USE OF VLP FOR THE DETECTION OF NUCLEIC ACIDS
20180320199 ยท 2018-11-08
Assignee
Inventors
Cpc classification
C12N2710/22042
CHEMISTRY; METALLURGY
C07K14/025
CHEMISTRY; METALLURGY
C12N2710/14143
CHEMISTRY; METALLURGY
C12N2810/40
CHEMISTRY; METALLURGY
C12N2710/22022
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N15/86
CHEMISTRY; METALLURGY
C07K14/025
CHEMISTRY; METALLURGY
Abstract
A method of using a virus-like particle from a polyomavirus having a first nucleic acid as a cargo to detect a second nucleic acid. The method includes providing the virus-like particle from the polyomavirus having the first nucleic acid as the cargo, and detecting, via the virus-like particle from the polyomavirus, the second nucleic acid.
Claims
1-31. (canceled)
32. A method of using a virus-like particle from a polyomavirus comprising a first nucleic acid as a cargo for the detection of a second nucleic acid, the method comprising: providing the virus-like particle from the polyomavirus comprising the first nucleic acid as the cargo; and detecting, via the virus-like particle from the polyomavirus, the second nucleic acid.
33. The method of using as recited in claim 32, wherein, the first nucleic acid comprised in the virus-like particle is used as a standard or as a control.
34. The method of using as recited in claim 32, wherein the first nucleic acid comprised in the virus-like particle and the second nucleic acid to be detected comprise a same sequence.
35. The method of using as recited in claim 32, wherein the second nucleic acid to be detected is a viral nucleic acid in a sample.
36. The method of using as recited in claim 35, wherein the sample is selected from blood, plasma, a cerebrospinal fluid, urine, saliva, lymph, sweat, and feces.
37. The method of using as recited in claim 32, wherein the polyomavirus is the human polyomavirus John-Cunningham virus (JCV).
38. The method of using as recited in claim 32, wherein the first nucleic acid comprised in the virus-like particle has a minimum length of 5 bp.
39. The method of using as recited in claim 32, wherein the first nucleic acid is at least one of a single-stranded DNA, a double-stranded DNA, a single-stranded RNA, a double-stranded RNA, and siRNA.
40. The method of using as recited in claim 32, wherein the first nucleic acid comprised in the virus-like particle is a polyomavirus nucleic acid or a heterologous nucleic acid.
41. The method of using as recited in claim 32, wherein, the virus-like particle further comprises a fusion protein comprising a VP1 binding protein and an exogenous peptide, and the exogenous peptide comprises at least one of a cargo-securing peptide (CSP) and an endosome translocating peptide (ETP).
42. The method of using as recited in claim 41, wherein the VP1 binding protein is VP2 or VP3.
43. The method of using as recited in claim 41, wherein the exogenous peptide forms at least one of the C-terminus and the N-terminus of the fusion protein.
44. The method of using as recited in claim 41, wherein, the fusion protein comprises at least one exogenous CSP and at least one exogenous ETP, the CSP being a cargo binding peptide (CBP) with a percentage of arginine residues of at least 25 and/or the amino acid sequence of the CBP has an identity of at least 80% to SEQ ID NO: 4 or SEQ ID NO: 5, and the endosome translocating peptide (ETP) is a cell penetrating peptide (CPP) and the amino acid sequence of the CPP has a percentage of nonpolar amino acids of at least 25 and/or the amino acid sequence of the CPP has an identity of at least 80% to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.
45. The method of using as recited in claim 32, wherein, the virus-like particle further comprises a VP1 fusion protein with a first peptide and a second peptide, the first peptide is VP1 or a fragment of VP1, the second peptide comprises a targeting region, a first interaction region and a second interaction region, the second peptide is located on the surface of the fusion protein, the second peptide comprises at least two interaction pairs, wherein an interaction pair is formed by an amino acid of the first interaction region and an amino acid of the second interaction region, the interaction region between the amino acid of an interaction pair is covalent or non-covalent, and at least one interaction pair is a covalent interaction pair in which the amino acids are covalently bound.
46. The method of using as recited in claim 32, wherein the virus-like particle further comprises an additional cargo selected from single-stranded DNA, double-stranded DNA, single-stranded RNA, double-stranded RNA, siRNA, oligopeptides, polypeptides, hormones, lipids, carbohydrates, other small organic compounds, or mixtures thereof.
47. A method of using a virus-like particle for the treatment or the diagnosis of a disease, the method comprising: providing the virus-like particle as recited in claim 32; and using the virus-like particle to treat or diagnose the disease.
48. A method for the detection of a nucleic acid in a sample, the method comprising: providing the virus-like particle as recited in claim 32; providing the sample; mixing the virus-like particle with the sample; isolating the nucleic acid from the sample; and detecting the nucleic acid isolated from the sample.
49. The method as recited in claim 48, wherein a specific amount of the virus-like particle is mixed with the sample.
50. The method as recited in claim 48, wherein the first nucleic acid comprised in the virus-like particle is used as a standard or as a control.
51. The method as recited in claim 48, wherein the isolated nucleic acid is detected by a polymerase chain reaction (PCR).
Description
BRIEF DESCRIPTION OF THE FIGURES
[0249]
[0250]
[0251]
[0252]
[0253]
[0254]
[0255]
[0256]
[0257]
[0258]
[0259]
[0260]
[0261]
EXAMPLES
Example 1: Production of VLPs with VP2/VP3 Fusion Proteins
[0262] I. Cloning of VP1 and VP2 Fusion Protein Coding Nucleotides into pFastBacDual.VP1VP2coHA Vector
[0263] Oligonucleotides (Life Technologies) Used in the Cloning:
TABLE-US-00001 L2sense: (SEQIDNO:59) CCATATTTTTTTACAGATGTCCGTGTGGCGGCCTGAGCGGCCGCTTTC L2antisense: (SEQIDNO:60) AAAACGTTTACGCCTGCGACGTAAAATAAAGTCGACAGCGTAATCTGG L2DD447antisense: (SEQIDNO:61) AAAACGTTTACGCCTGCGACGTAAATCATCGTCGACAGCGTAATCTGGA Tatsense: (SEQIDNO:62) CGCCGTCCACCCCAAAAGCGCAAGGGCTGAGCGGCCGCTTTC Tatantisense: (SEQIDNO:63) ACGTTGGCGACGCTTCTTGCGCCCGTCGACAGCGTAATCTGGAAC Penetratinsense: (SEQIDNO:64) AATCGACGAATGAAATGGAAAAAATGAGCGGCCGCTTTC Penetratinantisense: (SEQIDNO:65) TTGAAACCAGATTTTGATTTGTCGGTCGACAGCGTAATCTGGAAC HISsense: (SEQIDNO:66) CATCACCATTGAGCGGCCGCTTTC HISantisense: (SEQIDNO:67) GTGATGATGGTCGACAGCGTAATCTGGAAC pFastBacDual.VP1_VP2coHA (SEQIDNO:68)
[0264] Before the PCR the primers were phosphorylated 20 min at 37 C. and 10 min at 75 C. in the following reaction set up:
[0265] 10 l primer (10 M)
[0266] 2 l buffer A
[0267] 2 l 10 mM dATP
[0268] 10 U T4 polynucleotidkinase (Fermentas)
[0269] ad 20 l bidest
[0270] The following PCR mixture was prepared:
[0271] 31 l bidest
[0272] 10 l 5 buffer Q5 (NEB)
[0273] 5 l dNTPs
[0274] 1 l pFastBacDual.VP1_VP2coHA (50 ng)
[0275] 1 l sense primer
[0276] 1 l antisense primer
[0277] 1 l Q5 polymerase
[0278] For PCR, the following temperature profile was used: An initial activation at 98 C. for 30 sec followed by 35 repetitions of the following cycle steps 1 to 3: 1) Denaturation: 98 C. for 10 seconds; 2) Annealing: 60 C. for 30 seconds; and 3) Extension: 72 C. for 5 min. After the temperature cycling, the samples were again kept at 72 C. for 10 min until the samples were retrieved.
[0279] PCR samples were separated by agarose gel electrophoresis and fragments of about 7400 bp were eluted using the QiaEx Kit (Qiagen) with the modification that the elution was performed with 30 l of 70 C. buffer 4 (NEB). The eluted samples were subsequently incubated with 2 l DpnI (digest of methylated template plasmid DNA) for 2 h at 37 C. followed by an additional 20 min at 80 C. for inactivation of the DpnI. Afterwards the PCR fragments were religated to using the T4 ligase.
[0280] The plasmids were then transformed into competent DH5a bacteria by thermal shock and selection of recombinant clones by growth on Ampicillin agar plates.
[0281] The DNA of the recombinant clones was prepared and analysed using restriction analysis with SalI. Clones with correct restriction pattern were sequenced.
II. Generation of Recombinant Baculovirus
[0282] The baculoviruses were generated using the Bac-to-Bac system (Invitrogen). For details of the protocol it is referred to the Bac-to-Bac manual. The protocol includes the following steps a to f:
[0283] a) Transformation of DH10 bacteria with corresponding pFastBacDual construct
[0284] b) Isolation and PCR analysis of recombinant bacmid
[0285] Oligonucleotides:
TABLE-US-00002 Puc/M13-BACfor FW CCCAGTCACGACGTTGTAAAACG (SEQIDNO.69) Puc/M13-BACrev RW AGCGGATAACAATTTCACACAGG (SEQIDNO.70)
[0286] c) Transfection of Sf9 with recombinant bacmid
[0287] d) Production of recombinant baculovirus
[0288] e) Western blot analysis of protein expression
[0289] Western Blot (VP1 and VP2/3 fusion protein) was performed using mouse monoclonal VP1 antibody (254C7E4) and mouse monoclonal HA antibody (12CA5) for detection of VP2/VP3coHA
[0290] f) qPCR analysis of P3 supernatants (number of bacmids)
[0291] The following qPCR mixture was prepared:
[0292] 10 l 2 DynNAmo HS SYBR Green Mix (Thermo)
[0293] 7 l bidest
TABLE-US-00003 1lP3fwprimer (SEQIDNO:71) TGACATGCTGCCCTGCTACT 1lP3rwprimer (SEQIDNO:72) GCAAGTCAGGTCCTCGTTCAG
[0294] 1 l template
[0295] The template was either a recombinant Baculovirus, a standard (purified bacmid) or bidest H.sub.2O.
[0296] For qPCR, the following temperature profile was used: An initial activation at 95 C. for 10 min followed by 35 repetitions of the following cycle steps 1 to 3: 1) Denaturation: 95 C. for 10 seconds; 2) Annealing: 60 C. for 20 seconds; and 3) Extension: 72 C. for 30 sec. After the temperature cycling, the samples were again heated to 95 C.
III. Expression of Recombinant Proteins in Sf9 and Production of EPN
[0297] a) Protein Expression
[0298] Sf9 were grown to a cell density of 210.sup.7 in serum-free TC100 medium and infected with the recombinant baculovirus with a multiplicity of infection (MOI) of 5. After infection the cells were grown for 5 to 7 days at 27 C. producing the corresponding protein encoded by the baculovirus. The produced protein is secreted into the expression medium. In the cell supernatant the secreted proteins self-assemble into VLPs.
[0299] b) Purification of VLPs from the Supernatant
[0300] Sf9 cells were separated from the supernatant by centrifugation for 5 min at 500g. Cells were discarded and the supernatant was centrifuged a second time for 90 min at 5000g in order to remove larger impurities.
[0301] The VLPs were then separated by ultracentrifugation. For this, 15 ml of clarified supernatant was loaded on 3 ml 40% sucrose.
[0302] Ultracentrifugation was performed in a Sorwall MX150 for 4 h at 100000g and 4 C. In the centrifugation tube a pellet formed by the VLPs which was harvested. The VLP containing pellet was resuspended in Tris buffer (10 mM Tris, 150 mM NaCl, pH 7.5) The protein concentration of the resuspended VLPs was determined and adjusted to 0.5 g/1 by the addition of Tris-Buffer.
IV. Analysis
[0303] a) Analysis of the Particle Assembly
[0304] 1. Hemagglutination Assay (HA) to Analyze VLP's Activity
[0305] The quality and quantity of EPN preparation was visualized by hemagglutination of red blood cells. VLPs attach to molecules present on the surface of red blood cells (RBCs). A consequence of this is that at certain concentrations, the VLP suspension may agglutinate the RBCs, thus preventing the RBCs from settling out of suspension. For visualization 96 well U-bottom plates are used. The hemagglutination assay was performed in 96-well U-bottom plates (Greiner). In the wells of the plate settling out of the red blood cells can be recognized by a dark red central spot formed by the red blood cells at the bottom of the tube.
[0306] Human O type red blood cells were briefly centrifuged at 500g for 10 min. Red blood cells were then washed twice and resuspended in Alsever's buffer (27 mM sodium citrate, 70 mM NaCl, 100 mM glucose, 2.6 mM citric acid). Serial twofold dilutions of VLPs were prepared in Alsever's buffer in a volume of 50 l. 50 l of red blood cells were added into each well and mixed. Plates were incubated for 2 h at 4 C. An example of a Hemagglutination assay test plate is shown in
[0307] 2. Transmission Electron Microscopy
[0308] For electron microscopy VLP preparations were loaded on 400 mesh copper grids with carbon film (Science Services) and negatively stained with uranyl acetate (2%). Pictures were taken with a ZEISS 922 TEM. An exemplary image of a VLP sample is shown in
[0309] b) Expression and Purity
[0310] Presence of recombinant viral proteins was again monitored by Western Blot analysis and the purity of VLP preparations by protein staining using InstantBlue dye (Fa. Expedeon).
[0311] c) Analysis of the Incorporation of VP2 Fusion Proteins into VP1 Pentamers
[0312] 5 g of the VLP to be tested were dissociated in 100 l Dissociation buffer (10 mM Tris-HCl, 150 mM NaCl, 5 mM DTT, 10 mM EDTA) by incubation for one hour at 25 C. and 600 rpm shaking. DynabeadsMagneticBeads (LifeTechnologies) were resuspended for 10 min. 0.3 g Dynabeads in 10 l per sample were transferred into a reaction tube. The tubes were put into the magnetic part and the supernatants of the Dynabeads were discarded. 100 l PBS/Tween 0.02% were added together with 0.5 g of precipitating antibody (mouse monoclonal HA antibody 12CA5). The same experimental set up without antibody served as negative control for each antibody. The reaction mixture was tested incubated for 10 min at room temperature (RT). The tubes were put into the magnetic part and supernatants were discarded. The magnetic beads were washed with 100 l PBS/Tween 0.02%. The VLP samples were added to the reaction tube in a volume of 100 l and incubated at least 10 min at RT. The tubes were put into the magnetic part and supernatants were discarded. The beads were washed three times with PBS/Tween 0.02%. The beads-antibody-VP2/3coHA complexes were resuspended in 100 l PBS and transferred into new reaction tubes. The reaction tubes were put into the magnetic part and supernatants were discarded. Beads-antibody-VP2/3coHA complexes were resuspended in 2SDS loading buffer and heated for 5 min at 5 min at 95 C. The tubes were put into the magnetic part and supernatants were harvested. VP1 co-immunoprecipitation was tested by Western blot analysis using mouse monoclonal VP1 antibody 254C7E4.
[0313] d) Analysis of the Incorporation of VP2/VP3 Fusion Proteins
[0314] To investigate the incorporation of minor capsid proteins in VLPs, 300 g of EPN preparations were loaded onto 3 ml of a sucrose step gradient (10-50%, 5 steps a 600 l). Gradients were centrifuged at 36.000 rpm and 4 C. for 35 min in a S50ST rotor. After ultracentrifugation, 300 l fractions were harvested from the top of each gradient. Subsequently, 30 l of each fraction were tested either for the presence of VP1 or VP2/VP3coHA by Western blot analysis.
Example 2: Intracellular Localization of VLPs with VP2/ETP Fusion Proteins
I. Localization of VLPs in COS7 Cells
[0315] a) Production and Assembly of VLPs
[0316] The following four types of VLPs are expressed and assembled according to the protocol of example 1: [0317] 1) A VLP only consisting of VP1, [0318] 2) A VLP consisting of VP1 and VP2, [0319] 3) A VLP consisting of VP1 VLP and a VP2 fusion protein with a C-terminal penetratin peptide (SEQ ID NO: 13), and [0320] 4) A VLP consisting of VP1 VLP and a VP2 fusion protein with a C-terminal His-tag (SEQ ID NO: 16).
[0321] b) Internalization of VLPs
[0322] COS7 cells were inoculated into the culture medium DMEM+ (10% FCS, 1% penicillin/streptomycin) and grown on cover slips in a 24 well plaid at 37 C. Upon reaching a cell density 510.sup.4 cells/well, 10 g of a VLP is added to the cell culture medium and the cells are further incubated for 24 hours at 37 C. After the incubation, the cells are washed three times with 1PBS and fixed with 150 l methanol at a temperature of 20 C.
[0323] c) Antibody Labelling of the VLPs in the Cells
[0324] The cells were then washed two times with 1 ml 1PBS.
[0325] After the second wash-step, 1 Roti-Immunobloc (Fa. Roth) was added in a volume of 1 ml to each well. The cells were incubated with the blocking buffer for 30 minutes at room temperature (RT).
[0326] Primary Antibody
[0327] A mouse anti-VP1 antibody (254C7E4) or a rabbit polyclonal anti-VP1 antibody at a concentration of 0.5 g/ml was diluted 1:100 in 1 Roti-Immunobloc. 50 l of the antibody solution was added to the cells, and incubated for one hour at room temperature (RT). The cells were then washed three times with 1PBS/Tween 0.1%. For washing about 1 ml of the PBS/Tween mixture is added to the cells and removed again from the cells.
[0328] Secondary Antibody
[0329] An anti-mouse, anti-rabbit Ig-Alexa546 (Life Technologies) was diluted 1:1000 in 1 roti-immunobloc and 50 l of the antibody solution are added to the cells. The cells are incubated with the secondary antibody for one hour at room temperature.
[0330] d) Fluorescent Microscopy
[0331] Afterwards, the cells are washed again three times with 1PBS/0.1% (v/v) Tween. The cells on cover slips were then mounted on a slide using ProlongGold anti-fade reagent+DAPI (from Molecular Probes) to counterstain cell nuclei. The preparations were finally analyzed with the Nikon Eclipse TS 100-F microscope and pictures were taken with the corresponding NIS software.
[0332] The results are shown in
[0333] In the images, the cells are visible as light grey structures before a black background. Light grey or white structures within the cells represent areas with a high concentration of VLP. Darker areas contain low concentrations of VLP. The VLP concentration is proportional to the intensity of the signal. There is an obvious difference between the pictures of the two left panels and the two right panels.
[0334] In the two left panels representing the results of VLPs with only VP1 or VP1 and wild type VP2, a variety of bright spots are visible. In contrast, light grey areas, that means areas with a high signal, are more evenly distributed in the cells or in the two right panels which represent the results of VP2 fusion proteins. Moreover, in the two right panes very few bright spots are found.
[0335] An explanation of this result is that the VLPs consisting of VP1 only or VP1 and wild type VP2 are mainly located within the endosomes. The high concentration of VLPs within the endosomes leads to fluorescence spots of very high intensity. Thus, the majority of the proteins is not able to leave the endosomal pathway.
[0336] On the other hand, the VLPs with VP2 fusion proteins VP2-penetratin (VP2-PENp) or his-tagged VP2 (VP2-HISp) and accordingly the fluorescence signals of these VLPs are evenly distributed in the cell because the VLPs are able to leave the endosomal pathway and a lower percentage of the VLPs is trapped in the endosomal pathway.
II. Localization of VLPs in HeLa Cells
[0337] The internalization of VLPs in HeLa cells was tested using the same protocol as described under Example 1 I. for COS7 cells. The following VLP constructs were used: [0338] 1) A VLP only consisting of VP1, [0339] 2) A VLP consisting of VP1 and a VP2 fusion protein with C-terminal penetratin peptide (SEQ ID NO: 13), and [0340] 3) A VLP consisting of VP1 and a VP2 fusion protein with C-terminal His-tag (SEQ ID NO: 16).
[0341] The results are shown in
[0342] Again, light grey areas are more evenly distributed in the cells or in the central and right panel which represent the results of VP2-fusion proteins while in the HeLa cells infected with VLPs with only (left panel) several bright spots are visible. Accordingly, also in HeLa cells the VLPs consisting of VP1 only are mainly located within the endosomes and the VLPs with VP1 and the VP2-fusion proteins (VP2-PENp or VP2-HISp) spread out in the cells.
III. Localization of VLPs in TC620 Cells
[0343] The experiment of Example 2 I. and II. was repeated with TC620 cells and two VLP constructs: 1) VP1 and 2) VP1 and VP2-L2DD447 fusion protein.
[0344] In contrast to the protocol described in Example 2 I. the cells were fixed with 4% PFA, and stained for membranes with wheat germ agglutinin (WGA). Pictures were taken with a Zeiss LSM from the top to the bottom of the cells.
[0345]
[0346] The section images of the cells infected with VP1/VP2-L2DD447-VLP show a much higher fluorescent signal throughout the cell as compared to the cells infected with VP1. Accordingly, a higher number of VP1/VP2-L2DD447-VLPs
Example 3: Packaging of DNA Using VLP with VP2/VP3 Fusion Proteins
[0347] VLPs formed by the following proteins were used for the packaging test: wild type VP1 (VP1), wild type VP1 and VP2 (VP1_VP2), wild type VP1 and VP3 (VP1_VP3), wild type VP1 and VP2 with an N-terminal GFP fusion tag (VP1_GFP-VP2), wild type VP1 and VP3 with an N-terminal GFP fusion (VP1_GFP-VP3), VP1 wild type and VP2 with a C-terminal GFP (VP1_VP2-GFP), wild type VP1 and VP3 with a C-terminal GFP (VP1_VP3-GFP), wild type VP1 and VP2 with a C-terminal protamine-1 (VP1_VP2-PRTM), wild type VP1 and VP3 with a C-terminal protamine-1 (VP1_VP3-PRTM).
[0348] a) VLP Production
[0349] VLPs from the above identified proteins were produced according to the protocol of example 1.
[0350] b) Packaging of the DNA
[0351] DNA is packaged into the VLPs by a dissociation of the VLPs and reassociation in the presence of the DNA.
[0352] 25 g of the VLP are solved in 100 l TRIS buffer (10 mM Tris-HCl, 150 mM NaCl, 5 mM DTT, 10 mM EDTA) and incubated for one hour at 25 C. and 600 rpm shaking. Afterwards, 5 g DNA (pG14.51, #42) in water were added to the VLP solution and the protein/DNA mixture was incubated for one hour at room temperature to allow a binding of the VLP proteins to the DNA.
[0353] For reassociation, the VLP DNA mixture was transferred to 100 l dialysis cassettes (Thermo Scientific) and the dialysis cassette was placed into a TRIS buffer as defined above with additional 1 mM CaCl.sub.2. At a temperature of 4 C., the dialysis was allowed to happen for 72 hours. After this time period, the buffer was exchanged against a Glutathion buffer.
[0354] Composition of the Glutathion buffer:
[0355] 10 mM TRIS, pH 7.5
[0356] 150 mM NaCl
[0357] 1 mM CaCl.sub.2
[0358] 4.5 mM GSSG (glutathione ox., Firma Roth)
[0359] 0.5 mM GSH (glutathion red., Firma Roth)
[0360] The dialysis cassettes were stored in 100 ml of this buffer for 24 hours at 4 C.
[0361] c) DNAse Treatment of VLPs
[0362] After reassociation, VLP samples were divided in halves and one half was treated with DNase I (Fermentas). For DNase treatment, 50 units DNAseI and 6 mM MgCl.sub.2 were added to the sample and incubated for 1 hour at 37 C. in a micro test tube (Eppendorf).
[0363] d) Recovery of Packaged DNA
[0364] For recovery, at first the VLPs are digested. Thus, 40 l of packaging samples with or without DNaseI treatment were incubated in 500 l LP buffer and 50 l 10% SDS (w/v) for one hour at 56 C.
[0365] Composition of the LP buffer:
[0366] 10 mM TRIS, pH 8.2,
[0367] 400 mM NaCl
[0368] 2 mM EDTA
[0369] 0.3 mg/ml proteinase K.
[0370] After one hour of incubation, 500 l roti-phenol (Fa. Roth) were added, mixed thoroughly and centrifuged at 11,000 g for 10 minutes. After centrifugation, the water-soluble upper phase was transferred into a new micro test tube and mixed with 500 l chloroform. The resulting mixture was incubated for one hour at 4 C. wherein the tube was constantly rolled. After incubation, the mixture was centrifuged again for 10 minutes at 11,000 g. Again, the water-soluble upper face was transferred to a new tube and mixed with 500 l 2-propanol at a temperature of 20 C. and 50 l of a 5 M NaCl solution. The resulting mixture was incubated for one hour at 20 C. without shaking. The mixture was then centrifuged for 30 minutes at 4 C. and 11,000 g. After centrifugation, the liquid was decanted leaving a pellet at the bottom of the tube. The pellet was washed with 500 l 70% (v/v) ethanol, dried and finally resuspended in 35 l bi-distillated H.sub.2O. The resuspended DNA was then stored at 20 C.
[0371] e) Quantification of the Recovered DNA by q-PCR Analysis.
[0372] PCR was performed in BR clear 96-well PCR plates (Greiner).
[0373] The following PCR mixture was used:
[0374] 10 l 2 DyNAmo HS SYBR Green Mix (Thermo Scientific)
[0375] 7 l H.sub.2O.sub.bid
[0376] 1 l FW primer
[0377] 1 l RW primer
[0378] 1 l DNA.
TABLE-US-00004 DNAQuantificationFWprimer (SEQIDNO:73) CTTGGCAATCCEGTACTGTT. DNAQuantificationRWprimer (SEQIDNO:74) ATATGGCGTCGGTAAAGGC.
[0379] The DNA in the mix was either one of the DNA samples recovered under step 4. In the negative control (NTC) instead of the DNA sample H.sub.2O.sub.bid was added to the PCR mixture.
[0380] As a standard for determining the DNA concentration, the plasmid pG14.51 was measured in different concentrations in the range from 10.sup.3 to 10.sup.7 molecules.
[0381] For PCR, the following temperature profile was used: An initial activation at 95 C. for 10 minutes followed by 40 repetitions of the following cycle steps 1 to 3: 1) Denaturation: 95 C. for 10 seconds; 2) Annealing: 60 C. for 20 seconds; and 3) Extension: 72 C. for 30 seconds. After the temperature cycling, the samples were again heated for at 95 C. for 10 seconds, cooled to 55 C. for 5 seconds heated again to 95 C. until the samples were retrieved.
[0382] Using the standard the signal obtained in the PCR reactions could be related to a specific number of DNA molecules using the CFX manager. Comparing the samples of a specific VLP treated and untreated with DNase a DNA protection value in percent was obtained. Accordingly, a protection value in percent can be obtained for each VLP construct. In particular the DNA protection is defined by
DNA protection=N.sub.treated/N.sub.untreated*100
[0383] with
[0384] N.sub.untreated=Number of DNA molecules not treated with DNase
[0385] N.sub.treated=Number of DNA molecules treated with DNase
[0386] Thus, it represents the percentage of DNA protected in by a VLP construct. The results are represented for each of the VLP constructs in
Example 4: Packaging of DNA Using VLP with VP2/VP3 Fusion Proteins, Influence of the Concentration of the Fusion Protein
[0387] A second DNA packaging test was performed with the following constructs: a VLP build from VP1 as negative control and VLPs build from VP1-VP2-protamine-1 with different concentrations of the VP2-protamine-1 fusion protein.
[0388] The protocol described in Example 3 was repeated with VP1 and VP1-VP2-protamine-1. In addition two more VLP constructs were created by mixing the disassociated VP1 and VP1-VP2-protamine-1 pentamers in step b) in a ratio of 5:1 and 10:1.
[0389] DNA protection results are shown in
Example 5: Packaging of siRNA Using VLP with VP2/VP3 Fusion Proteins
[0390] VLPs formed by the following capsid proteins were used for the packaging test:
[0391] 1) VP1,
[0392] 2) VP1-VP2,
[0393] 3) VP1-VP2-protamine-1, and
[0394] 4) VP1-VP2-pentratin.
[0395] a) VLP Production
[0396] VLPs from the above identified proteins were produced according to the protocol of example 1.
[0397] b) Packaging of the siRNA
[0398] siRNA is packaged into the VLPs by a dissociation of the VLPs and reassociation in the presence of the siRNA.
[0399] 75 g (5 pmol) of the VLP are solved in 150 l TRIS buffer in a micro test tube (Eppendorf) and incubated for one hour at 25 C. and 600 rpm shaking.
[0400] After the one hour incubation, 10 pmol Kif1_8 siRNA (SEQ ID NO: 49) were added to the VLP solution and the protein/siRNA mixture was incubated for another hour at room temperature to allow a binding of the VLP proteins to the siRNA.
[0401] For reassociation, the VLP/siRNA mixture was transferred to 100 l dialysis cassettes (Thermo Scientific) and the dialysis cassette was placed into 21 of TRIS buffer as defined above with additional 1 mM CaCl.sub.2 and incubated at a temperature of 4 C. After 72 hours of dialysis the buffer was exchanged against a Glutathion buffer.
[0402] The dialysis cassettes were stored in 100 ml of this buffer for 24 hours at 4 C.
[0403] c) Benzoase Treatment of VLPs
[0404] After reassociation, VLP samples were divided in halves, and one half was treated with Benzoase (Novagen). For Benzoase treatment, 25 units Benzoase and 6 mM MgCl.sub.2 were added to the sample and incubated for 1 hour at 37 C. in a micro test tube (Eppendorf).
[0405] d) Recovery of Packaged siRNA
[0406] For recovery of the siRNA, at first the VLPs are digested. Thus, 40 l of packaging samples with or without Benzoase treatment were incubated in 500 l LP buffer and 50 l 10% SDS (w/v) for one hour at 56 C.
[0407] After one hour of incubation, 500 l Roti-Phenol (Fa Roth) were added, mixed thoroughly, and centrifuged at 11,000 g for 10 minutes. After centrifugation, the water-soluble upper phase was transferred into a new micro test tube and mixed with 500 l chloroform. The resulting mixture was incubated for one hour at 4 C., wherein the tube was constantly rolled. After incubation, the mixture was centrifuged again for 10 minutes at 11,000 g. Again, the water-soluble upper face was transferred to a test tube and mixed with 500 l 2-propanol at a temperature of 20 C. and 50 l of a 5 M NaCl solution. The resulting mixture was incubated for one hour at 20 C. without shaking. The mixture was then centrifuged for 30 minutes at 4 C. and 11,000 g. The liquid was decanted leaving a white pellet at the bottom of the tube. The pellet was washed with 500 l 70% (v/v) ethanol, dried and finally resuspended in 35 l bi-distillated H.sub.2O. The resuspended siRNA was stored at 20 Celsius. Before storage at 20 C. 1 l of RNasin (Promega) was added.
[0408] e) Quantification of the Recovered siRNA by RT and qPCR Analysis.
[0409] For quantification the siRNA is first transcribed into cDNA by reverse transcriptase (RT) and afterwards quantified by quantitative (real time) qPCR.
[0410] The following mixture was prepared for reverse transcriptase reaction and applied in to the wells of a 96 well plate (Fa. Greiner):
TABLE-US-00005 5x HiSpec Buffer 4 l 10x Nucleics Mix 2 l RNase-free water 7 l Reverse Transcriptase Mix 2 l Template RNA 5 l (= 350 ng standard siRNA)
[0411] In addition to the recovered siRNA also the following controls were used: [0412] 1. 10 pmol siRNA digested with benzonase in 100 l Tris buffer [0413] 2. 10 pmol siRNA extracted by phenol-chloroform-extraction and digested with benzonase 100 l Tris-Puffer [0414] 3. empty VLPs to exclude a reaction with insect cell DNA
[0415] The 96 well plate was then incubated to 60 min at 37 C. for reverse transcription and then 5 min at 95 C. to inactivate the reverse transcriptase and separate the RNA and DNA strands.
[0416] PCR was performed in BR clear 96-well PCR plates (Greiner).
[0417] The following PCR mixture was used:
TABLE-US-00006 2x Quantitect SYBR Green PCR Master Mix 12.5 l 10 x miSript Universal Primer 2 l siRNA-specific fw Primer (5 M) (SEQ ID NO: 75) 2 l RNase-free water 7.5 l 1 l cDNA (from RT reaction) 1 l.
[0418] For PCR, the following temperature profile was used: An initial activation at 95 C. for 15 minutes followed by 40 repetitions of the following cycle steps 1 to 3: 1) Denaturation: 95 C. for 15 seconds; 2) Annealing: 55 C. for 30 seconds; and 3) Extension: 70 C. for 30 seconds. After the temperature cycling the samples were again heated for at 95 C. for 10 seconds, cooled to 55 C. for 5 seconds heated again to 95 C. until the samples were retrieved.
[0419] The RNA protection in % is calculated as described in Example 2 for DNA protection. The results are shown in
Example 6: Transduction of Cells Mediated by VLPs with VP2/VP3-CPP Fusion Proteins
[0420] The assay is based on the principle that DNA encoding for luciferase is transduced into cells using the VLPs as transport system. Luciferase-dependent chemo luminescence in the cells is measured afterwards. The higher the chemo luminescent signal, the more DNA is introduced into the cells. Two different types of DNA were used as cargo:
[0421] a. pG14.15
[0422] b. pNL1.1_CMV
[0423] The two DNA plasmids can be used in different luciferase assay systems, namely, the luciferase assay system of Promega with pGL4.51 and Nano-GLO Luciferase assay for pNL1.1_CMV.
[0424] 1. VP1
[0425] 2. VP1_VP2-L2DD447p
[0426] 3. VP1_VP2-TATp
[0427] 4. VP1_VP2-PENp
[0428] 5. VP1_VP2-HISp
[0429] 6. Nanoluc-Vector
[0430] a) Packaging of DNA into VLPs
[0431] The DNA was packaged into the different VLPs, according to the protocol of example 3.
[0432] b) DNAse Treatment on Packaged DNA
[0433] The DNAse treatment was carried out, according to the protocol of example 3.
[0434] c) Transduction of Cells with DNA Containing VPLs
[0435] COS7 cells were grown in 24 well plates. For this, cells were inoculated into 500 l of DMEM+medium (10% FCS, 1% penicillin/streptomycin). The cells were incubated at 37 C. shaking. Upon reaching a density 510.sup.4 cells per well, 25 g VLP with or without DNaseI (see step 2) were added to the cells and the cells were further incubated for 48 hours at 37 C.
[0436] After incubation, the DMEM+medium was decanted and cells were washed two times with 1PBS.
[0437] d) A Measurement of the Luciferase Expression in the Cellular Extracts.
[0438] The transduced COS7 cells were incubated with 100 l 1 Lysis buffer for 10 minutes at room temperature.
[0439] Composition of the Luciferase Cell Culture Lysis Reagent (1)
[0440] 25 mM Tris-phosphate (pH 7.8)
[0441] 2 mM DTT
[0442] 2 mM 1,2-diaminocyclohexane-N,N,N,N-tetraacetic acid
[0443] 10% glycerol
[0444] 1% Triton X-100
[0445] The cell lysates were spun in a centrifuge for 1 minute at 11.000 g and afterwards 20 l of the supernatant were transferred into a well of a white 96 well plate (Nunc). At this stage, in case of the Nano-Glo Luciferase Assay, 20 l of Nanoluc reagent (0.5 ml combi tip) were added and incubated for 3 minutes at room temperature. Afterwards, the signal strength in relative lights units (RLU) was determined. Alternatively, in case of the luciferase assay system (GloMax, Promega), 100 l substrate Luciferin were added to the 20 l lysate, incubated for 10 sec and the signal strength in relative lights units (RLU) was determined.
[0446]
[0447] Using only the Nanoluc vector without a VLP transportation system (6) results in a similar signal. Thus, no DNA is transferred into the cells. The transduction experiment with VLPs consisting of only VP1 also resulted in a signal strength of about 100 RLU for both the DNase treated and the untreated sample.
[0448] In contrast, all VP2-ETP fusion proteins led to a drastic increase of DNA transduction into the COS7 cells. While the DNase treated samples of the VLPs with the VP2 fusion proteins VP2-L2DD447p (2), VP2-TATp (3), VP2-PENp (4), VP2-HISp (5) had a signal in the range of 100 relative light units when treated with DNase. However, the DNase-untreated samples led to a signal strength in the range of 100,000 RLU for VP2-L2DD447p (2) and VP2-TATp (3). The signal strength of the penetratin fusion protein VP2-PENp (4) was 10,000 RLU and 3,000 RLU were determined for the his-tagged VP2 (5). These results show that VP2 fusion proteins with a peptide from the class of ETPs leads to a drastic increase in the transduction of COS7 cells.
Example 7: Transduction of Cells Mediated by VLPs with VP2/VP3 Fusion Proteins
[0449] The Experiment according to example 6 was repeated with VLPs derived from the following constructs: VP1-VP2, VP1-VP2-protamine-1, VP1-VP2-L2DD447 and VP1-VP2-pentratin and VP1-VP2/VP1-VP2-protamine-1 in a ratio of 5:1. In contrast to Example 6 no control experiments with digested DNA were carried out. As negative controls served again cells that were not transduced or only transduced with the plasmid.
[0450] The results of the experiment are shown in
Example 8: siRNA Protection by VLPs Blood Plasma Treatment
[0451] VLPs with VP1 and VP2-PENp were produced according to the protocol of Example 1. The siRNA protection test including siRNA packaging, detection and quantification was performed according Example 5. In
[0452] In a parallel experiment, the benzonase treatment step of Example 5 is replaced by an incubation of the RNA in 500 l blood plasma at 37 C. During incubation samples were retrieved at the following time points: 15 min, 30 min, 60 min and 120 min. As a control, 10 pmol of unpackaged siRNA were analyzed for 30 min in 500 l blood plasma at 37 C. The result is shown in
Example 9: Assessment of Functionality of the Protected siRNA
[0453] Steps
[0454] 1) Packaging of siRNA using VLP
[0455] 2) Benzonase treatment packaged siRNA
[0456] 3) Phenol/chloroform extraction of nucleic acids
[0457] 4) Proliferation assay and transfection of siRNA
[0458] Steps 1 to 3 were carried out as described in example 5 (steps b) to d)). The siRNA was Kif11_8 siRNA (Qiagen). The VLPs were produced as described in example 1 with VP1 and VP2-Penetratin.
[0459] Step 4
[0460] TC-620 cells were diluted to a concentration of 2.010.sup.5 cells/ml in DMEM-HG FCS medium.
[0461] 100 l culture medium was applied into the wells a microtiter plate that incorporates a sensor electrode array (E-plate, ACEA Biosciences). After 15 min 50 l the TC-620 cell suspension was added.
[0462] The proliferation of the cells is measured in the xCelligence equipment (ACEA Biosciences) for 20 h under humidified conditions at 37 C. and 5% CO.sub.2. The system measures the proliferation based on the following principle: The presence of the cells on top of the electrodes will affect the local ionic environment at the electrode/solution interface, leading to an increase in the electrode impedance. The more cells are attached on the electrodes, the larger the increases in electrode impedance. In addition, the impedance depends on the quality of the cell interaction with the electrodes. For example, increased cell adhesion or spreading will lead to a larger change in electrode impedance. The output is a proliferation index based on the electrode impedance.
[0463] For siRNA transfection a RNAi-Max/Opti-MEM mastermix was prepared by mixing of 1 ml OptiMEM (Gibco) with 10 l RNAi-Max (Life Technologies).
[0464] Three test samples were prepared: [0465] 1) Media control: 50 l Opti-MEM (Life Technologies) [0466] 2) VLP extracted siRNA: 2 pmol of siRNA from step 3, diluted in 50 l OptiMEM, [0467] 3) Untreated siRNA: 2 pmol of untreated Kif11_8 siRNA diluted in 50 l OptiMEM,
[0468] 50 l of the RNAi-Max/Opti-MEM mastermix were added to each the test samples and incubated for 15 min at room temperature.
[0469] The xCelligence equipment is paused and 50 l of the test sample/mastermix solution is applied to the wells of the E-Plates.
[0470] The assay was run for additional 96 h.
[0471] Results:
[0472]
[0473] Curve 1 relates to sample 1 (Media control) and displays standard proliferation index curve representing a normal proliferation rate of the target cell. In the curve 1 the proliferation index constantly rises before and after addition sample before reaching a plateau at about 85 h.
[0474] In contrast in curves 2 and 3, corresponding the siRNA treated samples, the proliferation index already reaches a plateau within about 10 h of addition of the siRNA Afterwards the value of the proliferation index constantly decreases. The reason is that the siRNA targets Kif11/Eg5 which is involved in cell division processes. In comparison siRNA protected against nucleases by VLP with a fusion protein according to one embodiment of the invention show nearly a comparable efficiencyjust a small delay in the knock down kineticsas the untreated one if the siRNA. This experiment shows the efficient functional protection of the siRNA by EPN against external influences.
Example 10: Transduction of siRNA into Cells and Test of Functionality
[0475] Steps:
[0476] 1) Packaging of siRNA using VLP
[0477] 2) Proliferation assay and transduction of siRNA by VLP
[0478] Step 1
[0479] Kif11_8 siRNA was packaged in VLPs from VP1 and VP2-Penetratin as described in example 5 step b).
[0480] Step 2
[0481] TC-620 cells were diluted to a concentration of 2.010.sup.5 cells/ml in DMEM-HG FCS medium.
[0482] 100 l culture medium was applied into the wells a microtiter plate that incorporates a sensor electrode array (E-plate, ACEA Biosciences). After 15 min 50 l of the TC-620 cell suspension was added.
[0483] The proliferation of the cells is measured in the xCelligence equipment (ACEA Biosciences) for 20 h under humidified conditions at 37 C. and 5% CO.sub.2.
[0484] After 20 h the following samples were added to different wells of the E-plate:
[0485] 1) 50 l OptiMEM (media control)
[0486] 2) 50 l Reassociation Buffer
[0487] 3) Empty VLP in 50 l Reassociation Buffer
[0488] 4) VLP with siRNA in 50 l Reassociation Buffer
[0489] 5) VLP with siRNA in 50 l Reassociation Buffer
[0490] The assay was run for an additional 114 h.
[0491] Results
[0492]