METHOD FOR CONTROLLING SPEED OF POLYPEPTIDE PASSING THROUGH NANOPORE AND USE THEREOF

Abstract

The present invention provides a method for controlling a speed of a polypeptide passing through a nanopore and use thereof in determining an amino acid sequence of a polypeptide. Specifically, the method comprises: conjugating a polynucleotide to the polypeptide to give a polynucleotide-polypeptide conjugate, and applying a voltage across the nanopore in the presence of a polynucleotide binding enzyme to move the conjugate through the nanopore. The polynucleotide binding enzyme controls the movement of the polynucleotide and thereby controls the movement of the conjugated polypeptide in the nanopore, thus controlling the speed of the polypeptide passing through the nanopore. While controlling the speed of the polypeptide, the present invention reads a nanopore current signal during the process of the polypeptide passing through the nanopore to give an electrical signal of the polypeptide. The electrical signal can be further used to acquire an amino acid sequence of the polypeptide, to identify the polypeptide or a part thereof, or to establish a library of polypeptide electrical signals.

Claims

1. A method for controlling a speed of a polypeptide passing through a nanopore, comprising: 1) conjugating the polypeptide to a polynucleotide to give a polynucleotide-polypeptide conjugate; and 2) applying a voltage across the nanopore in the presence of a polynucleotide binding enzyme to move the polynucleotide-polypeptide conjugate through the nanopore, wherein the polynucleotide binding enzyme controls the movement of the polynucleotide, thus controlling the speed of the conjugated polypeptide passing through the nanopore.

2. The method according to claim 1, wherein the polynucleotide binding enzyme is a helicase, a polymerase or a translocase.

3. The method according to claim 2, wherein the polymerase is phi29 polymerase.

4. The method according to claim 2, wherein the helicase is an Hel308 family helicase.

5. The method according to claim 4, wherein the helicase is Hel308 Tga or a sequence of a variant thereof, Hel308 Mbu or a sequence of a variant thereof, Hel308 Pfu or a sequence of a variant thereof, Hel308Mma or a sequence of a variant thereof, Hel308Mok or a sequence of a variant thereof, Hel308Fac or a sequence of a variant thereof, Hel308Csy or a sequence of a variant thereof, Hel308Mhu or a sequence of a variant thereof, or F8813 protein or a sequence of a variant thereof.

6. The method according to claim 1, wherein the polynucleotide is a DNA or RNA.

7. The method according to claim 1, wherein the polynucleotide is a single-stranded DNA.

8. The method according to claim 1, wherein the polynucleotide and the polypeptide are linked covalently or through a linker group to form the polynucleotide-polypeptide conjugate.

9. The method according to claim 8, wherein the covalent linkage of the polynucleotide and the polypeptide is in a manner selected from an oxime bond, an amide bond, a thioether bond, a disulfide bond, a phosphoryl bond, a hydrazone bond, and a ureide bond, and a cyclic linkage formed by click reaction.

10. The method according to claim 1, wherein the nanopore is a biological nanopore or a solid nanopore.

11. The method according to claim 10, wherein the biological nanopore is selected from Staphylococcus aureus α-hemolysin nanopore, MspA nanopore, Csgg nanopore, phi29 nanopore and FraC nanopore, preferably MspA nanopore.

12. The method according to claim 10, wherein the solid nanopore is selected from graphene nanopore, silicon nitride nanopore, titanium dioxide nanopore, and alumina nanopore.

13. A method for measuring an electrical signal of a polypeptide formed by the polypeptide passing through a nanopore sensor, comprising: 1) conjugating the polypeptide to a polynucleotide to give a polynucleotide-polypeptide conjugate; 2) applying a voltage across the nanopore in the presence of a polynucleotide binding enzyme to move the polynucleotide-polypeptide conjugate through the nanopore, wherein the polynucleotide binding enzyme controls the movement of the polynucleotide, thus controlling the speed of the conjugated polypeptide passing through the nanopore; and 3) reading a nanopore current signal to acquire the electrical signal of the polypeptide.

14. (canceled)

15. The method according to claim 13, comprising: 1) conjugating the polypeptide to a polynucleotide to give a polynucleotide-polypeptide conjugate; 2) applying a voltage across the nanopore in the presence of a polynucleotide binding enzyme to move the polynucleotide-polypeptide conjugate through the nanopore, wherein the polynucleotide binding enzyme controls the movement of the polynucleotide, thus controlling the speed of the conjugated polypeptide passing through the nanopore; and 3) reading a nanopore current signal to identify a current signal of the amino acid sequence of the polypeptide.

16. A method for identifying a polypeptide or a part thereof, wherein the identification is performed by measuring an electrical signal generated by the polypeptide passing through a nanopore sensor, comprising: 1) ligating the polypeptide to a nucleic acid to give a nucleic acid-polypeptide ligation product; 2) applying a voltage across the nanopore in the presence of a nuclease to move the nucleic acid-polypeptide ligation product through the nanopore, wherein the nuclease controls the movement of the nucleic acid, thus controlling the speed of the ligated polypeptide passing through the nanopore; 3) reading a nanopore current signal to acquire the electrical signal of the polypeptide; and 4) identifying the polypeptide or the part thereof based on the electrical signal.

17. (canceled)

18. The method according to claim 16, wherein the identification is to detect, in the polypeptide or the part thereof, a post-translational modification preferably selected from ubiquitination, phosphorylation, glycosylation, esterification, alkylation and acetylation, glutamation, lipoation, isoprenylation, glycination, sulfation, adenylation and ADP ribosylation.

18. (canceled)

19. The method according to claim 16, wherein the part is a continuous amino acid sequence of the polypeptide or one or several amino acid residues of the polypeptide.

20. The method according to claim 16, wherein the part is one or more mutation sites of the polypeptide.

21. The method according to claim 16, wherein in step 4), the polypeptide or the part thereof is identified by comparing an electrical signal of the polypeptide with signals from a library of known polypeptides.

Description

DESCRIPTION OF THE DRAWINGS

[0083] Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings, in which:

[0084] FIG. 1 illustrates an ssDNA-polypeptide conjugate formed by conjugating a Sulfo-SMCC-activated ssDNA and a polypeptide with a sulfhydryl group at one end;

[0085] FIG. 2 illustrates the process of the ssDNA-polypeptide conjugate passing through a nanopore in the presence of a polynucleotide binding enzyme: the polynucleotide-polypeptide conjugate quickly passes through the nanopore, and in the action of the polynucleotide binding enzyme, the polynucleotide pulls the conjugated polypeptide to pass through the nanopore again at a controlled speed, and when the polypeptide passes through the nanopore, the polypeptide is determined;

[0086] FIG. 3 illustrates a predicted ssDNA test signal;

[0087] FIG. 4 illustrates an actual ssDNA test result;

[0088] FIG. 5 illustrates an actual ssDNA test result;

[0089] FIG. 6 illustrates an actual ssDNA test result;

[0090] FIG. 7 illustrates a 15% denaturing gel electrophoresis of the ssDNA-polypeptide conjugate, wherein lanes 2-4 are ssDNA, ssDNA+Sulfo-SMCC, ssDNA+Sulfo-SMCC+E29C, respectively;

[0091] FIG. 8 illustrates a 15% denaturing gel electrophoresis of the ssDNA-polypeptide conjugate, wherein lanes 2-4 are ssDNA+Sulfo-SMCC+EGSLFL-60C, ssDNA, and ssDNA+Sulfo-SMCC+EDSLFYD-60C, respectively;

[0092] FIGS. 9-10 illustrate test results of the conjugate of ssDNA and E29C;

[0093] FIGS. 11-12 illustrate test results of the conjugate of ssDNA and EGSLFL-60C; and

[0094] FIGS. 13-14 illustrate test results of the conjugate of ssDNA and EDSLFYD-60C.

DETAILED DESCRIPTION

[0095] Technical schemes in the examples of the present invention will be described clearly and completely in conjunction with the accompanying drawings. It is apparent that the examples described herein are only some examples of the present invention, but not all of them. Based on the examples of the present invention, all other examples obtained by those of ordinary skill in the art without creative work shall fall within the protection scope of the present invention.

Example 1. Materials

[0096] Hel308 helicase, ATP (100 mM, Thermo Fisher)

[0097] 1,2-Diphytanoyl-sn-glycero-3-phosphocholine (Avanti)

[0098] Sequences:

TABLE-US-00001 ssDNA (SEQ ID NO. 1): NH2-CAAGAATACCTTTTTTTTTCCTTTTTTTTCCTCTACCACTTTTCAG ATCTCACTATCGCATTCTCATGCAGGTCGTAGCTTTTTTCTTTTTTCATC ATC ssDNA-R (SEQ ID NO. 2): TTTTTTTTTTTTTTTGCTACGACCTGCATGAGAATTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTT-cholesterol EGSLFL-60C (SEQ ID NO. 3): EEEEGEEEEGGEEEGGEEESSEEEEGGEEELFEEGGGGEEEESSSSEEEE LLEEEEEEEC EDSLFYD-60C (SEQ ID NO. 4): EDEDEEEDYDDDEEEDEEDEVEEEEEYGEVVGELGGGGSHHDHHSSSGSE EEYEEDDDDC E29C (SEQ ID NO. 5): EEEEEEEEEEEEEEEEEEEEEEEEEEEEEC

Example 2. Determination of ssDNA

[0099] 1. Procedures:

[0100] The ssDNA and ssDNA-R in Example 1 were annealed at a molar ratio of 1:1 to form a double-stranded part; the cross section of PEEK tubing was pre-coated with a mixture of phospholipid and hexadecane and immersed in an electrolyte solution before bubbles were blown on the cross section of the peek tubing and sucked away using a pipette to form a phospholipid bilayer. In a system of 400 mM KCl in HEPES buffer (pH 7), MspA protein was added at the cis terminal. At 180 mV, when a pore current of about 160 pA was read, a 2-μL mixture of the above-mentioned annealed product and Hel308 protein was added to 50 μL of the cis terminal solution before adding 2 μL of ATP. A voltage of 180 mV was applied and the data were recorded.

[0101] 2. Results

[0102] As shown in FIGS. 4, 5 and 6, nanopore current demonstrated stepped jumps over time at a fixed voltage, which is the passing current signal of the ssDNA under the speed control of the helicase. In particular, long step signals of about 25 pA were observed in the second half of these segments, in which a rising current step was also observed. Such changes are consistent with the passing signal of positions 80-90 in the nucleotide sequence in FIG. 3, corresponding to the passing signal of TTTTTTTTTCCTTTTTTTT sequence near the 5′ end of the ssDNA.

Example 3. Conjugation of ssDNA and Polypeptide

[0103] 1. Procedures:

[0104] 1 mg of Sulfo-SMCC was dissolved in 40 μL DMSO. After a complete dissolution, 80 μL of 150 mM boric acid buffer (pH 8.5) was added and mixed well. The mixture was quickly added to 10-16 nmol of ssDNA in Example 1, vortexed and shaken to mix well, and incubated in a thermostat at 30° C. Unchanged SMCC was removed by dialysis, ethanol precipitation and desalting column. According to the ssDNA concentration measured by UV absorption, sulfhydryl-containing polypeptides EGSLFL-60C, EDSLFYD-60C and E29C at a 5-fold concentration were added, and shaken at room temperature for 1.5 h. The products were preserved at −20° C. for later use. The above conjugate was used for 15% Urea-PAGE gel electrophoresis.

[0105] 2. Results

[0106] FIGS. 7 and 8 show the 15% Urea-PAGE gel electrophoresis results of the ssDNA-polypeptide conjugate. Lanes 2-4 in FIG. 7 were ssDNA, ssDNA+Sulfo-SMCC, ssDNA+Sulfo-SMCC+E29C, respectively. Lanes 2-4 in FIG. 8 were ssDNA+Sulfo-SMCC+EGSLFL-60C, ssDNA, ssDNA+Sulfo-SMCC+EDSLFYD-60C, respectively. The bands in the figures were all in the desired positions. Among these, high molecular weight bands were observed after conjugation to peptide chains, indicating a successful ssDNA-polypeptide conjugation and a reaction efficiency above 50% for the ssDNA part. The high molecular weight band with low signal intensity in Lane 3 ssDNA sample of FIG. 8 was caused by excessive sample amount, rather than the conjugate.

Example 4.Determination of ssDNA-E29C Conjugate

[0107] 1. Procedures:

[0108] The ssDNA-E29C conjugate from Example 3 and ssDNA-R were annealed at a molar ratio of 1:1 to form a double-stranded part; the cross section of PEEK tubing was pre-coated with a mixture of phospholipid and hexadecane and immersed in an electrolyte solution before bubbles were blown on the cross section of the peek tubing and sucked away using a pipette to form a phospholipid bilayer. In a system of 400 mM KCl in HEPES buffer (pH 7), MspA protein was added at the cis terminal. At 180 mV, when a pore current of about 160 pA was read, a 2-μL mixture of the above-mentioned annealed product and Hel308 protein was added to 50 μL of the cis terminal solution before adding 2 μL of ATP. A voltage of 180 mV was applied and the data were recorded.

[0109] 2. Results

[0110] As shown in FIG. 9, the ssDNA-E29C conjugate first demonstrated a current signal similar to those in FIGS. 7 and 8, indicating a controlled passing-through of the ssDNA part, and then a fluctuating plateau at 70-75 pA at the end of the signal was observed. As the current generated by ssDNA in the nanopore in this condition was below 60 pA, this high current value was caused by the peptide chain being dragged into the narrowest part of the nanopore. In a straightened state, the peptide chain has a smaller diameter than ssDNA, thus generating a larger nanopore current. FIG. 10 is an enlarged view of the signal in FIG. 9 where the peptide chain passed through the nanopore. It can be seen that the 70-75 pA plateau had a nearly 5-pA fluctuation, which may be caused by the thermal movement of the E29 peptide chain during the passing.

Example 5. Determination of ssDNA-EGSLFL-60Cconjugate

[0111] 1. Procedures:

[0112] The ssDNA-EGSLFL-60C conjugate from Example 3 and ssDNA-R were annealed at a molar ratio of 1:1 to form a double-stranded part; the cross section of PEEK tubing was pre-coated with a mixture of phospholipid and hexadecane and immersed in an electrolyte solution before bubbles were blown on the cross section of the peek tubing and sucked away using a pipette to form a phospholipid bilayer. In a system of 400 mM KCl in HEPES buffer (pH 7), MspA protein was added at the cis terminal. At 180 mV, when a pore current of about 160 pA was read, a 2-μL mixture of the above-mentioned annealed product and Hel308 protein was added to 50 μL of the cis terminal solution before adding 2 μL of ATP. A voltage of 180 mV was applied and the data were recorded.

[0113] 2. Results

[0114] As shown in FIG. 11, the ssDNA-EGSLFL-60C conjugate first demonstrated a current signal similar to those in FIGS. 7 and 8, indicating a controlled passing-through of the ssDNA part, and then a fluctuating plateau at 70-75 pA at the end of the signal was observed. As the current generated by ssDNA in the nanopore in this condition was below 60 pA, this high current value was caused by the peptide chain being dragged into the narrowest part of the nanopore. In a straightened state, the peptide chain has a smaller diameter than ssDNA, thus generating a larger nanopore current. FIG. 12 is an enlarged view of the signal in FIG. 11 where the peptide chain passed through the nanopore. It can be seen that a current trough of nearly 50 pA was observed at the beginning of the 70-75 pA plateau, which may be caused by the current decrease due to the hydrophobic amino acid LL near the C-terminal. This indicates that the method can distinguish amino acid sequences to a certain extent.

Example 6. Determination of ssDNA-EDSLFYD-60Cconjugate

[0115] 1. Procedures:

[0116] The ssDNA-EDSLFYD-60C conjugate from Example 3 and ssDNA-R were annealed at a molar ratio of 1:1 to form a double-stranded part; the cross section of PEEK tubing was pre-coated with a mixture of phospholipid and hexadecane and immersed in an electrolyte solution before bubbles were blown on the cross section of the peek tubing and sucked away using a pipette to form a phospholipid bilayer. In a system of 400 mM KCl in HEPES buffer (pH 7), MspA protein was added at the cis terminal. At 180 mV, when a pore current of about 160 pA was read, a 2-μL mixture of the above-mentioned annealed product and Hel308 protein was added to 50 μL of the cis terminal solution before adding 2 μL of ATP. A voltage of 180 mV was applied and the data were recorded.

[0117] 2. Results

[0118] As shown in FIG. 13, the ssDNA-EGSLFL-60C conjugate first demonstrated a current signal similar to those in FIGS. 7 and 8, indicating a controlled passing-through of the ssDNA part. After this signal, the current continuously increased to a plateau at 80 pA before it decreased to 46 pA, increased to 55 pA and then decreased to 45 pA. This was caused by greater changes in sequence and species of the first 10-20 amino acids from the C-terminus to the N-terminus of the EGSLFL-60C peptide chain as compared to Example 4 and Example 5, thus resulting in more complex changes in current over time. FIG. 14 is an enlarged view of the signal in FIG. 13 where the peptide chain passed through the nanopore.

[0119] The preferred embodiments of the present invention are described in detail above, which, however, are not intended to limit the present invention. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, all of which will fall within the protection scope of the present invention.

[0120] In addition, it should be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, such combinations will not be illustrated separately.

[0121] Various embodiments of the present invention can also be combined arbitrarily, and should also be regarded as the disclosure of the present invention, as long as they do not violate the idea of the present invention.