X denotes pRNA or pDNA strands as detailed in Table 3.
(113) Results in Table 3 show pure pRNA duplexes are substantially more stable than pDNA duplexes, with pRNA hybridizing to pDNA with intermediate stability.
(114) TABLE-US-00005 TABLE 3 The T.sub.m of different pRNA and pDNA duplexes in three different buffers. pRNA- pRNA- pDNA- pDNA- Buffer Composition pRNA pDNA pRNA pDNA 50 mM Tris-HCl 41.9 C. 37.4 C. 36.3 C. 29.5 C. 200 mM NaCl 50 mM NaCl 36.7 C. 33.6 C. 32.0 C. 27.0 C. 20 mM Na-cacodylate 0.5 mM Na.sub.2-EDTA 100 mM NaCl 41.4 C. 37.9 C. 37.1 C. 31.2 C. 10 mM MgCl.sub.2 10 mM Na-PIPES