Highly efficient ethanol-fermentative yeast
10125379 ยท 2018-11-13
Assignee
Inventors
- Yoshiki Tsuchida (Saitama, JP)
- Ikumi Kurihara (Saitama, JP)
- Tomohiro Imai (Saitama, JP)
- Iku Koike (Saitama, JP)
Cpc classification
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N9/1022
CHEMISTRY; METALLURGY
International classification
Abstract
An object of the present invention is to obtain a fermentative yeast having a highly efficient ethanol production without introducing a foreign gene. A further object is to obtain a fermentative yeast that is resistant to proliferation inhibitors such as organic acids, which prevent the growth of the fermentative yeast. Yeast having improved ethanol production ability was generated by introducing transaldolase and alcohol dehydrogenase gene by self-cloning to Meyerozyma guilliermondii that can produce ethanol effectively from pentose and hexose obtained by breeding. This fermentative yeast is deposited to NITE Patent Microorganisms Depositary under the accession number NITE ABP-01976.
Claims
1. A highly efficient ethanol-fermentative yeast, the ethanol-fermentative yeast effectively producing ethanol from pentose and hexose, wherein the ethanol-fermentative yeast is yeast in which transaldolase gene and alcohol dehydrogenase gene are introduced by self-cloning into a fermentative yeast deposited to National Institute of Technology and Evaluation (NITE) Patent Microorganisms Depositary under the accession number NITE BP-01964 and wherein the ethanol-fermentative yeast is capable of exhibiting equivalent ethanol production abilities by using either of a slurry and a clear liquid, and conducting ethanol production with rice straw or corn stover as biomass, and deposited to NITE Patent Microorganisms Depositary under the accession number NITE ABP-01976.
2. An ethanol-fermentative yeast deposited to National Institute of Technology and Evaluation (NITE) Patent Microorganisms Depositary under accession number NITE ABP-01976.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
DESCRIPTION OF EMBODIMENTS
(5) The yeast strain according to the present invention is described below.
EXAMPLES
(6) 1. Isolation of Strain
(7) Strains having high ethanol production ability were selected by breeding of the parent strain (the strain N) of Meyerozyma guilliermondii using a sugar solution derived from rice straw. Rice straw from Kumagaya, Japan was immersed in an equal amount of a 25% ammonium solution at 80 C. for 3 hours and then ammonia was allowed to be evaporated. The pH of the treated biomass was adjusted to 4 with 10% NaOH solution and then Acremonium cellulase (manufactured by Meiji Seika Pharma Co., Ltd.) was added to conduct enzymatic saccharification at 50 C. for 72 hours. The solid-liquid separation of the produced slurry was conducted by filter-pressing to collect the liquid. Using this liquid (hereinafter, also referred to as clear liquid), habituation in culture was conducted with addition of a mutagen for 19 months and strains with improved fermentation performance were selected. Strains having improved fermentation performance were selected based on the amount of ethanol produced after a certain period of time. Yeast strain with high fermentation performance was deposited to NITE Patent Microorganisms Depositary, National Institute of Technology and Evaluation (Independent Administrative Institution) under the accession number NITE BP-01964 on Nov. 19, 2014 (accession date).
(8) It has been confirmed, although it is not shown here, that the yeast strain BP-01964 is a strain that produces ethanol more than twice as much as the wild type (the strain N) does and that, not only the ability to utilize glucose, which is C6, but also the ability to utilize xylose, which is C5, is improved.
(9) Next, transaldolase and alcohol dehydrogenase genes were introduced to the yeast strain BP-01964 by self-cloning to obtain yeast having further improved ethanol production ability.
(10) Fermentation inhibitors such as organic acids, aldehyde, and phenol are produced as by-products when a liquid of rice straw treated with ammonia was used and treated with a saccharification enzyme to obtain a sugar solution. In particular, acetic acid is present at a very high concentration of about 1,000 mg/L and reduces the fermentation yield. Therefore, by suppressing the inhibition of fermentative yeast growth with acetic acid, the ethanol production efficiency can be further improved.
(11) Transaldolase is an enzyme that catalyzes metabolism from sedoeptulose-7-phosphate (S7P) and glyceraldehyde-3-phosphate (GAP) to erythrose-4-phosphate (E4P) and fructose 6-phosphate (F6P) in the pentose phosphate pathway, which is branched from the glycolysis. It has been confirmed that introduction of this enzyme increases the ethanol yield in the presence of acetic acid, an inhibitor.
(12) The xylose reductase promoter was ligated in the upstream of the transaldolase. This is because transaldolase is considered to work efficiently when using the promoter of xylose reductase that functions in the xylose utilization.
(13) Alcohol dehydrogenase is an enzyme that can produce ethanol from acetaldehyde and that can convert aldehyde contained as an inhibitor in a rice straw sugar solution obtained by treating a liquid of ammonia-treated rice straw with a saccharification enzyme into ethanol to reduce its toxicity. Alcohol dehydrogenase produces NAD.sup.+ when it is NADH-dependent as well as serves to convert acetaldehyde into ethanol. Therefore, it serves to enhance the effect of NAD.sup.+-dependent xylitol dehydrogenase.
(14) The GAPDH promoter was ligated in the upstream of the alcohol dehydrogenase. Since the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) prompter is a strong promoter that functions in the glycolysis, it is considered to be an efficient promoter for use as a promoter of alcohol dehydrogenase, which is an enzyme in the glycolysis.
(15) Therefore, generation of a recombinant fermentative yeast into which the 2 enzymes are introduced by genetic introduction can be expected to produce yeast having higher ethanol production ability.
(16) The genetic introduction was conducted by the following procedure. Amplify the gene to be introduced and a terminator region thereof (hereinafter, referred to as gene+terminator region) by PCR Amplify a promoter region to be used for the introduction by PCR These should be both amplified by PCR from the chromosomes of the strain of Meyerozyma guilliermondii used in the present invention.
(17) Clone the DNA fragments amplified by PCR into a commercially available vector for Escherichia coli by infusion in the order of promoter, gene+terminator region. Transform Escherichia coli with the cloned vector and amplify the vector. Obtain DNA fragments for homologous recombination by cutting out the promoter and gene+terminator region from the amplified vector with restriction enzymes or amplifying the promoter and gene+terminator region from the amplified vector by PCR
(18) The xylose reductase promoter was amplified with the following primers of SEQ ID NO: 1 and SEQ ID NO: 2 and the transaldolase gene and the terminator region were amplified with the following primers of SEQ ID NOs: 3 and 4.
(19) TABLE-US-00001 SEQIDNO:1: AAGGCTTGGGAACTTTCTTT SEQIDNO:2: AGCAATTGATGATTAATTTT SEQIDNO3: ATGACCAATTCTCTTGAACA SEQIDNO4: AAATTGTGCCGTGTCAAACT
(20) Specifically, the GAPDH prompter was amplified with the primers of the following SEQ ID NO: 5 and SEQ ID NO: 6 and the alcohol dehydrogenase gene and the terminator region were amplified with the primers of the following SEQ ID NOs: 7 and 8.
(21) TABLE-US-00002 SEQIDNO:5: GTTGTAGCGGAGGCTCAATT SEQIDNO:6: TGTATAATTTAAATGTGGGT SEQIDNO:7: ATGTCAATTCCAGAATCCAT SEQIDNO:8: CACCTTGGCTGGAAGTGCTG
(22) The homologous recombination of the obtained DNA fragments into the yeast strain was performed to obtain desired strains. Electroporation was used for the homologous recombination. The DNA fragments for the homologous recombination were the xylose reductase promoter, transaldolase+terminator, the GAPDH promoter, and alcohol dehydrogenase+terminator, in this order. Moreover, while the strains obtained by this method comprise an introduced gene, they belong to a category to be treated as a non-modified yeast under the Cartagena Act because it is self-cloned.
(23) Yeast having high ethanol production ability was isolated from the yeast strains in which genes have been introduced and deposited to NITE Patent Microorganisms Depositary to obtain the accession number NITE ABP-01976. The gene expression and the fermentation yield in the recombinant yeast in which genes were introduced were examined.
(24) The expression of the transaldolase gene was analyzed by real-time PCR A PCR apparatus (Applied Biosystems) and SYBR Green Master Mix (Applied Biosystems) were of SEQ ID NOs: 9 and 10 were used.
(25) TABLE-US-00003 SEQIDNO9: GGCGAGAAACACCCTCCAT SEQIDNO10: CATTGGCCCTTTCCACCAT
(26) As illustrated in
(27) The ethanol production ability was analyzed using corn stover sugar solution. A saccharified liquid obtained by treating corn stover with dilute sulphuric acid and adjusting pH to 5.2 was used and a liquid culture of the yeast strain was added so that the OD.sub.600 of the medium became 2.0. The amount of ethanol in the culture liquid after culturing at 30 C. for 96 hours was indicated. Glucose in the saccharified solution was 63.2 g/L and xylose was 34.5 g/L. Ethanol was measured using GC-FID (manufactured by GL Sciences Inc.: GC390B). The result is shown in
(28) 2. Properties of the Yeast Strain
(29) 2.1 Fermentation Yield
(30) Fermentation tests of the parent strain and the strain of the present invention were conducted. Plural enzymatically saccharified solutions having different sugar concentrations derived from corn stover treated with dilute sulphuric acid and adjusted to pH 6 were used and a liquid culture of the yeast strain was added so that the OD.sub.600 of the medium became 2.0. The concentrations of ethanol obtained after culturing at 30 C. for 96 hours and the fermentation yields calculated from the sugar concentration of the used saccharified solution were plotted. The result is shown in
(31) As shown in
(32) 2.2 Examination of Xylose Utilization Ability
(33) Next, rice straw was treated with an ammonium aqueous solution in a similar way to the ammonia treatment described above and then Acremonium cellulase was added to conduct enzymatic saccharification at 50 C. for 72 hours. Fermentation was conducted using the produced slurry.
(34) The slurry fermenter has a jacket structure and the temperature was regulated by the circulation of warm water through the jacket part. Air ports are provided at the bottom and fermentation was conducted with continuously providing a predetermined amount of filtered air through the air ports at the bottom with agitation with impellers coupled with a motor.
(35) The change over time in amount of glucose, xylose, and ethanol contained in the slurry was analyzed. Glucose and xylose were measured by sampling and centrifuging the slurry and measuring the resultant supernatant by HPLC. Ethanol was measured using GC-FID (manufactured by GL Sciences Inc.: GC390B) as described above. The result is shown in
(36) Glucose, which is C6, is consumed earlier, but as glucose in the slurry decreases, xylose, which is C5, is consumed to produce ethanol. Since the obtained yeast comprises both C5 and C6 utilization abilities, it can produce ethanol efficiently. Therefore, it is a strain that is also useful in industrial production.
(37) 2.3 Slurry Fermentation Ability, Clear Liquid Fermentation Ability
(38) Yeast that efficiently carries out fermentation both with slurry and with clear liquid in the bioethanol production is preferred. Therefore, the fermentation yields with slurry and with clear liquid were compared. The fermentation yield is calculated by the following equation.
Fermentation yield=amount of obtained ethanol (g/L)/amount of glucose+xylose contained in sugar solution at the onset of fermentation (g/L)/0.5114
(39) As illustrated in
(40) The strain ABP-01976 has xylose utilization ability enhanced by breeding of the wild type Meyerozyma guilliermondii and can effectively produce ethanol both when using rice straw and when using corn stover as biomass, as described in the foregoing.
(41) As described in the foregoing, a strain having xylose utilization ability enhanced by breeding of the wild type Meyerozyma guilliermondii and high ethanol production ability due to genetic recombination was obtained. Furthermore, the strain can effectively produce ethanol both when using rice straw and when using corn stover as biomass.
(42) TABLE-US-00004 0-1 Form PCT/RO/134 (SAFE) This indication relating to deposited microorganism(s) or other biological material (PCT Rule 13 bis) is 0-1-1 prepared using: JPO-PAS i221 0-2 International Application No. 0-3 Applicant's or agent's file reference PCT140401 1 The indications made below relate to the deposited microorganism(s) or other biological material referred to in the description on: 1-1 paragraph 0021 1-3 Identification of deposit 1-3-1 Name of depositary institution NPMD National Institute of Technology and Evaluation (Independent Administrative Institution), Patent Microorganisms Depositary (NPMD) 1-3-2 Address of depositary institution 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba 292-0818, Japan 1-3-3 Date of deposit Nov. 19, 2014 (19.11.2014) 1-3-4 Accession Number NPMD NITE BP-01964 1-5 Designated states for which indications are all designations made 2 The indications made below relate to the deposited microorganism(s) or other biological material referred to in the description on: 2-1 paragraph 0024 2-3 Identification of deposit 2-3-1 Name of depositary institution NPMD National Institute of Technology and Evaluation (Independent Administrative Institution), Patent Microorganisms Depositary (NPMD) 2-3-2 Address of depositary institution 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba 292-0818, Japan 2-3-3 Date of deposit Dec. 4, 2014 (04.12.2014) 2-3-4 Accession Number NPMD NITE ABP-01976 2-5 Designated states for which indications are all designations made
For Receiving Office Use Only
(43) TABLE-US-00005 0-4 This sheet was received with the international application: (yes or no) 0-4-1 Authorized officer
For International Bureau Use Only
(44) TABLE-US-00006 0-5 This sheet was received by the International Bureau on: 0-5-1 Authorized officer