METHODS FOR THE DIAGNOSIS AND TREATMENT OF INFLAMMATORY BOWEL DISEASE
20180320222 ยท 2018-11-08
Inventors
- Alain Stintzi (Ottawa, CA)
- David R. Mack (Ottawa, CA)
- Daniel Figeys (Ottawa, CA)
- Walid Abdelfattah Elsayed Mottawea (Ottawa, CA)
- Turki Saleh A. Abujamel (Jeddah, SA)
- Cheng-kang Chiang (Ottawa, CA)
Cpc classification
A61P1/00
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K31/00
HUMAN NECESSITIES
C12Q1/6883
CHEMISTRY; METALLURGY
C12Q1/04
CHEMISTRY; METALLURGY
C12Q2600/112
CHEMISTRY; METALLURGY
International classification
A61K45/06
HUMAN NECESSITIES
A61K31/00
HUMAN NECESSITIES
C12Q1/6883
CHEMISTRY; METALLURGY
C12Q1/04
CHEMISTRY; METALLURGY
Abstract
There is provided methods and compositions to diagnose, classify and treat inflammatory bowel disease including ulcerative colitis and Crohn's disease by measuring the levels of certain bacterial taxa and proteins collected from the gut.
Claims
1. A method for detecting the presence of inflammatory bowel disease, Crohn's disease, or ulcerative colitis in a human subject comprising: providing a gut microbiota sample of a human subject; and detecting a level of one or more species of H2S producing bacteria selected from Fusobacterium nucleatum, Veillonella parvula, and Atopobium parvulum in the gut microbiota sample.
2. The method of claim 1 wherein the one or more species of H2S producing bacteria consists of Atopobium parvulum and wherein the measuring comprises using quantitative polymerase chain reaction.
3. The method of claim 2 wherein the quantitative polymerase chain reaction uses a forward and reverse primer for targeting Atopobium parvulum and wherein the forward primer of the primer pair is SEQ ID 1 and the reverse primer is SEQ ID 2.
4. A method of treating inflammatory bowel disease, Crohn's disease, or ulcerative colitis in a human subject comprising: providing a gut microbiota sample of a human subject; detecting a level of one or more species of H2S producing bacteria selected from Fusobacterium nucleatum, Veillonella parvula, and Atopobium parvulum in the gut microbiota sample; comparing the detected level for each of the one or more species of H2S producing bacteria selected from Fusobacterium nucleatum, Veillonella parvula, and Atopobium parvulum to a predetermined level of the respective one or more species of H2S producing bacteria selected from Fusobacterium nucleatum, Veillonella parvula, and Atopobium parvulum, wherein a level of each of the one or more species of H2S producing bacteria relative to the respective predetermined level is indicative of the presence of the disease, and administering to the patient a pharmaceutically effective amount of a compound selected from aminosalycylates, immunomodulators, anti-integrins, anti-cytokines, enteral feed programs, steroids, corticosteroids, antibiotics, anti-TNF, bismuth or a combination thereof.
5. The method of claim 4 wherein the patient has an elevated level of Atopobium parvulum and wherein bismuth is administered.
6. The method of claim 4 wherein the one or more species of H2S producing bacteria consists of Atopobium parvulum and wherein the measuring comprises using quantitative polymerase chain reaction.
7. The method of claim 6 wherein the quantitative polymerase chain reaction uses a forward and reverse primer for targeting Atopobium parvulum and wherein the forward primer of the primer pair is SEQ ID 1 and the reverse primer is SEQ ID 2.
8. The method of claim 4 wherein the one or more species of H2S producing bacteria consists of Atopobium parvulum.
9. The method of claim 4 wherein the one or more species of H2S producing bacteria consists of Atopobium parvulum and said step of detecting is by measuring a level of a marker selected from cytokines and GALT foci wherein a level of cytokine or GALT foci above normal level is indicative of a presence of Atopobium parvulum and of the disease.
10. The method of claim 9 wherein the cytokines are selected from CxcH, IL17a, IL-12 and IL-1 or combination thereof.
11. The method of claim 1 wherein the one or more species of H2S producing bacteria consists of Atopobium parvulum.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0054] The invention is better understood by way of the following detailed description of embodiments of the invention with reference to the appended drawings, in which:
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
DETAILED DESCRIPTION
[0100] In the present description by microbiota it is meant an ensemble of microorganisms residing in an environment and in particular by gut microbiota it is meant microorganisms found in any part of the alimentary canal from lips to the anus.
[0101] By patients having Inflammatory bowel disease (IBD) it is meant patients with ulcerative colitis (UC) or patients with Crohn's disease (CD) or IBD-undefined (IBD-U).
[0102] By level or abundance of bacteria or bacterial taxa it is meant a level or abundance obtained by a means to quantify bacteria such as culture based methods, flow cytometry, microscopy, quantitative DNA analysis and any other means that would be obvious to a person skilled in the art.
[0103] By severity of the disease it is meant a level of symptoms as described in disease activity index such Crohn's disease activity index (CDAI), Pediatric Crohn's disease activity index (PCDAI) Harvey-Bradshaw index, Ulcerative colitis activity index (UCAI), Pediatric Ulcerative colitis activity index (PUCAI), Paris classification of pediatric Crohn's disease and the like. For example severe CD corresponds to a score of 450 in the CDAI index.
[0104] By core it is meant the bacterial taxa that are conserved between individuals (that are present in two or more individuals).
[0105] In an aspect of the invention there is provided a method in which IBD can be detected by measuring the levels (or relative abundance) of certain bacterial taxa in samples from the gut of patients. Microbiota samples from the gut may be obtained from stools, intestinal mucosal biopsies, gut lavage or combination thereof. In an embodiment of the invention, microbiota samples are collected such as to comprise the microbiota from the mucosa-luminal interface of the gut.
[0106] In one embodiment of the invention, the collection can be performed during endoscopy by flushing a physiological solution, such as sterile saline solution or sterile water, onto the mucosa to remove the strongly adherent mucus layer overlying the intestinal mucosal epithelial cells and the microbial community embedded within the mucus layer. Aspirates are then collected directly through a colonoscope at a specific location in the gut as for example from the terminal ileum right colon and left colon and the samples are preferably immediately put on ice right in the endoscopy suite. For example the following steps can be performed: 1) a regular protocol of bowel clean out in preparation for colonoscopy is first applied to the patient, 2) then the colonoscope (scope) is advanced to the ascending colon or a region of the colon distal to that of interest, 3) suction out fluid and particulate matter, using either the scope's wash system or with a syringe through biopsy port, 4) flush sterile water onto mucosa until shards of mucus are dislodged, 5) aspirate mucus containing fluid into sterile trap through scope aspiration system, 6) remove the trap from scope suction and cap it and immediately place on ice, 7) advance the scope to more proximal region of interest and repeat steps 3-6, 8) transport traps with mucus to lab within 15 minutes of collection. The sample can then be analyzed at the point of care or transferred to a laboratory. The samples can also be further processed and then stored at 80 C.
[0107] Collection of the gut microbiota can also be performed on stools. Collection of bacteria from stools is known in the art. In the case of fecal microbiota collection/analysis, fresh stools may be collected and immediately processed and stored at 80 C. for DNA extraction and sequence/quantification as part of a bacterial analysis as further described below.
[0108] Samples containing gut microbiota collected as described above can be assayed for determining their microbial composition. Identification of the bacteria present in samples can be performed using DNA sequencing techniques as described in the examples below. In one embodiment, total DNA can be extracted from intestinal aspirates or stool samples. The protocol may comprise the extraction of total DNA using an extraction step with mechanical disruption. The extracted DNA can then be subjected to sequencing to identify bacteria by comparing the sequences to sequences contained in databases. In a preferred embodiment metagenomic DNA can be subjected to multiplexed massively parallel sequencing on the hypervariable V6 region of the 16S rRNA gene. It is appreciated that the sequencing of regions other than the hypervariable V6 region of the 16S rRNA gene can be used provided that such regions provide discriminating power (taxonomic resolution) for at least some bacterial taxa or operational taxonomic units (OTU's) and in particular for bacterial taxa that are preferentially associated with IBD as is further described below.
[0109] It will also be appreciated that other methods can be used to identify bacteria from the gut samples including but not limited to microscopy, metabolites identification, Gram staining, flow cytometry, immunological techniques (antibodies), culture-based methods such a colony forming unit counting and the like as would be known to a person skilled in the art.
[0110] In an aspect of the invention the relative abundance of certain bacterial taxa namely phylum, class, order, family, genus or species or combination thereof in the gut (gut microbiota profile) of patients is used to assess the presence or absence of IBD disease. It has been found that the IBD microbiota is characterized by a smaller core as compared to controls (
[0111] Assessment of the presence of CD and UC disease in a human subject can be achieved by measuring the relative abundance of taxa as exemplified in table 1. In this particular example, microbial operational taxonomic units (OTUs) that were detected in all the samples within each group and that vary significantly in abundance between CD, UC and/or controls are listed. The number of 16S rDNA reads in each sample was normalized by random subsampling to 500,000. Minimum and maximum correspond to the minimum and maximum number of reads obtained; mean corresponds to the mean of the number of reads obtained. P values were generated using a Kruskal-Wallis test with a Dunn's post hoc test. p|Control indicates the P values obtained by comparison to the controls; p|UC and p|CD indicate the P values obtained by comparison to the UC and CD patients respectively. Values in bold indicate significance (P<0.05). From the table it can be seen that certain taxa are more or less abundant in patients with disease than in healthy controls. Furthermore there it is also possible to distinguish between CD and UC based on the relative abundance.
TABLE-US-00001 TABLE 1 Core OTUs that varies significantly in abundance in at least one of the three pairwise comparisons performed (controls vs. CD; controls vs. UC; and CD vs. UC). OTU| Std. p| p| Variable Taxonomy|Variable Min Max Mean deviation Control UC p|CD 177005| k_Bacteria; 0.000 12876.000 1590.857 3303.847 1 0.304 0.022 Control p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_Blautia; s_| Control 177005|UC k_Bacteria; 1.000 8538.000 829.071 2266.987 0.304 1 0.388 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_Blautia; s_|UC 177005|CD k_Bacteria; 0.000 24758.000 870.135 4086.298 0.022 0.388 1 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_Blautia; s_|CD 541301| k_Bacteria; 0.000 34876.000 2923.571 7856.412 1 0.265 0.332 Control p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Porphyromonadaceae; g_Parabacteroides; s_|Control 541301|UC k_Bacteria; 2.000 4594.000 400.357 1221.873 0.265 1 0.038 p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Porphyromonadaceae; g_Parabacteroides; s_|UC 541301|CD k_Bacteria; 1.000 10433.000 1166.622 2439.874 0.332 0.038 1 p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Porphyromonadaceae; g_Parabacteroides; s_|CD 258691| k_Bacteria; 0.000 40719.000 2275.238 8846.849 1 0.812 0.038 Control p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_Bacteroidesovatus| Control 258691|UC k_Bacteria; 1.000 86361.000 6325.500 23037.262 0.812 1 0.122 p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_Bacteroidesovatus| UC 258691|CD k_Bacteria; 1.000 37102.000 3148.459 7654.185 0.038 0.122 1 p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_Bacteroidesovatus| CD 182122| k_Bacteria; 3.000 13653.000 1649.619 3463.599 1 0.034 0.077 Control p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_; s_|Control 182122|UC k_Bacteria; 0.000 5379.000 518.643 1417.505 0.034 1 0.427 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_; s_|UC 182122|CD k_Bacteria; 1.000 7805.000 691.216 1475.854 0.077 0.427 1 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_; s_|CD 261912| k_Bacteria; 12.000 23969.000 7682.238 8341.342 1 0.043 0.540 Control p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_Dorea; s_Doreaformicigenerans_| Control 261912|UC k_Bacteria; 24.000 7473.000 1846.143 2506.511 0.043 1 0.091 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_Dorea; s_Doreaformicigenerans_| UC 261912|CD k_Bacteria; 4.000 92806.000 10038.811 17773.654 0.540 0.091 1 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_Dorea; s_Doreaformicigenerans_| CD 585419| k_Bacteria; 2.000 860.000 111.000 201.434 1 0.003 0.114 Control p_Firmicutes; c_Clostridia; o_Clostridiales; f_Veillonellaceae; g_Veillonella; s_| Control 585419|UC k_Bacteria; 17.000 29801.000 4900.714 9206.483 0.003 1 0.059 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Veillonellaceae; g_Veillonella; s_|UC 585419|CD k_Bacteria; 5.000 14260.000 1293.811 3473.360 0.114 0.059 1 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Veillonellaceae; g_Veillonella; s_|CD 566952| k_Bacteria; 1.000 559.000 152.381 171.608 1 0.011 0.137 Control p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_Clostridium; s_| Control 566952|UC k_Bacteria; 0.000 378.000 41.429 101.442 0.011 1 0.137 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_Clostridium; s_| UC 566952|CD k_Bacteria; 0.000 720.000 106.108 165.187 0.137 0.137 1 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_Clostridium; s_| CD 303772| k_Bacteria; 0.000 149466.000 8653.333 32546.409 1 0.163 0.177 Control p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_; s_|Control 303772|UC k_Bacteria; 1.000 16984.000 1460.286 4486.377 0.163 1 0.007 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_; s_|UC 303772|CD k_Bacteria; 0.000 2852.000 193.811 613.649 0.177 0.007 1 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_; s_|CD 145149| k_Bacteria; 1.000 350.000 75.524 107.340 1 0.012 0.170 Control p_Firmicutes; c_Clostridia; o_Clostridiales; f_Veillonellaceae; g_Veillonella; s_| Control 145149|UC k_Bacteria; 2.000 15569.000 4072.786 6042.303 0.012 1 0.119 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Veillonellaceae; g_Veillonella; s_|UC 145149|CD k_Bacteria; 1.000 9591.000 811.892 1841.236 0.170 0.119 1 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Veillonellaceae; g_Veillonella; s_|CD 362168| k_Bacteria; 1.000 10035.000 709.286 2194.846 1 0.540 0.039 Control p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_| Control 362168|UC k_Bacteria; 2.000 17437.000 1507.500 4604.990 0.540 1 0.261 p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_| UC 362168|CD k_Bacteria; 2.000 35846.000 1950.054 6025.223 0.039 0.261 1 p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_| CD 470973| k_Bacteria; 3.000 73975.000 5461.905 16369.874 1 0.106 0.637 Control p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_Ruminococcus; s_Ruminococcustorques| Control 470973|UC k_Bacteria; 3.000 55265.000 4591.643 14678.969 0.106 1 0.029 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_Ruminococcus; s_Ruminococcustorques| UC 470973|CD k_Bacteria; 0.000 109867.000 8736.757 20949.142 0.637 0.029 1 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_Ruminococcus; s_Ruminococcustorques| CD 138006| k_Bacteria; 0.000 2913.000 464.476 900.379 1 0.117 0.229 Control p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Rikenellaceae; g_Alistipes; s_| Control 138006|UC k_Bacteria; 0.000 1393.000 193.286 411.329 0.117 1 0.006 p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Rikenellaceae; g_Alistipes; s_|UC 138006|CD k_Bacteria; 1.000 7020.000 795.243 1586.474 0.229 0.006 1 p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Rikenellaceae; g_Alistipes; s_|CD 188900| k_Bacteria; 11.000 9087.000 1275.952 2844.824 1 0.266 0.042 Control p_Firmicutes; c_Clostridia; o_Clostridiales; f_Ruminococcaceae; g_Faecalibacterium; s_|Control 188900|UC k_Bacteria; 3.000 87401.000 7661.214 23050.226 0.266 1 0.585 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Ruminococcaceae; g_Faecalibacterium; s_|UC 188900|CD k_Bacteria; 2.000 98077.000 8299.324 20200.719 0.042 0.585 1 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Ruminococcaceae; g_Faecalibacterium; s_|CD 64396| k_Bacteria; 0.000 674.000 86.952 185.286 1 0.050 0.013 Control p_Fusobacteria; c_Fusobacteria; o_Fusobacteriales; f_Fusobacteriaceae; g_Fusobacterium; s_| Control 64396|UC k_Bacteria; 0.000 41529.000 3892.429 11049.181 0.050 1 0.993 p_Fusobacteria; c_Fusobacteria; o_Fusobacteriales; f_Fusobacteriaceae; g_Fusobacterium; s_| UC 64396|CD k_Bacteria; 1.000 164748.000 6092.135 27224.424 0.013 0.993 1 p_Fusobacteria; c_Fusobacteria; o_Fusobacteriales; f_Fusobacteriaceae; g_Fusobacterium; s_| CD 196731| k_Bacteria; 1.000 787.000 174.333 238.985 1 <0.0001 0.346 Control p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_; s_|Control 196731|UC k_Bacteria; 0.000 0.000 0.000 0.000 <0.0001 1 <0.0001 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_; s_|UC 196731|CD k_Bacteria; 0.000 8748.000 666.892 1933.413 0.346 <0.0001 1 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_; s_|CD 469709| k_Bacteria; 4.000 113796.000 12561.190 32939.260 1 0.274 0.035 Control p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_Bacteroidesdorei| Control 469709|UC k_Bacteria; 11.000 123061.000 14096.286 34346.257 0.274 1 0.529 p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_Bacteroidesdorei| UC 469709|CD k_Bacteria; 2.000 221413.000 22583.189 42793.771 0.035 0.529 1 p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_Bacteroidesdorei| CD 183879| k_Bacteria; 0.000 25451.000 2080.381 5620.095 1 0.097 0.005 Control p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_; s_|Control 183879|UC k_Bacteria; 1.000 26097.000 2375.786 6987.836 0.097 1 0.533 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_; s_|UC 183879|CD k_Bacteria; 0.000 2104.000 220.324 486.771 0.005 0.533 1 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_; s_|CD 514611| k_Bacteria; 3.000 44090.000 2806.333 9573.507 1 0.154 0.019 Control p_Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Clostridium; s_| Control 514611|UC k_Bacteria; 0.000 3656.000 599.643 1154.057 0.154 1 0.633 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Clostridium; s_| UC 514611|CD k_Bacteria; 0.000 173925.000 6113.162 29294.960 0.019 0.633 1 p_Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Clostridium; s_| CD 288565| k_Bacteria; 1.000 204469.000 18673.762 57773.500 1 0.343 <0.0001 Control p_Fusobacteria; c_Fusobacteria; o_Fusobacteriales; f_Fusobacteriaceae; g_Fusobacterium; s_| Control 288565|UC k_Bacteria; 0.000 21535.000 2582.714 6677.428 0.343 1 <0.0001 p_Fusobacteria; c_Fusobacteria; o_Fusobacteriales; f_Fusobacteriaceae; g_Fusobacterium; s_| UC 288565|CD k_Bacteria; 0.000 0.000 0.000 0.000 <0.0001 <0.0001 1 p_Fusobacteria; c_Fusobacteria; o_Fusobacteriales; f_Fusobacteriaceae; g_Fusobacterium; s_| CD 171559| k_Bacteria; 1.000 697.000 109.762 201.308 1 <0.0001 <0.0001 Control p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_| Control 171559|UC k_Bacteria; 0.000 0.000 0.000 0.000 <0.0001 1 1.000 p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_| UC 171559|CD k_Bacteria; 0.000 0.000 0.000 0.000 <0.0001 1.000 1 p_Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_| CD
[0112] In table 2 results for relative abundance of taxa are presented. Taxa that vary significantly in abundance in at least one of the three pairwise comparisons performed (controls vs. CD; controls vs. UC; and CD vs. UC) are shown. In table 2, microbial OTUs that were detected in at least 75% of the samples within each group and that vary significantly in abundance between CD, UC and/or controls are listed. The number of 16S rDNA reads in each sample was normalized by random subsampling to 500,000. Minimum and maximum correspond to the minimum and maximum number of reads obtained; mean corresponds to the mean of the number of reads obtained. P values were generated using a Kruskal-Wallis test with a Dunn's post hoc test. p|Control indicates the P values obtained by comparison to the controls; p|UC and p|CD indicate the P values obtained by comparison to the UC and CD patients respectively. Values in bold indicate significance (P<0.05).
TABLE-US-00002 TABLE 2 p| p| Variable Minimum Maximum Mean Std. dev. Control UC p|CD PHYLUM Firmicutes|Control 177570.000 471151.000 300049.381 95087.202 1 0.011 0.246 Firmicutes|UC 39474.000 359555.000 204394.000 82968.346 0.011 1 0.075 Firmicutes|CD 66149.000 447067.000 259197.486 102279.924 0.246 0.075 1 CLASS Negativicutes| 23.000 16688.000 1555.333 3588.392 1 0.020 0.008 Control Negativicutes|UC 95.000 39966.000 10613.357 14349.888 0.020 1 0.799 Negativicutes|CD 27.000 74088.000 8759.081 15370.608 0.008 0.799 1 Clostridia|Control 172358.000 466967.000 290267.667 92133.532 1 0.006 0.054 Clostridia|UC 37917.000 356417.000 186560.357 84887.686 0.006 1 0.173 Clostridia|CD 9293.000 413730.000 227236.162 109051.179 0.054 0.173 1 Verrucomicrobiae| 0.000 1098.000 85.381 251.309 1 0.014 0.296 Control Verrucomicrobiae| 0.000 13.000 1.071 3.452 0.014 1 0.075 UC Verrucomicrobiae| 0.000 2103.000 95.811 357.421 0.296 0.075 1 CD Betaproteobacteria| 14.000 44407.000 4215.810 10576.956 1 0.120 0.002 Control Betaproteobacteria| 27.000 74113.000 12641.071 23053.369 0.120 1 0.306 UC Betaproteobacteria| 26.000 129123.000 14407.270 26352.478 0.002 0.306 1 CD ORDER Pasteurellales| 0.000 446.000 24.238 96.821 1 0.003 0.002 Control Pasteurellales|UC 0.000 6141.000 661.857 1682.557 0.003 1 0.544 Pasteurellales|CD 0.000 998.000 75.135 190.092 0.002 0.544 1 Chromatiales| 0.000 1.000 0.048 0.218 1 0.003 0.009 Control Chromatiales|UC 0.000 12.000 2.071 3.407 0.003 1 0.331 Chromatiales|CD 0.000 30.000 2.054 5.637 0.009 0.331 1 Burkholderiales| 9.000 44407.000 4150.000 10590.948 1 0.764 0.015 Control Burkholderiales|UC 5.000 52910.000 6830.000 14990.496 0.764 1 0.073 Burkholderiales|CD 9.000 128561.000 13994.270 26364.706 0.015 0.073 1 Selenomonadales| 23.000 16688.000 1555.333 3588.392 1 0.020 0.008 Control Selenomonadales| 95.000 39966.000 10613.357 14349.888 0.020 1 0.799 UC Selenomonadales| 27.000 74088.000 8759.081 15370.608 0.008 0.799 1 CD Clostridiales|Control 172357.000 466967.000 290267.619 92133.596 1 0.006 0.054 Clostridiales|UC 37917.000 356417.000 186558.857 84887.572 0.006 1 0.173 Clostridiales|CD 9292.000 413730.000 227233.919 109052.061 0.054 0.173 1 Hydrogenophilales| 0.000 0.000 0.000 0.000 1 0.008 0.660 Control Hydrogenophilales| 0.000 2.000 0.286 0.611 0.008 1 0.011 UC Hydrogenophilales| 0.000 2.000 0.054 0.329 0.660 0.011 1 CD Oceanospirillales| 0.000 4777.000 381.000 1090.456 1 0.007 0.127 Control Oceanospirillales| 1.000 8453.000 1310.500 2596.743 0.007 1 0.100 UC Oceanospirillales| 0.000 2349.000 180.459 413.881 0.127 0.100 1 CD Rhizobiales|Control 0.000 2.000 0.238 0.539 1 0.001 0.537 Rhizobiales|UC 0.000 170.000 23.786 55.134 0.001 1 0.002 Rhizobiales|CD 0.000 67.000 4.243 14.245 0.537 0.002 1 Verrucomicrobiales| 0.000 1098.000 85.381 251.309 1 0.014 0.296 Control Verrucomicrobiales| 0.000 13.000 1.071 3.452 0.014 1 0.075 UC Verrucomicrobiales| 0.000 2103.000 95.811 357.421 0.296 0.075 1 CD FAMILY Verrucomicrobiaceae| 0.000 1098.000 85.381 251.309 1 0.014 0.296 Control Verrucomicrobiaceae| 0.000 13.000 1.071 3.452 0.014 1 0.075 UC Verrucomicrobiaceae| 0.000 2103.000 95.811 357.421 0.296 0.075 1 CD Staphylococcaceae| 0.000 4079.000 355.333 910.119 1 0.345 0.009 Control Staphylococcaceae| 0.000 229.000 59.000 80.285 0.345 1 0.216 UC Staphylococcaceae| 0.000 5529.000 222.270 934.404 0.009 0.216 1 CD Lachnospiraceae| 1485.000 244085.000 73731.762 57312.252 1 0.006 0.058 Control Lachnospiraceae| 1094.000 83206.000 26960.929 25720.429 0.006 1 0.178 UC Lachnospiraceae| 388.000 160635.000 47128.243 45439.902 0.058 0.178 1 CD Halomonadaceae| 0.000 55.000 2.667 11.993 1 0.014 0.263 Control Halomonadaceae| 0.000 711.000 52.857 189.465 0.014 1 0.083 UC Halomonadaceae| 0.000 12.000 0.811 2.246 0.263 0.083 1 CD Pasteurellaceae| 0.000 446.000 24.238 96.821 1 0.003 0.002 Control Pasteurellaceae|UC 0.000 6141.000 661.857 1682.557 0.003 1 0.544 Pasteurellaceae|CD 0.000 998.000 75.135 190.092 0.002 0.544 1 Paenibacillaceae| 0.000 181.000 32.000 44.159 1 0.014 0.009 Control Paenibacillaceae| 0.000 53.000 8.286 14.435 0.014 1 0.658 UC Paenibacillaceae| 0.000 617.000 23.730 100.869 0.009 0.658 1 CD Listeriaceae|Control 0.000 11.000 1.381 3.008 1 0.310 0.011 Listeriaceae|UC 0.000 3.000 0.286 0.825 0.310 1 0.272 Listeriaceae|CD 0.000 2.000 0.054 0.329 0.011 0.272 1 Bradyrhizobiaceae| 0.000 2.000 0.190 0.512 1 0.006 0.604 Control Bradyrhizobiaceae| 0.000 32.000 3.714 8.914 0.006 1 0.010 UC Bradyrhizobiaceae| 0.000 57.000 3.216 11.814 0.604 0.010 1 CD Methylococcaceae| 0.000 2.000 0.190 0.512 1 0.004 0.243 Control Methylococcaceae| 0.000 351.000 30.929 94.613 0.004 1 0.032 UC Methylococcaceae| 0.000 4.000 0.243 0.830 0.243 0.032 1 CD Hydrogenophilaceae| 0.000 0.000 0.000 0.000 1 0.008 0.660 Control Hydrogenophilaceae| 0.000 2.000 0.286 0.611 0.008 1 0.011 UC Hydrogenophilaceae| 0.000 2.000 0.054 0.329 0.660 0.011 1 CD GENUS Porphyromonas| 0.000 1.000 0.143 0.359 1 0.002 0.443 Control Porphyromonas|UC 0.000 42.000 6.286 12.073 0.002 1 0.007 Porphyromonas|CD 0.000 16.000 1.000 2.963 0.443 0.007 1 Lautropia|Control 0.000 1.000 0.048 0.218 1 0.001 0.555 Lautropia|UC 0.000 57.000 5.286 15.097 0.001 1 <0.0001 Lautropia|CD 0.000 0.000 0.000 0.000 0.555 <0.0001 1 Methylobacterium| 0.000 1.000 0.048 0.218 1 0.004 0.243 Control Methylobacterium| 0.000 103.000 12.786 31.740 0.004 1 0.032 UC Methylobacterium| 0.000 11.000 1.000 2.759 0.243 0.032 1 CD Akkermansia| 0.000 1098.000 85.381 251.309 1 0.014 0.296 Control Akkermansia|UC 0.000 13.000 1.071 3.452 0.014 1 0.075 Akkermansia|CD 0.000 2103.000 95.811 357.421 0.296 0.075 1 Tannerella|Control 0.000 60.000 2.857 13.093 1 0.042 0.431 Tannerella|UC 0.000 1.000 0.214 0.426 0.042 1 0.004 Tannerella|CD 0.000 0.000 0.000 0.000 0.431 0.004 1 Haemophilus| 0.000 11.000 1.381 2.941 1 0.007 0.010 Control Haemophilus|UC 0.000 722.000 79.714 190.874 0.007 1 0.478 Haemophilus|CD 0.000 600.000 30.568 101.515 0.010 0.478 1 Finegoldia|Control 0.000 1.000 0.048 0.218 1 0.014 0.941 Finegoldia|UC 0.000 303.000 30.643 84.514 0.014 1 0.009 Finegoldia|CD 0.000 1.000 0.054 0.229 0.941 0.009 1 Turicibacter|Control 0.000 866.000 70.190 198.733 1 0.007 0.006 Turicibacter|UC 0.000 2.000 0.286 0.611 0.007 1 0.569 Turicibacter|CD 0.000 1456.000 39.919 239.274 0.006 0.569 1 Nitrincola|Control 0.000 88.000 6.762 20.630 1 0.008 0.021 Nitrincola|UC 0.000 4354.000 397.071 1158.944 0.008 1 0.360 Nitrincola|CD 0.000 1068.000 38.676 175.578 0.021 0.360 1 Hydrogenophilus| 0.000 0.000 0.000 0.000 1 0.008 0.660 Control Hydrogenophilus| 0.000 2.000 0.286 0.611 0.008 1 0.011 UC Hydrogenophilus| 0.000 2.000 0.054 0.329 0.660 0.011 1 CD Listeria|Control 0.000 11.000 1.381 3.008 1 0.310 0.011 Listeria|UC 0.000 3.000 0.286 0.825 0.310 1 0.272 Listeria|CD 0.000 2.000 0.054 0.329 0.011 0.272 1 Actinobacillus| 0.000 6.000 0.571 1.535 1 0.005 0.018 Control Actinobacillus|UC 0.000 1806.000 138.786 480.704 0.005 1 0.307 Actinobacillus|CD 0.000 243.000 15.649 45.935 0.018 0.307 1 Anaerococcus| 0.000 20.000 1.095 4.358 1 0.001 0.054 Control Anaerococcus|UC 0.000 23670.000 1740.571 6312.547 0.001 1 0.065 Anaerococcus|CD 0.000 1602.000 46.324 263.052 0.054 0.065 1 Catonella|Control 0.000 8.000 0.524 1.750 1 0.133 0.231 Catonella|UC 0.000 13.000 2.071 3.990 0.133 1 0.007 Catonella|CD 0.000 19.000 0.595 3.149 0.231 0.007 1 Mobiluncus|Control 0.000 0.000 0.000 0.000 1 0.007 0.677 Mobiluncus|UC 0.000 3.000 0.500 1.092 0.007 1 0.009 Mobiluncus|CD 0.000 1.000 0.027 0.164 0.677 0.009 1 Pantoea|Control 0.000 0.000 0.000 0.000 1 0.058 0.002 Pantoea|UC 0.000 8.000 1.071 2.401 0.058 1 0.523 Pantoea|CD 0.000 99.000 3.432 16.194 0.002 0.523 1 Enterobacter| 0.000 17.000 1.810 3.829 1 0.003 0.109 Control Enterobacter|UC 0.000 10592.000 778.786 2824.745 0.003 1 0.057 Enterobacter|CD 0.000 3590.000 105.892 588.904 0.109 0.057 1 Paenibacillus| 0.000 181.000 31.952 44.147 1 0.013 0.007 Control Paenibacillus|UC 0.000 53.000 8.214 14.412 0.013 1 0.699 Paenibacillus|CD 0.000 617.000 23.595 100.894 0.007 0.699 1 Staphylococcus| 0.000 4079.000 353.762 910.667 1 0.224 0.010 Control Staphylococcus|UC 0.000 229.000 58.357 80.759 0.224 1 0.370 Staphylococcus|CD 0.000 5529.000 214.649 925.461 0.010 0.370 1 Vitreoscilla|Control 0.000 37.000 2.286 8.057 1 0.009 0.319 Vitreoscilla|UC 0.000 1667.000 128.357 443.285 0.009 1 0.044 Vitreoscilla|CD 0.000 15.000 1.622 3.192 0.319 0.044 1 Alcanivorax|Control 0.000 0.000 0.000 0.000 1 0.012 1.000 Alcanivorax|UC 0.000 5.000 0.643 1.646 0.012 1 0.006 Alcanivorax|CD 0.000 0.000 0.000 0.000 1.000 0.006 1 Veillonella|Control 6.000 1213.000 187.571 292.401 1 0.003 0.106 Veillonella|UC 23.000 38298.000 8985.571 13795.955 0.003 1 0.063 Veillonella|CD 7.000 17002.000 2107.243 4464.809 0.106 0.063 1 Tatumella|Control 0.000 61.000 3.381 13.347 1 0.014 0.090 Tatumella|UC 0.000 1836.000 175.643 501.883 0.014 1 0.224 Tatumella|CD 0.000 71.000 5.054 13.894 0.090 0.224 1 Afipia|Control 0.000 1.000 0.095 0.301 1 0.027 0.913 Afipia|UC 0.000 30.000 2.429 7.949 0.027 1 0.012 Afipia|CD 0.000 3.000 0.135 0.536 0.913 0.012 1
[0113] Certain bacterial taxa exhibit higher levels (abundance) in UC or CD or IBD patients and some taxa exhibit lower levels in UC or CD or IBD patients. Therefore, an assay on a gut sample from a patient can be performed to measure an abundance (or level) of a bacterial taxa and by comparing this abundance to that of a predetermined abundance or an average abundance (as in tables 1 or 2) of the taxa derived from sample of patients with UC or CD or IBD. The result allows one to determine whether a patient has UC or CD or IBD.
[0114] The abundance or level of bacterial taxa can be determined for example by quantitative DNA analysis such as quantitative polymerase chain reaction. As described above the data can be normalized (example subsampling normalization) as would be known in the art. Therefore the results discussed in the present application can represent relative abundance. It will be appreciated that a person skilled in the art would know to interpret these values to determine the relative levels of bacteria.
[0115] A method is also provided in which a diagnosis of UC or CD or IBD is achieved by collecting a gut sample from a patient and from which bacterial taxa levels will be determined using an assay as described above. The gut sample may be from the flushing of the colon wall as described above and still further described below or from stools.
[0116] Certain taxa exhibit a statistically significant difference in their abundance between UC patients and CD patients. Therefore by comparing the relative abundance of one or more of these taxa between UC and CD patients it is possible to determine whether the patient has CD or UC disease. For example, Hydrogenophilus is more abundant in both CD and UC patients relative to healthy individuals and furthermore it is more abundant in UC patients than CD patients.
[0117] In another aspect of the invention the severity of the disease can also be assessed from the bacterial profile of the gut microbiota. Thus, the severity of CD can be established by measuring the relative abundance of certain bacterial taxa in a gut microbiota sample. In this respect, the relative abundance of one or more microbial taxa from the gut can be compared/correlated with a standard disease activity index. The resulting classification allows the use of relative abundance of bacterial taxa as an indicator of disease severity (Table 3). It will be appreciated that abundance measurements from one or more bacterial taxa can be used for that purpose.
[0118] Supplementary Table 6: Taxa that varies significantly in abundance in CD patients in at least one of the three pairwise comparisons performed (mild vs. moderate; mild vs. sever; and moderate vs. severe). In table 3 the number of 16S rDNA reads in each sample was normalized by random subsampling to 500,000. Minimum and maximum correspond to the minimum and maximum number of reads obtained; mean corresponds to the mean of the number of reads obtained. P values were generated using a Kruskal-Wallis test with a Dunn's post hoc test and a Bonferroni correction for multiple hypotheses. p|mild indicates the P values obtained by comparison to the CD patients with a mild inflammation; p|moderate and p|severe indicate the P values obtained by comparison to CD patients with a moderate and severe inflammation respectively. Values in bold indicate significance (P<0.05).
TABLE-US-00003 TABLE 3 Std. p| p| p| Variable Minimum Maximum Mean deviation mild severe moderate PHYLUM None CLASS Clostridia|Mild 174469.000 413730.000 312892.000 87462.076 1 0.012 0.105 Clostridia|Severe 9293.000 407027.000 198223.435 105908.496 0.012 1 0.860 Clostridia|Moderate 59849.000 289226.000 206514.200 90299.691 0.105 0.860 1 Betaproteobacteria|Mild 26.000 29550.000 4640.333 9490.562 1 0.170 0.013 Betaproteobacteria|Severe 60.000 54643.000 10878.696 15121.993 0.170 1 0.084 Betaproteobacteria| 2685.000 129123.000 48219.200 55650.162 0.013 0.084 1 Moderate ORDER Clostridiales|Mild 174469.000 413730.000 312892.000 87462.076 1 0.012 0.105 Clostridiales|Severe 9292.000 407027.000 198219.870 105908.987 0.012 1 0.860 Clostridiales|Moderate 59849.000 289225.000 206514.000 90299.462 0.105 0.860 1 FAMILY Staphylococcaceae|Mild 4.000 1507.000 255.222 507.068 1 0.025 0.002 Staphylococcaceae|Severe 0.000 5529.000 257.522 1149.930 0.025 1 0.089 Staphylococcaceae| 0.000 2.000 0.800 0.837 0.002 0.089 1 Moderate Propionibacteriaceae|Mild 0.000 1.000 0.556 0.527 1 0.016 0.484 Propionibacteriaceae|Severe 0.000 363.000 33.652 88.327 0.016 1 0.007 Propionibacteriaceae| 0.000 1.000 0.200 0.447 0.484 0.007 1 Moderate Acidaminococcaceae|Mild 0.000 4.000 1.111 1.691 1 0.003 0.030 Acidaminococcaceae| 0.000 36271.000 2476.261 7722.681 0.003 1 0.965 Severe Acidaminococcaceae| 0.000 8395.000 1712.000 3736.459 0.030 0.965 1 Moderate Bacillaceae|Mild 0.000 136.000 16.000 45.008 1 0.137 0.281 Bacillaceae|Severe 0.000 6167.000 427.174 1339.746 0.137 1 0.016 Bacillaceae|Moderate 0.000 3.000 0.600 1.342 0.281 0.016 1 Carnobacteriaceae|Mild 13.000 643.000 155.222 229.710 1 0.206 0.148 Carnobacteriaceae|Severe 5.000 76920.000 3723.870 15973.648 0.206 1 0.008 Carnobacteriaceae| 4.000 78.000 26.200 30.136 0.148 0.008 1 Moderate Sutterellaceae|Mild 2.000 1157.000 136.889 382.665 1 0.004 0.004 Sutterellaceae|Severe 1.000 54546.000 7005.435 15182.702 0.004 1 0.342 Sutterellaceae|Moderate 9.000 128471.000 42805.000 59466.785 0.004 0.342 1 GENUS Atopobium|Mild 1.000 257.000 60.778 81.208 1 0.704 0.056 Atopobium|Severe 0.000 1273.000 118.652 263.676 0.704 1 0.014 Atopobium|Moderate 0.000 7.000 4.800 2.775 0.056 0.014 1 Propionibacterium|Mild 0.000 1.000 0.556 0.527 1 0.016 0.484 Propionibacterium|Severe 0.000 363.000 33.652 88.327 0.016 1 0.007 Propionibacterium|Moderate 0.000 1.000 0.200 0.447 0.484 0.007 1 Trichococcus|Mild 0.000 3.000 0.556 1.014 1 0.002 0.031 Trichococcus|Severe 0.000 0.000 0.000 0.000 0.002 1 1.000 Trichococcus|Moderate 0.000 0.000 0.000 0.000 0.031 1.000 1 Pectobacterium|Mild 0.000 0.000 0.000 0.000 1 1.000 0.029 Pectobacterium|Severe 0.000 0.000 0.000 0.000 1.000 1 0.014 Pectobacterium|Moderate 0.000 80.000 16.000 35.777 0.029 0.014 1 Granulicatella|Mild 13.000 581.000 145.444 215.009 1 0.229 0.167 Granulicatella|Severe 5.000 74250.000 3494.130 15434.318 0.229 1 0.012 Granulicatella|Moderate 3.000 78.000 25.000 30.406 0.167 0.012 1 Jonquetella|Mild 0.000 0.000 0.000 0.000 1 1.000 0.029 Jonquetella|Severe 0.000 0.000 0.000 0.000 1.000 1 0.014 Jonquetella|Moderate 0.000 83.000 16.600 37.119 0.029 0.014 1 Riemerella|Mild 0.000 0.000 0.000 0.000 1 1.000 0.002 Riemerella|Severe 0.000 0.000 0.000 0.000 1.000 1 0.000 Riemerella|Moderate 0.000 3.000 0.800 1.304 0.002 0.000 1 Mogibacterium|Mild 0.000 45.000 7.556 14.934 1 0.187 0.207 Mogibacterium|Severe 0.000 376.000 34.478 82.168 0.187 1 0.013 Mogibacterium|Moderate 0.000 1.000 0.200 0.447 0.207 0.013 1 Staphylococcus|Mild 4.000 1247.000 226.333 428.093 1 0.024 0.002 Staphylococcus|Severe 0.000 5529.000 256.565 1150.035 0.024 1 0.090 Staphylococcus|Moderate 0.000 2.000 0.800 0.837 0.002 0.090 1 Sutterella|Mild 2.000 1157.000 136.889 382.665 1 0.004 0.004 Sutterella|Severe 1.000 54546.000 7005.435 15182.702 0.004 1 0.342 Sutterella|Moderate 9.000 128471.000 42805.000 59466.785 0.004 0.342 1 Phascolarctobacterium|Mild 0.000 4.000 1.111 1.691 1 0.003 0.030 Phascolarctobacterium| 0.000 36271.000 2476.261 7722.681 0.003 1 0.965 Severe Phascolarctobacterium| 0.000 8395.000 1712.000 3736.459 0.030 0.965 1 Moderate Comamonas|Mild 0.000 3.000 0.667 1.118 1 0.016 0.054 Comamonas|Severe 0.000 1.000 0.043 0.209 0.016 1 0.792 Comamonas|Moderate 0.000 0.000 0.000 0.000 0.054 0.792 1 Hylemonella|Mild 0.000 0.000 0.000 0.000 1 1.000 0.029 Hylemonella|Severe 0.000 0.000 0.000 0.000 1.000 1 0.014 Hylemonella|Moderate 0.000 1.000 0.200 0.447 0.029 0.014 1 Xenorhabdus|Mild 0.000 0.000 0.000 0.000 1 1.000 0.029 Xenorhabdus|Severe 0.000 0.000 0.000 0.000 1.000 1 0.014 Xenorhabdus|Moderate 0.000 1.000 0.200 0.447 0.029 0.014 1 Averyella|Mild 0.000 0.000 0.000 0.000 1 1.000 0.029 Averyella|Severe 0.000 0.000 0.000 0.000 1.000 1 0.014 Averyella|Moderate 0.000 11.000 2.200 4.919 0.029 0.014 1
[0119] It will be appreciated that it is possible to refine the assessment of the stage or severity of the disease by combining the measurement(s) of the abundance of bacterial taxa with the observation of a choice of symptoms underlying the classic disease indexes to arrive at the establishment of a diagnosis. For example it may be desirable or sometimes only possible to measure only a limited set of standard symptoms associated with disease indexes. This limited set of symptoms may not be sufficient to pose a diagnostic. In such cases it may be possible to combine an assay involving the measurement of bacterial taxa to provide additional information on the nature or stage of the disease.
[0120] In an aspect of the invention A. parvulum, an H.sub.2S producer, is a good marker of CD exhibiting a higher relative abundance in patient with CD than in controls. Furthermore, the relative abundance of A. parvulum compared to core bacterial taxa abundance is also a measure of the presence and severity of the disease. For example an abundance of A. parvulum relative to the core greater than 0.005% is indicative of moderate or severe stage of the disease (
[0121] In yet another aspect of the invention a decrease in the relative abundance of butyrate producers such as Firmicutes, Clostridia, Clostridiales and Lachnopiraceae Eubacterium and Faecalibacterium is indicative of the presence of disease (CD or UC).
[0122] The measurements of the abundance of bacterial taxa using DNA quantification can generally be done by methods that are known in the art. However in one aspect of the invention there is provided a method for determining the abundance of A. parvulum by absolute quantitative DNA measurement by performing PCR on the extracted metagenomic DNA. The following primers for the quantitative measurements of A. parvulum were developed: Aparv-711F 5-GGGGAGTATTTCTTCCGTGCCG-3 (SEQ ID NO. 1) and Aparv-881R 5-CTTCACCTAAATGTCAA GCCCTGG-3 (SEQ ID NO. 2). The development of these primers enables the use of an assay for measuring the abundance of A. parvulum that is highly specific, rapid and reliable. Thus in an another aspect of the invention there is also provided kits that would comprise these primers and other reagents as would be known in the art to detect A. parvulum or other taxa useful for the diagnosis, assessment or staging of UC, CD or IBD as described herein.
[0123] In further embodiment of the invention, the presence of UC and CD disease can be assessed by the presence, absence and/or relative abundance of certain host proteins. Proteins can be identified and measured by techniques known in the art such as shotgun mass-spectrometry in conjunction with protein fractionation. Other method for detecting specific proteins such as, immunology based methods (antibodies), western blots, spectrophotometry, enzyme assays, ELISA and any other method as would be known to one skilled in the art may also be used.
[0124] Table 4 provides a list of all differentially expressed proteins and their variable importance in projection scores (VIP) derived from the calculated PLS-DA. (Control v. CD with increasing inflammation severity)
TABLE-US-00004 TABLE 4 Comp 1 Comp 2 Comp 3 Variable VIP VIP VIP General transcription factor IIA subunit 1; TFIIA p19 subunit; TFIIA p35 2.513 1.975 1.814 subunit; TFIIAL; Transcription initiation factor IIA alpha chain; Transcription initiation factor IIA beta chain; Transcription initiation factor IIA subunit 1; Transcription initiation factor TFIIA 42 kDa subunit Angiotensin-binding protein; Microsomal endopeptidase; Mitochondrial oligopeptidase 2.296 1.901 1.745 M; Neurolysin, mitochondrial; Neurotensin endopeptidase Defensin, alpha 5; Defensin-5 2.013 1.575 1.399 Mineral dust-induced gene protein; MYC-induced nuclear antigen; Nucleolar protein 52 1.942 1.793 1.585 Glutaminase kidney isoform, mitochondrial; K-glutaminase; L-glutamine amidohydrolase 1.880 1.538 1.358 Ethanolaminephosphotransferase 1; Selenoprotein I; Putative uncharacterized protein 1.853 1.918 1.702 ENSP00000385426; Putative uncharacterized protein ENSP00000391804 18S rRNA dimethylase; DIM1 dimethyladenosine transferase 1-like; Probable 1.790 1.524 1.435 dimethyladenosine transferase; S-adenosylmethionine-6-N,N-adenosyl(rRNA) dimethyltransferase 6PF-2-K/Fru-2,6-P2ase heart-type isozyme; 6-phosphofructo-2-kinase; 6-phosphofructo-2- 1.717 1.442 1.275 kinase/fructose-2,6-biphosphatase 2; Fructose-2,6-bisphosphatase Armadillo repeat-containing protein 8; cDNA FLJ56387, highly similar to Mus musculus 1.692 1.548 1.376 armadillo repeat containing 8 (Armc8), mRNA; Putative uncharacterized protein ARMC8; Armadillo repeat containing 8, isoform CRA_g; cDNA FLJ53383, highly similar to Homo sapiens armadillo repeat containing 8 (ARMC8), transcript variant 2, mRNA Aconitase 2, mitochondrial; Aconitate hydratase, mitochondrial; Citrate hydro-lyase; cDNA 1.645 1.338 1.191 FLJ60429, highly similar to Aconitate hydratase, mitochondrial (EC 4.2.1.3); cDNA FLJ50886, highly similar to Aconitate hydratase, mitochondrial (EC 4.2.1.3) 2C40; Class II mMOB1; Mob1 homolog 3; Mps one binder kinase activator-like 1.634 1.359 1.203 3; Preimplantation protein 3; cDNA FLJ52887, highly similar to Preimplantation protein 3 Iron-sulfur subunit of complex II; Succinate dehydrogenase [ubiquinone] iron-sulfur 1.612 1.266 1.216 subunit, mitochondrial Reticulocalbin-1; cDNA FLJ55835, highly similar to Reticulocalbin-1 1.593 1.238 1.093 DRB sensitivity-inducing factor 14 kDa subunit; DRB sensitivity-inducing factor small 1.592 1.247 1.102 subunit; Transcription elongation factor SPT4 Rhodanese; Thiosulfate sulfurtransferase 1.590 1.257 1.112 22 kDa protein; CP-22; Sorcin; V19; Putative uncharacterized protein SRI; cDNA FLJ60640, 1.589 1.282 1.144 highly similar to Sorcin; cDNA FLJ54267, moderately similar to Sorcin Flavoprotein subunit of complex II; Succinate dehydrogenase [ubiquinone] flavoprotein 1.576 1.225 1.169 subunit, mitochondrial Acetylneuraminyl hydrolase; G9 sialidase; Lysosomal sialidase; N-acetyl-alpha- 1.562 1.955 1.773 neuraminidase 1; Sialidase-1 Beta-IV spectrin; Spectrin beta chain, brain 3; Spectrin, non-erythroid beta chain 3; Putative 1.557 1.291 1.194 uncharacterized protein SPTBN4 Translocation protein SEC63 homolog 1.542 1.555 1.373 Epidermal-type fatty acid-binding protein; Fatty acid-binding protein 5; Fatty acid-binding 1.540 1.206 1.071 protein, epidermal; Psoriasis-associated fatty acid-binding protein homolog Complex I-51 kD; NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial; NADH 1.530 1.205 1.205 dehydrogenase flavoprotein 1; NADH-ubiquinone oxidoreductase 51 kDa subunit; cDNA FLJ57949, highly similar to NADH-ubiquinone oxidoreductase 51 kDa subunit, mitochondrial (EC 1.6.5.3); cDNA, FLJ79021, highly similar to NADH-ubiquinone oxidoreductase 51 kDa subunit, mitochondrial (EC 1.6.5.3) Calregulin; Calreticulin; CRP55; Endoplasmic reticulum resident protein 1.528 1.220 1.077 60; grp60; HACBP; cDNA FLJ58668, highly similar to Calreticulin UDP-glucose 6-dehydrogenase; cDNA FLJ60093, highly similar to UDP-glucose 6- 1.522 1.183 1.052 dehydrogenase (EC 1.1.1.22) 4-alpha-glucanotransferase; Amylo-alpha-1,6-glucosidase; Dextrin 6-alpha-D- 1.516 1.200 1.072 glucosidase; Glycogen debrancher; Glycogen debranching enzyme; Oligo-1,4-1,4- glucantransferase Malic enzyme 2; NAD-dependent malic enzyme, mitochondrial 1.514 1.225 1.081 Delta(3), delta(2)-enoyl-CoA isomerase; Diazepam-binding inhibitor-related protein 1.513 1.178 1.046 1; Dodecenoyl-CoA isomerase; DRS-1; Hepatocellular carcinoma-associated antigen 88; Peroxisomal 3,2-trans-enoyl-CoA isomerase; Renal carcinoma antigen NY-REN- 1; Putative uncharacterized protein PECI Complex I-75 kD; NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial; cDNA 1.510 1.324 1.181 FLJ60586, highly similar to NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial (EC 1.6.5.3) cDNA FLJ53665, highly similar to Four and a half LIM domains protein 1; Four and a half 1.500 1.168 1.031 LIM domains 1; Four and a half LIM domains protein 1; Skeletal muscle LIM-protein 1 Putative adenosylhomocysteinase 3; S-adenosylhomocysteine hydrolase-like protein 2; S- 1.499 1.165 1.031 adenosyl-L-homocysteine hydrolase 3 28S ribosomal protein S9, mitochondrial 1.489 1.198 1.121 150 kDa oxygen-regulated protein; 170 kDa glucose-regulated protein; Hypoxia up- 1.480 1.179 1.041 regulated protein 1; cDNA FLJ54708, highly similar to 150 kDa oxygen-regulated protein (Orp150) Complex I-39 kD; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, 1.466 1.152 1.083 mitochondrial; NADH-ubiquinone oxidoreductase 39 kDa subunit DDAHI; Dimethylargininase-1; N(G), N(G)-dimethylarginine dimethylaminohydrolase 1.465 1.177 1.072 1; cDNA FLJ54083, highly similar to NG,NG-dimethylarginine dimethylaminohydrolase 1 (EC 3.5.3.18); cDNA FLJ54119, highly similar to NG,NG-dimethylarginine dimethylaminohydrolase 1 (EC 3.5.3.18) Phenylalanine--tRNA ligase beta chain; Phenylalanyl-tRNA synthetase beta chain 1.462 1.154 1.080 ABP-278; ABP-280 homolog; Actin-binding-like protein; Beta-filamin; Filamin homolog 1.462 1.166 1.032 1; Filamin-3; Filamin-B; Thyroid autoantigen; Truncated actin-binding protein GTP-specific succinyl-CoA synthetase subunit beta; Succinyl-CoA ligase [GDP-forming] 1.459 1.151 1.018 subunit beta, mitochondrial; Succinyl-CoA synthetase beta-G chain TPPP/p20; Tubulin polymerization-promoting protein family member 3 1.455 1.376 1.275 F8W031; F8VXJ7; F8VP03 1.450 1.187 1.058 Protein NipSnap homolog 1 1.438 1.119 0.993 78 kDa gastrin-binding protein; Long chain 3-hydroxyacyl-CoA dehydrogenase; Long-chain 1.434 1.118 1.032 enoyl-CoA hydratase; TP-alpha; Trifunctional enzyme subunit alpha, mitochondrial Antioxidant enzyme AOE372; Peroxiredoxin IV; Peroxiredoxin-4; Thioredoxin peroxidase 1.421 1.144 1.011 AO372; Thioredoxin-dependent peroxide reductase A0372 Calumenin; Crocalbin; IEF SSP 9302 1.418 1.286 1.136 GTPase IMAP family member 4; Immunity-associated nucleotide 1 protein; Immunity- 1.418 1.105 0.975 associated protein 4; cDNA FLJ51351, highly similar to GTPase, IMAP family member 4 Plakophilin-2; Truncated plakophilin-2 1.417 1.103 1.000 Adaptor protein complex AP-1 mu-2 subunit; Adaptor-related protein complex 1 mu-2 1.417 1.262 1.117 subunit; AP-1 complex subunit mu-2; AP-mu chain family member mu1B; Clathrin assembly protein complex 1 medium chain 2; Golgi adaptor HA1/AP1 adaptin mu-2 subunit; Mu1B- adaptin; Mu-adaptin 2 Complex III subunit 1; Core protein I; Cytochrome b-c1 complex subunit 1, 1.413 1.209 1.071 mitochondrial; Ubiquinol-cytochrome-c reductase complex core protein 1 90 kDa ribosomal protein S6 kinase 3; Insulin-stimulated protein kinase 1; MAP kinase- 1.410 1.200 1.080 activated protein kinase 1b; pp90RSK2; Ribosomal protein S6 kinase alpha-3; Ribosomal S6 kinase 2; cDNA, FLJ79381, highly similar to Ribosomal protein S6 kinase alpha-3 (EC 2.7.11.1); cDNA FLJ56618, highly similar to Ribosomal protein S6 kinase alpha-3 (EC 2.7.11.1) 3-5 RNA exonuclease OLD35; PNPase old-35; Polynucleotide phosphorylase 1.407 1.255 1.155 1; Polynucleotide phosphorylase-like protein; Polyribonucleotide nucleotidyltransferase 1, mitochondrial Complex I-B15; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 4; NADH- 1.397 1.113 1.010 ubiquinone oxidoreductase B15 subunit; Putative uncharacterized protein NDUFB4 Carnitine O-palmitoyltransferase 2, mitochondrial; Carnitine palmitoyltransferase II 1.396 1.089 0.976 Aldehyde dehydrogenase 5; Aldehyde dehydrogenase family 1 member B1; Aldehyde 1.393 1.120 0.988 dehydrogenase X, mitochondrial; cDNA FLJ51238, highly similar to Aldehyde dehydrogenase X, mitochondrial (EC 1.2.1.3) Coatomer subunit epsilon; Epsilon-coat protein; Coatomer protein complex, subunit 1.388 1.080 0.959 epsilon, isoform CRA_e; Putative uncharacterized protein COPE Ethylmalonic encephalopathy protein 1; Hepatoma subtracted clone one protein; Protein 1.383 1.090 0.974 ETHE1, mitochondrial SRA stem-loop-interacting RNA-binding protein, mitochondrial 1.382 1.075 0.960 15-hydroxyprostaglandin dehydrogenase [NADP+]; Carbonyl reductase [NADPH] 1.379 1.085 1.043 1; NADPH-dependent carbonyl reductase 1; Prostaglandin 9-ketoreductase; Prostaglandin- E(2) 9-reductase; Putative uncharacterized protein CBR1; Carbonyl reductase 1, isoform CRA_c; cDNA FLJ60474, highly similar to Carbonyl reductase ER-Golgi intermediate compartment 53 kDa protein; Gp58; Intracellular mannose-specific 1.374 1.129 1.046 lectin MR60; Lectin mannose-binding 1; Protein ERGIC-53 Intestinal trefoil factor; Polypeptide P1.B; Trefoil factor 3 1.369 1.093 0.971 78 kDa glucose-regulated protein; Endoplasmic reticulum lumenal Ca(2+)-binding protein 1.366 1.104 1.046 grp78; Heat shock 70 kDa protein 5; Immunoglobulin heavy chain-binding protein Complex I-13 kD-A; NADH dehydrogenase [ubiquinone] iron-sulfur protein 6, 1.365 1.090 0.968 mitochondrial; NADH-ubiquinone oxidoreductase 13 kDa-A subunit 3-ketoacyl-CoA thiolase, mitochondrial; Acetyl-CoA acyltransferase; Beta- 1.365 1.097 1.028 ketothiolase; Mitochondrial 3-oxoacyl-CoA thiolase; T1 Endoplasmic reticulum resident protein 46; Thioredoxin domain-containing protein 1.363 1.103 0.994 5; Thioredoxin-like protein p46; TXNDC5 protein; cDNA, FLJ96678, Homo sapiens thioredoxin domain containing 5 (TXNDC5), mRNA; HCG1811539, isoform CRA_b Elongation factor Tu, mitochondrial; P43 1.361 1.065 0.985 Outer mitochondrial membrane protein porin 2; Voltage-dependent anion-selective 1.361 1.060 0.938 channel protein 2; Voltage-dependent anion channel 2; cDNA FLJ60120, highly similar to Voltage-dependent anion-selective channel protein 2; cDNA, FLJ78818, highly similar to Voltage-dependent anion-selective channel protein 2 63 kDa membrane protein; Cytoskeleton-associated protein 4 1.361 1.102 0.975 Cytovillin; Ezrin; p81; Villin-2 1.360 1.057 0.937 Myosin I beta; Myosin-Ic 1.359 1.071 0.948 250/210 kDa paraneoplastic pemphigus antigen; Desmoplakin 1.356 1.126 1.002 Very long-chain specific acyl-CoA dehydrogenase, mitochondrial 1.355 1.089 0.983 15-oxoprostaglandin 13-reductase; Prostaglandin reductase 2; Zinc-binding alcohol 1.353 1.160 1.057 dehydrogenase domain-containing protein 1 Complex III subunit 2; Core protein II; Cytochrome b-c1 complex subunit 2, 1.345 1.200 1.182 mitochondrial; Ubiquinol-cytochrome-c reductase complex core protein 2 Aspartate aminotransferase, mitochondrial; Fatty acid-binding protein; Glutamate 1.339 1.041 0.919 oxaloacetate transaminase 2; Plasma membrane-associated fatty acid-binding protein; Transaminase A CML33; Phenylalanine--tRNA ligase alpha chain; Phenylalanyl-tRNA synthetase alpha 1.337 1.179 1.051 chain; cDNA FLJ50378, highly similar to Phenylalanyl-tRNA synthetase alpha chain (EC 6.1.1.20) Sodium pump subunit alpha-1; Sodium/potassium-transporting ATPase subunit alpha- 1.335 1.042 0.927 1; ATPase, Na+/K+ transporting, alpha 1 polypeptide, isoform CRA_a; cDNA FLJ52430, highly similar to Sodium/potassium-transporting ATPase alpha-1 chain (EC 3.6.3.9) Putative uncharacterized protein MLLT4; Afadin; ALL1-fused gene from chromosome 6 1.334 1.277 1.207 protein; Myeloid/lymphoid or mixed-lineage leukemia (Trithorax homolog, Drosophila); translocated to, 4 Cytochrome c oxidase polypeptide Vb; Cytochrome c oxidase subunit 5B, mitochondrial 1.332 1.229 1.092 35 kDa lectin; Carbohydrate-binding protein 35; Galactose-specific lectin 3; Galactoside- 1.328 1.057 0.972 binding protein; Galectin-3; IgE-binding protein; L-31; Laminin-binding protein; Lectin L- 29; Mac-2 antigen Complex I-B22; LYR motif-containing protein 3; NADH dehydrogenase [ubiquinone] 1 beta 1.327 1.179 1.045 subcomplex subunit 9; NADH-ubiquinone oxidoreductase B22 subunit 3-ketoacyl-CoA thiolase; Acetyl-CoA acyltransferase; Beta-ketothiolase; TP- 1.325 1.030 0.972 beta; Trifunctional enzyme subunit beta, mitochondrial; cDNA FLJ56214, highly similar to Trifunctional enzyme subunit beta, mitochondrial; Putative uncharacterized protein HADHB Endoplasmic reticulum resident protein 28; Endoplasmic reticulum resident protein 1.322 1.061 0.938 29; Endoplasmic reticulum resident protein 31 Alu corepressor 1; Antioxidant enzyme B166; Liver tissue 2D-page spot 71B; Peroxiredoxin 1.316 1.071 0.947 V; Peroxiredoxin-5, mitochondrial; Peroxisomal antioxidant enzyme; PLP; Thioredoxin peroxidase PMP20; Thioredoxin reductase; TPx type VI; Putative uncharacterized protein PRDX5 ER-Golgi SNARE of 24 kDa; SEC22 vesicle-trafficking protein homolog B; SEC22 vesicle- 1.315 1.023 0.937 trafficking protein-like 1; Vesicle-trafficking protein SEC22b Calcium-binding mitochondrial carrier protein Aralar2; Citrin; Mitochondrial aspartate 1.314 1.021 0.944 glutamate carrier 2; Solute carrier family 25 member 13 RRP12-like protein 1.311 1.083 0.961 Endoplasmic reticulum resident protein 70; Endoplasmic reticulum resident protein 1.311 1.110 0.980 72; Protein disulfide-isomerase A4 Myosin-Id 1.308 1.070 0.944 Actin-depolymerizing factor; Destrin 1.306 1.027 0.918 Complex I-B14.5a; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 1.305 1.115 1.169 7; NADH-ubiquinone oxidoreductase subunit B14.5a Beta-G1; Beta-glucuronidase 1.297 1.019 0.921 Chymotrypsin-like elastase family member 3A; Elastase IIIA; Elastase-3A; Protease E 1.297 1.020 0.910 17-beta-hydroxysteroid dehydrogenase 11; 17-beta-hydroxysteroid dehydrogenase 1.294 1.013 0.895 XI; Cutaneous T-cell lymphoma-associated antigen HD-CL-03; Dehydrogenase/reductase SDR family member 8; Estradiol 17-beta-dehydrogenase 11; Retinal short-chain dehydrogenase/reductase 2 Interleukin-25; Stromal cell-derived growth factor SF20; UPF0556 protein C19orf10 1.292 1.121 0.990 Complex III subunit 3; Complex III subunit III; Cytochrome b; Cytochrome b-c1 complex 1.287 1.237 1.209 subunit 3; Ubiquinol-cytochrome-c reductase complex cytochrome b subunit Cellular thyroid hormone-binding protein; p55; Prolyl 4-hydroxylase subunit beta; Protein 1.285 1.018 0.995 disulfide-isomerase; cDNA FLJ59430, highly similar to Protein disulfide-isomerase (EC 5.3.4.1) Importin-4; Importin-4b; Ran-binding protein 4 1.280 1.268 1.137 94 kDa glucose-regulated protein; Endoplasmin; gp96 homolog; Heat shock protein 90 kDa 1.277 1.040 1.005 beta member 1; Tumor rejection antigen 1 Amine oxidase [flavin-containing] A; Monoamine oxidase type A; cDNA FLJ61220, highly 1.276 1.023 0.903 similar to Amine oxidase (flavin-containing) A (EC 1.4.3.4) Ubiquitin-fold modifier 1 1.269 1.042 1.089 Antigen NY-CO-4; Elongation factor 1-delta 1.267 1.160 1.025 3-phosphoadenosine-5-phosphosulfate synthase; Adenosine-5-phosphosulfate 3- 1.263 0.990 0.874 phosphotransferase; Adenylylsulfate 3-phosphotransferase; Adenylyl-sulfate kinase; APS kinase; ATP-sulfurylase; Bifunctional 3-phosphoadenosine 5-phosphosulfate synthase 2; Sulfate adenylate transferase; Sulfate adenylyltransferase; Sulfurylase kinase 2 Alpha-adducin; Erythrocyte adducin subunit alpha; Adducin 1 (Alpha); Adducin 1 (Alpha), 1.259 1.110 0.981 isoform CRA_e; ADD1 protein Microsomal signal peptidase 25 kDa subunit; Signal peptidase complex subunit 2 1.257 0.978 0.863 Quiescin Q6; Sulfhydryl oxidase 1 1.257 1.111 1.053 Acetoacetyl-CoA thiolase; Acetyl-CoA acetyltransferase, mitochondrial; T2 1.255 0.994 0.887 2-oxoglutarate dehydrogenase complex component E1; 2-oxoglutarate dehydrogenase, 1.254 0.996 0.933 mitochondrial; Alpha-ketoglutarate dehydrogenase Complex III subunit 7; Complex III subunit VII; Cytochrome b-c1 complex subunit 7; QP- 1.251 1.078 0.966 C; Ubiquinol-cytochrome c reductase complex 14 kDa protein; cDNA FLJ52271, moderately similar to Ubiquinol-cytochrome c reductase complex 14 kDa protein (EC 1.10.2.2) Calcium-activated chloride channel family member 1; Calcium-activated chloride channel 1.250 0.983 0.905 protein 1; Calcium-activated chloride channel regulator 1 Complement component 4A (Rodgers blood group); Putative uncharacterized protein 1.249 0.982 0.981 C4A; Complement component C4B (Childo blood group); Complement component C4B (Childo blood group) 2; C4B1 Complement component 4B (Childo blood group) Actin-interacting protein 1; NORI-1; WD repeat-containing protein 1; cDNA FLJ58303, 1.249 1.050 1.050 highly similar to WD repeat protein 1 Catalase 1.245 0.986 0.951 Proteasome subunit alpha type-7; Proteasome subunit RC6-1; Proteasome subunit 1.244 0.988 1.122 XAPC7; Proteasome subunit alpha type Heat shock-related 70 kDa protein 2; cDNA FLJ40505 fis, clone TESTI2045562, highly 1.244 1.032 0.922 similar to HEAT SHOCK-RELATED 70 kDa PROTEIN 2 Endopeptidase SP18; Microsomal signal peptidase 18 kDa subunit; SEC11 homolog 1.240 1.009 1.057 A; SEC11-like protein 1; Signal peptidase complex catalytic subunit SEC11A; SPC18; cDNA FLJ51313, highly similar to Microsomal signal peptidase 18 kDa subunit (EC 3.4..); SEC11-like 1 (S. cerevisiae), isoform CRA_d Inorganic pyrophosphatase; Pyrophosphate phospho-hydrolase; Pyrophosphatase 1.238 0.962 0.998 (Inorganic) 1 Myosin heavy chain 11; Myosin heavy chain, smooth muscle isoform; Myosin- 1.234 0.963 0.862 11; SMMHC; Myosin heavy chain 11 smooth muscle isoform Clathrin heavy chain 1; Clathrin heavy chain on chromosome 17 1.232 0.982 0.869 Villin-1; cDNA FLJ57609, highly similar to Villin-1 1.228 0.979 0.871 Centromere protein V; Nuclear protein p30; Proline-rich protein 6 1.227 1.172 1.067 Cathepsin C; Cathepsin J; Dipeptidyl peptidase 1; Dipeptidyl peptidase 1 exclusion domain 1.224 0.962 0.855 chain; Dipeptidyl peptidase 1 heavy chain; Dipeptidyl peptidase 1 light chain; Dipeptidyl peptidase I; Dipeptidyl peptidase I exclusion domain chain; Dipeptidyl peptidase I heavy chain; Dipeptidyl peptidase I light chain; Dipeptidyl transferase Hydroxyacyl-coenzyme A dehydrogenase, mitochondrial; Medium and short-chain L-3- 1.224 1.009 0.903 hydroxyacyl-coenzyme A dehydrogenase; Short-chain 3-hydroxyacyl-CoA dehydrogenase Aldo-keto reductase family 1 member B10; Aldose reductase-like; Aldose reductase- 1.223 0.954 0.851 related protein; ARL-1; Small intestine reductase Carbonate dehydratase II; Carbonic anhydrase 2; Carbonic anhydrase C; Carbonic 1.223 1.031 0.910 anhydrase II Putative uncharacterized protein PRRC1; Protein PRRC1 1.223 0.951 0.938 Cytosolic malate dehydrogenase; Malate dehydrogenase, cytoplasmic; Malate 1.222 0.988 0.875 dehydrogenase; Putative uncharacterized protein MDH1 Cadherin-associated Src substrate; Catenin delta-1; p120 catenin; p120(cas); Putative 1.222 1.013 0.894 uncharacterized protein CTNND1 Metavinculin; Vinculin 1.221 0.977 0.955 Amphiregulin-associated protein; Midgestation and kidney protein; Midkine; Neurite 1.220 1.206 1.070 outgrowth-promoting factor 2; Neurite outgrowth-promoting protein Putative uncharacterized protein APEH; Acylamino-acid-releasing enzyme; Acylaminoacyl- 1.219 0.973 0.871 peptidase; Acyl-peptide hydrolase; Oxidized protein hydrolase Kallikrein inhibitor; Kallistatin; Peptidase inhibitor 4; Serpin A4 1.218 1.258 1.166 Dihydrolipoamide dehydrogenase; Dihydrolipoyl dehydrogenase, mitochondrial; Glycine 1.213 0.980 0.911 cleavage system L protein; cDNA FLJ50515, highly similar to Dihydrolipoyl dehydrogenase, mitochondrial (EC 1.8.1.4); Dihydrolipoyl dehydrogenase 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase; AICAR 1.212 0.943 0.864 transformylase; ATIC; Bifunctional purine biosynthesis protein PURH; IMP cyclohydrolase; IMP synthase; Inosinicase; Phosphoribosylaminoimidazolecarboxamide formyltransferase Glioma pathogenesis-related protein 2; Golgi-associated plant pathogenesis-related 1.210 1.027 0.947 protein 1; GLI pathogenesis-related 2 Signal transducer and activator of transcription 1-alpha/beta; Transcription factor ISGF-3 1.209 1.167 1.046 components p91/p84 PDHE1-A type I; Pyruvate dehydrogenase E1 component subunit alpha, somatic form, 1.205 0.948 0.932 mitochondrial Glucose phosphomutase 1; Phosphoglucomutase-1; cDNA FLJ50606, highly similar to 1.202 0.935 0.998 Phosphoglucomutase-1 (EC 5.4.2.2) 18 kDa Alu RNA-binding protein; Signal recognition particle 14 kDa protein 1.200 1.015 0.912 Isovaleryl-CoA dehydrogenase, mitochondrial; cDNA FLJ16602 fis, clone TESTI4007816, 1.198 1.177 1.045 highly similar to Isovaleryl-CoA dehydrogenase, mitochondrial (EC 1.3.99.10); Isovaleryl Coenzyme A dehydrogenase, isoform CRA_b Cullin-associated and neddylation-dissociated protein 1; Cullin-associated NEDD8- 1.197 1.039 0.994 dissociated protein 1; p120 CAND1; TBP-interacting protein of 120 kDa A Cytochrome c oxidase polypeptide VIc; Cytochrome c oxidase subunit 6C 1.196 1.056 0.935 Beta-hexosaminidase subunit alpha; Beta-N-acetylhexosaminidase subunit alpha; N- 1.194 1.105 1.110 acetyl-beta-glucosaminidase subunit alpha HCNPpp; Hippocampal cholinergic neurostimulating peptide; Neuropolypeptide 1.193 0.958 0.996 h3; Phosphatidylethanolamine-binding protein 1; Prostatic-binding protein; Raf kinase inhibitor protein; cDNA FLJ51535, highly similar to Phosphatidylethanolamine-binding protein 1 59 kDa serine/threonine-protein kinase; ILK-1; ILK-2; Integrin-linked protein 1.192 1.090 0.965 kinase; p59ILK; cDNA FLJ50979, moderately similar to Integrin-linked protein kinase (EC 2.7.11.1); cDNA FLJ53825, highly similar to Integrin-linked protein kinase 1 (EC 2.7.11.1) Collagen alpha-1(XV) chain; Endostatin; Endostatin-XV; Related to endostatin; Restin 1.188 0.994 0.894 Desmoyokin; Neuroblast differentiation-associated protein AHNAK 1.187 0.968 0.893 HBeAg-binding protein 2 binding protein A; Mannose-P-dolichol utilization defect 1 1.183 0.933 0.904 protein; Suppressor of Led5 and Lec35 glycosylation mutation homolog; My008 protein; cDNA FLJ57793, moderately similar to Mannose-P-dolichol utilization defect 1 protein; cDNA FLJ14836 fis, clone OVARC1001702 Outer mitochondrial membrane protein porin 1; Plasmalemmal porin; Porin 31HL; Porin 1.182 0.920 0.858 31HM; Voltage-dependent anion-selective channel protein 1 Alpha E-catenin; Cadherin-associated protein; Catenin alpha-1; Renal carcinoma antigen 1.180 0.933 0.847 NY-REN-13; cDNA FLJ54047, highly similar to Alpha-1 catenin (Cadherin-associated protein); Catenin (Cadherin-associated protein), alpha 1, 102 kDa, isoform CRA_c; CTNNA1 protein Antigen KI-67 1.180 1.623 1.483 Glutamate dehydrogenase 1, mitochondrial; cDNA FLJ55203, highly similar to Glutamate 1.179 0.981 0.896 dehydrogenase 1, mitochondrial (EC 1.4.1.3); cDNA FLJ16138 fis, clone BRALZ2017531, highly similar to Glutamate dehydrogenase 1, mitochondrial (EC 1.4.1.3); Glutamate dehydrogenase 1, isoform CRA_a; Glutamate dehydrogenase 2, mitochondrial Complex I-PDSW; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 1.176 1.263 1.126 10; NADH-ubiquinone oxidoreductase PDSW subunit; NADH dehydrogenase (Ubiquinone) 1 beta subcomplex, 10, 22 kDa, isoform CRA_a; NDUFB10 protein Hydroxysteroid dehydrogenase-like protein 2; cDNA FLJ61200, highly similar to Homo 1.175 0.941 0.868 sapiens hydroxysteroid dehydrogenase like 2 (HSDL2), mRNA Elongation factor Ts, mitochondrial; Elongation factor Ts 1.169 1.294 1.165 5H9 antigen; CD9 antigen; Cell growth-inhibiting gene 2 protein; Leukocyte antigen 1.169 0.916 0.826 MIC3; Motility-related protein; p24; Tetraspanin-29; Putative uncharacterized protein CD9; cDNA FLJ51032, highly similar to CD9 antigen 180 kDa ribosome receptor homolog; ES/130-related protein; Ribosome receptor 1.168 0.928 1.046 protein; Ribosome-binding protein 1 Hematopoietic cell-specific LYN substrate 1: Hematopoietic lineage cell-specific 1.167 1.083 1.017 protein; LckBP1; p75 DDAHII; Dimethylargininase-2; N(G),N(G)-dimethylarginine dimethylaminohydrolase 1.166 0.968 0.901 2; Protein G6a; S-phase protein; Dimethylarginine dimethylaminohydrolase 2 Glutathione S-transferase omega-1; Glutathione S-transferase omega 1, isoform 1.162 0.906 0.890 CRA_a; Glutathione S-transferase omega 1 Apoptotic chromatin condensation inducer in the nucleus 1.160 1.040 0.920 Aldehyde dehydrogenase family 6 member A1; Methylmalonate-semialdehyde 1.158 0.938 0.845 dehydrogenase [acylating], mitochondrial Protein disulfide isomerase P5; Protein disulfide-isomerase A6; Thioredoxin domain- 1.158 0.924 0.953 containing protein 7; cDNA FLJ58502, highly similar to Protein disulfide-isomerase A6 (EC 5.3.4.1) Nuclear transport factor 2; Placental protein 15 1.157 1.016 0.914 Complex I-23kD; NADH dehydrogenase [ubiquinone] iron-sulfur protein 8, 1.151 1.148 1.025 mitochondrial; NADH-ubiquinone oxidoreductase 23 kDa subunit; TYKY subunit Complex III subunit 5; Complex III subunit IX; Cytochrome b-c1 complex subunit 1.150 1.059 0.936 11; Cytochrome b-c1 complex subunit 5; Cytochrome b-c1 complex subunit Rieske, mitochondrial; Rieske iron-sulfur protein; Ubiquinol-cytochrome c reductase 8 kDa protein; Ubiquinol-cytochrome c reductase iron-sulfur subunit; Putative cytochrome b-c1 complex subunit Rieske-like protein 1 Nicotinamide phosphoribosyltransferase; Pre-B-cell colony-enhancing factor 1.148 0.893 0.823 1; Visfatin; Novel protein similar to Pre-B cell enhancing factor (PBEF) Basic leucine zipper and W2 domain-containing protein 2; Putative uncharacterized 1.147 0.987 0.974 protein BZW2; Basic leucine zipper and W2 domains 2, isoform CRA_b ATP-specific succinyl-CoA synthetase subunit beta; Renal carcinoma antigen NY-REN- 1.147 0.928 0.922 39; Succinyl-CoA ligase [ADP-forming] subunit beta, mitochondrial; Succinyl-CoA synthetase beta-A chain; Succinate-CoA ligase, ADP-forming, beta subunit 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial; 3-hydroxyisobutyryl-coenzyme A 1.145 1.152 1.058 hydrolase E3 UFM1-protein ligase 1 1.143 1.066 1.053 UPF0197 transmembrane protein C11orf10 1.140 0.886 0.782 Interferon-induced protein 53; T1-TrpRS; T2-TrpRS; Tryptophan--tRNA 1.139 1.201 1.084 ligase; Tryptophanyl-tRNA synthetase, cytoplasmic Tumor protein D52-like 2; Tumor protein D52-like 2, isoform CRA_e; Tumor protein D54 1.136 1.002 0.885 Glycogen phosphorylase, brain form 1.131 0.884 0.787 Cytosolic thyroid hormone-binding protein; Opa-interacting protein 3; p58; Pyruvate kinase 1.131 1.043 0.931 2/3; Pyruvate kinase isozymes M1/M2; Pyruvate kinase muscle isozyme; Thyroid hormone- binding protein 1; Tumor M2-PK 58 kDa glucose-regulated protein; 58 kDa microsomal protein; Disulfide isomerase ER- 1.129 0.910 1.022 60; Endoplasmic reticulum resident protein 57; Endoplasmic reticulum resident protein 60; Protein disulfide-isomerase A3; cDNA PSEC0175 fis, clone OVARC1000169, highly similar to Protein disulfide-isomerase A3 (EC 5.3.4.1) Glutathione S-transferase kappa 1; Glutathione S-transferase subunit 13; GST 13-13; GST 1.128 0.978 0.995 class-kappa; GSTK1-1 Enoyl-CoA hydratase 1; Enoyl-CoA hydratase, mitochondrial; Short-chain enoyl-CoA 1.125 0.890 0.787 hydratase Active breakpoint cluster region-related protein; cDNA FLJ54747, highly similar to Active 1.124 0.918 0.913 breakpoint cluster region-related protein HLA-DR-associated protein II; Inhibitor of granzyme A-activated 1.118 1.145 1.099 DNase; PHAPII; Phosphatase 2A inhibitor I2PP2A; Protein SET; Template-activating factor I; SET nuclear oncogene; Putative uncharacterized protein SET Tubulin beta-2 chain; Tubulin beta-2C chain 1.117 0.900 0.805 Beta-II spectrin; Fodrin beta chain; Spectrin beta chain, brain 1; Spectrin, non-erythroid beta 1.117 0.905 0.800 chain 1 Cyclophilin B; CYP-S1; Peptidyl-prolyl cis-trans isomerase B; Rotamase B; S-cyclophilin 1.115 0.920 0.903 ATP synthase subunit a; F-ATPase protein 6 1.112 0.888 0.826 Putative uncharacterized protein ARPC4; Actin-related protein 2/3 complex subunit 1.106 0.931 0.919 4; Arp2/3 complex 20 kDa subunit Carboxymethylenebutenolidase homolog 1.106 0.927 0.820 Vasodilator-stimulated phosphoprotein 1.106 1.087 0.995 47 kDa mannose 6-phosphate receptor-binding protein; Cargo selection protein 1.102 0.978 0.917 TIP47; Mannose-6-phosphate receptor-binding protein 1; Perilipin-3; Placental protein 17 All-trans-13,14-dihydroretinol saturase; All-trans-retinol 13,14-reductase 1.099 1.249 1.121 Beta-coat protein; Coatomer subunit beta; p102; cDNA FLJ56271, highly similar to 1.097 0.880 0.905 Coatomer subunit beta; Coatomer protein complex, subunit beta 2 (Beta prime), isoform CRA_b BPG-dependent PGAM 1; Phosphoglycerate mutase 1; Phosphoglycerate mutase isozyme B 1.096 1.042 0.940 Cadherin family member 5; Desmoglein-2; HDGC 1.096 1.083 1.010 Superoxide dismutase [Mn], mitochondrial; Superoxide dismutase 1.095 0.871 0.872 Interferon-induced 15 kDa protein; Interferon-induced 17 kDa protein; Ubiquitin cross- 1.093 0.918 0.810 reactive protein Transmembrane and coiled-coil domain-containing protein 1; Transmembrane and coiled- 1.092 0.849 0.786 coil domains protein 4; Xenogeneic cross-immune protein PCIA3; Putative uncharacterized protein TMCO1 Actin-binding protein 280; Alpha-filamin; Endothelial actin-binding protein; Filamin- 1.091 0.939 0.851 1; Filamin-A; Non-muscle filamin; Filamin A, alpha (Actin binding protein 280) ABP-280-like protein; ABP-L; Actin-binding-like protein; Filamin-2; Filamin-C; Gamma-filamin 1.089 0.855 0.761 1-acylglycerophosphocholine O-acyltransferase; 1-acylglycerophosphoserine O- 1.088 1.242 1.118 acyltransferase; Lysophosphatidylcholine acyltransferase; Lysophosphatidylcholine acyltransferase 3; Lysophosphatidylserine acyltransferase; Lysophospholipid acyltransferase 5; Membrane-bound O-acyltransferase domain-containing protein 5; cDNA FLJ55747, highly similar to Membrane bound O-acyltransferase domain-containing protein 5 (EC 2.3..) Alcohol dehydrogenase 1C; Alcohol dehydrogenase subunit gamma 1.086 0.976 0.875 Beta-hexosaminidase subunit beta; Beta-hexosaminidase subunit beta chain A; Beta- 1.081 0.841 0.811 hexosaminidase subunit beta chain B; Beta-N-acetylhexosaminidase subunit beta; Cervical cancer proto-oncogene 7 protein; N-acetyl-beta-glucosaminidase subunit beta; ENC-1AS E3 ubiquitin/ISG15 ligase TRIM25; Estrogen-responsive finger protein; RING finger protein 1.079 0.982 0.925 147; Tripartite motif-containing protein 25; Ubiquitin/ISG15-conjugating enzyme TRIM25; Zinc finger protein 147 p195; Ras GTPase-activating-like protein IQGAP1 1.078 0.877 0.859 Cytochrome c oxidase polypeptide IV; Cytochrome c oxidase subunit 4 isoform 1, 1.074 1.097 0.969 mitochondrial; Cytochrome c oxidase subunit IV isoform 1; COX4I1 protein Intramembrane protease 1; Minor histocompatibility antigen H13; Presenilin-like protein 1.074 0.847 0.768 3; Signal peptide peptidase Complex I-ASHI; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 8, 1.073 0.986 1.194 mitochondrial; NADH-ubiquinone oxidoreductase ASHI subunit; NADH dehydrogenase (Ubiquinone) 1 beta subcomplex, 8, 19 kDa; NADH dehydrogenase (Ubiquinone) 1 beta subcomplex, 8, 19 kDa, isoform CRA_a; cDNA FLJ52503, highly similar to NADH dehydrogenase (ubiquinone) 1 beta subcomplex subunit 8, mitochondrial (EC 1.6.5.3) (EC 1.6.99.3) (NADH-ubiquinone oxidoreductase ASHI subunit) (Complex I-ASHI) (CI- ASHI) Cathepsin D; Cathepsin D heavy chain; Cathepsin D light chain 1.070 0.864 0.790 Golgi transport 1 homolog B; hGOT1a; Putative NF-kappa-B-activating protein 470; Vesicle 1.069 0.834 0.763 transport protein GOT1B ADP-ribosylation factor 4; Putative uncharacterized protein ARF4 1.069 0.890 0.832 Calnexin; IP90; Major histocompatibility complex class I antigen-binding protein 1.068 0.857 0.983 p88; p90; cDNA FLJ54242, highly similar to Calnexin Macropain subunit C8; Multicatalytic endopeptidase complex subunit C8; Proteasome 1.066 0.845 0.953 component C8; Proteasome subunit alpha type-3 Endoplasmic oxidoreductin-1-like protein; ERO1-like protein alpha; Oxidoreductin-1-L- 1.066 0.875 0.912 alpha Elastin microfibril interface-located protein 1; EMILIN-1 1.064 0.846 0.788 Membrane protein p24A; Transmembrane emp24 domain-containing protein 2; cDNA 1.059 0.828 0.826 FLJ52153, highly similar to Transmembrane emp24 domain-containing protein 2 60 kDa SS-A/Ro ribonucleoprotein; Ro 60 kDa autoantigen; Sjoegren syndrome antigen 1.057 1.024 0.928 A2; Sjoegren syndrome type A antigen; TROVE domain family member 2; TROVE domain family, member 2; TROVE domain family, member 2, isoform CRA_c; TROVE domain family, member 2, isoform CRA_e; TROVE domain family, member 2, isoform CRA_d Serine/threonine-protein phosphatase PP1-beta catalytic subunit 1.049 0.850 0.916 Complex I-49kD; NADH dehydrogenase [ubiquinone] iron-sulfur protein 2, 1.048 0.883 0.931 mitochondrial; NADH-ubiquinone oxidoreductase 49 kDa subunit; cDNA, FLJ78876, highly similar to NADH-ubiquinone oxidoreductase 49 kDa subunit, mitochondrial (EC 1.6.5.3) Glycoprotein GP36b; Lectin mannose-binding 2; Vesicular integral-membrane protein 1.039 0.809 0.779 VIP36; cDNA FLJ52285, highly similar to Vesicular integral-membrane protein VIP36 Azoreductase; DT-diaphorase; Menadione reductase; NAD(P)H dehydrogenase [quinone] 1.039 0.880 0.848 1; NAD(P)H: quinone oxidoreductase 1; Phylloquinone reductase; Quinone reductase 1; cDNA FLJ50573, highly similar to Homo sapiens NAD(P)H dehydrogenase, quinone 1 (NQO1), transcript variant 3, mRNA Fortilin; Histamine-releasing factor; p23; Translationally-controlled tumor protein; TPT1 1.037 0.854 0.770 protein; Tumor protein, translationally-controlled 1; Tumor protein, translationally-controlled 1, isoform CRA_a Adapter protein CMS; Cas ligand with multiple SH3 domains; CD2-associated protein 1.033 1.063 0.962 Oxysterol-binding protein 1 1.032 1.125 1.001 B5; Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 1.029 0.966 0.888 STT3A; Integral membrane protein 1; Transmembrane protein TMC 11S regulator complex subunit alpha; Activator of multicatalytic protease subunit 1.028 1.069 0.953 1; Interferon gamma up-regulated I-5111 protein; Proteasome activator 28 subunit alpha; Proteasome activator complex subunit 1; Putative uncharacterized protein PSME1 CFR-1; Cysteine-rich fibroblast growth factor receptor; E-selectin ligand 1; Golgi apparatus 1.028 0.879 0.890 protein 1; Golgi sialoglycoprotein MG-160 Ubiquitin carrier protein D3; Ubiquitin-conjugating enzyme E2 D3; Ubiquitin-conjugating 1.028 0.940 0.831 enzyme E2(17)KB 3; Ubiquitin-conjugating enzyme E2-17 kDa 3; Ubiquitin-protein ligase D3; Ubiquitin carrier protein D2; Ubiquitin-conjugating enzyme E2 D2; Ubiquitin-conjugating enzyme E2(17)KB 2; Ubiquitin-conjugating enzyme E2-17 kDa 2; Ubiquitin-protein ligase D2; Ubiquitin carrier protein Activated RNA polymerase II transcriptional coactivator p15; p14; Positive cofactor 4; SUB1 1.024 0.913 0.818 homolog HLA-B-associated transcript 3; Large proline-rich protein BAT3; Protein G3; HLA-B 1.024 0.942 0.836 associated transcript 3; HLA-B associated transcript 3, isoform CRA_a Cytochrome c oxidase polypeptide II; Cytochrome c oxidase subunit 2 1.024 1.008 1.048 Histone H1; Histone H1(0); Histone H1.0 1.022 0.846 0.748 Echinoderm microtubule-associated protein-like 4; Restrictedly overexpressed 1.021 0.899 0.822 proliferation-associated protein; Ropp 120; Putative uncharacterized protein EML4 Fructose-bisphosphate aldolase A; Lung cancer antigen NY-LU-1; Muscle-type aldolase 1.019 0.828 0.750 High density lipoprotein-binding protein; Vigilin 1.018 0.791 0.705 32 kDa accessory protein; Vacuolar proton pump subunit d 1; V-ATPase 40 kDa accessory 1.015 0.810 0.900 protein; V-ATPase AC39 subunit; V-type proton ATPase subunit d 1 NADH dehydrogenase [ubiquinone] flavoprotein 2, mitochondrial; NADH-ubiquinone 1.015 0.833 0.956 oxidoreductase 24 kDa subunit Maternal-embryonic 3; Vacuolar protein sorting-associated protein 35; Vesicle protein 1.013 0.795 0.951 sorting 35 Histone H3 1.013 0.825 0.729 17-beta-hydroxysteroid dehydrogenase type 2; 20 alpha-hydroxysteroid 1.013 1.457 1.303 dehydrogenase; E2DH; Estradiol 17-beta-dehydrogenase 2; Microsomal 17-beta- hydroxysteroid dehydrogenase; Testosterone 17-beta-dehydrogenase 56 kDa selenium-binding protein; Selenium-binding protein 1; cDNA FLJ61035, highly 1.013 0.789 0.706 similar to Selenium-binding protein 1; Selenium binding protein 1 Cell proliferation-inducing gene 19 protein; LDH muscle subunit; L-lactate dehydrogenase 1.006 0.936 1.001 A chain; Renal carcinoma antigen NY-REN-59 Tight junction protein 1; Tight junction protein ZO-1; Zona occludens protein 1; Zonula 1.002 1.323 1.170 occludens protein 1 Ras-related protein Rab-18; RAB18, member RAS oncogene family 1.000 0.849 1.001 Epithelial protein lost in neoplasm; LIM domain and actin-binding protein 1; cDNA 1.000 0.980 0.875 FLJ55990, highly similar to LIM domain and actin-binding protein 1 Iron regulatory protein 2; Iron-responsive element-binding protein 2 0.999 0.786 0.761 G protein subunit beta-2; Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta- 0.995 0.799 0.785 2; Transducin beta chain 2; Putative uncharacterized protein GNB2 40S ribosomal protein S13 0.991 0.857 0.891 Heat shock 70 kDa protein 1/2; Heat shock 70 kDa protein 1A/1B; Heat shock 70 kDa 0.989 1.199 1.082 protein 1A LIM and SH3 domain protein 1; Metastatic lymph node gene 50 protein; Putative 0.981 0.977 0.872 uncharacterized protein LASP1; cDNA FLJ51834, highly similar to LIM and SH3 domain protein 1; cDNA FLJ52195, highly similar to LIM and SH3 domain protein 1 60S ribosomal protein L26 0.981 0.765 0.972 20 kDa myosin light chain; MLC-2C; Myosin regulatory light chain 2, smooth muscle 0.981 1.027 0.924 isoform; Myosin regulatory light chain 9; Myosin regulatory light chain MRLC1; Myosin regulatory light polypeptide 9; Myosin RLC Guanine nucleotide-binding protein G(y) subunit alpha; Guanine nucleotide-binding protein 0.978 0.764 0.780 subunit alpha-11 Meg-3; Niban-like protein 1; Protein FAM129B 0.972 0.829 0.789 ADP-ribosylation factor-like protein 6-interacting protein 5; Cytoskeleton-related vitamin A- 0.969 1.128 1.069 responsive protein; Dermal papilla-derived protein 11; Glutamate transporter EAAC1- interacting protein; GTRAP3-18; JM5; PRA1 family protein 3; Prenylated Rab acceptor protein 2; Protein JWa; Putative MAPK-activating protein PM27 60S ribosomal protein L27 0.968 0.799 0.741 Beta-globin; Hemoglobin beta chain; Hemoglobin subunit beta; LVV-hemorphin-7 0.967 0.996 1.014 GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase-4-reductase; GDP-L-fucose 0.964 0.927 0.848 synthase; Protein FX; Red cell NADP(H)-binding protein; Short-chain dehydrogenase/reductase family 4E member 1 26S protease regulatory subunit 6A; 26S proteasome AAA-ATPase subunit 0.963 1.125 1.059 RPT5; Proteasome 26S subunit ATPase 3; Proteasome subunit P50; Tat-binding protein 1 Apolipoprotein A-I-binding protein; YjeF N-terminal domain-containing protein 1 0.958 1.024 0.970 APEX nuclease; Apurinic-apyrimidinic endonuclease 1; DNA-(apurinic or apyrimidinic site) 0.954 1.016 0.900 lyase; Protein REF-1 Signal recognition particle 54 kDa protein 0.953 0.743 0.667 5F7; Basigin; Collagenase stimulatory factor; Extracellular matrix metalloproteinase 0.952 0.794 0.849 inducer; Leukocyte activation antigen M6; OK blood group antigen; Tumor cell-derived collagenase stimulatory factor AIR carboxylase; Multifunctional protein ADE2; Phosphoribosylaminoimidazole 0.952 0.740 0.673 carboxylase; Phosphoribosylaminoimidazole-succinocarboxamide synthase; SAICAR synthetase 70 kDa peroxisomal membrane protein; ATP-binding cassette sub-family D member 3 0.951 0.926 0.853 Actin, aortic smooth muscle; Alpha-actin-2; Cell growth-inhibiting gene 46 protein; Actin, 0.951 0.935 0.971 alpha 1, skeletal muscle 3-hydroxybutyrate dehydrogenase type 2; Dehydrogenase/reductase SDR family member 0.946 0.753 0.896 6; Oxidoreductase UCPA; R-beta-hydroxybutyrate dehydrogenase Kinesin light chain 4; Kinesin-like protein 8; cDNA FLJ58264, highly similar to Kinesin light 0.945 1.267 1.218 chain 4 Deubiquitinating enzyme 15; Ubiquitin carboxyl-terminal hydrolase 15; Ubiquitin 0.944 1.145 1.049 thioesterase 15; Ubiquitin-specific-processing protease 15; Unph-2; Unph4 Putative uncharacterized protein KIAA0664; Protein KIAA0664 0.933 0.738 0.830 Protein SCO2 homolog, mitochondrial 0.928 0.744 0.657 35-alpha calcimedin; Annexin A3; Annexin III; Annexin-3; Inositol 1,2-cyclic phosphate 2- 0.926 1.006 0.966 phosphohydrolase; Lipocortin III; Placental anticoagulant protein III Inosine phosphorylase; Purine nucleoside phosphorylase 0.919 0.803 0.816 Complex I-B8; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 2; NADH- 0.916 0.719 0.780 ubiquinone oxidoreductase B8 subunit Lamin-B2 0.914 0.712 0.910 Signal transducing adapter molecule 1; Putative uncharacterized protein STAM 0.906 0.965 0.883 Plasma membrane calcium ATPase isoform 1; Plasma membrane calcium pump isoform 0.896 0.797 0.826 1; Plasma membrane calcium-transporting ATPase 1 Carbonyl reductase [NADPH] 3; NADPH-dependent carbonyl reductase 3 0.896 1.061 1.298 DNA-directed RNA polymerase II subunit H; DNA-directed RNA polymerases I, II, and III 0.892 1.439 1.271 17.1 kDa polypeptide; DNA-directed RNA polymerases I, II, and III subunit RPABC3; RPB17; RPB8 homolog; Putative uncharacterized protein POLR2H 70 kDa lamin; Lamin-A/C; Renal carcinoma antigen NY-REN-32; Lamin 0.888 0.914 0.853 A/C; Progerin; Rhabdomyosarcoma antigen MU-RMS-40.12 22 kDa neuronal tissue-enriched acidic protein; Brain acid soluble protein 1; Neuronal 0.888 0.915 0.984 axonal membrane protein NAP-22 ADP-ribosylation factor-like protein 3 0.884 1.055 1.005 Acetylglucosamine phosphomutase; N-acetylglucosamine-phosphate 0.884 0.712 0.632 mutase; Phosphoacetylglucosamine mutase; Phosphoglucomutase-3 Cytochrome c oxidase polypeptide VIIc; Cytochrome c oxidase subunit 7C, mitochondrial 0.879 0.913 0.839 Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 67 kDa subunit; Dolichyl- 0.878 0.715 0.974 diphosphooligosaccharide--protein glycosyltransferase subunit 1; Ribophorin I; Ribophorin- 1; cDNA FLJ50809, highly similar to Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 67 kDa subunit (EC 2.4.1.119); cDNA FLJ51908, highly similar to Dolichyl-diphosphooligosaccharide--proteinglycosyltransferase 67 kDa subunit (EC 2.4.1.119) Cytochrome c oxidase subunit 7A2, mitochondrial; Cytochrome c oxidase subunit VIIa- 0.875 0.705 0.933 liver/heart 21 kDa transmembrane-trafficking protein; p24delta; S31III125; Tmp-21-I; Transmembrane 0.875 0.690 0.754 emp24 domain-containing protein 10; Transmembrane protein Tmp21 Cell cycle control protein 50A; Transmembrane protein 30A; cDNA FLJ55687, highly 0.868 2.133 1.883 similar to Cell cycle control protein 50A Oxidative stress-responsive 1 protein; Serine/threonine-protein kinase OSR1; Putative 0.864 1.203 1.066 uncharacterized protein OXSR1 Acyl-CoA-binding domain-containing protein 3; Golgi complex-associated protein 1; Golgi 0.861 1.201 1.111 phosphoprotein 1; Golgi resident protein GCP60; PBR- and PKA-associated protein 7; Peripheral benzodiazepine receptor-associated protein PAP7 Pyruvate carboxylase, mitochondrial; Pyruvic carboxylase; cDNA FLJ60715, highly similar 0.857 1.001 0.885 to Pyruvate carboxylase, mitochondrial (EC 6.4.1.1) Double-stranded RNA-binding protein Staufen homolog 1; Staufen, RNA binding protein, 0.855 1.316 1.229 homolog 1 (Drosophila) Q15149-6 0.851 0.704 1.087 40S ribosomal protein S19 0.848 0.732 0.944 Intestine-specific plastin; Plastin-1 0.845 1.185 1.053 Nidogen-2; Osteonidogen 0.836 1.244 1.104 Gastric cancer antigen Ga19; N-alpha-acetyltransferase 15, NatA auxiliary subunit; NMDA 0.833 0.751 0.704 receptor-regulated protein 1; N-terminal acetyltransferase; Protein tubedown-1; Tbdn100 40S ribosomal protein S14 0.832 0.654 0.615 Heterogeneous nuclear ribonucleoprotein L; cDNA FLJ75895, highly similar to Homo 0.829 0.747 0.663 sapiens heterogeneous nuclear ribonucleoprotein L (HNRPL), transcript variant 2, mRNA; Putative uncharacterized protein HNRNPL cDNA FLJ56102, highly similar to Homo sapiens calpastatin (CAST), transcript variant 8, 0.826 0.782 0.694 mRNA; Calpain inhibitor; Calpastatin; Sperm BS-17 component; cDNA FLJ56123, highly similar to Calpastatin Tropomyosin 3; Tropomyosin 3, isoform CRA_b; cDNA FLJ35393 fis, clone 0.826 0.829 0.732 SKNSH2000971, highly similar to TROPOMYOSIN, CYTOSKELETAL TYPE Macropain chain Z; Multicatalytic endopeptidase complex chain Z; Proteasome subunit 0.825 0.745 0.685 beta type-7; Proteasome subunit Z; Proteasome (Prosome, macropain) subunit, beta type, 7; cDNA FLJ60039, highly similar to Proteasome subunit beta type 7 (EC 3.4.25.1); Proteasome (Prosome, macropain) subunit, beta type, 7, isoform CRA_b DNA-directed RNA polymerase II 140 kDa polypeptide; DNA-directed RNA polymerase II 0.824 1.499 1.425 subunit B; DNA-directed RNA polymerase II subunit RPB2; RNA polymerase II subunit 2; RNA polymerase II subunit B2; Putative uncharacterized protein POLR2B 40S ribosomal protein S7; Putative uncharacterized protein RPS7 0.824 0.813 0.982 Thyroid hormone receptor-associated protein 3; Thyroid hormone receptor-associated 0.823 1.280 1.131 protein complex 150 kDa component Large tumor suppressor homolog 1; Serine/threonine-protein kinase LATS1; WARTS 0.822 0.768 0.718 protein kinase; LATS1 protein 11S regulator complex subunit beta; Activator of multicatalytic protease subunit 0.819 1.303 1.157 2; Proteasome activator 28 subunit beta; Proteasome activator complex subunit 2 Leukocyte common antigen; Receptor-type tyrosine-protein phosphatase C; T200 0.819 0.976 0.975 Tight junction protein 2; Tight junction protein ZO-2; Zona occludens protein 2; Zonula 0.811 0.919 0.836 occludens protein 2 CDC42 GTPase-activating protein; GTPase-activating protein rhoOGAP; p50- 0.805 0.963 1.011 RhoGAP; Rho GTPase-activating protein 1; Rho-related small GTPase protein activator; Rho-type GTPase-activating protein 1 Calcium-activated neutral proteinase 2; Calpain large polypeptide L2; Calpain M- 0.804 1.056 1.017 type; Calpain-2 catalytic subunit; Calpain-2 large subunit; Millimolar-calpain ABP125; ABP130; Protein transport protein Sec31A; SEC31-like protein 1; SEC31-related 0.798 0.622 0.895 protein A; Web1-like protein; SEC31A protein Electron transfer flavoprotein subunit beta 0.797 0.696 0.886 Collapsin response mediator protein 2; Dihydropyrimidinase-related protein 2; N2A3; Unc- 0.796 0.874 1.048 33-like phosphoprotein 2 DEAD box protein 27; Probable ATP-dependent RNA helicase DDX27 0.781 1.299 1.171 Copper amine oxidase; HPAO; Membrane primary amine oxidase; Semicarbazide-sensitive 0.778 0.845 0.888 amine oxidase; Vascular adhesion protein 1 Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 63 kDa subunit; Dolichyl- 0.777 0.766 1.033 diphosphooligosaccharide--protein glycosyltransferase subunit 2; RIBIIR; Ribophorin II; Ribophorin-2 Argininosuccinate synthase; Citrulline--aspartate ligase 0.776 0.987 0.880 Glycoprotein 25L2; Transmembrane emp24 domain-containing protein 9 0.772 1.404 1.242 NAP-1-related protein; Nucleosome assembly protein 1-like 1; cDNA FLJ30458 fis, clone 0.763 1.080 0.954 BRACE2009421, highly similar to NUCLEOSOME ASSEMBLY PROTEIN 1-LIKE 1; cDNA FLJ58569, highly similar to Nucleosome assembly protein 1-like 1; cDNA FLJ16112 fis, clone 3NB692001853, highly similar to NUCLEOSOME ASSEMBLY PROTEIN 1-LIKE 1; Nucleosome assembly protein 1-like 1, isoform CRA_c TESS; Testin 0.761 1.013 0.896 14 kDa phosphohistidine phosphatase; Phosphohistidine phosphatase 1; Protein janus-A 0.761 0.888 0.888 homolog Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1; Transducin beta chain 0.758 1.071 1.024 1; Guanine nucleotide binding protein (G protein), beta polypeptide 1 130 kDa leucine-rich protein; GP130; Leucine-rich PPR motif-containing protein, 0.756 0.741 0.954 mitochondrial Cellugyrin; Synaptogyrin-2 0.754 0.685 0.839 c-Ki-ras; c-K-ras; GTPase KRas; GTPase KRas, N-terminally processed; Ki-Ras; K-Ras 2 0.750 1.185 1.075 80K-H protein; Glucosidase 2 subunit beta; Glucosidase II subunit beta; Protein kinase C 0.749 0.874 1.036 substrate 60.1 kDa protein heavy chain Haptoglobin; Haptoglobin alpha chain; Haptoglobin beta chain; HP protein 0.746 0.838 1.044 49 kDa TATA box-binding protein-interacting protein; 54 kDa erythrocyte cytosolic 0.742 0.585 0.524 protein; INO80 complex subunit H; Nuclear matrix protein 238; Pontin 52; RuvB-like 1; TIP49a; TIP60-associated protein 54-alpha Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1; Peptidyl-prolyl cis-trans isomerase 0.741 0.769 0.689 Pin1; Rotamase Pin1 Acid ceramidase; Acid ceramidase subunit alpha; Acid ceramidase subunit 0.740 1.345 1.559 beta; Acylsphingosine deacylase; N-acylsphingosine amidohydrolase; Putative 32 kDa heart protein Annexin A2; Annexin II; Annexin-2; Calpactin I heavy chain; Calpactin-1 heavy 0.740 0.626 0.871 chain; Chromobindin-8; Lipocortin II; p36; Placental anticoagulant protein IV; Protein I; Annexin A2 pseudogene 2; Lipocortin II pseudogene; Putative annexin A2-like protein; cDNA FLJ34687 fis, clone MESAN2000620, highly similar to Annexin A2 Translocation protein 1; Translocation protein SEC62 0.735 1.515 1.341 Smu-1 suppressor of mec-8 and unc-52 protein homolog; WD40 repeat-containing protein 0.723 1.363 1.272 SMU1; cDNA FLJ54259, highly similar to Smu-1 suppressor of mec-8 and unc-52 protein homolog UPF0568 protein C14orf166 0.722 0.730 0.998 NADPH--cytochrome P450 reductase 0.721 1.142 1.009 60S ribosomal protein L3; HIV-1 TAR RNA-binding protein B; Putative uncharacterized 0.715 0.561 0.512 protein RPL3 Actin-related protein 2/3 complex subunit 5; Arp2/3 complex 16 kDa subunit 0.709 0.599 0.724 Citrate synthase, mitochondrial; Citrate synthase 0.706 0.689 0.932 ATP-dependent 61 kDa nucleolar RNA helicase; DEAD box protein 21; DEAD box protein 0.705 0.549 0.971 56; Probable ATP-dependent RNA helicase DDX56; Putative uncharacterized protein DDX56 Ribosome maturation protein SBDS; Shwachman-Bodian-Diamond syndrome protein 0.705 0.681 0.704 Selenide, water dikinase 1; Selenium donor protein 1; Selenophosphate synthase 1; cDNA 0.699 1.296 1.294 FLJ60186, highly similar to Selenide, water dikinase 1 (EC 2.7.9.3); Selenophosphate synthetase 1; Selenophosphate synthetase 1, isoform CRA_a eIF-2B GDP-GTP exchange factor subunit epsilon; Translation initiation factor eIF-2B 0.691 1.419 1.313 subunit epsilon C-terminal LIM domain protein 1; Elfin; LIM domain protein CLP-36; PDZ and LIM domain 0.673 0.568 0.950 protein 1 Calcyclin; Growth factor-inducible protein 2A9; MLN 4; Prolactin receptor-associated 0.672 0.522 0.519 protein; Protein S100-A6; S100 calcium-binding protein A6 Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunit 0.670 0.522 0.898 ICD-M; IDP; Isocitrate dehydrogenase [NADP], mitochondrial; NADP(+)-specific 0.669 1.139 1.036 ICDH; Oxalosuccinate decarboxylase 100 kDa coactivator; EBNA2 coactivator p100; p100 co-activator; Staphylococcal nuclease 0.665 0.600 0.914 domain-containing protein 1; Tudor domain-containing protein 11 Glutaredoxin-1; Thioltransferase-1 0.656 1.176 1.038 Microsomal triglyceride transfer protein large subunit 0.639 1.044 1.044 Beta-coat protein; Coatomer subunit beta 0.638 0.631 0.946 60S ribosomal protein L23a; Putative uncharacterized protein RPL23A; Ribosomal protein 0.634 0.711 0.945 L23a, isoform CRA_a 14-3-3 protein eta; Protein AS1; Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase 0.626 1.253 1.129 activation protein, eta polypeptide Putative uncharacterized protein SUMO1; GAP-modifying protein 1; Sentrin; Small 0.623 0.485 0.694 ubiquitin-related modifier 1; SMT3 homolog 3; Ubiquitin-homology domain protein PIC1; Ubiquitin-like protein SMT3C; Ubiquitin-like protein UBL1; SMT3 suppressor of mif two 3 homolog 1 (Yeast), isoform CRA_c; SMT3 suppressor of mif two 3 homolog 1 (Yeast), isoform CRA_b Complex I-15 kDa; NADH dehydrogenase [ubiquinone] iron-sulfur protein 5; NADH- 0.622 0.602 0.912 ubiquinone oxidoreductase 15 kDa subunit Importin-7; Ran-binding protein 7 0.621 0.754 0.722 Dnm1p/Vps1p-like protein; Dynamin family member proline-rich carboxyl-terminal domain 0.614 1.328 1.172 less; Dynamin-1-like protein; Dynamin-like protein; Dynamin-like protein 4; Dynamin-like protein IV; Dynamin-related protein 1; cDNA FLJ59504, highly similar to Dynamin-1-like protein (EC 3.6.5.5) Activated-platelet protein 1; Inducible poly(A)-binding protein; Polyadenylate-binding 0.611 0.710 0.994 protein 4; Poly(A) binding protein, cytoplasmic 4 (Inducible form); Poly(A) binding protein, cytoplasmic 4 (Inducible form), isoform CRA_e Succinyl-CoA ligase [GDP-forming] subunit alpha, mitochondrial; Succinyl-CoA synthetase 0.604 0.498 0.906 subunit alpha 27 kDa prosomal protein; Macropain iota chain; Multicatalytic endopeptidase complex iota 0.603 1.148 1.138 chain; Proteasome iota chain; Proteasome subunit alpha type-6; cDNA FLJ51729, highly similar to Proteasome subunit alpha type 6 (EC 3.4.25.1); Proteasome (Prosome, macropain) subunit, alpha type, 6, isoform CRA_a; cDNA FLJ52022, highly similar to Proteasome subunit alpha type 6 (EC 3.4.25.1); cDNA, FLJ79122, highly similar to Proteasome subunit alpha type 6 (EC 3.4.25.1) Cytosol aminopeptidase; Leucine aminopeptidase 3; Leucyl aminopeptidase; Peptidase 0.599 0.963 0.857 S; Proline aminopeptidase; Prolyl aminopeptidase 60S ribosomal protein L14; CAG-ISL 7; cDNA FLJ51325, highly similar to 60S ribosomal 0.589 0.522 0.744 protein L14 DNA topoisomerase 1; DNA topoisomerase I 0.575 0.715 0.997 40S ribosomal protein S26; Putative 40S ribosomal protein S26-like 1 0.571 0.777 0.753 Rho GDP-dissociation inhibitor 1; Rho-GDI alpha; cDNA FLJ50748, highly similar to Rho 0.562 0.438 1.074 GDP-dissociation inhibitor 1; Putative uncharacterized protein ARHGDIA Hsc70/Hsp90-organizing protein; Renal carcinoma antigen NY-REN-11; Stress-induced- 0.550 0.715 1.000 phosphoprotein 1; Transformation-sensitive protein IEF SSP 3521 Signal sequence receptor subunit delta; Translocon-associated protein subunit 0.548 0.602 0.556 delta; Putative uncharacterized protein SSR4 Putative uncharacterized protein MUTED 0.547 0.734 0.906 ATPase family AAA domain-containing protein 3A 0.544 0.612 0.978 Nuclear distribution protein C homolog; Nuclear migration protein nudC 0.540 0.429 0.779 Protein LSM12 homolog 0.530 0.932 1.102 Protein transport protein Sec61 subunit beta 0.528 0.579 0.791 Macropain subunit C5; Multicatalytic endopeptidase complex subunit C5; Proteasome 0.509 1.172 1.039 component C5; Proteasome gamma chain; Proteasome subunit beta type-1 Alcohol dehydrogenase 5; Alcohol dehydrogenase class chi chain; Alcohol dehydrogenase 0.508 0.456 0.936 class-3; Alcohol dehydrogenase class-III; Glutathione-dependent formaldehyde dehydrogenase; S-(hydroxymethyl)glutathione dehydrogenase DEAD box protein 47; Probable ATP-dependent RNA helicase DDX47 0.502 0.638 0.755 Macropain delta chain; Multicatalytic endopeptidase complex delta chain; Proteasome 0.499 1.013 1.008 delta chain; Proteasome subunit beta type-6; Proteasome subunit Y Proteasome chain 13; Proteasome component C10-II; Proteasome subunit beta type- 0.499 1.147 1.422 3; Proteasome theta chain Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-5 0.493 0.673 1.014 60S ribosomal protein L35 0.480 0.523 0.899 Putative uncharacterized protein DBN1; Developmentally-regulated brain protein; Drebrin 0.468 0.770 0.774 tRNA pseudouridine synthase A; tRNA pseudouridylate synthase I; tRNA-uridine 0.467 0.877 0.963 isomerase I Protein NDRG2; Protein SyId709613; cDNA FLJ55190, highly similar to Protein NDRG2 0.467 1.647 1.485 AKAP 120-like protein; A-kinase anchor protein 350 kDa; A-kinase anchor protein 450 kDa; 0.465 0.785 0.703 A-kinase anchor protein 9; Centrosome- and Golgi-localized PKN-associated protein; Protein hyperion; Protein kinase A-anchoring protein 9; Protein yotiao Anandamide amidohydrolase 1; Fatty-acid amide hydrolase 1; Oleamide hydrolase 1 0.462 0.612 1.046 Acyl-coenzyme A thioesterase 13; Thioesterase superfamily member 2 0.461 1.134 1.032 40S ribosomal protein S21; RPS21 protein; Ribosomal protein S21; Ribosomal protein S21, 0.456 0.594 0.980 isoform CRA_e NSFL1 cofactor p47; p97 cofactor p47; UBX domain-containing protein 2C 0.448 0.600 1.023 Glutaredoxin-3; PKC-interacting cousin of thioredoxin; PKC-theta-interacting 0.445 0.808 0.971 protein; Thioredoxin-like protein 2 Charcot-Leyden crystal protein; CLC; Eosinophil lysophospholipase; Galectin- 0.445 1.579 1.477 10; Lysolecithin acylhydrolase LanC-like protein 2; Testis-specific adriamycin sensitivity protein 0.441 1.599 1.423 Dimethylallyltranstransferase; Farnesyl diphosphate synthase; Farnesyl pyrophosphate 0.441 0.469 0.821 synthase; Geranyltranstransferase 26S protease regulatory subunit 7; 26S proteasome AAA-ATPase subunit 0.436 0.409 0.774 RPT1; Proteasome 26S subunit ATPase 2; Protein MSS1; cDNA FLJ52353, highly similar to 26S protease regulatory subunit 7 CCT-epsilon; T-complex protein 1 subunit epsilon 0.432 0.768 0.859 Glyceraldehyde-3-phosphate dehydrogenase 0.428 0.605 0.994 Ras-related protein Rab-6A 0.427 0.874 1.046 Nucleosome assembly protein 1-like 4b; Putative uncharacterized protein 0.426 0.331 0.996 NAP1L4; Nucleosome assembly protein 1-like 4; Nucleosome assembly protein 2 Myosin-VI; Unconventional myosin-6 0.422 0.789 0.865 26S proteasome non-ATPase regulatory subunit 3; 26S proteasome regulatory subunit 0.420 0.562 0.992 RPN3; 26S proteasome regulatory subunit S3; Proteasome subunit p58; cDNA FLJ54148, highly similar to 26S proteasome non-ATPase regulatory subunit 3 Placental ribonuclease inhibitor; Ribonuclease inhibitor; Ribonuclease/angiogenin inhibitor 1 0.419 0.470 0.883 30 kDa prosomal protein; Macropain subunit C2; Multicatalytic endopeptidase complex 0.402 0.563 0.994 subunit C2; Proteasome component C2; Proteasome nu chain; Proteasome subunit alpha type-1; Proteasome subunit alpha type IMPDH-II; Inosine-5-monophosphate dehydrogenase 2 0.401 0.356 0.652 Bax antagonist selected in saccharomyces 1; Negative regulatory element-binding 0.401 0.560 0.906 protein; Protein DBP-5; Protein SON; SON3 AGX-1; AGX-2; Antigen X; Sperm-associated antigen 2; UDP-N-acetylgalactosamine 0.400 1.176 1.039 pyrophosphorylase; UDP-N-acetylglucosamine pyrophosphorylase; UDP-N- acetylhexosamine pyrophosphorylase; UDP-N-acteylglucosamine pyrophosphorylase 1 Heat shock 70 kDa protein 4; Heat shock 70-related protein APG-2; HSP70RY 0.390 1.029 1.069 Autocrine motility factor; Glucose-6-phosphate isomerase; Neuroleukin; Phosphoglucose 0.383 0.317 0.849 isomerase; Phosphohexose isomerase; Sperm antigen 36 ATP-dependent helicase SMARCA2; BRG1-associated factor 190B; Probable global 0.379 0.669 1.095 transcription activator SNF2L2; Protein brahma homolog; SNF2-alpha; SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 2 PEP11 homolog; Vacuolar protein sorting-associated protein 29; Vesicle protein sorting 29 0.366 1.199 1.100 Deubiquitinating enzyme 7; Herpesvirus-associated ubiquitin-specific protease; Ubiquitin 0.365 0.730 0.991 carboxyl-terminal hydrolase 7; Ubiquitin thioesterase 7; Ubiquitin-specific-processing protease 7; Ubiquitin carboxyl-terminal hydrolase Butyrate-induced protein 1; Protein tyrosine phosphatase-like protein PTPLAD1; Protein- 0.365 0.301 0.736 tyrosine phosphatase-like A domain-containing protein 1; cDNA FLJ54138, highly similar to Homo sapiens butyrate-induced transcript 1 (HSPC121), mRNA Amine oxidase [flavin-containing] B; Monoamine oxidase type B; cDNA FLJ51821, highly 0.364 1.217 1.126 similar to Amine oxidase (flavin-containing) B (EC 1.4.3.4); cDNA FLJ52418, highly similar to Amine oxidase (flavin-containing) B (EC 1.4.3.4) Cell proliferation-inducing gene 21 protein; Guanine nucleotide-binding protein subunit 0.361 0.644 0.979 beta-2-like 1; Guanine nucleotide-binding protein subunit beta-like protein 12.3; Human lung cancer oncogene 7 protein; Receptor for activated C kinase; Receptor of activated protein kinase C 1 CAAX farnesyltransferase subunit alpha; FTase-alpha; Protein 0.356 1.417 1.499 farnesyltransferase/geranylgeranyltransferase type-1 subunit alpha; Ras proteins prenyltransferase subunit alpha; Type I protein geranyl-geranyltransferase subunit alpha 1F5 antigen; 20 kDa homologous restriction factor; CD59 glycoprotein; MAC-inhibitory 0.354 1.131 1.368 protein; MEM43 antigen; Membrane attack complex inhibition factor; Membrane inhibitor of reactive lysis; Protectin Aldehyde dehydrogenase family 1 member A1; Aldehyde dehydrogenase, cytosolic; ALDH- 0.348 0.678 1.002 E1; ALHDII; Retinal dehydrogenase 1 Glycine hydroxymethyltransferase; Serine hydroxymethyltransferase, mitochondrial; Serine 0.345 0.677 0.978 methylase; cDNA FLJ58585, highly similar to Serine hydroxymethyltransferase, mitochondrial (EC 2.1.2.1); Serine hydroxymethyltransferase 2 (Mitochondrial), isoform CRA_h Macropain zeta chain; Multicatalytic endopeptidase complex zeta chain; Proteasome 0.339 0.954 0.900 subunit alpha type-5; Proteasome zeta chain; cDNA FLJ52182, highly similar to Proteasome subunit alpha type 5 (EC 3.4.25.1); Proteasome (Prosome, macropain) subunit, alpha type, 5, isoform CRA_c Methionine--tRNA ligase; Methionyl-tRNA synthetase, cytoplasmic; Putative 0.325 0.537 0.977 uncharacterized protein MARS; cDNA FLJ16674 fis, clone THYMU3008136, highly similar to Methionyl-tRNA synthetase (EC 6.1.1.10) Importin-9; Ran-binding protein 9 0.320 0.530 0.801 Pre-mRNA-splicing factor SRP75; Splicing factor, arginine/serine-rich 4; SRP001LB 0.310 1.096 1.336 Anterior gradient protein 2 homolog; HPC8; Secreted cement gland protein XAG-2 0.310 1.524 1.365 homolog; Putative uncharacterized protein AGR2 Coagulation factor XIII A chain; Protein-glutamine gamma-glutamyltransferase A 0.306 1.379 1.397 chain; Transglutaminase A chain DNA replication licensing factor MCM2; Minichromosome maintenance protein 2 0.303 0.555 0.981 homolog; Nuclear protein BM28 Phosphate carrier protein, mitochondrial; Phosphate transport protein; Solute carrier family 0.299 0.569 0.911 25 member 3 CCT-beta; T-complex protein 1 subunit beta 0.291 0.540 0.980 Protein ftsJ homolog 3; Putative rRNA methyltransferase 3; rRNA (uridine-2-O-)- 0.286 0.995 1.042 methyltransferase 3 High mobility group-like nuclear protein 2 homolog 1; NHP2-like protein 1; OTK27; SNU13 0.280 0.676 0.992 homolog; U4/U6.U5 tri-snRNP 15.5 kDa protein; NHP2 non-histone chromosome protein 2- like 1 (S. cerevisiae) CCT-gamma; hTRiC5; T-complex protein 1 subunit gamma 0.278 0.521 0.867 Nuclear matrix protein 200; Pre-mRNA-processing factor 19; PRP19/PSO4 0.276 0.291 0.352 homolog; Senescence evasion factor Protein mago nashi homolog; cDNA FLJ55283, moderately similar to Protein mago nashi 0.272 1.125 1.047 homolog; Mago-nashi homolog, proliferation-associated (Drosophila); Mago-nashi homolog, proliferation-associated (Drosophila), isoform CRA_a Mannose-6-phosphate isomerase; Phosphohexomutase; Phosphomannose 0.261 0.847 0.931 isomerase; Mannose phosphate isomerase isoform Carnitine/acylcarnitine translocase; Mitochondrial carnitine/acylcarnitine carrier 0.254 1.064 1.024 protein; Solute carrier family 25 member 20; cDNA FLJ53016, highly similar to Mitochondrial carnitine/acylcarnitine carrier protein Caspase-1; Caspase-1 subunit p10; Caspase-1 subunit p20; Interleukin-1 beta 0.252 1.158 1.068 convertase; Interleukin-1 beta-converting enzyme; p45; cDNA FLJ59442, highly similar to Caspase-1 (EC 3.4.22.36) 40S ribosomal protein S4, X isoform; SCR10; Single copy abundant mRNA protein 0.252 0.522 0.958 Dipeptidyl aminopeptidase II; Dipeptidyl peptidase 2; Dipeptidyl peptidase 7; Dipeptidyl 0.248 1.042 0.922 peptidase II; Quiescent cell proline dipeptidase Protein mago nashi homolog 2; Putative uncharacterized protein MAGOHB 0.240 1.337 1.259 Brain-type aldolase; Fructose-bisphosphate aldolase C; Fructose-bisphosphate 0.236 0.954 0.892 aldolase; Putative uncharacterized protein ALDOC Ras-related protein Rab-1A; YPT1-related protein; cDNA FLJ57768, highly similar to Ras- 0.230 0.572 0.900 related protein Rab-1A Brush border myosin I; Myosin I heavy chain; Myosin-Ia 0.222 1.238 1.241 CDC21 homolog; DNA replication licensing factor MCM4; P1-CDC21 0.220 0.172 0.646 28 kDa heat shock protein; Estrogen-regulated 24 kDa protein; Heat shock 27 kDa 0.208 0.621 0.941 protein; Heat shock protein beta-1; Stress-responsive protein 27; cDNA FLJ52243, highly similar to Heat-shock protein beta-1 ATP-dependent RNA helicase DDX19A; DDX19-like protein; DEAD box protein 19A; ATP- 0.207 0.443 0.447 dependent RNA helicase DDX19B; DEAD box protein 19B; DEAD box RNA helicase DEAD5; cDNA FLJ52463, highly similar to ATP-dependent RNA helicase DDX19A (EC 3.6.1.) Double-stranded RNA-binding protein 76; Interleukin enhancer-binding factor 3; M-phase 0.202 0.696 0.934 phosphoprotein 4; Nuclear factor associated with dsRNA; Nuclear factor of activated T- cells 90 kDa; Translational control protein 80; Putative uncharacterized protein ILF3; cDNA FLJ58801, highly similar to Interleukin enhancer-binding factor 3 PHD finger protein 6; PHD-like zinc finger protein; cDNA FLJ60207, highly similar to PHD 0.201 1.197 1.485 finger protein 6; PHD finger protein 6, isoform CRA_d Glycosyltransferase 25 family member 1; Hydroxylysine galactosyltransferase 0.197 0.183 1.063 1; Procollagen galactosyltransferase 1 D-fructose-6-phosphate amidotransferase 2; Glucosamine--fructose-6-phosphate 0.197 1.720 1.634 aminotransferase [isomerizing] 2; Glutamine:fructose 6 phosphate amidotransferase 2; Hexosephosphate aminotransferase 2 CCT-delta; Stimulator of TAR RNA-binding; T-complex protein 1 subunit delta 0.189 0.562 0.972 5-3 exoribonuclease 2; DHM1-like protein; cDNA FLJ55645, highly similar to 5-3 0.187 0.495 0.838 exoribonuclease 2 (EC 3.1.11.) High mobility group protein 2a; High mobility group protein 4; High mobility group protein 0.182 0.609 1.217 B3 CCT-theta; Renal carcinoma antigen NY-REN-15; T-complex protein 1 subunit theta; cDNA 0.181 0.581 0.962 FLJ53379, highly similar to T-complex protein 1 subunit theta; cDNA FLJ59382, highly similar to T-complex protein 1 subunit theta CD63 antigen; Granulophysin; Lysosomal-associated membrane protein 3; Melanoma- 0.180 0.953 0.884 associated antigen ME491; Ocular melanoma-associated antigen; OMA81H; Tetraspanin- 30; Putative uncharacterized protein CD63; Lysosome-associated membrane protein-3 variant Sideroflexin-1; Tricarboxylate carrier protein 0.178 0.600 0.965 Phosphopantothenate--cysteine ligase; Phosphopantothenoylcysteine synthetase 0.178 0.853 1.016 CCT-alpha; T-complex protein 1 subunit alpha 0.175 0.864 0.990 Aldehyde dehydrogenase family 18 member A1; Delta-1-pyrroline-5-carboxylate 0.174 0.757 0.868 synthase; Gamma-glutamyl kinase; Gamma-glutamyl phosphate reductase; Glutamate 5- kinase; Glutamate-5-semialdehyde dehydrogenase; Glutamyl-gamma-semialdehyde dehydrogenase Alpha-II spectrin; Fodrin alpha chain; Spectrin alpha chain, brain; Spectrin, non-erythroid 0.173 0.562 0.960 alpha chain; Putative uncharacterized protein SPTAN1; cDNA FLJ59116, highly similar to Spectrin alpha chain, brain Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial 0.167 0.512 0.972 Farnesyl-diphosphate farnesyltransferase; FPP:FPP farnesyltransferase; Squalene 0.167 0.280 0.600 synthase; cDNA FLJ50548, highly similar to Squalene synthetase (EC 2.5.1.21); cDNA FLJ50447, highly similar to Squalene synthetase (EC 2.5.1.21); cDNA, FLJ78892, highly similar to Squalene synthetase (EC 2.5.1.21); cDNA, FLJ79250, highly similar to Squalene synthetase (EC 2.5.1.21); cDNA, FLJ79430, highly similar to Squalene synthetase (EC 2.5.1.21); cDNA FLJ50660, highly similar to Squalene synthetase (EC 2.5.1.21); cDNA, FLJ79433, highly similar to Squalene synthetase (EC 2.5.1.21); cDNA FLJ33164 fis, clone UTERU2000542, highly similar to Squalene synthetase (EC 2.5.1.21) DEAH box protein 30; Putative ATP-dependent RNA helicase DHX30 0.162 0.794 1.002 Bifunctional coenzyme A synthase; Dephospho-CoA kinase; Dephospho-CoA 0.162 1.139 1.115 pyrophosphorylase; Dephosphocoenzyme A kinase; NBP; Pantetheine-phosphate adenylyltransferase; Phosphopantetheine adenylyltransferase; POV-2 DNA-dependent protein kinase catalytic subunit; DNPK1; p460 0.161 0.579 0.967 CDC46 homolog; DNA replication licensing factor MCM5; P1-CDC46; MCM5 0.159 0.349 0.925 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae), isoform CRA_c; Minichromosome maintenance complex component 5 Protein A1S9; Ubiquitin-activating enzyme E1; Ubiquitin-like modifier-activating enzyme 0.156 0.683 0.940 1; cDNA FLJ54582, highly similar to Ubiquitin-activating enzyme E1 CNDP dipeptidase 2; Cytosolic non-specific dipeptidase; Glutamate carboxypeptidase-like 0.155 1.122 0.999 protein 1; Peptidase A Ras-related protein Rab-5B; cDNA FLJ60627, highly similar to Ras-related protein Rab- 0.152 0.305 0.369 5B; RAB5B, member RAS oncogene family, isoform CRA_b 358 kDa nucleoporin; E3 SUMO-protein ligase RanBP2; Nuclear pore complex protein 0.152 0.806 0.988 Nup358; Nucleoporin Nup358; p270; Ran-binding protein 2 Paraspeckle protein 2; RNA-binding motif protein 14; RNA-binding protein 14; RRM- 0.142 0.762 0.779 containing coactivator activator/modulator; Synaptotagmin-interacting protein 11-zinc finger protein; CCCTC-binding factor; CTCFL paralog; Transcriptional repressor 0.131 0.524 1.286 CTCF; Putative uncharacterized protein CTCF 6-phosphofructokinase, muscle type; Phosphofructo-1-kinase isozyme 0.124 0.812 1.019 A; Phosphofructokinase 1; Phosphohexokinase Cyclin-A/CDK2-associated protein p19; Organ of Corti protein 2; Organ of Corti protein 0.123 0.644 0.779 II; p19A; p19skp1; RNA polymerase II elongation factor-like protein; SIII; S-phase kinase- associated protein 1; Transcription elongation factor B DRG family-regulatory protein 1; Likely ortholog of mouse immediate early response 0.121 0.869 0.890 erythropoietin 4; Zinc finger CCCH domain-containing protein 15 39S ribosomal protein L53, mitochondrial 0.119 0.960 0.919 Met-induced mitochondrial protein; Mitochondrial carrier homolog 2 0.116 0.476 0.951 Protein H105e3; Sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating; Putative 0.105 1.222 1.087 uncharacterized protein NSDHL Bw-45; HLA class I histocompatibility antigen, B-45 alpha chain; MHC class I antigen B*45 0.095 0.796 0.733 Hsc70-interacting protein; Progesterone receptor-associated p48 protein; Protein 0.095 0.714 0.961 FAM10A1; Putative tumor suppressor ST13; Renal carcinoma antigen NY-REN- 33; Suppression of tumorigenicity 13 protein; ST13 protein; Putative protein FAM10A5; Putative protein FAM10A4 BRCA1-A complex subunit MERIT40; Mediator of RAP80 interactions and targeting 0.091 0.275 0.504 subunit of 40 kDa; New component of the BRCA1-A complex Ezrin-radixin-moesin-binding phosphoprotein 50; Na(+)/H(+) exchange regulatory cofactor 0.088 0.557 0.968 NHE-RF1; Regulatory cofactor of Na(+)/H(+) exchanger; Sodium-hydrogen exchanger regulatory factor 1; Solute carrier family 9 isoform A3 regulatory factor 1 Valyl-tRNA synthetase; Protein G7a; Valine--tRNA ligase 0.084 0.710 0.910 HCV F-transactivated protein 2; Up-regulated during skeletal muscle growth protein 5 0.083 0.468 0.994 Adenylate cyclase-stimulating G alpha protein Extra large alphas protein; Guanine 0.073 1.209 1.091 nucleotide-binding protein G(s) subunit alpha isoforms XLas; Putative uncharacterized protein GNAS; Guanine nucleotide-binding protein G(s) subunit alpha isoforms short CCT-eta; HIV-1 Nef-interacting protein; T-complex protein 1 subunit eta; Putative 0.071 0.574 0.934 uncharacterized protein CCT7; cDNA FLJ59454, highly similar to T-complex protein 1 subunit eta; Chaperonin containing TCP1, subunit 7 (Eta), isoform CRA_a Collagen alpha-1(VI) chain; cDNA FLJ61362, highly similar to Collagen alpha-1(VI) chain 0.068 1.608 1.496 ARF-binding protein 1; E3 ubiquitin-protein ligase HUWE1; HECT, UBA and WWE domain- 0.066 0.661 0.963 containing protein 1; Homologous to E6AP carboxyl terminus homologous protein 9; Large structure of UREB1; Mcl-1 ubiquitin ligase E3; Upstream regulatory element-binding protein 1 Alpha-1-acid glycoprotein 2; Orosomucoid-2 0.060 1.836 1.804 Protein NipSnap homolog 3A; Protein NipSnap homolog 4; Target for Salmonella secreted 0.060 0.931 1.090 protein C Antioxidant protein 1; HBC189; Peroxiredoxin III; Peroxiredoxin-3; Protein MER5 0.058 0.578 0.972 homolog; Thioredoxin-dependent peroxide reductase, mitochondrial Aspartate carbamoyltransferase; CAD protein; Dihydroorotase; Glutamine-dependent 0.049 0.820 0.923 carbamoyl-phosphate synthase Nuclear mitotic apparatus protein 1; SP-H antigen 0.045 0.486 0.961 50 kDa nucleoporin; Nuclear pore complex protein Nup50; Nuclear pore-associated protein 0.043 0.036 0.745 60 kDa-like; Nucleoporin Nup50 [Acyl-carrier-protein] S-acetyltransferase; [Acyl-carrier-protein] 5-malonyltransferase; 3- 0.035 0.582 0.581 hydroxypalmitoyl-[acyl-carrier-protein] dehydratase; 3-oxoacyl-[acyl-carrier-protein] reductase; 3-oxoacyl-[acyl-carrier-protein] synthase; Enoyl-[acyl-carrier-protein] reductase; Fatty acid synthase; Oleoyl-[acyl-carrier-protein] hydrolase DNA mismatch repair protein Msh6; G/T mismatch-binding protein; MutS-alpha 160 kDa 0.029 0.674 0.714 subunit; cDNA FLJ55677, highly similar to DNA mismatch repair protein MSH6 Heterogeneous nuclear ribonucleoprotein H; Heterogeneous nuclear ribonucleoprotein H, 0.025 0.583 0.972 N-terminally processed Protein-tyrosine phosphatase 1D; Protein-tyrosine phosphatase 2C; SH-PTP2; SH- 0.018 0.430 0.913 PTP3; Tyrosine-protein phosphatase non-receptor type 11 ATP-dependent RNA helicase A; DEAH box protein 9; Nuclear DNA helicase II 0.006 0.562 0.967 Cysteine dioxygenase type 1; Cysteine dioxygenase type I 0.005 1.364 1.209
[0125] It has been observed that certain mitochondrial proteins are differentially expressed and their levels can be associated with the presence or absence of UC or CD disease. For example, sulfur dioxygenase (ETHE1), thiosulfate sulfur transferase (TST), cytochrome c oxidase subunit IV, sulfide dehydrogenase genes (SQR) and complexes III and IV of mithochondrial respiratory chain obtained from a gut mucus sample of a human subject can be indicative of the presence of UC or CD or IBD in the subject. However it will be appreciated that any other protein(s) listed in table 4 or 5 alone or in combination that is or are differentially expressed can also be used to assess the presence/absence/severity of UC or CD disease.
[0126] Expression of certain cytokines above normal levels can also be used to detect the presence of A. parvulum. For example the presence of A. parvulum is correlated with expression (or overexpression) of Cxcl1, II17a, II12 and II1. Therefore there is provided an assay for identifying the likelihood of an individual of having UC or CD or IBD by measuring a relative abundance of A. parvulum by measuring the expression of Cxcl1, II17a, II12 or II1. This correlation can also be used to provide a method of diagnostic that comprises collecting samples to measure one or more cytokines, determining the presence of A. parvulum based on the cytokine(s) measurement and establishing a diagnosis.
[0127] Table 5 List of all differentially expressed mitochondrial proteins and their variable importance in projection scores (VIP) derived from the calculated PLS-DA model.
TABLE-US-00005 TABLE 5 Comp. 1 Comp. 2 Comp. 3 Variable VIP VIP VIP Complex I-PDSW; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 1.834 1.448 1.178 10; NADH-ubiquinone oxidoreductase PDSW subunit; NADH dehydrogenase (Ubiquinone) 1 beta subcomplex, 10, 22 kDa, isoform CRA_a; NDUFB10 protein Complex I-75kD; NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial; cDNA 1.788 1.323 1.100 FLJ60586, highly similar to NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial (EC 1.6.5.3) Isovaleryl-CoA dehydrogenase, mitochondrial; cDNA FLJ16602 fis, clone TESTI4007816, 1.748 1.559 1.324 highly similar to Isovaleryl-CoA dehydrogenase, mitochondrial (EC 1.3.99.10); Isovaleryl Coenzyme A dehydrogenase, isoform CRA_b Complex I-39kD; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, 1.706 1.331 1.100 mitochondrial; NADH-ubiquinone oxidoreductase 39 kDa subunit Cytochrome c oxidase polypeptide Vb; Cytochrome c oxidase subunit 5B, mitochondrial 1.666 1.237 1.006 Complex III subunit 5; Complex III subunit IX; Cytochrome b-c1 complex subunit 1.658 1.249 1.038 11; Cytochrome b-c1 complex subunit 5; Cytochrome b-c1 complex subunit Rieske, mitochondrial; Rieske iron-sulfur protein; Ubiquinol-cytochrome c reductase 8 kDa protein; Ubiquinol-cytochrome c reductase iron-sulfur subunit; Putative cytochrome b-c1 complex subunit Rieske-like protein 1 Complex III subunit 7; Complex III subunit VII; Cytochrome b-c1 complex subunit 7; QP- 1.625 1.220 1.007 C; Ubiquinol-cytochrome c reductase complex 14 kDa protein; cDNA FLJ52271, moderately similar to Ubiquinol-cytochrome c reductase complex 14 kDa protein (EC 1.10.2.2) Complex III subunit 2; Core protein II; Cytochrome b-c1 complex subunit 2, 1.551 1.167 1.207 mitochondrial; Ubiquinol-cytochrome-c reductase complex core protein 2 Angiotensin-binding protein; Microsomal endopeptidase; Mitochondrial oligopeptidase 1.547 1.997 1.627 M; Neurolysin, mitochondrial; Neurotensin endopeptidase Rhodanese; Thiosulfate sulfurtransferase 1.504 1.169 0.954 Complex I-ASHI; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 8, 1.489 1.117 1.207 mitochondrial; NADH-ubiquinone oxidoreductase ASHI subunit; NADH dehydrogenase (Ubiquinone) 1 beta subcomplex, 8, 19 kDa; NADH dehydrogenase (Ubiquinone) 1 beta subcomplex, 8, 19 kDa, isoform CRA_a; cDNA FLJ52503, highly similar to NADH dehydrogenase (ubiquinone) 1 beta subcomplex subunit 8, mitochondrial (EC 1.6.5.3) (EC 1.6.99.3) (NADH-ubiquinone oxidoreductase ASHI subunit) (Complex I-ASHI) (CI-ASHI) Iron-sulfur subunit of complex II; Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, 1.486 1.167 1.040 mitochondrial Complex III subunit 1; Core protein I; Cytochrome b-c1 complex subunit 1, 1.474 1.124 0.922 mitochondrial; Ubiquinol-cytochrome-c reductase complex core protein 1 Complex I-B14.5a; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 1.470 1.088 1.194 7; NADH-ubiquinone oxidoreductase subunit B14.5a Complex I-23kD; NADH dehydrogenase [ubiquinone] iron-sulfur protein 8, 1.443 1.178 0.982 mitochondrial; NADH-ubiquinone oxidoreductase 23 kDa subunit; TYKY subunit Cytochrome c oxidase polypeptide IV; Cytochrome c oxidase subunit 4 isoform 1, 1.432 1.063 0.934 mitochondrial; Cytochrome c oxidase subunit IV isoform 1; COX4I1 protein Cytochrome c oxidase polypeptide VIc; Cytochrome c oxidase subunit 6C 1.416 1.074 0.929 Glutathione S-transferase kappa 1; Glutathione S-transferase subunit 13; GST 13-13; GST 1.404 1.172 0.975 class-kappa; GSTK1-1 Cytochrome c oxidase polypeptide II; Cytochrome c oxidase subunit 2 1.375 1.120 0.943 GTP-specific succinyl-CoA synthetase subunit beta; Succinyl-CoA ligase [GDP-forming] 1.363 1.127 0.961 subunit beta, mitochondrial; Succinyl-CoA synthetase beta-G chain 250/210 kDa paraneoplastic pemphigus antigen; Desmoplakin 1.354 1.040 0.867 Complex I-51kD; NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial; NADH 1.353 1.034 1.066 dehydrogenase flavoprotein 1; NADH-ubiquinone oxidoreductase 51 kDa subunit; cDNA FLJ57949, highly similar to NADH-ubiquinone oxidoreductase 51 kDa subunit, mitochondrial (EC 1.6.5.3); cDNA, FLJ79021, highly similar to NADH-ubiquinone oxidoreductase 51 kDa subunit, mitochondrial (EC 1.6.5.3) Alu corepressor 1; Antioxidant enzyme B166; Liver tissue 2D-page spot 71B; Peroxiredoxin 1.336 0.994 0.821 V; Peroxiredoxin-5, mitochondrial; Peroxisomal antioxidant enzyme; PLP; Thioredoxin peroxidase PMP20; Thioredoxin reductase; TPx type VI; Putative uncharacterized protein PRDX5 ICD-M; IDP; Isocitrate dehydrogenase [NADP], mitochondrial; NADP(+)-specific 1.320 1.210 1.078 ICDH; Oxalosuccinate decarboxylase Flavoprotein subunit of complex II; Succinate dehydrogenase [ubiquinone] flavoprotein 1.292 1.057 1.032 subunit, mitochondrial Brain-type aldolase; Fructose-bisphosphate aldolase C; Fructose-bisphosphate 1.289 1.115 0.906 aldolase; Putative uncharacterized protein ALDOC Complex I-13kD-A; NADH dehydrogenase [ubiquinone] iron-sulfur protein 6, 1.261 0.935 0.781 mitochondrial; NADH-ubiquinone oxidoreductase 13 kDa-A subunit Ethylmalonic encephalopathy protein 1; Hepatoma subtracted clone one protein; Protein 1.252 0.951 0.851 ETHE1, mitochondrial Complex I-B15; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 4; NADH- 1.241 0.922 0.749 ubiquinone oxidoreductase B15 subunit; Putative uncharacterized protein NDUFB4 DEAH box protein 30; Putative ATP-dependent RNA helicase DHX30 1.213 1.450 1.220 Cytochrome c oxidase polypeptide VIIc; Cytochrome c oxidase subunit 7C, mitochondrial 1.211 0.897 0.751 Amine oxidase [flavin-containing] A; Monoamine oxidase type A; cDNA FLJ61220, highly 1.204 0.970 0.866 similar to Amine oxidase (flavin-containing) A (EC 1.4.3.4) Carnitine O-palmitoyltransferase 2, mitochondrial; Carnitine palmitoyltransferase II 1.141 0.869 0.871 Amine oxidase [flavin-containing] B; Monoamine oxidase type B; cDNA FLJ51821, highly 1.066 1.289 1.107 similar to Amine oxidase (flavin-containing) B (EC 1.4.3.4); cDNA FLJ52418, highly similar to Amine oxidase (flavin-containing) B (EC 1.4.3.4) Glutaminase kidney isoform, mitochondrial; K-glutaminase; L-glutamine amidohydrolase 1.033 1.317 1.087 Acyl-coenzyme A thioesterase 13; Thioesterase superfamily member 2 1.006 1.393 1.190 Cathepsin D; Cathepsin D heavy chain; Cathepsin D light chain 1.004 0.784 0.652 78 kDa gastrin-binding protein; Long chain 3-hydroxyacyl-CoA dehydrogenase; Long-chain 0.999 0.742 0.836 enoyl-CoA hydratase; TP-alpha; Trifunctional enzyme subunit alpha, mitochondrial Elongation factor Tu, mitochondrial; P43 0.991 0.754 0.929 Enoyl-CoA hydratase 1; Enoyl-CoA hydratase, mitochondrial; Short-chain enoyl-CoA 0.968 0.842 0.714 hydratase Dihydrolipoamide dehydrogenase; Dihydrolipoyl dehydrogenase, mitochondrial; Glycine 0.956 0.716 0.728 cleavage system L protein; cDNA FLJ50515, highly similar to Dihydrolipoyl dehydrogenase, mitochondrial (EC 1.8.1.4); Dihydrolipoyl dehydrogenase Delta(3), delta(2)-enoyl-CoA isomerase; Diazepam-binding inhibitor-related protein 0.945 0.706 0.578 1; Dodecenoyl-CoA isomerase; DRS-1; Hepatocellular carcinoma-associated antigen 88; Peroxisomal 3,2-trans-enoyl-CoA isomerase; Renal carcinoma antigen NY-REN- 1; Putative uncharacterized protein PECI Catalase 0.924 0.881 0.801 3-ketoacyl-CoA thiolase; Acetyl-CoA acyltransferase; Beta-ketothiolase; TP- 0.892 0.696 0.981 beta; Trifunctional enzyme subunit beta, mitochondrial; cDNA FLJ56214, highly similar to Trifunctional enzyme subunit beta, mitochondrial; Putative uncharacterized protein HADHB Aldehyde dehydrogenase family 6 member A1; Methylmalonate-semialdehyde 0.882 0.756 0.616 dehydrogenase [acylating], mitochondrial Malic enzyme 2; NAD-dependent malic enzyme, mitochondrial 0.872 1.419 1.325 Outer mitochondrial membrane protein porin 2; Voltage-dependent anion-selective channel 0.871 0.649 0.538 protein 2; Voltage-dependent anion channel 2; cDNA FLJ60120, highly similar to Voltage- dependent anion-selective channel protein 2; cDNA, FLJ78818, highly similar to Voltage- dependent anion-selective channel protein 2 Aspartate aminotransferase, mitochondrial; Fatty acid-binding protein; Glutamate 0.869 0.668 0.605 oxaloacetate transaminase 2; Plasma membrane-associated fatty acid-binding protein; Transaminase A Aldehyde dehydrogenase 5; Aldehyde dehydrogenase family 1 member B1; Aldehyde 0.861 0.893 0.729 dehydrogenase X, mitochondrial; cDNA FLJ51238, highly similar to Aldehyde dehydrogenase X, mitochondrial (EC 1.2.1.3) Protein NipSnap homolog 1 0.849 0.635 0.541 Calcium-binding mitochondrial carrier protein Aralar2; Citrin; Mitochondrial aspartate 0.840 0.650 0.691 glutamate carrier 2; Solute carrier family 25 member 13 Elongation factor Ts, mitochondrial; Elongation factor Ts 0.822 0.893 0.726 Cytosol aminopeptidase; Leucine aminopeptidase 3; Leucyl aminopeptidase; Peptidase 0.797 0.590 0.848 S; Proline aminopeptidase; Prolyl aminopeptidase Outer mitochondrial membrane protein porin 1; Plasmalemmal porin; Porin 31HL; Porin 0.766 0.602 0.533 31HM; Voltage-dependent anion-selective channel protein 1 Superoxide dismutase [Mn], mitochondrial; Superoxide dismutase 0.723 0.581 0.916 Sideroflexin-1; Tricarboxylate carrier protein 0.721 0.705 1.238 Aldehyde dehydrogenase family 18 member A1; Delta-1-pyrroline-5-carboxylate 0.716 0.559 1.164 synthase; Gamma-glutamyl kinase; Gamma-glutamyl phosphate reductase; Glutamate 5- kinase; Glutamate-5-semialdehyde dehydrogenase; Glutamyl-gamma-semialdehyde dehydrogenase 39S ribosomal protein L53, mitochondrial 0.705 0.812 0.703 Glycine hydroxymethyltransferase; Serine hydroxymethyltransferase, mitochondrial; Serine 0.687 0.690 1.139 methylase; cDNA FLJ58585, highly similar to Serine hydroxymethyltransferase, mitochondrial (EC 2.1.2.1); Serine hydroxymethyltransferase 2 (Mitochondrial), isoform CRA_h Antioxidant enzyme AOE372; Peroxiredoxin IV; Peroxiredoxin-4; Thioredoxin peroxidase 0.651 1.017 1.015 AO372; Thioredoxin-dependent peroxide reductase A0372 Hematopoietic cell-specific LYN substrate 1; Hematopoietic lineage cell-specific 0.635 0.872 0.708 protein; LckBP1; p75 Acetoacetyl-CoA thiolase; Acetyl-CoA acetyltransferase, mitochondrial; T2 0.592 0.646 0.573 Complex I-B8; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 2; NADH- 0.570 1.106 0.937 ubiquinone oxidoreductase B8 subunit Heat shock-related 70 kDa protein 2; cDNA FLJ40505 fis, clone TESTI2045562, highly 0.551 1.027 0.850 similar to HEAT SHOCK-RELATED 70 kDa PROTEIN 2 Pyruvate carboxylase, mitochondrial; Pyruvic carboxylase; cDNA FLJ60715, highly similar to 0.542 0.477 0.394 Pyruvate carboxylase, mitochondrial (EC 6.4.1.1) Hydroxysteroid dehydrogenase-like protein 2; cDNA FLJ61200, highly similar to Homo 0.509 0.403 0.419 sapiens hydroxysteroid dehydrogenase like 2 (HSDL2), mRNA PDHE1-A type I; Pyruvate dehydrogenase E1 component subunit alpha, somatic form, 0.498 0.372 0.801 mitochondrial Antioxidant protein 1; HBC189; Peroxiredoxin III; Peroxiredoxin-3; Protein MER5 0.490 0.707 1.120 homolog; Thioredoxin-dependent peroxide reductase, mitochondrial 3-hydroxybutyrate dehydrogenase type 2; Dehydrogenase/reductase SDR family member 0.476 0.807 0.883 6; Oxidoreductase UCPA; R-beta-hydroxybutyrate dehydrogenase 3-5 RNA exonuclease OLD35; PNPase old-35; Polynucleotide phosphorylase 0.470 1.236 1.035 1; Polynucleotide phosphorylase-like protein; Polyribonucleotide nucleotidyltransferase 1, mitochondrial 3-ketoacyl-CoA thiolase, mitochondrial; Acetyl-CoA acyltransferase; Beta- 0.461 0.677 1.061 ketothiolase; Mitochondrial 3-oxoacyl-CoA thiolase; T1 Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial 0.458 0.638 1.143 Carnitine/acylcarnitine translocase; Mitochondrial carnitine/acylcarnitine carrier 0.453 2.048 1.697 protein; Solute carrier family 25 member 20; cDNA FLJ53016, highly similar to Mitochondrial carnitine/acylcarnitine carrier protein Protein SCO2 homolog, mitochondrial 0.439 1.323 1.107 HCNPpp; Hippocampal cholinergic neurostimulating peptide; Neuropolypeptide 0.411 0.517 0.981 h3; Phosphatidylethanolamine-binding protein 1; Prostatic-binding protein; Raf kinase inhibitor protein; cDNA FLJ51535, highly similar to Phosphatidylethanolamine-binding protein 1 Collapsin response mediator protein 2; Dihydropyrimidinase-related protein 2; N2A3; Unc-33- 0.403 0.309 1.150 like phosphoprotein 2 28S ribosomal protein S9, mitochondrial 0.356 2.072 1.692 Met-induced mitochondrial protein; Mitochondrial carrier homolog 2 0.353 0.461 1.075 Phosphate carrier protein, mitochondrial; Phosphate transport protein; Solute carrier family 0.353 0.514 1.140 25 member 3 Acyl-CoA-binding domain-containing protein 3; Golgi complex-associated protein 1; Golgi 0.351 1.694 1.801 phosphoprotein 1; Golgi resident protein GCP60; PBR- and PKA-associated protein 7; Peripheral benzodiazepine receptor-associated protein PAP7 HCV F-transactivated protein 2; Up-regulated during skeletal muscle growth protein 5 0.344 0.707 1.117 Protein-tyrosine phosphatase 1D; Protein-tyrosine phosphatase 2C; SH-PTP2; SH- 0.303 0.699 1.024 PTP3; Tyrosine-protein phosphatase non-receptor type 11 ATP synthase subunit a; F-ATPase protein 6 0.260 0.193 0.279 Complex III subunit 3; Complex III subunit III; Cytochrome b; Cytochrome b-c1 complex 0.235 0.489 0.692 subunit 3; Ubiquinol-cytochrome-c reductase complex cytochrome b subunit Clathrin heavy chain 1; Clathrin heavy chain on chromosome 17 0.226 0.477 0.730 Glutamate dehydrogenase 1, mitochondrial; cDNA FLJ55203, highly similar to Glutamate 0.216 0.315 0.598 dehydrogenase 1, mitochondrial (EC 1.4.1.3); cDNA FLJ16138 fis, clone BRALZ2017531, highly similar to Glutamate dehydrogenase 1, mitochondrial (EC 1.4.1.3); Glutamate dehydrogenase 1, isoform CRA_a; Glutamate dehydrogenase 2, mitochondrial Succinyl-CoA ligase [GDP-forming] subunit alpha, mitochondrial; Succinyl-CoA synthetase 0.189 0.452 1.125 subunit alpha Complex I-15 kDa; NADH dehydrogenase [ubiquinone] iron-sulfur protein 5; NADH- 0.163 1.344 1.142 ubiquinone oxidoreductase 15 kDa subunit Complex I-49kD; NADH dehydrogenase [ubiquinone] iron-sulfur protein 2, 0.137 0.301 1.161 mitochondrial; NADH-ubiquinone oxidoreductase 49 kDa subunit; cDNA, FLJ78876, highly similar to NADH-ubiquinone oxidoreductase 49 kDa subunit, mitochondrial (EC 1.6.5.3) 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial; 3-hydroxyisobutyryl-coenzyme A 0.106 1.378 1.513 hydrolase Alcohol dehydrogenase 5; Alcohol dehydrogenase class chi chain; Alcohol dehydrogenase 0.093 0.471 1.107 class-3; Alcohol dehydrogenase class-III; Glutathione-dependent formaldehyde dehydrogenase; S-(hydroxymethyl)glutathione dehydrogenase Electron transfer flavoprotein subunit beta 0.091 0.479 1.047 130 kDa leucine-rich protein; GP130; Leucine-rich PPR motif-containing protein, 0.057 0.480 1.135 mitochondrial ATP-specific succinyl-CoA synthetase subunit beta; Renal carcinoma antigen NY-REN- 0.024 0.865 0.725 39; Succinyl-CoA ligase [ADP-forming] subunit beta, mitochondrial; Succinyl-CoA synthetase beta-A chain; Succinate-CoA ligase, ADP-forming, beta subunit Citrate synthase, mitochondrial; Citrate synthase 0.014 0.627 1.020
[0128] In yet another embodiment of the invention there is provided an assay that allows the measurement of the gut microbiota composition and the meta-proteome from a same sample. More specifically the assay comprises the collection of mucus at the luminal interface of the gut during endoscopy by flushing a physiological solution, such as sterile saline, onto the mucosa to remove the strongly adherent mucus layer overlaying the intestinal mucosal epithelial cells thereby sampling the microbial community and host and bacterial proteins embedded within the mucus layer. Aspirates are then collected directly through the colonoscope and the samples are preferably immediately put on ice right in the endoscopy suite. The sample can then be analyzed at the point of care or transferred to a laboratory. Bacteria and proteins can then be identified and/or measured as described above. This method advantageously permits the establishment of a protein and bacterial profile in the same patient at a pre-determined time point.
[0129] The establishment of the presence of disease using bacterial taxa can be used to determine a course of treatment in a patient. Treatment is normally based on accepted diseases indexes. The methods and assays provided by the invention can complement or replace such disease indexes to provide more accurate diagnosis and thereby permit more efficacious treatments.
[0130] It will be appreciated that the above described assays for identifying and measuring gut proteins and bacteria can be performed as a function of time thereby allowing an assessment of the progression of the disease as well as of the efficacy of a treatment. Staging of IBD (and CD and UC) is particularly useful for choosing the appropriate treatment to be delivered. For example, treatment regimen may advantageously be adjusted taking in consideration the levels of H.sub.2S producing bacteria, which as described above, are more elevated as the severity of the disease increases. Thus regimens that are more aggressive towards mitigating the effects of the H.sub.2S producing bacteria can be timely administered to optimize the therapeutic dose. Treatment optimization using the information on the presence/stage of IBD, UC and CD provided by the measuring of bacteria and protein as described above, can be applied to known therapeutic agents such as but not limited to aminosalycylates, immunomodulators, anti-integrins, anti-cytokines, enteral feed programs, steroids, corticosteroids, antibiotics, anti-TNF, bismuth and the like. In particular, as further described below, bismuth can be used effectively as treatment when A. parvulum is detected in a patient and or assessed to be above certain critical abundance levels.
[0131] In table 6 taxa that vary significantly in abundance in II10/ mice in response to A. parvulum colonization and/or bismuth administration are listed. As can be seen from the table bismuth treatment may be indicated or beneficial when the relative abundance of taxa other than A. parvulum are within levels indicative of disease.
TABLE-US-00006 TABLE 6 Std. Variable Minimum Maximum Mean dev. p|Atopo p|AtopoBis p|Bis p|SPF PHYLUM Basidiomycota|Atopo 0.000 0.000 0.000 0.000 1 1.000 1.000 0.000 Basidiomycota|AtopoBis 0.000 0.000 0.000 0.000 1.000 1 1.000 0.000 Basidiomycota|Bis 0.000 0.000 0.000 0.000 1.000 1.000 1 0.000 Basidiomycota|SPF 0.000 80.000 25.429 32.103 0.000 0.000 0.000 1 Firmicutes|Atopo 57699.000 101958.000 79769.875 13542.546 1 0.869 0.002 0.194 Firmicutes|AtopoBis 49410.000 184098.000 104984.625 60115.166 0.869 1 0.003 0.255 Firmicutes|Bis 105913.000 199488.000 175443.625 40788.918 0.002 0.003 1 0.084 Firmicutes|SPF 64133.000 198934.000 121645.143 57520.397 0.194 0.255 0.084 1 Cyanobacteria|Atopo 1.000 136.000 56.125 53.731 1 0.023 0.007 0.006 Cyanobacteria|AtopoBis 63.000 553.000 216.125 157.070 0.023 1 0.680 0.563 Cyanobacteria|Bis 52.000 669.000 261.000 194.269 0.007 0.680 1 0.857 Cyanobacteria|SPF 30.000 872.000 370.000 326.109 0.006 0.563 0.857 1 Fusobacteria|Atopo 0.000 20.000 3.500 6.845 1 0.008 0.089 0.007 Fusobacteria|AtopoBis 1.000 34434.000 6670.125 12103.868 0.008 1 0.341 0.889 Fusobacteria|Bis 0.000 3175.000 445.125 1109.012 0.089 0.341 1 0.289 Fusobacteria|SPF 5.000 96.000 38.571 31.921 0.007 0.889 0.289 1 Bacteroidetes|Atopo 86976.000 133781.000 108741.375 14150.040 1 0.216 <0.0001 0.011 Bacteroidetes|AtopoBis 232.000 117882.000 64729.375 53917.801 0.216 1 0.004 0.175 Bacteroidetes|Bis 98.000 519.000 209.500 134.340 <0.0001 0.004 1 0.151 Bacteroidetes|SPF 71.000 107705.000 28633.857 48179.254 0.011 0.175 0.151 1 CLASS Fusobacteria (class)|Atopo 0.000 20.000 3.500 6.845 1 0.008 0.089 0.007 Fusobacteria (class)| 1.000 34434.000 6670.125 12103.868 0.008 1 0.341 0.889 AtopoBis Fusobacteria (class)|Bis 0.000 3175.000 445.125 1109.012 0.089 0.341 1 0.289 Fusobacteria (class)|SPF 5.000 96.000 38.571 31.921 0.007 0.889 0.289 1 Erysipelotrichi|Atopo 998.000 7663.000 4385.500 2215.367 1 0.409 0.011 0.004 Erysipelotrichi|AtopoBis 928.000 8147.000 3320.375 2780.457 0.409 1 0.088 0.037 Erysipelotrichi|Bis 2.000 10136.000 1779.000 3443.700 0.011 0.088 1 0.660 Erysipelotrichi|SPF 6.000 3618.000 861.857 1483.609 0.004 0.037 0.660 1 Negativicutes|Atopo 1.000 2446.000 783.625 939.756 1 0.741 0.078 0.198 Negativicutes|AtopoBis 5.000 32.000 16.375 8.568 0.741 1 0.036 0.333 Negativicutes|Bis 0.000 10.000 3.625 3.335 0.078 0.036 1 0.003 Negativicutes|SPF 1.000 7076.000 2222.286 2915.263 0.198 0.333 0.003 1 Clostridia|Atopo 49447.000 95800.000 72002.750 15417.245 1 0.826 0.002 0.111 Clostridia|AtopoBis 41041.000 155491.000 88416.125 47521.587 0.826 1 0.005 0.167 Clostridia|Bis 95673.000 193932.000 161745.625 37810.173 0.002 0.005 1 0.184 Clostridia|SPF 54427.000 194395.000 116338.286 57644.557 0.111 0.167 0.184 1 Agaricomycetes|Atopo 0.000 0.000 0.000 0.000 1 1.000 1.000 0.000 Agaricomycetes|AtopoBis 0.000 0.000 0.000 0.000 1.000 1 1.000 0.000 Agaricomycetes|Bis 0.000 0.000 0.000 0.000 1.000 1.000 1 0.000 Agaricomycetes|SPF 0.000 80.000 25.429 32.103 0.000 0.000 0.000 1 Bacteroidia|Atopo 86976.000 133781.000 108741.375 14150.040 1 0.216 <0.0001 0.011 Bacteroidia|AtopoBis 232.000 117882.000 64729.375 53917.801 0.216 1 0.004 0.175 Bacteroidia|Bis 96.000 519.000 209.250 134.578 <0.0001 0.004 1 0.151 Bacteroidia|SPF 71.000 107705.000 28633.857 48179.254 0.011 0.175 0.151 1 Betaproteobacteria|Atopo 0.000 295.000 44.375 101.677 1 0.067 0.837 0.001 Betaproteobacteria| 11.000 61.000 30.375 15.638 0.067 1 0.105 0.102 AtopoBis Betaproteobacteria|Bis 5.000 27.000 13.625 8.297 0.837 0.105 1 0.001 Betaproteobacteria|SPF 38.000 133.000 62.143 33.810 0.001 0.102 0.001 1 ORDER Clostridiales|Atopo 49447.000 95800.000 72002.750 15417.245 1 0.826 0.002 0.111 Clostridiales|AtopoBis 41041.000 155488.000 88397.875 47505.759 0.826 1 0.005 0.167 Clostridiales|Bis 95673.000 193932.000 161745.500 37810.379 0.002 0.005 1 0.184 Clostridiales|SPF 54427.000 194394.000 116338.000 57644.323 0.111 0.167 0.184 1 Alteromonadales|Atopo 0.000 1.000 0.125 0.354 1 0.724 0.282 0.000 Alteromonadales|AtopoBis 0.000 1.000 0.250 0.463 0.724 1 0.470 0.001 Alteromonadales|Bis 0.000 126.000 24.875 47.975 0.282 0.470 1 0.007 Alteromonadales|SPF 1.000 915.000 264.143 345.489 0.000 0.001 0.007 1 Bacteroidales|Atopo 86976.000 133781.000 108741.375 14150.040 1 0.216 <0.0001 0.011 Bacteroidales|AtopoBis 232.000 117882.000 64729.375 53917.801 0.216 1 0.004 0.175 Bacteroidales|Bis 96.000 519.000 209.250 134.578 <0.0001 0.004 1 0.151 Bacteroidales|SPF 71.000 107705.000 28633.857 48179.254 0.011 0.175 0.151 1 Oceanospirillales|Atopo 0.000 5.000 2.000 1.852 1 0.393 0.576 0.004 Oceanospirillales|AtopoBis 0.000 74.000 23.125 27.910 0.393 1 0.158 0.037 Oceanospirillales|Bis 0.000 56.000 11.250 21.645 0.576 0.158 1 0.001 Oceanospirillales|SPF 3.000 4829.000 1391.571 1770.378 0.004 0.037 0.001 1 Agaricales|Atopo 0.000 0.000 0.000 0.000 1 1.000 1.000 0.000 Agaricales|AtopoBis 0.000 0.000 0.000 0.000 1.000 1 1.000 0.000 Agaricales|Bis 0.000 0.000 0.000 0.000 1.000 1.000 1 0.000 Agaricales|SPF 0.000 80.000 25.429 32.103 0.000 0.000 0.000 1 Actinomycetales|Atopo 0.000 1.000 0.500 0.535 1 0.446 0.796 0.002 Actinomycetales|AtopoBis 0.000 4.000 1.250 1.488 0.446 1 0.615 0.020 Actinomycetales|Bis 0.000 11.000 1.875 3.834 0.796 0.615 1 0.005 Actinomycetales|SPF 1.000 61.000 12.286 21.593 0.002 0.020 0.005 1 Erysipelotrichales|Atopo 998.000 7663.000 4385.500 2215.367 1 0.409 0.011 0.004 Erysipelotrichales|AtopoBis 928.000 8147.000 3320.375 2780.457 0.409 1 0.088 0.037 Erysipelotrichales|Bis 2.000 10136.000 1779.000 3443.700 0.011 0.088 1 0.660 Erysipelotrichales|SPF 6.000 3618.000 861.857 1483.609 0.004 0.037 0.660 1 Neisseriales|Atopo 0.000 0.000 0.000 0.000 1 0.004 0.585 0.441 Neisseriales|AtopoBis 0.000 2.000 0.750 0.707 0.004 1 0.022 0.048 Neisseriales|Bis 0.000 1.000 0.125 0.354 0.585 0.022 1 0.809 Neisseriales|SPF 0.000 8.000 1.143 3.024 0.441 0.048 0.809 1 Pasteurellales|Atopo 0.000 1.000 0.125 0.354 1 0.594 0.530 0.000 Pasteurellales|AtopoBis 0.000 4.000 0.750 1.488 0.594 1 0.925 0.001 Pasteurellales|Bis 0.000 14.000 2.000 4.899 0.530 0.925 1 0.001 Pasteurellales|SPF 2.000 56.000 20.143 21.836 0.000 0.001 0.001 1 Chromatiales|Atopo 0.000 0.000 0.000 0.000 1 1.000 0.560 0.000 Chromatiales|AtopoBis 0.000 0.000 0.000 0.000 1.000 1 0.560 0.000 Chromatiales|Bis 0.000 2.000 0.250 0.707 0.560 0.560 1 0.001 Chromatiales|SPF 0.000 14.000 4.571 5.255 0.000 0.000 0.001 1 Vibrionales|Atopo 0.000 13.000 2.375 4.534 1 0.191 0.374 <0.0001 Vibrionales|AtopoBis 1.000 14.000 5.000 5.155 0.191 1 0.677 0.006 Vibrionales|Bis 0.000 23.000 6.125 8.097 0.374 0.677 1 0.002 Vibrionales|SPF 20.000 48532.000 15351.143 18959.865 <0.0001 0.006 0.002 1 Burkholderiales|Atopo 0.000 294.000 43.875 101.490 1 0.052 0.978 0.001 Burkholderiales|AtopoBis 10.000 58.000 27.750 15.351 0.052 1 0.056 0.137 Burkholderiales|Bis 5.000 19.000 11.125 5.357 0.978 0.056 1 0.001 Burkholderiales|SPF 32.000 133.000 58.571 35.156 0.001 0.137 0.001 1 Fusobacteriales|Atopo 0.000 20.000 3.500 6.845 1 0.008 0.089 0.007 Fusobacteriales|AtopoBis 1.000 34434.000 6670.125 12103.868 0.008 1 0.341 0.889 Fusobacteriales|Bis 0.000 3175.000 445.125 1109.012 0.089 0.341 1 0.289 Fusobacteriales|SPF 5.000 96.000 38.571 31.921 0.007 0.889 0.289 1 Bacillales|Atopo 73.000 348.000 155.000 97.999 1 0.000 0.007 0.115 Bacillales|AtopoBis 1326.000 30228.000 8866.125 9642.601 0.000 1 0.336 0.050 Bacillales|Bis 46.000 13607.000 5683.500 4962.745 0.007 0.336 1 0.304 Bacillales|SPF 163.000 7884.000 1604.857 2795.624 0.115 0.050 0.304 1 Selenomonadales|Atopo 1.000 2446.000 783.625 939.756 1 0.741 0.078 0.198 Selenomonadales|AtopoBis 5.000 32.000 16.375 8.568 0.741 1 0.036 0.333 Selenomonadales|Bis 0.000 10.000 3.625 3.335 0.078 0.036 1 0.003 Selenomonadales|SPF 1.000 7076.000 2222.286 2915.263 0.198 0.333 0.003 1 Lactobacillales|Atopo 295.000 7198.000 2442.750 2396.791 1 0.783 0.296 0.032 Lactobacillales|AtopoBis 187.000 18776.000 4365.625 6472.746 0.783 1 0.187 0.060 Lactobacillales|Bis 848.000 22750.000 6231.875 7499.344 0.296 0.187 1 0.002 Lactobacillales|SPF 66.000 1769.000 444.000 610.249 0.032 0.060 0.002 1 FAMILY Staphylococcaceae|Atopo 0.000 9.000 1.375 3.114 1 0.002 0.004 0.010 Staphylococcaceae| 6.000 82.000 32.625 28.213 0.002 1 0.793 0.637 AtopoBis Staphylococcaceae|Bis 0.000 132.000 40.000 45.854 0.004 0.793 1 0.827 Staphylococcaceae|SPF 2.000 838.000 191.000 333.003 0.010 0.637 0.827 1 Enterococcaceae|Atopo 11.000 38.000 20.750 9.588 1 0.000 0.014 0.040 Enterococcaceae|AtopoBis 122.000 1580.000 725.125 549.030 0.000 1 0.178 0.106 Enterococcaceae|Bis 0.000 1440.000 567.125 531.694 0.014 0.178 1 0.753 Enterococcaceae|SPF 39.000 1383.000 261.286 495.744 0.040 0.106 0.753 1 Eubacteriaceae|Atopo 3.000 43.000 8.875 13.861 1 0.061 0.518 0.001 Eubacteriaceae|AtopoBis 10.000 32.000 18.500 8.783 0.061 1 0.220 0.111 Eubacteriaceae|Bis 1.000 2387.000 313.625 838.348 0.518 0.220 1 0.005 Eubacteriaceae|SPF 13.000 1107.000 485.143 399.257 0.001 0.111 0.005 1 Ferrimonadaceae|Atopo 0.000 0.000 0.000 0.000 1 0.625 1.000 <0.0001 Ferrimonadaceae|AtopoBis 0.000 1.000 0.125 0.354 0.625 1 0.625 0.000 Ferrimonadaceae|Bis 0.000 0.000 0.000 0.000 1.000 0.625 1 0.0001 Ferrimonadaceae|SPF 0.000 623.000 140.714 227.571 <0.0001 0.000 <0.0001 1 Alcanivoracaceae|Atopo 0.000 4.000 1.500 1.773 1 0.477 0.314 0.064 Alcanivoracaceae|AtopoBis 0.000 73.000 22.125 28.119 0.477 1 0.086 0.245 Alcanivoracaceae|Bis 0.000 4.000 0.500 1.414 0.314 0.086 1 0.005 Alcanivoracaceae|SPF 0.000 554.000 143.286 208.723 0.064 0.245 0.005 1 Bacteroidaceae|Atopo 86967.000 133771.000 108707.250 14136.218 1 0.226 <0.0001 0.007 Bacteroidaceae|AtopoBis 211.000 117745.000 64625.875 53942.157 0.226 1 0.005 0.125 Bacteroidaceae|Bis 74.000 515.000 171.750 143.702 <0.0001 0.005 1 0.239 Bacteroidaceae|SPF 57.000 107600.000 28388.714 48274.613 0.007 0.125 0.239 1 Oceanospirillaceae|Atopo 0.000 1.000 0.250 0.463 1 0.424 0.722 0.000 Oceanospirillaceae| 0.000 4.000 1.000 1.414 0.424 1 0.657 0.003 AtopoBis Oceanospirillaceae|Bis 0.000 16.000 3.250 6.228 0.722 0.657 1 0.001 Oceanospirillaceae|SPF 3.000 3579.000 1056.714 1313.005 0.000 0.003 0.001 1 Halomonadaceae|Atopo 0.000 0.000 0.000 0.000 1 1.000 1.000 0.000 Halomonadaceae|AtopoBis 0.000 0.000 0.000 0.000 1.000 1 1.000 0.000 Halomonadaceae|Bis 0.000 0.000 0.000 0.000 1.000 1.000 1 0.000 Halomonadaceae|SPF 0.000 18.000 5.857 7.010 0.000 0.000 0.000 1 Lactobacillaceae|Atopo 263.000 7137.000 2406.750 2385.720 1 0.004 0.000 0.001 Lactobacillaceae|AtopoBis 3.000 27.000 12.375 9.226 0.004 1 0.440 0.586 Lactobacillaceae|Bis 0.000 1026.000 133.000 360.889 0.000 0.440 1 0.840 Lactobacillaceae|SPF 0.000 81.000 19.571 30.127 0.001 0.586 0.840 1 Neisseriaceae|Atopo 0.000 0.000 0.000 0.000 1 0.004 0.585 0.441 Neisseriaceae|AtopoBis 0.000 2.000 0.750 0.707 0.004 1 0.022 0.048 Neisseriaceae|Bis 0.000 1.000 0.125 0.354 0.585 0.022 1 0.809 Neisseriaceae|SPF 0.000 8.000 1.143 3.024 0.441 0.048 0.809 1 Halothiobacillaceae|Atopo 0.000 0.000 0.000 0.000 1 1.000 1.000 <0.0001 Halothiobacillaceae| 0.000 0.000 0.000 0.000 1.000 1 1.000 <0.0001 AtopoBis Halothiobacillaceae|Bis 0.000 0.000 0.000 0.000 1.000 1.000 1 <0.0001 Halothiobacillaceae|SPF 0.000 14.000 4.571 5.255 <0.0001 <0.0001 <0.0001 1 Pasteurellaceae|Atopo 0.000 1.000 0.125 0.354 1 0.594 0.530 0.000 Pasteurellaceae|AtopoBis 0.000 4.000 0.750 1.488 0.594 1 0.925 0.001 Pasteurellaceae|Bis 0.000 14.000 2.000 4.899 0.530 0.925 1 0.001 Pasteurellaceae|SPF 2.000 56.000 20.143 21.836 0.000 0.001 0.001 1 Erysipelotrichaceae|Atopo 998.000 7663.000 4385.500 2215.367 1 0.409 0.011 0.004 Erysipelotrichaceae| 928.000 8147.000 3320.375 2780.457 0.409 1 0.088 0.037 AtopoBis Erysipelotrichaceae|Bis 2.000 10136.000 1779.000 3443.700 0.011 0.088 1 0.660 Erysipelotrichaceae|SPF 6.000 3618.000 861.857 1483.609 0.004 0.037 0.660 1 Fusobacteriaceae|Atopo 0.000 20.000 3.500 6.845 1 0.008 0.089 0.007 Fusobacteriaceae|AtopoBis 1.000 34434.000 6670.125 12103.868 0.008 1 0.341 0.889 Fusobacteriaceae|Bis 0.000 3175.000 445.125 1109.012 0.089 0.341 1 0.289 Fusobacteriaceae|SPF 5.000 96.000 38.571 31.921 0.007 0.889 0.289 1 Bacillaceae|Atopo 71.000 336.000 147.875 94.253 1 0.001 0.024 0.311 Bacillaceae|AtopoBis 1182.000 28393.000 8495.875 9032.956 0.001 1 0.284 0.028 Bacillaceae|Bis 6.000 13296.000 5596.125 4907.619 0.024 0.284 1 0.244 Bacillaceae|SPF 65.000 7836.000 1401.571 2847.097 0.311 0.028 0.244 1 Listeriaceae|Atopo 0.000 1.000 0.375 0.518 1 0.006 0.029 0.477 Listeriaceae|AtopoBis 0.000 17.000 7.250 6.497 0.006 1 0.590 0.055 Listeriaceae|Bis 0.000 14.000 5.000 4.751 0.029 0.590 1 0.161 Listeriaceae|SPF 0.000 29.000 4.571 10.799 0.477 0.055 0.161 1 Streptococcaceae|Atopo 0.000 21.000 7.500 7.521 1 0.182 0.001 0.056 Streptococcaceae|AtopoBis 0.000 17141.000 3433.000 6026.709 0.182 1 0.046 0.532 Streptococcaceae|Bis 9.000 22660.000 5396.500 7790.156 0.001 0.046 1 0.193 Streptococcaceae|SPF 8.000 237.000 84.714 100.521 0.056 0.532 0.193 1 Vibrionaceae|Atopo 0.000 13.000 2.375 4.534 1 0.191 0.374 <0.0001 Vibrionaceae|AtopoBis 1.000 14.000 5.000 5.155 0.191 1 0.677 0.006 Vibrionaceae|Bis 0.000 23.000 6.125 8.097 0.374 0.677 1 0.002 Vibrionaceae|SPF 20.000 48532.000 15351.143 18959.865 <0.0001 0.006 0.002 1 Methylococcaceae|Atopo 0.000 0.000 0.000 0.000 1 1.000 1.000 0.027 Methylococcaceae| 0.000 0.000 0.000 0.000 1.000 1 1.000 0.027 AtopoBis Methylococcaceae|Bis 0.000 0.000 0.000 0.000 1.000 1.000 1 0.027 Methylococcaceae|SPF 0.000 2.000 0.429 0.787 0.027 0.027 0.027 1 Sutterellaceae|Atopo 0.000 14.000 3.125 5.592 1 0.020 0.708 0.007 Sutterellaceae|AtopoBis 1.000 37.000 12.125 12.253 0.020 1 0.050 0.645 Sutterellaceae|Bis 0.000 10.000 2.500 3.381 0.708 0.050 1 0.019 Sutterellaceae|SPF 1.000 125.000 33.571 44.071 0.007 0.645 0.019 1 Veillonellaceae|Atopo 1.000 2444.000 780.750 938.048 1 0.815 0.085 0.197 Veillonellaceae|AtopoBis 5.000 26.000 12.625 7.689 0.815 1 0.050 0.287 Veillonellaceae|Bis 0.000 10.000 3.375 3.378 0.085 0.050 1 0.003 Veillonellaceae|SPF 1.000 7076.000 2221.857 2915.640 0.197 0.287 0.003 1 Catabacteriaceae|Atopo 0.000 2.000 0.250 0.707 1 0.643 0.220 0.004 Catabacteriaceae|AtopoBis 0.000 0.000 0.000 0.000 0.643 1 0.091 0.001 Catabacteriaceae|Bis 0.000 1472.000 314.000 592.517 0.220 0.091 1 0.097 Catabacteriaceae|SPF 0.000 525.000 113.857 201.222 0.004 0.001 0.097 1 Shewanellaceae|Atopo 0.000 0.000 0.000 0.000 1 1.000 0.352 0.000 Shewanellaceae|AtopoBis 0.000 0.000 0.000 0.000 1.000 1 0.352 0.000 Shewanellaceae|Bis 0.000 1.000 0.250 0.463 0.352 0.352 1 0.003 Shewanellaceae|SPF 0.000 118.000 24.429 42.637 0.000 0.000 0.003 1 Hahellaceae|Atopo 0.000 1.000 0.250 0.463 1 0.427 0.947 0.002 Hahellaceae|AtopoBis 0.000 0.000 0.000 0.000 0.427 1 0.389 0.000 Hahellaceae|Bis 0.000 4.000 0.625 1.408 0.947 0.389 1 0.003 Hahellaceae|SPF 0.000 200.000 56.143 70.099 0.002 0.000 0.003 1 Actinomycetaceae|Atopo 0.000 1.000 0.125 0.354 1 0.190 0.325 0.000 Actinomycetaceae| 0.000 3.000 0.875 1.126 0.190 1 0.743 0.017 AtopoBis Actinomycetaceae|Bis 0.000 9.000 1.375 3.114 0.325 0.743 1 0.007 Actinomycetaceae|SPF 1.000 60.000 11.571 21.454 0.000 0.017 0.007 1 Alteromonadaceae|Atopo 0.000 1.000 0.125 0.354 1 1.000 0.274 0.001 Alteromonadaceae| 0.000 1.000 0.125 0.354 1.000 1 0.274 0.001 AtopoBis Alteromonadaceae|Bis 0.000 125.000 24.625 47.533 0.274 0.274 1 0.027 Alteromonadaceae|SPF 0.000 280.000 99.000 107.201 0.001 0.001 0.027 1 Lycoperdaceae|Atopo 0.000 0.000 0.000 0.000 1 1.000 1.000 0.000 Lycoperdaceae|AtopoBis 0.000 0.000 0.000 0.000 1.000 1 1.000 0.000 Lycoperdaceae|Bis 0.000 0.000 0.000 0.000 1.000 1.000 1 0.000 Lycoperdaceae|SPF 0.000 80.000 25.429 32.103 0.000 0.000 0.000 1 Peptostreptococcaceae| 0.000 0.000 0.000 0.000 1 0.308 0.352 0.006 Atopo Peptostreptococcaceae| 0.000 3.000 0.625 1.188 0.308 1 0.929 0.078 AtopoBis Peptostreptococcaceae|Bis 0.000 2.000 0.500 0.926 0.352 0.929 1 0.065 Peptostreptococcaceae| 0.000 11.000 3.714 4.348 0.006 0.078 0.065 1 SPF GENUS Morganella|Atopo 0.000 0.000 0.000 0.000 1 1.000 1.000 0.000 Morganella|AtopoBis 0.000 0.000 0.000 0.000 1.000 1 1.000 0.000 Morganella|Bis 0.000 0.000 0.000 0.000 1.000 1.000 1 0.000 Morganella|SPF 0.000 80.000 25.429 32.103 0.000 0.000 0.000 1 Erwinia|Atopo 0.000 24.000 12.750 8.714 1 0.826 0.710 0.003 Erwinia|AtopoBis 0.000 145.000 49.625 60.985 0.826 1 0.880 0.006 Erwinia|Bis 0.000 50896.000 10198.375 19632.394 0.710 0.880 1 0.010 Erwinia|SPF 146.000 2984.000 919.857 992.120 0.003 0.006 0.010 1 Peptostreptococcus|Atopo 0.000 0.000 0.000 0.000 1 0.308 0.352 0.006 Peptostreptococcus| 0.000 3.000 0.625 1.188 0.308 1 0.929 0.078 AtopoBis Peptostreptococcus|Bis 0.000 2.000 0.500 0.926 0.352 0.929 1 0.065 Peptostreptococcus|SPF 0.000 11.000 3.714 4.348 0.006 0.078 0.065 1 Dorea|Atopo 0.000 9.000 2.625 2.973 1 0.757 0.527 0.041 Dorea|AtopoBis 0.000 20.000 5.750 7.888 0.757 1 0.346 0.081 Dorea|Bis 0.000 10.000 2.375 3.926 0.527 0.346 1 0.008 Dorea|SPF 0.000 30.000 13.429 10.114 0.041 0.081 0.008 1 Ruminococcus|Atopo 13.000 281.000 62.375 89.427 1 0.030 0.021 0.002 Ruminococcus|AtopoBis 29.000 1586.000 441.500 610.453 0.030 1 0.891 0.341 Ruminococcus|Bis 33.000 1006.000 398.250 401.712 0.021 0.891 1 0.412 Ruminococcus|SPF 69.000 20346.000 4684.143 8151.122 0.002 0.341 0.412 1 Kangiella|Atopo 0.000 0.000 0.000 0.000 1 1.000 0.548 0.003 Kangiella|AtopoBis 0.000 0.000 0.000 0.000 1.000 1 0.548 0.003 Kangiella|Bis 0.000 1.000 0.125 0.354 0.548 0.548 1 0.015 Kangiella|SPF 0.000 23.000 4.429 8.344 0.003 0.003 0.015 1 Enterovibrio|Atopo 0.000 0.000 0.000 0.000 1 1.000 1.000 <0.0001 Enterovibrio|AtopoBis 0.000 0.000 0.000 0.000 1.000 1 1.000 <0.0001 Enterovibrio|Bis 0.000 0.000 0.000 0.000 1.000 1.000 1 <0.0001 Enterovibrio|SPF 0.000 239.000 88.000 92.454 <0.0001 <0.0001 <0.0001 1 Coprobacillus|Atopo 331.000 2302.000 1152.125 678.666 1 0.003 0.008 0.004 Coprobacillus|AtopoBis 0.000 1735.000 257.375 605.539 0.003 1 0.772 0.970 Coprobacillus|Bis 0.000 1309.000 200.625 452.797 0.008 0.772 1 0.750 Coprobacillus|SPF 0.000 924.000 177.571 348.761 0.004 0.970 0.750 1 Actinomyces|Atopo 0.000 1.000 0.125 0.354 1 0.190 0.325 0.000 Actinomyces|AtopoBis 0.000 3.000 0.875 1.126 0.190 1 0.743 0.017 Actinomyces|Bis 0.000 9.000 1.375 3.114 0.325 0.743 1 0.007 Actinomyces|SPF 1.000 60.000 11.571 21.454 0.000 0.017 0.007 1 Marinomonas|Atopo 0.000 1.000 0.250 0.463 1 0.694 0.694 0.002 Marinomonas|AtopoBis 0.000 1.000 0.375 0.518 0.694 1 0.431 0.007 Marinomonas|Bis 0.000 1.000 0.125 0.354 0.694 0.431 1 0.001 Marinomonas|SPF 0.000 494.000 144.857 185.634 0.002 0.007 0.001 1 Vibrio|Atopo 0.000 13.000 2.375 4.534 1 0.216 0.381 <0.0001 Vibrio|AtopoBis 1.000 12.000 4.750 4.683 0.216 1 0.718 0.006 Vibrio|Bis 0.000 23.000 6.125 8.097 0.381 0.718 1 0.002 Vibrio|SPF 19.000 48256.000 15217.857 18829.126 <0.0001 0.006 0.002 1 Dialister|Atopo 0.000 9.000 1.375 3.114 1 0.020 0.534 0.129 Dialister|AtopoBis 0.000 18.000 6.625 6.675 0.020 1 0.003 0.465 Dialister|Bis 0.000 1.000 0.250 0.463 0.534 0.003 1 0.034 Dialister|SPF 0.000 7.000 3.571 3.101 0.129 0.465 0.034 1 Halothiobacillus|Atopo 0.000 0.000 0.000 0.000 1 1.000 1.000 <0.0001 Halothiobacillus|AtopoBis 0.000 0.000 0.000 0.000 1.000 1 1.000 <0.0001 Halothiobacillus|Bis 0.000 0.000 0.000 0.000 1.000 1.000 1 <0.0001 Halothiobacillus|SPF 0.000 14.000 4.571 5.255 <0.0001 <0.0001 <0.0001 1 Trichococcus|Atopo 0.000 6.000 1.125 2.031 1 0.007 0.041 0.009 Trichococcus|AtopoBis 0.000 0.000 0.000 0.000 0.007 1 0.519 1.000 Trichococcus|Bis 0.000 1.000 0.125 0.354 0.041 0.519 1 0.533 Trichococcus|SPF 0.000 0.000 0.000 0.000 0.009 1.000 0.533 1 Nitrincola|Atopo 0.000 0.000 0.000 0.000 1 0.577 1.000 0.001 Nitrincola|AtopoBis 0.000 3.000 0.375 1.061 0.577 1 0.577 0.003 Nitrincola|Bis 0.000 0.000 0.000 0.000 1.000 0.577 1 0.001 Nitrincola|SPF 0.000 226.000 55.143 83.762 0.001 0.003 0.001 1 Serratia|Atopo 0.000 0.000 0.000 0.000 1 0.198 1.000 0.000 Serratia|AtopoBis 0.000 3.000 0.750 1.165 0.198 1 0.198 0.009 Serratia|Bis 0.000 0.000 0.000 0.000 1.000 0.198 1 0.000 Serratia|SPF 0.000 621.000 192.286 237.182 0.000 0.009 0.000 1 Ferrimonas|Atopo 0.000 0.000 0.000 0.000 1 0.625 1.000 <0.0001 Ferrimonas|AtopoBis 0.000 1.000 0.125 0.354 0.625 1 0.625 0.000 Ferrimonas|Bis 0.000 0.000 0.000 0.000 1.000 0.625 1 <0.0001 Ferrimonas|SPF 0.000 623.000 140.714 227.571 <0.0001 0.000 <0.0001 1 Butyrivibrio|Atopo 0.000 1.000 0.125 0.354 1 1.000 0.534 0.032 Butyrivibrio|AtopoBis 0.000 1.000 0.125 0.354 1.000 1 0.534 0.032 Butyrivibrio|Bis 0.000 0.000 0.000 0.000 0.534 0.534 1 0.006 Butyrivibrio|SPF 0.000 1.000 0.571 0.535 0.032 0.032 0.006 1 Oscillospira|Atopo 0.000 3.000 0.750 1.165 1 0.055 0.144 0.000 Oscillospira|AtopoBis 1.000 7.000 3.125 2.167 0.055 1 0.646 0.083 Oscillospira|Bis 0.000 3538.000 715.625 1371.803 0.144 0.646 1 0.030 Oscillospira|SPF 2.000 3855.000 713.000 1439.678 0.000 0.083 0.030 1 Epulopiscium|Atopo 0.000 9.000 1.625 3.068 1 0.434 0.099 0.014 Epulopiscium|AtopoBis 0.000 2.000 0.375 0.744 0.434 1 0.015 0.001 Epulopiscium|Bis 0.000 8385.000 1199.875 2932.011 0.099 0.015 1 0.393 Epulopiscium|SPF 2.000 60.000 17.429 24.110 0.014 0.001 0.393 1 Escherichia|Atopo 0.000 7.000 2.000 2.507 1 0.029 0.557 0.351 Escherichia|AtopoBis 0.000 0.000 0.000 0.000 0.029 1 0.110 0.002 Escherichia|Bis 0.000 52.000 10.375 19.799 0.557 0.110 1 0.133 Escherichia|SPF 0.000 5.000 2.714 1.799 0.351 0.002 0.133 1 Alkalimonas|Atopo 0.000 0.000 0.000 0.000 1 1.000 1.000 0.006 Alkalimonas|AtopoBis 0.000 0.000 0.000 0.000 1.000 1 1.000 0.006 Alkalimonas|Bis 0.000 0.000 0.000 0.000 1.000 1.000 1 0.006 Alkalimonas|SPF 0.000 30.000 7.714 11.339 0.006 0.006 0.006 1 Listeria|Atopo 0.000 1.000 0.375 0.518 1 0.006 0.029 0.477 Listeria|AtopoBis 0.000 17.000 7.250 6.497 0.006 1 0.590 0.055 Listeria|Bis 0.000 14.000 5.000 4.751 0.029 0.590 1 0.161 Listeria|SPF 0.000 29.000 4.571 10.799 0.477 0.055 0.161 1 Streptococcus|Atopo 0.000 21.000 7.500 7.521 1 0.182 0.001 0.056 Streptococcus|AtopoBis 0.000 17141.000 3433.000 6026.709 0.182 1 0.046 0.532 Streptococcus|Bis 9.000 22660.000 5396.500 7790.156 0.001 0.046 1 0.193 Streptococcus|SPF 8.000 237.000 84.714 100.521 0.056 0.532 0.193 1 Actinobacillus|Atopo 0.000 0.000 0.000 0.000 1 0.681 0.328 0.000 Actinobacillus|AtopoBis 0.000 1.000 0.125 0.354 0.681 1 0.571 0.001 Actinobacillus|Bis 0.000 8.000 1.125 2.800 0.328 0.571 1 0.005 Actinobacillus|SPF 0.000 39.000 12.000 15.011 0.000 0.001 0.005 1 Roseburia|Atopo 10.000 46.000 23.125 12.722 1 0.773 0.040 0.321 Roseburia|AtopoBis 1.000 56.000 22.875 17.836 0.773 1 0.078 0.203 Roseburia|Bis 1.000 22.000 7.875 7.453 0.040 0.078 1 0.003 Roseburia|SPF 8.000 192.000 65.429 64.714 0.321 0.203 0.003 1 Bacillus|Atopo 70.000 331.000 145.500 92.705 1 0.001 0.023 0.298 Bacillus|AtopoBis 1162.000 24417.000 7572.750 7652.213 0.001 1 0.284 0.029 Bacillus|Bis 5.000 11338.000 4861.250 4100.801 0.023 0.284 1 0.250 Bacillus|SPF 57.000 7717.000 1376.429 2805.259 0.298 0.029 0.250 1 Parabacteroides|Atopo 0.000 40.000 8.875 13.559 1 0.195 0.562 0.036 Parabacteroides|AtopoBis 1.000 35.000 12.750 10.820 0.195 1 0.061 0.397 Parabacteroides|Bis 0.000 9.000 3.750 3.284 0.562 0.061 1 0.008 Parabacteroides|SPF 0.000 43.000 23.571 16.662 0.036 0.397 0.008 1 Sarcina|Atopo 0.000 1.000 0.125 0.354 1 0.005 0.009 0.317 Sarcina|AtopoBis 0.000 1929.000 424.250 698.617 0.005 1 0.815 0.082 Sarcina|Bis 0.000 2282.000 700.125 966.646 0.009 0.815 1 0.131 Sarcina|SPF 0.000 8.000 2.286 3.147 0.317 0.082 0.131 1 Enterococcus|Atopo 11.000 38.000 20.750 9.588 1 0.000 0.016 0.040 Enterococcus|AtopoBis 121.000 1543.000 718.125 539.764 0.000 1 0.161 0.100 Enterococcus|Bis 0.000 1425.000 558.625 527.899 0.016 0.161 1 0.773 Enterococcus|SPF 39.000 1382.000 260.429 495.621 0.040 0.100 0.773 1 Carnobacterium|Atopo 0.000 1.000 0.125 0.354 1 0.006 0.045 0.543 Carnobacterium|AtopoBis 0.000 42.000 17.500 18.769 0.006 1 0.451 0.040 Carnobacterium|Bis 0.000 29.000 6.500 10.100 0.045 0.451 1 0.185 Carnobacterium|SPF 0.000 4.000 1.000 1.732 0.543 0.040 0.185 1 Coprococcus|Atopo 244.000 35300.000 7793.625 11731.118 1 0.001 0.012 0.220 Coprococcus|AtopoBis 10.000 79.000 40.625 22.671 0.001 1 0.433 0.050 Coprococcus|Bis 6.000 5234.000 893.750 1803.125 0.012 0.433 1 0.228 Coprococcus|SPF 20.000 31009.000 6867.571 12275.631 0.220 0.050 0.228 1 Enterobacter|Atopo 0.000 3.000 0.500 1.069 1 0.849 0.333 0.000 Enterobacter|AtopoBis 0.000 1.000 0.375 0.518 0.849 1 0.437 0.001 Enterobacter|Bis 0.000 12.000 2.875 4.794 0.333 0.437 1 0.007 Enterobacter|SPF 3.000 2140.000 682.571 877.138 0.000 0.001 0.007 1 Neisseria|Atopo 0.000 0.000 0.000 0.000 1 0.003 0.538 0.387 Neisseria|AtopoBis 0.000 2.000 0.750 0.707 0.003 1 0.014 0.032 Neisseria|Bis 0.000 1.000 0.125 0.354 0.538 0.014 1 0.785 Neisseria|SPF 0.000 5.000 0.714 1.890 0.387 0.032 0.785 1 Photobacterium|Atopo 0.000 0.000 0.000 0.000 1 0.222 1.000 <0.0001 Photobacterium|AtopoBis 0.000 2.000 0.250 0.707 0.222 1 0.222 <0.0001 Photobacterium|Bis 0.000 0.000 0.000 0.000 1.000 0.222 1 <0.0001 Photobacterium|SPF 1.000 121.000 42.286 49.671 <0.0001 <0.0001 <0.0001 1 Brenneria|Atopo 0.000 0.000 0.000 0.000 1 1.000 1.000 0.000 Brenneria|AtopoBis 0.000 0.000 0.000 0.000 1.000 1 1.000 0.000 Brenneria|Bis 0.000 0.000 0.000 0.000 1.000 1.000 1 0.000 Brenneria|SPF 0.000 595.000 156.429 226.566 0.000 0.000 0.000 1 Oceanobacillus|Atopo 0.000 0.000 0.000 0.000 1 0.465 0.005 1.000 Oceanobacillus|AtopoBis 0.000 1.000 0.125 0.354 0.465 1 0.026 0.480 Oceanobacillus|Bis 0.000 2.000 0.625 0.744 0.005 0.026 1 0.006 Oceanobacillus|SPF 0.000 0.000 0.000 0.000 1.000 0.480 0.006 1 Lactobacillus|Atopo 263.000 7137.000 2406.750 2385.720 1 0.000 <0.0001 <0.0001 Lactobacillus|AtopoBis 3.000 27.000 12.375 9.226 0.000 1 0.277 0.441 Lactobacillus|Bis 0.000 1026.000 133.000 360.889 <0.0001 0.277 1 0.774 Lactobacillus|SPF 0.000 81.000 19.571 30.127 <0.0001 0.441 0.774 1 Xanthomonas|Atopo 0.000 1.000 0.125 0.354 1 0.620 0.138 0.007 Xanthomonas|AtopoBis 0.000 0.000 0.000 0.000 0.620 1 0.052 0.002 Xanthomonas|Bis 0.000 1005.000 207.500 395.202 0.138 0.052 1 0.163 Xanthomonas|SPF 0.000 29.000 6.000 10.360 0.007 0.002 0.163 1 Sutterella|Atopo 0.000 14.000 3.125 5.592 1 0.009 0.657 0.003 Sutterella|AtopoBis 1.000 37.000 12.125 12.253 0.009 1 0.026 0.586 Sutterella|Bis 0.000 10.000 2.500 3.381 0.657 0.026 1 0.009 Sutterella|SPF 1.000 125.000 33.571 44.071 0.003 0.586 0.009 1 Staphylococcus|Atopo 0.000 8.000 1.250 2.765 1 0.000 0.001 0.003 Staphylococcus|AtopoBis 6.000 82.000 32.625 28.213 0.000 1 0.744 0.558 Staphylococcus|Bis 0.000 132.000 40.000 45.854 0.001 0.744 1 0.785 Staphylococcus|SPF 2.000 838.000 191.000 333.003 0.003 0.558 0.785 1 Lachnobacterium|Atopo 0.000 22.000 4.125 7.605 1 0.072 0.275 0.068 Lachnobacterium|AtopoBis 0.000 0.000 0.000 0.000 0.072 1 0.006 0.001 Lachnobacterium|Bis 0.000 11871.000 2128.000 4324.494 0.275 0.006 1 0.418 Lachnobacterium|SPF 0.000 809.000 230.857 372.166 0.068 0.001 0.418 1 Vagococcus|Atopo 0.000 0.000 0.000 0.000 1 0.001 0.004 0.129 Vagococcus|AtopoBis 0.000 37.000 7.000 12.387 0.001 1 0.570 0.049 Vagococcus|Bis 0.000 34.000 8.500 12.166 0.004 0.570 1 0.144 Vagococcus|SPF 0.000 3.000 0.857 1.215 0.129 0.049 0.144 1 Leclercia|Atopo 0.000 2.000 0.500 0.756 1 0.298 0.501 <0.0001 Leclercia|AtopoBis 0.000 4.000 0.500 1.414 0.298 1 0.707 <0.0001 Leclercia|Bis 0.000 1.000 0.250 0.463 0.501 0.707 1 <0.0001 Leclercia|SPF 12.000 4650.000 1419.143 1875.855 <0.0001 <0.0001 <0.0001 1 Fusobacterium|Atopo 0.000 20.000 3.500 6.845 1 0.006 0.065 0.005 Fusobacterium|AtopoBis 1.000 34434.000 6670.000 12103.946 0.006 1 0.307 0.865 Fusobacterium|Bis 0.000 3175.000 445.125 1109.012 0.065 0.307 1 0.249 Fusobacterium|SPF 4.000 94.000 38.000 31.559 0.005 0.865 0.249 1 Citrobacter|Atopo 0.000 0.000 0.000 0.000 1 1.000 1.000 0.000 Citrobacter|AtopoBis 0.000 0.000 0.000 0.000 1.000 1 1.000 0.000 Citrobacter|Bis 0.000 0.000 0.000 0.000 1.000 1.000 1 0.000 Citrobacter|SPF 0.000 41.000 11.857 16.477 0.000 0.000 0.000 1 Hahella|Atopo 0.000 1.000 0.250 0.463 1 0.265 0.925 0.000 Hahella|AtopoBis 0.000 0.000 0.000 0.000 0.265 1 0.229 <0.0001 Hahella|Bis 0.000 4.000 0.625 1.408 0.925 0.229 1 0.000 Hahella|SPF 0.000 200.000 56.143 70.099 0.000 <0.0001 0.000 1 Alcanivorax|Atopo 0.000 4.000 1.500 1.773 1 0.481 0.085 0.045 Alcanivorax|AtopoBis 0.000 73.000 22.125 28.119 0.481 1 0.019 0.170 Alcanivorax|Bis 0.000 0.000 0.000 0.000 0.085 0.019 1 0.001 Alcanivorax|SPF 0.000 531.000 138.857 200.897 0.045 0.170 0.001 1 Facklamia|Atopo 0.000 0.000 0.000 0.000 1 1.000 1.000 0.003 Facklamia|AtopoBis 0.000 0.000 0.000 0.000 1.000 1 1.000 0.003 Facklamia|Bis 0.000 0.000 0.000 0.000 1.000 1.000 1 0.003 Facklamia|SPF 0.000 56.000 11.571 21.509 0.003 0.003 0.003 1 Faecalibacterium|Atopo 0.000 252.000 39.625 86.169 1 0.010 0.687 0.007 Faecalibacterium|AtopoBis 8.000 120.000 57.000 37.413 0.010 1 0.004 0.811 Faecalibacterium|Bis 1.000 31.000 13.375 11.476 0.687 0.004 1 0.003 Faecalibacterium|SPF 8.000 212.000 88.571 76.868 0.007 0.811 0.003 1 Eubacterium|Atopo 3.000 43.000 8.875 13.861 1 0.024 0.417 0.000 Eubacterium|AtopoBis 10.000 32.000 18.500 8.783 0.024 1 0.130 0.052 Eubacterium|Bis 1.000 2387.000 313.625 838.348 0.417 0.130 1 0.001 Eubacterium|SPF 13.000 1107.000 485.143 399.257 0.000 0.052 0.001 1 Shewanella|Atopo 0.000 0.000 0.000 0.000 1 1.000 0.144 <0.0001 Shewanella|AtopoBis 0.000 0.000 0.000 0.000 1.000 1 0.144 <0.0001 Shewanella|Bis 0.000 1.000 0.250 0.463 0.144 0.144 1 <0.0001 Shewanella|SPF 0.000 118.000 24.429 42.637 <0.0001 <0.0001 <0.0001 1 Tatumella|Atopo 0.000 0.000 0.000 0.000 1 0.454 1.000 <0.0001 Tatumella|AtopoBis 0.000 1.000 0.125 0.354 0.454 1 0.454 0.000 Tatumella|Bis 0.000 0.000 0.000 0.000 1.000 0.454 1 <0.0001 Tatumella|SPF 0.000 76.000 26.714 33.674 <0.0001 0.000 <0.0001 1 Bacteroides|Atopo 86967.000 133771.000 108707.250 14136.218 1 0.075 <0.0001 0.000 Bacteroides|AtopoBis 211.000 117745.000 64625.875 53942.157 0.075 1 0.000 0.027 Bacteroides|Bis 74.000 515.000 171.750 143.702 <0.0001 0.000 1 0.083 Bacteroides|SPF 57.000 107600.000 28388.714 48274.613 0.000 0.027 0.083 1
[0132] It has also been found that A. parvulum is correlated with the presence/abundance of GALT foci. Therefore there is provided an assay for identifying the likelihood of an individual of having UC or CD or IBD by measuring a relative abundance of A. parvulum by measuring the abundance of GALT foci. This correlation can also be used to provide a method of diagnostic that comprises collecting samples to measure the abundance of GAT foci, determining the presence of A. parvulum based on the cytokine(s) measurement and establishing a diagnosis.
[0133] In other aspect of the invention it has been shown that certain OTU's and/or taxa are indicative of improve therapeutic response. Table 7 exemplifies OTU's and/or taxa that exhibit a significant difference between the levels of bacteria between patients that responded to treatment. The patients in the two groups (responded to treatment/failed to respond to treatment) received a systemic corticosteroid medication (prednisone) as their acute anti-inflammatory therapy. Two patients (in the group that responded) received the mucosally active corticosteroid medication Entocort instead. Azathioprine (n=11) or methotrexate (n=4) immunomodulator medication was initiated in the patients for maintenance therapy. The clinical failure of response was determined by Physician Global Assessment and Pediatric Crohn's Disease Activity Index scoring determinations.
[0134] Clearly from the data of table 7 there is link between the level of bacteria and the efficacy of treatment. Thus when a patient exhibits bacterial levels in one or more taxa or OTU's from table 7 that are more elevated than a predetermined level or average corresponding to responders level the patient is likely not to respond to treatment. Alternatively patients exhibiting levels of bacteria lower that a predetermined level or average corresponding to non responders will profit the most from the treatment. The patient that did not respond have a different physiological or pathological status as assessed by standard diagnostic tests. For example patients with levels of Erwinia greater than about 3431 or preferably greater than about 13482 (one std dev) are likely not to respond and patient with lower levels than these likely to benefit most.
TABLE-US-00007 TABLE 7 Std. p| p| Observations Minimum Maximum Mean deviation responded Failed Analysis at OTU level Variable Eubacterium (OTU589746)|responded 9 0.000 4.000 1.333 1.732 1 0.011 Eubacterium (OTU589746)|Failed 6 2.000 20.000 9.667 7.174 0.011 1 Oribacteriumsinus (OTU470747)| 9 0.000 11.000 2.778 3.598 1 0.005 responded Oribacteriumsinus (OTU470747)|Failed 6 2.000 77.000 28.000 25.954 0.005 1 Veillonellaceae (OTU535825)| 9 0.000 40.000 9.000 14.186 1 0.024 responded Veillonellaceae (OTU535825)|Failed 6 2.000 93.000 49.500 38.667 0.024 1 Enterobacteriaceae (OTU323418)| 9 0.000 180.000 23.889 59.675 1 0.035 responded Enterobacteriaceae (OTU323418)| 6 1.000 140.000 34.000 55.714 0.035 1 Failed Lachnospiraceae (OTU71387)| 9 0.000 137.000 16.000 45.418 1 0.015 responded Lachnospiraceae (OTU71387)|Failed 6 2.000 259.000 73.500 95.663 0.015 1 Atopobium (OTU529659)|responded 9 0.000 101.000 17.889 32.259 1 0.018 Atopobium (OTU529659)|Failed 6 19.000 187.000 78.667 62.516 0.018 1 Mogibacterium (OTU46159)|responded 9 0.000 163.000 21.556 53.346 1 0.043 Mogibacterium (OTU46159)|Failed 6 3.000 376.000 79.167 146.389 0.043 1 Propionibacteriumacnes (OTU368907)| 9 0.000 192.000 32.667 68.431 1 0.044 responded Propionibacteriumacnes (OTU368907)| 6 1.000 363.000 63.500 146.761 0.044 1 Failed Alteromonadaceae; BD2-13 9 0.000 44.000 8.444 15.001 1 0.022 (OTU110075)|responded Alteromonadaceae; BD2-13 6 1.000 715.000 142.000 281.637 0.022 1 (OTU110075)|Failed Coprococcus (OTU182512)|responded 9 0.000 133.000 23.778 43.249 1 0.045 Coprococcus (OTU182512)|Failed 6 3.000 282.000 129.167 128.205 0.045 1 Lachnospiraceae (OTU303772)| 9 1.000 78.000 14.778 25.806 1 0.043 responded Lachnospiraceae (OTU303772)|Failed 6 2.000 509.000 167.667 205.745 0.043 1 Clostridiales (OTU204932)|responded 9 0.000 2054.000 237.222 681.670 1 0.024 Clostridiales (OTU204932)|Failed 6 11.000 5639.000 1037.833 2257.516 0.024 1 Bacteroidales (OTU183618)|responded 9 0.000 2059.000 246.667 681.482 1 0.023 Bacteroidales (OTU183618)|Failed 6 9.000 6706.000 1295.167 2666.325 0.023 1 Ruminococcaceae (OTU195252)| 9 0.000 120.000 21.889 40.946 1 0.044 responded Ruminococcaceae (OTU195252)| 6 2.000 9494.000 1716.333 3814.455 0.044 1 Failed Sutterella (OTU295422)|responded 9 2.000 1132.000 145.556 371.004 1 0.018 Sutterella (OTU295422)|Failed 6 17.000 20759.000 6729.833 8755.580 0.018 1 Enterobacteriaceae (OTU307080)| 9 6.000 13849.000 1846.333 4559.821 1 0.025 responded Enterobacteriaceae (OTU307080)| 6 165.000 15872.000 4616.833 5840.027 0.025 1 Failed Ruminococcus (OTU174136)| 9 0.000 24.000 6.667 9.000 1 0.033 responded Ruminococcus (OTU174136)|Failed 6 1.000 48877.000 8170.833 19941.884 0.033 1 Clostridiumramosum (OTU470139)| 9 5.000 10411.000 1186.444 3459.360 1 0.045 responded Clostridiumramosum (OTU470139)| 6 10.000 139273.000 36964.333 53876.950 0.045 1 Failed Erwinia (OTU289103)|responded 9 3.000 30231.000 3425.667 10052.419 1 0.010 Erwinia (OTU289103)|Failed 6 78.000 164661.000 42988.167 62253.786 0.010 1 Analysis at genus level Variable Erwinia|responded 9 3.000 30231.000 3430.778 10050.512 1 0.013 Erwinia|Failed 6 78.000 164661.000 42989.333 62253.169 0.013 1 Atopobium|responded 9 0.000 307.000 51.556 101.187 1 0.045 Atopobium|Failed 6 23.000 231.000 90.167 76.434 0.045 1 Propionibacterium| 9 0.000 196.000 40.444 79.783 1 0.042 responded Propionibacterium|Failed 6 2.000 363.000 63.833 146.593 0.042 1
[0135] It will be appreciated that more than one taxa and/or OTU can be combined to identify patients that are more likely to respond to treatment. For example one could combine the measurement of OTU295422 and of taxa Erwinia in a patient and if the levels are below about 145 and about 3430 respectively then the patient is considered likely to respond. It should be noted that OTU's are most of the time closely related to a taxa therefore the above described approach would also be applicable using taxa associated with an OTU.
[0136] Thus in one aspect the present invention provides a method to test or assay or measure the levels of gut bacteria obtained directly from the gut or from stools and in which the actual measurement of bacterial levels is done in vitro. The measured levels can be used to assess the nature, severity or stage of IBD, CD or UC disease and determine treatment course such as the administration of certain drugs.
[0137] Furthermore there is also provided a method in which a test to measure the level(s) of bacteria as described above is requested to provide the results of an analysis to determine whether a patient has IBD, CD or UC or to determine the severity or stage of such disease by assessing bacterial levels as described above and administering a treatment if the patient exhibit the type and levels of bacteria associated with disease or the severity or stage of the disease.
[0138] Thus the present invention provides to the identification of pathological states or characteristics of patients by identifying bacteria associated with disease and of physiological states by providing levels of bacteria present in disease or at different stages or severity of disease.
[0139] The bacterial taxa and proteins described above can be referred to as diagnostic markers. These diagnostic markers can be used in a method for classifying a sample as being associated with IBD, UC or CD. The method comprises the steps of determining a presence or level of one or more of the diagnostic markers and comparing the presence or level to samples from IBD, UC or CD patients and/or normal patients. A combination of diagnostic markers may be combined together and may also further be combined with a standard diagnostic results derived from a disease activity index.
[0140] The algorithm can be a statistical algorithm which may comprise a learning statistical classifier system (or combination of such systems) such as neural network, random forest, interactive tree and the like, as would be known to a person skilled in the art. The predictive value of the classifying system maybe predetermined and may for example be at least 60%, 70%, 80%, 90% or 95%. The classification result may be provided to a clinician such as a gastroenterologist or general practitioner.
[0141] In yet a further aspect of the invention there is provided a method of classifying a gut sample to determine an association with IBD, UC or CD that comprises determining a diagnostic marker profile by detecting a presence or level of at least one gut diagnostic marker and classifying the sample as IBD, UC or CD by comparing the diagnostic marker profile to samples from IBD, UC or CD patients or normal subjects or combination thereof. The profile can be combined with a diagnostic based on a disease activity index specific for IBD, UC or CD.
[0142] The diagnostic marker can be selected from H.sub.2S producing bacteria, Proteobacteria, butyrate producing bacteria, Fusobacterium nucleatum, Veillonella parvula, Atopobium parvulum, Firmicutes, Clostridia, Clostridiales, Lachnopiraceae, Eubacterium, Roseburia, Coprococcus, Clostridium, Eubacterium rectale, Clostridium coccoides, Roseburia inulivorans, Verrucomicrobiae, Clostridiales, Verrucomicrobiales, Verrucomicrobiacae, Lachnospiraceae, Paenibacillaceae, Akkermansia, Turicibacter, Paenibacillus, Pasteurellales, Chromatialles, Hydrogenophilales, Oceanospirillales, Rhizobiales, Halomonadaceae, Pasteurellaceae, Bradyrhizobiaceae, Methylococcaceae, Hydrogenophilaceae, Porphyromonas, Lautropia, Methylobacterium, Haemophilus, Finegoldia, Nitrincola, Hydrogenophilu, Actinobacillus, Anaerococcus, Mobiluncus, Enterobacter, Vitreoscilla, Alcanivorax, Veillonella, Tatumella, Staphylococcaceae, Paenibacillaceae, Listeriaceae, Listeria, Paenibacillus, Staphylococcus, Negativicutes, Beta proteobacteria, Pasteurellales, Chromatialles, Burkholderiales, Selenomonadales, Pasteurellaceae, Haemophilus, Pantoea, Carnobacteriaceae, Granulicatella, Mogibacterium, Proprionibacterium, Bacillaceae, Atopobium, Hydrogenophilales, Rhizobiales, Bradyrhyzobiaceae, Hydrogenophylaceae, Porphyromonas, Lautropia, Tannarella, Finegoldia, Hydrogenophilus, Catonella, Mobilumcus, Alcanivorax, Afipia, sulfur dioxygenase (ETHE1), thiosulfate sulfur transferase (TST), cytochrome c oxidase subunit IV, sulfide dehydrogenase (SQR), complexes III and IV of mithochondrial respiratory chain, Cxcl1, IL17a, II12, II1 and combination thereof.
[0143] The profile may consist of level(s) of a marker or the combination of levels from different markers or the relative levels (ratios) of markers combined or not with a diagnosis based on a disease activity index. The profile may also comprise levels of markers over time or stages of the disease(s) or severity of the disease(s). The profile may also be weighted with respect to the markers or the diagnosis.
[0144] There is also provided an apparatus comprising a diagnostic marker detector capable of detecting one or more of the markers described above for example by methods described in this application, a processor configured to classify the sample as an IBD, UC or CD sample by comparing the diagnostic marker profile to samples from IBD, CD, UC or normal subjects or combination thereof and a result display unit to display to a user a classification obtained from the processor. The processor may also receive from an input a diagnostic result based on a disease activity index specific for IBD, UC or CD and combine this diagnostic result with the diagnostic marker profile to generate the classification. Thus the processor may use training data or a training cohort to identify the characterisitics of the diagnostic marker that provides a reliable classification. The data provided here (levels of bacteria and proteins for example) with their correlation to presence of disease or disease severity or progression can be used as a training cohort. However it will be appreciated that additional data could be generated to improve the training data based on the guidance of the results presented in this application.
[0145] It will be understood that the processor may use algorithms as described above.
EXAMPLES
Example 1
[0146] An inception cohort of 157 patients (84 Crohn's disease (CD), 20 ulcerative colitis (UC) and 53 controls; Table 8) was recruited.
TABLE-US-00008 TABLE 8 Site Visual Paris #SampleID Description M/F age Sampled Appearance Classification PCDAI/PUCAI Experiment HMC002RC UC F 16 RC normal E1, S0 20 (Mild) Illumina HMC003RC Control F 9 RC normal n/a n/a Illumina HMC004RC Control M 12 RC normal n/a n/a 454Pyro HMC005RC Control F 10 RC normal n/a n/a Illumina HMC006RC Control M 15 RC normal n/a n/a Illumina HMC012RC CD M 13 RC normal A1b, L1, B1, G0 12.5 (Mild) Illumina HMC013RC UC M 12 RC inflammed E4, S1 65 Illumina (Severe) HMC014RC CD F 14 RC normal A1b, L3, L4a, B1, 37.5 454pyro G1 (Moderate HMC015RC CD F 14 RC normal A1b, L1, B2, G0 10 (Mild) Illumina HMC016RC CD M 13 RC normal A1b, L3, B1, G0 20 (Mild) Illumina HMC017RC CD M 13 RC inflammed A1b, L2, L4a, B1, 57.5 Illumina G1 (Severe) HMC018RC Control M 13 RC normal n/a n/a Illumina HMC019RC UC M 14 RC inflammed E4, S1 80 Illumina/454pyro (Severe) HMC020RC Control F 12 RC normal n/a n/a 454Pyro HMC022RC CD M 14 RC normal A1b, L1, B1, G1 37.5 Illumina (Moderate HMC023RC UC M 14 RC normal E4, S1 50 Illumina/454pyro (Moderate HMC024RC UC M 16 RC normal E3, S1 40 454pyro (Moderate HMC025RC CD F 15 RC normal A1b, L4b, B1, G0 20 (Mild) Illumina HMC026RC Control F 16 RC normal n/a n/a 454Pyro HMC027RC Control F 16 RC normal n/a n/a Illumina HMC028RC Control M 13 RC normal n/a n/a Illumina/454pyro HMC029RC CD M 14 RC inflammed A1b, L3, L4a, B1, 32.5 Illumina G0 (Moderate HMC030RC CD F 17 RC inflammed A1b, L3, L4a, B1, 45 Illumina G0 (Severe) HMC038RC CD F 16 RC inflammed A1b, L2, B1p, G0 20 (Mild) Illumina HMC039RC CD F 13 RC normal A1b, L1, L4a, B1, 60 Illumina G1 (Severe) HMC041RC CD F 15 RC normal A1b, L3, B1, G0 57.5 Illumina (Severe) HMC042RC Control M 17 RC normal n/a n/a Illumina HMC043RC Control F 16 RC normal n/a n/a Illumina HMC044RC CD F 15 RC normal A1b, L1, B3, G1 52.5 Illumina (Severe) HMC045RC UC M 17 RC normal E3 45 Illumina (Moderate HMC046RC UC F 4 RC inflammed E4, S1 65 Illumina/454pyro (Severe) HMC047RC CD M 16 RC inflammed A1b, L3, L4a, B1, 65 Illumina G1 (Severe) HMC049RC CD M 12 RC normal A1b, L1, B1, G1 40 Illumina/454pyro (Severe) HMC050RC CD F 16 RC normal A1b, L1, B1, G0 12.5 (Mild) IIlumina HMC051RC CD F 16 RC inflammed A1b, L3, L4a, B1, 65 Illumina G0 (Severe) HMC052RC Control F 8 RC normal n/a n/a 454Pyro HMC055RC Control M 6 RC normal n/a n/a Illumina/454pyro HMC056RC Control F 8 RC normal n/a n/a Illumina HMC059RC Control M 14 RC normal n/a n/a Illumina HMC061RC CD M 9 RC inflammed A1a, L2, B1, G0 32.5 Illumina/454pyro (Moderate HMC062RC CD F 15 RC inflammed A1b, L3, L4a, B3, 57.5 Illumina G0 (Severe) HMC063RC CD M 13 RC normal A1b, L1, L4a, B1, 65 Illumina/454pyro G1 (Severe) HMC064RC UC M 18 RC inflammed E4, S1 0 Illumina (Inactive) HMC065RC CD M 16 RC normal A1b, L1, B2, B3, G0 50 Illumina (Severe) HMC066RC UC F 18 RC inflammed E4, S0 35 Illumina/454pyro (Moderate HMC067RC Control F 17 RC normal n/a n/a Illumina HMC068RC CD M 17 RC inflammed A1b, L2, B1, G0 32.5 454Pyro (Moderate HMC069RC Control F 17 RC normal n/a n/a Illumina HMC070RC Control F 8 RC normal n/a n/a 454Pyro HMC071RC Control M 11 RC normal n/a n/a Illumina HMC072RC CD M 12 RC inflammed A1b, L3, L4a, B1, 55 Illumina G1 (Severe) HMC073RC Control F 16 RC normal n/a n/a Illumina HMC074RC Control F 16 RC normal n/a n/a 454Pyro HMC075RC CD M 14 RC inflammed A1b, L2, B1, G1 50 Illumina (Severe) HMC076RC UC F 17 RC inflammed E4, S0 55 Illumina/454pyro (Moderate HMC077RC UC M 17 RC normal E3, S0 50 Illumina/454pyro (Moderate HMC078RC CD F 15 RC normal A1b, L1, B1, G0 45 Illumina (Severe) HMC079RC CD M 16 RC inflammed A1b, L3, B1, G0 45 Illumina (Severe) HMC081RC CD M 11 RC normal A1b, L1, B1, G1 67.5 Illumina (Severe) HMC082RC CD F 15 RC inflammed A1a, L3, B1, G0 27.5 (Mild) Illumina HMC085RC CD M 16 RC normal A1b, L2, B1, G1 62.5 Illumina/454pyro (Severe) HMC086RC CD M 8 RC normal A1a, L1, L4a, L4b, 22.5 (Mild) Illumina B1, G0 HMC087RC Control F 18 RC normal n/a n/a Illumina/454pyro HMC088RC UC M 16 RC inflammed E1, S0 20 (Mild) Illumina HMC090RC CD M 16 RC inflammed A1b, L3, L4, B1, G0 52.5 Illumina/454pyro (Severe) HMC091RC Control M 12 RC normal n/a n/a Illumina HMC092RC UC M 12 RC normal E3, S1 80 Illumina/454pyro (Severe) HMC093RC CD M 12 RC normal A1b, L1, B1p, G0 27.5 (Mild) Illumina/454pyro HMC094RC CD M 11 RC normal A1b, L1, B1p, G0 45 Illumina (Severe) HMC095RC CD M 11 RC normal A1b, L3, B1p, G1 65 Illumina (Severe) HMC097RC CD M 12 RC inflammed A1b, L3, L4a, 40 454Pyro B1, G0 (Severe) HMC098RC Control F 16 RC normal n/a n/a Illumina HMC100RC Control M 15 RC normal n/a n/a Illumina HMC102RC Control F 17 RC normal n/a n/a Illumina HMC103RC UC F 17 RC inflammed E4, S0 50 Illumina (Moderate HMC106DC Control F 16 DC normal n/a n/a qPCR/qRTPCR HMC109DC Control F 3 DC normal n/a n/a qPCR/qRTPCR HMC112DC Control M 9 DC normal n/a n/a qPCR/qRTPCR HMC113DC UC M 15 DC inflammed E2, S1 0 qRTPCR ((Inactive)) HMC117DC Control F 15 DC normal n/a n/a qRTPCR HMC201RC CD F 11 RC inflammed A1b, L2, B1, G1 37.5 Illumina/Massspec/ (Moderate qPCR/qRTP HMC202RC CD M 17 RC inflammed A1b, L3, B1, G0 37.5 Illumina/Massspec/ (Moderate qPCR/qRTP HMC203RC CD M 11 RC inflammed A1b, L3, B1, G0 45 Illumina/Massspec/ (Severe) qPCR/qRTP HMC204RC CD M 13 RC normal A1b, L1, L4b, B1, 45 Illumina/qRTPCR G1 (Severe) HMC205RC CD M 13 RC normal A1b, L1, L4a, B1, 45 Illumina/qPCR/qRTPCR P.G1 (Severe) HMC206RC CD M 14 RC inflammed A1b, L3, B1, G1 45 qRTPCR (Severe) HMC207RC UC F 13 RC inflammed E4, S1 70 Illumina (Severe) HMC208RC Control F 16 RC normal n/a n/a Illumina/qPCR/qRTPCR HMC210RC CD F 17 RC normal A1b, L1, B1, G0 37.5 qRTPCR (Moderate HMC211RC control M 13 RC normal n/a n/a qRTPCR HMC212RC control F 15 RC normal n/a n/a qRTPCR HMC213RC CD M 10 RC inflammed A1b, L3, B1, G1 60 qPCR/MassSpec (Severe) HMC214RC UC M 17 RC inflammed E3, S0 35 qRTPCR (Moderate HMC215RC UC F 12 RC inflammed E4, S1 65 qRTPCR (Severe) HMC217RC CD F 14 RC normal A1b, L1, L4a, 55 qPCR/qRTPCR B1, G0 (Severe) HMC219RC CD M 14 RC inflammed A1b, L3, B1, G1 37.5 MassSpec/qRTPCR (Moderate HMC220RC CD M 13 RC inflammed A1b, L3, B1, G0 60 MassSpec/qRTPCR (Severe) HMC221RC control F 9 RC normal n/a n/a qPCR/qRTPCR HMC222RC control M 10 RC normal n/a n/a qPCR/qRTPCR HMC223RC CD F 9 RC inflammed A1a, L2, B1, G1 45 MassSpec/qRTPCR (Severe) HMC224RC control M 15 RC normal n/a n/a qPCR/qRTPCR/ MassSpec HMC225RC control F 15 RC normal n/a n/a qRTPCR HMC227RC CD F 13 RC inflammed A1b, L3, B1, G0 32.5 qPCR/qRTPCR/ (Moderate MassSpec HMC228RC CD M 13 RC inflammed A1b, L3, B1, P, 62.5 MassSpec/qRTPCR G0 (Severe) HMC229RC CD M 10 RC inflammed A1b, L2, L4a, 57.5 qPCR/qRTPCR B1, G0 (Severe) HMC230RC CD M 14 RC inflammed A1b, L3, L4a, 52.5 qPCR/qRTPCR B1, P, G0 (Severe) HMC231RC CD F 15 RC normal A1b, L1, B1, G0 37.5 qPCR/qRTPCR (Moderate HMC232RC control F 15 RC normal n/a n/a qPCR/qRTPCR/ MassSpec HMC234RC CD F 13 RC inflammed A1b, L3, B1, G0 52.5 qRTPCR (Severe) HMC235RC control M 11 RC normal n/a n/a qRTPCR HMC237RC control M 14 RC normal n/a n/a MassSpec/qRTPCR HMC238RC Control M 14 RC normal n/a n/a qPCR/qRTPCR HMC239RC CD M 3 RC infamed A1a, L3, B1p, 22.5 (Mild) MassSpec/qRTPCR GO HMC240RC CD M 10 RC normal A1b, L1, B1, G0 55 qRTPCR (Severe) HMC241RC Control F 12 RC normal n/a n/a qRTPCR HMC243RC UC M 8 RC inflammed E1, S0 45 qRTPCR (Moderate HMC245RC Control M 16 RC normal n/a n/a qRTPCR HMC246RC Control M 13 RC normal n/a n/a qRTPCR HMC247RC UC F 13 RC inflammed E4, S1 80 qRTPCR (Severe) HMC249RC UC M 14 RC inflammed E4, S0 45 qRTPCR (Moderate HMC252RC CD M 9 RC inflammed A1a, L3, B1, G0 37.5 MassSpec (Moderate HMC253RC CD F 11 RC inflammed A1b, L2, L4a, B1 40 qPCR (Severe) HMC254RC CD M 12 RC normal A1a, L1, L4a, 27.5 (Mild) MassSpec B2B3 HMC256RC CD F 10 RC inflammed A1b, L2, B1 30 MassSpec (Moderate HMC258RC Control M 15 RC normal n/a n/a MassSpec HMC260RC CD M 13 RC inflammed A1b, L2, B1p 47.5 qPCR (Severe) HMC261RC CD F 13 RC normal A1b, L3, L4, B1p 32.5 qPCR (Moderate HMC264RC CD F 15 RC normal A1bL3L4aB1G0 30 qPCR (Moderate HMC266RC CD F 10 RC inflammed A1a, L2, B1 27.5 (Mild) qPCR HMC269RC CD M 8 RC normal A1a, L3, L4a, B1 2.5 qPCR (Inactive) HMC270RC Control F 17 RC normal n/a n/a qPCR HMC271RC CD M 15 RC inflammed A1a, L3, B1p, 62.5 qPCR/MassSpec GO (Severe) HMC272RC CD M 12 RC inflammed A1a, L3, B1p, 50 MassSpec G1 (Severe) HMC280RC CD M 15 RC inflammed A1b, L3, B1 35 MassSpec (Moderate HMC281RC Control F 15 RC normal n/a n/a MassSpec HMC285RC CD F 9 RC inflammed A1a, L3, B1, G0 17.5 (Mild) qPCR HMC286RC CD M 15 RC inflammed A1b, L3, L4a, B1 5 qPCR (Inactive) HMC288RC CD M 14 RC inflammed A1b, L3, B1p 62.5 qPCR/MassSpec (Severe) HMC289RC CD M 12 RC inflammed A1b, L3, B1p 67.5 qPCR (Severe) HMC293RC CD F 12 RC inflammed A1b, L2, B1, G1 22.5 (Mild) qPCR HMC295RC CD F 14 RC inflammed L2, B1, G0 20 (Mild) qPCR HMC297RC Control F 17 RC normal n/a n/a qPCR HMC298RC CD M 12 RC normal A1b, L1, B1 52.5 qPCR (Severe) HMC300RC CD M 10 RC inflammed A1a, L3, L4a, 27.5 (Mild) MassSpec B1, G1 HMC301RC CD F 14 RC inflammed A1b, L3, L4a, 60 MassSpec B1, G0 (Severe) HMC305RC CD M 4 RC normal A1a, L3, L4a, 12.5 (Mild) qPCR B2p, G0 HMC307RC Control F 16 RC normal n/a n/a qPCR/MassSpec HMC309RC Control M 10 RC normal n/a n/a qPCR/MassSpec HMC313RC Control M 16 RC normal n/a n/a qPCR HMC315RC Control M 16 RC normal n/a n/a MassSpec HMC316RC CD M 14 RC inflammed A1b, L3, L4a, B1 17.5 (Mild) qPCR/MassSpec HMC317RC CD M 15 RC normal A1b, L1, L4a, 0 qPCR B1p (Inactive) HMC319RC CD M 12 RC normal L1, B1, G1 40 qPCR (Severe) HMC321RC Control F 16 RC normal n/a n/a qPCR HMC322RC CD M 12 RC inflammed A1bL3B1P 27.5 (Mild) qPCR HMC323RC CD F 16 RC inflammed A1bL3B1G0 35 qPCR (Moderate HMC327RC CD F 10 RC inflammed A1aL2B1 25 (Mild) MassSpec
[0147] The microbiota at the intestinal mucosal interface embedded within the mucus layer and in direct contact with the site of disease was collected, and the microbial composition was characterized. The IBD microbiota was characterized by a smaller core as compared to controls (
[0148] The relative abundance of A. parvulum was validated by quantitative polymerase chain reaction (qPCR) and found to be positively correlated with disease severity (
[0149] To evaluate the colitogenic potential of A. parvulum, we utilized colitic-susceptible II10.sup./ mice.sup.12,13. Germ-free II10.sup./ mice were transferred to specific pathogen free (SPF) housing and gavaged with A. parvulum (10.sup.8 CFU/mouse/week) for 6 weeks. Compared to control uninfected II10.sup./ mice, A. parvulum-colonized II10.sup./ mice showed macroscopic evidence of cecal atrophy and colon length reduction (
[0150] To gain mechanistic insights into the role of H.sub.2S-producing microbes in IBD severity, an unbiased, quantitative proteomic analysis of mucosal biopsies of IBD subjects of various disease severity (n=21) and controls (n=8) was conducted. Measurements for 3880 proteins were obtained of which 490 were identified as differentially expressed by comparing the 3 major groups, severe vs. moderate vs. control (one-way ANOVA with P<0.05). Mitochondrial proteins were identified as a major discriminant feature representing 21.7% of all differentially expressed proteins (
[0151] The findings demonstrate an alteration of the balance between bacterial-derived H.sub.2S production and host-mediated detoxification of H.sub.2S at the mucosal-luminal interface. To test the causative role of H.sub.2S-producing microbes in colitis, we assessed whether an H.sub.2S scavenger (bismuth) could alleviate Atopobium-induced colitis in II10.sup./ mice. Consistent with the first cohort, Atopobium-associated SPF mice developed severe colitis (
[0152] Collectively the findings shed light on the pathogenic mechanisms of early IBD onset. The emerging picture is that the pediatric IBD microbiota is characterized by a depletion in butyrate producing microbes together with an increased abundance of H.sub.2S-generating bacteria, namely A. parvulum, Fusobacterium and Veillonella, which produce H.sub.2S by protein fermentation.sup.18. Because IBD patients exhibit increased levels of fecal H.sub.2S.sup.14, sulfate-reducing bacteria (SRB) have long been proposed to be involved in the etiology of IBD, although studies have failed to demonstrate a link between SRB and IBD.sup.10. Instead, our study demonstrates a key role for microbes producing H.sub.2S through protein fermentation in CD pathogenesis. Butyrate is known to activate the expression of the genes encoding the host mitochondrial H.sub.2S detoxification components.sup.19 and our proteomic analyses indicate a diminished capacity for H.sub.2S detoxification by IBD patients. Therefore, we postulate that the depletion of butyrate-producing microbes from the gut microbiota would disable the host H.sub.2S defense systems. This disarmed host would be highly susceptible to further damage caused by enhanced H.sub.2S production, resulting in metabolic stress and subsequently increased mucosal inflammation. Interestingly, variants in mitochondrial DNA, which result in increased metabolic activities, protect mice from colitis.sup.20. This is in agreement with the important role of the mitochondria in modulating the mucosal barrier. More recently, excess H.sub.2S has been shown to act as an autocrine T-cell activator, potentially contributing to unwanted T-cell responses against commensal bacteria.sup.21, consistent with our observation that the gut microbiota is required for A. parvulum-induced experimental colitis. Given the essential role of butyrate in regulating regulatory T cells (T.sub.reg) homeostasis and the critical role of T.sub.reg in limiting intestinal inflammation.sup.22, H.sub.2S production may also interfere with this process by impairing butyrate oxidation and thus might lead to increased colitis severity. This result emphasises the importance of the microbial community and its interaction with the host in the pathogenesis of IBD. Altogether, our findings provide new avenues for diagnostics as well as therapies to treat IBD.
Methods
Example 2
[0153] Colonic mucosal lavages and/or mucosal biopsies were collected from 157 pediatric subjects (84 Crohn's Disease, 20 Ulcerative Colitis, and 53 controls). All IBD cases were newly diagnosed with IBD and met the standard diagnostic criteria for either CD or UC. Metagenomic DNA from the intestinal lavages was extracted using the FastDNA SPIN Kit. Microbial communities were surveyed by deep sequencing the 16S rRNA V6 hypervariable region using Illumina HiSeq2500 and 454-Pyrosequencing. Reads were quality filtered and QIIME .sup.23 was used to assign reads into operational taxonomic units (OTUs) against the Greengenes reference set. Several statistical approaches (Kruskal-Wallis tests, LEFSe, PCA, PLS-DA) were used to determine differentially abundant OTUs. The correlation between A. parvulum relative abundance and CD severity was confirmed by qPCR. Proteomic analysis of mucosal biopsies was conducted using super-SILAC-based HPLC-ESI-MS/MS. The generated raw data was processed and analyzed by MaxQuant against the decoy Uniport-human database with the protein-group file imported into Persus for statistical analysis. Pathway analysis was done using the DAVID Bioinformatics Resources. The transcript levels of TST, SQRDL and COX4-1 were quantified by RT-qPCR. Gnotobiotic and specific pathogen free II10.sup./ mice were gavaged once weekly with A. parvulum (10.sup.8 cfu) for 6 weeks. Bismuth (III) subsalicylate (7 g/kg) was added to the diet of the assigned groups one week before the gavage. Tissue samples from the colon were collected for RNA and histology as described previously .sup.24. Mouse colonoscopies were performed and histological inflammation was blindly scored as previously described .sup.25. Mice mucosal cytokines (Cxcl1, II12p40, II1 and II17a) were quantified by RT-qPCR.
Example 3
[0154] Patient Cohort and Study Design:
[0155] This study involved the enrollment, detailed assessment, and biological sampling of 157 pediatric subjects (84 CD, 20 UC, and 53 controls; Table 7). All patients under 18 years of age scheduled to undergo their first diagnostic colonoscopy at the Children's Hospital of Eastern Ontario (CHEO) were potentially eligible for recruitment to this study, with the following exclusions which are known to affect the gut microbiota composition: (1) body mass index (BMI) greater than 95th percentile for age; (2) diagnosis with diabetes mellitus; (3) diagnosis with infectious gastroenteritis within the preceding 2 months; and (4) use of any antibiotics or probiotics within the last 4 weeks. All cases were newly diagnosed with IBD (inception cohort prior to the initiation of treatment) and met the standard diagnostic criteria for either Ulcerative Colitis or Crohn's Disease following thorough clinical, microbiologic, endoscopic, histologic and radiologic evaluation.sup.26; most had active inflammatory luminal disease involving the terminal ileum and/or the colon+/ perianal disease. Phenotyping of disease was based on endoscopy and clinical disease activity scores. The Simplified-Endoscopy Score-Crohn's disease was used to record macroscopic activity in each segment of the intestinal tract in Crohn's disease.sup.27, the site of involvement in CD was recorded utilizing the Paris IBD Classification.sup.28 and clinical disease activity of CD was determined using the Pediatric Crohn's Disease Activity Index (PCDAI).sup.29. For UC, the site of disease was recorded using the Paris Classification system.sup.28, endoscopic activity was recorded using the Mayo Score Flexible Proctosigmoidoscopy Assessment in ulcerative colitis and clinical activity of UC was determined using and Pediatric Ulcerative Colitis Activity Index (PUCAI).sup.30. The clinical activity scores are both validated for use in Pediatric IBD. All controls had a macroscopically and microscopically normal colon, and did not carry a diagnosis for any known inflammatory intestinal disorder and did not have a well-defined infectious etiology for the bowel inflammation. Data collected on all participants included: demographics (age, gender, BMI, country of birth, age of diagnosis), environmental exposures (cigarette smoke, diet, previous antibiotic exposure), and all clinical features. This study was performed in compliance with the protocol approved by the Research Ethic Board of the Children's Hospital of Eastern Ontario.
Example 4
[0156] Biopsies and Mucosa-Luminal Sample Collection:
[0157] Mucosal-luminal interface samples were collected from the right colon at the time of endoscopy. Colonoscopy preparation was done the day before the procedure as per standard protocol.sup.31. During endoscopy, once the correct position is reached, loose fluid and debris was aspirated. Thereafter sterile water was flushed onto the mucosa and the collection of water, mucus and intestinal cells of the colonic mucosa was aspirated into sterile container through the colonoscope. These samples were immediately place on ice in the endoscopy suite, promptly transferred to the lab to minimize delay for processing and then storing at 80 C. Up to 2 biopsies were collected from macroscopically involved area of the right colon. Biopsies were flash frozen on dry-ice in the endoscopy suite and immediately stored at 80 C. until further processing.
Example 5
[0158] Microbiota DNA Extraction and Sequencing of 16S rDNA Amplicons:
[0159] Metagenomic DNA was extracted from the mucosa-luminal samples using the Fast DNA SPIN Kit (MP Biomedicals) and the FastPrep machine (MP Biomedicals) with two mechanical lysis cycles at speed 6.0 for 40 seconds. Extracted DNA was then used for the construction of the sequencing libraries.
[0160] Two sequencing-by-synthesis platforms were used in this study: (1) pyrosequencing (Roche 454 GS-FLX) and (2) IIlumina Hiseq 2500. Samples for both sequencing techniques were PCR amplified to target the same V6 hypervariable region. Samples for sequencing by Roche 454 were independently sequenced using the FLX chemistry on 12 lanes of a 16-lane sub-divided 454 FLX PicoTiter plate (7075 mm) and using a total of 3 plates. The 454 amplicons libraries were constructed using the conserved V6 primers pair 16S-V6_907-F (5-AAACTCAAAKGAATTGACGG-3) (SEQ ID NO. 16) and 16S-V6_1073-R (5-ACGAGCTGACGACARCCATG-3).sup.32 (SEQ ID NO. 17). The hypervariable V6 region of 16S rDNA gene was amplified using two successive PCR reactions to reduce PCR bias as previously described.sup.33. The first PCR used 16S-V6 specific primers and the 2nd PCR involved 454 fusion-tailed primers. In the first PCR, ten amplicons were generated from each extracted DNA sample. Each PCR reaction contained 2 L DNA template, 17.5 L molecular biology grade water, 2.5 L 10 reaction buffer (200 mM Tris-HCl, 500 mM KCl, pH 8.4), 0.5 L dNTPs (10 mM), 1 l 50 mM MgCl.sub.2, 1 L of both forward and reverse primers (10 mM each) and 0.5 L Invitrogen's Platinum Taq polymerase (5 U/L) in total volume of 25 L. The PCR conditions were initiated with heated lid at 95 C. for 5 min, followed by a total of 15 cycles of 94 C. for 40 sec, 48 C. for 1 min, and 72 C. for 30 sec, and a final extension at 72 C. for 5 min, and hold at 4 C. Amplicons generated from each sample were pooled and purified to remove the excess unused primers using Qiagen's MiniElute PCR purification columns and eluted in 30 L molecular biology grade water. The purified amplicons from the first PCR were used as templates in a second PCR with the same amplification conditions used in the first PCR with the exception of using 454 fusion-tailed primers in a 30-cycle amplification regime. An Eppendorf Mastercycler ep gradient S thermalcycler was used in all PCRs. A negative control reaction (no DNA template) was included in all experiments. PCR success was checked by agarose gel electrophoresis. The 16S-V6 amplicon of each sample was quantified by fluorometer and purified with AMPure magnetic beads. The amplicon libraries were sequenced on a 454 Genome Sequencer FLX System (Roche Diagnostics GmbH) following the amplicon sequencing protocol. Amplicons of each sample was bi-directionally sequenced in 1/16th of full sequencing run (7075 picotiter plate).
[0161] For samples to be sequenced by Illumina Hiseq 2500, the V6 hypervariable region of the 16S rDNA gene was amplified using two successive PCR reactions as described previously.sup.34. The universal 16S rDNA-V6 primers for the first PCR step were modified from Sundquist et al.sup.32 to include the Illumina paired-end sequencing adapters, and a 4-6 nucleotide barcode sequence (Supplementary Table 10). Each PCR reaction was performed in a total volume of 50 L using 50 ng of the extracted DNA, 1 Phusion HF PCR buffer, 0.5 M of each primer, 0.2 mM dNTPs, and 1 U Phusion High-Fidelity DNA polymerase (Thermo Scientific). The PCR conditions included initial denaturation at 94 C. for 30 s, 10 cycles of 94 C. for 10 s, 61 C. for 10 s with a 1 C. drop each cycle and 72 C. for 15 s followed by an additional 15 cycles using an annealing temperature of 51 C. for 45 s, and a final extension at 72 C. for 2 min. The second PCR was carried out using 10 L of the first PCR products in a final volume of 50 L using the primers PCRFWD1/PCRRVS1 (Supplementary Table 10). The second PCR conditions were 30 s at 94 C., 15 cycles of 10 s at 94 C., 10 s at 65 C., and 15 s at 72 C. followed by a final extension step at 72 C. for 2 min. The amplicons of each sample were visualized on a 1.5% agarose gel and purified using the Montage PCR.sub.96 Cleanup Kit (Millipore). Next, the DNA concentration in each reaction was quantified using the Qubit dsDNA BR Assay Kit (Invitrogen) following the manufacturer instructions and 100 ng of amplicons from each sample were pooled. Finally, the library consisting of the pooled amplicons was gel purified using the QIAquick Gel Extraction Kit (Qiagen), quantified and subjected to Illumina HiSeq 2500 sequencing at The Center for Applied Genomics (TCAG, Toronto) generating paired-end reads of 2 100 bases.
Example 6
[0162] Microbiota Analysis:
[0163] 454 Pyrosequencing Data Analysis:
[0164] A total of 346,160 reads were generated from 454 pyrosequencing of 16S rDNA-V6 region from 26 right colon samples. The generated reads were submitted to NCBI Sequence Read Archive under accession number SRP034632. The raw sequences were processed to remove low quality and short reads using Quantitative Insights Into Microbial Ecology pipeline release 1.4.0 (QIIME 1.4.0).sup.23 according to the following parameters: (1) Minimum read length of 100 bp, (2) Exact matching to the sequencing primers, (3) No ambiguous nucleotides, and (4) The minimum average quality score of 20. This resulted in a total of 266,006 high quality reads with an average of 10,224 sequences per sample and a mean length of 169.58 bases including the primers. Next, sequences were clustered into operational taxonomic units (OTUs) using UCLUST based on average percentage of identity of 97%. The most abundant read from each OTU was picked as a representative sequence for that cluster, while singletons were discarded. PyNAST was used to align the representative sequences with a minimum alignment length of 100 and a minimum percentage identity of 75%, followed by identification of chimeric OTUs with the Blast Fragments Algorithm implemented in QIIME. Only 6 representative sequences were identified as chimeras and therefore were removed from the aligned representative set. Taxonomy assignments were made with BLAST by searching the representative sequences against the Greengenes database (release 4 Feb. 2011) with an e value of 1e-8 and a confidence score of 0.5. The resulting OTU table was used to determine the alpha and beta diversity within and between the samples using the default criteria of QIIME. Taxa significantly associated with disease status (CD, UC and control) or disease severity (mild, moderate and severe) were identified using the linear discriminant effect size (LEFSe) algorithm (http://huttenhower.org/galaxy/).sup.11. To assign taxonomy at the species level, representative reads from OTUs of interest were retrieved from QIIME and aligned against the NCBI and RDB databases.sup.35,36.
[0165] IIlumina Sequencing Data Analysis:
[0166] Paired-end sequences obtained by Illumina HiSeq 2500 (2101 nucleotides) were merged into longer reads (with an average length per sequence of 165 nucleotides) using Fast Length Adjustment of Short reads (FLASh) software avoiding any mismatch in the overlap region that ranges from 20 to 80 nucleotides.sup.37. More than 95% of the reads was merged successfully, while the sequences that failed to merge were discarded. The merged reads were then quality filtered with a minimum quality score of 20 using the fastq_quality_filter command from the Fastx toolkit (http://hannonlab.cshl.edu/). High quality reads were sorted according to the forward and the reverse barcode sequences with barcodes trimming using the NovoBarCode software (Novocraft.com). Sequences with mismatched primers were excluded. The sorted reads were submitted to NCBI Sequence Read Archive under accession number SRP034595. Next, the reads were fed to QIIME 1.5.0.sup.23 pipeline and clustered into OTUs using a closed-reference OTU picking workflow with UCLUST against the Greengenes reference set (release 4 Feb, 2011) based on average percentage of identity of 97%. The OTUs were assigned the taxonomy associated with the corresponding Greengenes reference sequence. Singletons and doubletons were removed and a table of OTU counts per sample was generated. Next, the OTU table was randomly subsampled to a total number of reads per sample of 500,000. The resulting rarefied OTU table was used to analyze the microbiota structure and diversity using the microbial ecology tools available in the QIIME package and for all other downstream analyses. For the identification of the core microbiota, OTUs detected in at least 75% of the samples within a clinical group (CD patients, UC patients or control subjects) were considered as members of the core microbiota for that particular group.
[0167] Multivariate Statistical Analysis:
[0168] Several statistical approaches were employed to identify taxa significantly associated with disease status and severity. A Kruskal-Wallis test with post hoc Dunn's test was performed to compare the relative abundance of taxa as a function of disease status (CD vs. UC vs. control) and disease severity (mild vs. moderate vs severe). A Bonferroni correction was employed to account for multiple hypotheses with a P<0.05 considered significant. The relative abundances of the taxa identified were also analyzed by principal component analysis (PCA) and partial least square discriminant analysis (PLS-DA). For PLS-DA calculation the data were log-transformed and scaled to unit variance as described in Durbin et al..sup.38. The PLS-DA models were validated by cross-validation and permutation tests. The variable importance in projection (VIP) value was used to identify features which contribute the most to the clustering (taxa with VIP>1.0 were considered influential and with VIP>1.5 highly influential). All statistical analyses were performed using XLSTAT and/or R software package.
Example 7
[0169] Atopobium parvulum qPCR Quantification:
[0170] The relative abundance of A. parvulum was determined by conducting absolute quantitative PCR on the extracted metagenomic DNA using the Applied Biosystems 7300 DNA analyzer and A. parvulum-specific 16S rRNA primers developed for the current study; Aparv-711F 5-GGGGAGTATTTCTTCCGTGCCG-3 (SEQ ID NO. 1) and Aparv-881R 5-CTTCACCTAAATGTCAA GCCCTGG-3 (SEQ ID NO. 2). Each sample was tested in duplicate in a total volume of 25 L per reaction. 100 ng of template DNA was added to a reaction mixture containing 1 M of each primer, and 1 QuantiFast SYBR Green PCR master mix (Qiagen). The amplification conditions were 5 min at 95 C. followed by 40 cycles of 95 C. for 10 sec and 66 C. for 1 min with data collection at the second step of each cycle. To normalize between samples, the total 16S rRNA in each sample was simultaneously quantified using the universal primers; 331F 5-TCCTACGGGAGGCAGCAGT-3 (SEQ ID NO. 18) and 797R 5-GGACTACCAGGGTATCTAATCCTGTT-3 .sup.39 (SEQ ID NO. 19). The positive standards for A. parvulum and the total 16S rRNA quantification were prepared by conducting PCR on the DNA extracted from A. parvulum ATCC 33793 strain and one mucosal aspirate sample from a healthy subject, respectively. The amplicons were purified using PureLink PCR Purification Kit (Invitrogen) and quantified by Qubit dsDNA BR Assay Kit (Invitrogen). Afterward, 10.sup.6, 10.sup.7, 10.sup.8 and 10.sup.9 copies from each gene fragment were prepared, assuming the average molecular weight of the base pair is 660, and the C.sub.t values were determined for each concentration by qPCR following the same conditions described above. The standard curves of both A. parvulum and the total 16S rRNA gene copy numbers against Ct values were established and the relative abundance of A. parvulum in each sample was calculated as A. parvulum 16S-rRNA divided by the total 16S-rRNA copy number. To validate the specificity of Apar-711F and Aparv-881R, fresh PCR amplicons from the total DNA extracted from two different mucosal aspirates was cloned using TOPO TA cloning kit (Invitrogen) according to the manufacturer's instructions, and then, the plasmid containing the 16S rRNA gene fragment was extracted from 6 different clones by QIAprep Spin Miniprep kit (Qiagen) using its standard protocol followed by Sanger sequencing using M13F and M13R primers.
Example 8
[0171] Stable Isotope Labeling by Amino Acids in Cell Culture (SILAC):
[0172] Human hepatic HuH7 cells (HuH-7), human embryonic kidney 293 cells (HEK-293) and human colorectal cancer 116 cells (HCT-116) were individually grown at 37 C. in a 5% CO.sub.2 humidified incubator. SILAC medium was prepared as follows: DMEM lacking lysine, arginine and methionine was custom prepared by AthenaES (Baltimore, Md., USA) and supplemented with 30 mg/L methionine (Sigma Aldrich; Oakville, ON, CAN), 10% (v/v) dialyzed FBS (GIBCO-Invitrogen; Burlington, ON, CAN), 1 mM sodium pyruvate (Gibco-Invitrogen), 28 g/mL gentamicin (Gibco-Invitrogen), and [.sup.13C.sub.6,.sup.15N.sub.2]-L-lysine, [.sup.13C.sub.6,.sup.15N.sub.4]-L-arginine (heavy form of amino acids; Heavy Media) from Sigma Aldrich (Oakville, ON, CAN) at final concentrations of 42 mg/L and 146 mg/L for arginine and lysine respectively. For HCT-116, the concentration of arginine was increased to 84 mg/L. Cells were grown for at least 10 doublings in SILAC media to allow for complete incorporation of the isotopically labeled amino acids into the cells.
Example 9
[0173] Determination of the Rate of SILAC Amino Acids Incorporation into HuH-7, HEK-293 and HCT-116 Cells:
[0174] Cells were grown to 80% confluency in SILAC medium (510.sup.6 cells were plated in 10-cm dish). Next, the cells were washed twice with ice-cold phosphate-buffered saline and lyzed by addition of 1 mL of 1RIPA buffer (50 mM Tris (pH 7.6), 150 mM NaCl, 1% (v/v) NP-40, 0.5% (w/v) deoxycholate, 0.1% (w/v) SDS with protease inhibitor cocktail (Complete Mini Roche; Mississauga, ON, CAN) and phosphatase inhibitor (PhosStop Roche tablet). The lysates were then transferred to 15 mL conical tubes and the proteins were precipitated by addition of 5 mL ice-cold acetone followed by incubation at 20 C. overnight. Proteins were collected by centrifugation (3000g, 10 min, 4 C.), washed with ice-cold acetone two times, and the protein pellets were resolubilized in 300 L of a 50 mM NH.sub.4HCO.sub.3 solution containing 8 M urea. Protein concentrations were determined by the Bradford dye-binding method using Bio-Rad's Protein Assay Kit (Mississauga, ON, CAN). For the general in-solution digestion, 200 g of protein lysates were reconstituted in 50 mM NH.sub.4HCO.sub.3 (200 L) and proteins were reduced by mixing with 5 L of 400 mM DTT at 56 C. for 15 min. The proteins were then subjected to alkylation by mixing with 20 L of 400 mM iodoacetamide in darkness (15 min at room temperature) followed by addition of 800 L of 50 mM NH.sub.4HCO.sub.3 to reduce the urea concentration to 0.8 M. Next, the proteins were digested with TPCK-trypsin solution (final ratio of 1:20 (w/w, trypsin: protein) at 37 C. for 18 h. Finally, the digested peptides were desalted using C.sub.18 Sep-Pack cartridges (Waters), dried down in a speed-vac, and reconstituted in 0.5% formic acid prior to mass spectrometric analysis (as described below) and the determination of labeling efficiency. The incorporation efficiency was calculated according to the following equation: (11/Ratio(H/L)); where H and L represents the intensity of heavy and light peptides detected by mass-spectrometry, respectively. Labeling was considered complete when values reached at least 95% for each cell type.
Example 10
[0175] Proteomic Analysis of Biopsies Using Super-SILAC-Based Quantitative Mass Spectrometry:
[0176] Biopsies were lysed in 4% SDS (sodium dodecyl sulfate), 50 mM Tris-HCl (pH 8.0) supplemented with proteinase inhibitor cocktail (Roche) and homogenized with a Pellet pestle. The lysates were sonicated 3 times with 10 s pulses each with at least 30 s on ice between each pulse. Protein concentrations were determined using the Bio-Rad DC Protein Assay. The proteins were processed using the Filter Aided Sample Preparation Method (FASP) as previously described with some modifications.sup.40. Colon tissue lysates (45 g of proteins) and heavy SILAC-labeled cell lysates (15 g from each HuH-7, HEK-293 and HCT-116 cells) were mixed at a 1:1 weight ratio and transferred into the filter. The samples were centrifuged (16,000g, 10 min), followed by two washes of 200 L 8 M urea, 50 mM Tris-HCl pH 8.0. Samples were then reduced by incubation in 200 L of 8 M urea, 50 mM Tris-HCl (pH 8.0) supplemented with 20 mM dithiothreitol. After centrifugation, samples were subjected to alkylation by adding 200 L of 8 M urea, 50 mM Tris-HCl pH 8.0, containing 20 mM iodoacetamide (30 min at room temperature protected from light). Samples were washed using 200 L 8 M urea, 50 mM Tris-HCl pH 8.0 (twice) to remove excess SDS. To further dilute urea, two washes of 200 L 50 mM Tris-HCl pH 8.0 were performed. For the trypsin digest, samples were incubated in 200 L of 50 mM Tris-HCl pH 8.0, containing 5 g of Trypsin (TPCK Treated, Worthington) on a shaker (250 rpm) at 37 C. overnight. Finally, 200 L of 50 mM Tris-HCl pH 8.0 was added to elute the peptides by centrifugation (twice). Peptides were fractionated, using an in-house constructed SCX column with five pH fractions (pH 4.0, 6.0, 8.0, 10.0, 12.0). The buffer composition was 20 mM boric acid, 20 mM phosphoric acid, and 20 mM acetic acid, with the pH adjusted by using 1 M NaOH). Finally, the fractionated samples were desalted using in-house C.sub.18 desalting cartridges and dried in a speed-vac prior to LC-MS analysis.
[0177] Mass-Spectrometry Analyses:
[0178] All resulting peptide mixtures were analyzed by high-performance liquid chromatography/electrospray ionization tandem mass spectrometry (HPLC-ESI-MS/MS). The HPLC-ESI-MS/MS consisted of an automated Ekspert nanoLC 400 system (Eksigent, Dublin, Calif., USA) coupled with an LTQ Velos Pro Orbitrap Elite mass spectrometer (ThermoFisher Scientific, San Jose, Calif.) equipped with a nano-electrospray interface operated in positive ion mode. Briefly, each peptide mixture was reconstituted in 20 L of 0.5% (v/v) formic acid and 12 L was loaded on a 200 m50 mm fritted fused silica pre-column packed in-house with reverse phase Magic C.sub.18AQ resins (5 m; 200 pore size; Dr. Maisch GmbH, Ammerbuch, Germany). The separation of peptides was performed on an analytical column (75 m10 cm) packed with reverse phase beads (3 m; 120 pore size; Dr. Maisch GmbH, Ammerbuch, Germany) using a 120 min gradient of 5-30% acetonitrile (v/v) containing 0.1% formic acid (v/v) (JT Baker, Phillipsburg N.J., USA) at an eluent flow rate of 300 nL/min. The spray voltage was set to 2.2 kV and the temperature of heated capillary was 300 C. The instrument method consisted of one full MS scan from 400 to 2000 m/z followed by data-dependent MS/MS scan of the 20 most intense ions, a dynamic exclusion repeat count of 2, and a repeat duration of 90 s. The full mass was scanned in an Orbitrap analyzer with R=60,000 (defined at m/z 400), and the subsequent MS/MS analyses were performed in LTQ analyzer. To improve the mass accuracy, all the measurements in the Orbitrap mass analyzer were performed with on-the-fly internal recalibration (Lock Mass). The charge state rejection function was enabled with charge states unassigned and single states rejected. All data were recorded with Xcalibur software (ThermoFisher Scientific, San Jose, Calif.).
[0179] Database Search and Bioinformatic Analysis:
[0180] All raw files were processed and analyzed by MaxQuant, Version 1.2.2.5 against the decoy Uniport-human database (86,749 entries), including commonly observed contaminants. The following parameters were used: cysteine carbamidomethylation was selected as a fixed modification, with methionine oxidation, protein N-terminal acetylation and heavy proline set as variable modifications. Enzyme specificity was set to trypsin. Up to two missing cleavages of trypsin were allowed. SILAC double labeling (light: KOR0; heavy: K8R10) was set as the search parameter in order to assess the conversion efficiency. The precursor ion mass tolerances were 7 ppm and the fragment ion mass tolerance was 0.5 Da for MS/MS spectra. The false discovery rate (FDR) for peptides and proteins was set at 1% and a minimum length of six amino acids was used for peptide identification. The peptides file was imported into Persus (version 1.2.0.17) to extract the lysine- and arginine-containing peptides, respectively.
[0181] The protein-group file was imported into Persus (version 1.3.0.4) for data statistical analysis and an ANOVA-test was chosen for the protein profile with p values of less than 0.05 considered significant. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis was achieved using the DAVID Bioinformatics Resources (http://david.abcc.ncifcrf.gov/). DAVID statistical analyses were performed against the whole genome. Proteomics has a tendency to oversample proteins from the cytosol and nucleus while under-sampling membrane-associated proteins. Therefore, the results from DAVID were retested against the set of proteins that were not changing in our dataset in order to eliminate any pathway/GO enrichment biases.
Example 11
[0182] Total RNA Extraction and qRT-PCR Quantification of Mitochondrial Genes Expression:
[0183] RNA integrity was preserved by adding the mucosal aspirates to an equal volume of RNAlater (Ambion) before freezing at 80 C. The frozen aliquot (2 mL) was thawed on ice and the total RNA was extracted following a hot phenol protocol as described previously .sup.41. Briefly, 4 mL of each sample in RNAlater was pelleted by centrifugation at 13,000g for 5 min at 4 C. The pellets were washed once in 50% RNAlater/PBS buffer and resuspended with lysis in 2 mL of denaturing buffer (4 M guanidium thiocyanate, 25 mM sodium citrate, 0.5% N-laurylsarcosine, 1% N-acetyl cysteine, 0.1 M 2-mercaptoethanol). The lysate was divided into 500 L aliquots, to which 4 L of 1M sodium acetate (pH 5.2) was added. Each aliquot was then incubated with 500 L of buffer saturated phenol (pH 4.3) at 64 C. for 10 minutes, with intermittent mixing. One ml of chloroform was added to the solution and incubated for 15 minutes on ice, followed by centrifugation at 18,000g for 30 min at 4 C. Afterward, RNA was precipitated from the aqueous layer by adding 1/10 volume 3M sodium acetate, 500 mM DEPC treated EDTA and 2 volumes of cold ethanol followed by overnight incubation at 80 C. The RNA was then pelleted by centrifugation at 4 C., washed with 80% cold ethanol and resuspended in 100 L of RNAse free ddH.sub.2O. The extracted RNA was treated twice with DNase I (Epicentre) followed by PCR amplification using the 16S rRNA universal primers; Bact-8F and 1391-R; to confirm the absence of genomic DNA. The quality and the quantity of the extracted RNA was determined by NanoDrop 2000 spectrophotometer (Thermoscientific) and confirmed by BioRad's Experion StdSens RNA system according to the manufacturer's description and stored at 80 C. until use.
[0184] The quantification of the expression level of TST (Thiosulfate Sulfurtransferase), SQRDL (Sulfide Quinone Reductase Like) and COX4-1 (Cytochrome C oxidase subunit IV isoform 1) relative to GAPDH (Glyceraldehyde-3-Phosphate Dehydrogenase) genes was determined using the Applied Biosystems 7300 DNA analyzer and Quantitect SYBR Green RT-PCR kit (Qiagen). The primers used were either designed by NCBI Primer-BLAST tool.sup.42 or extracted from a literature source as detailed in Supplementary Table 11. Each reaction contained 100 ng RNA template, 0.5 M of each primer, 1 Quantitect SYBR Green RT-PCR master mix and 0.25 L Quantitect RT-mix in a final volume of 25 L. The one step RT-PCR conditions were 50 C. for 30 min, 95 C. for 15 min followed by 40 cycles of 15 sec at 94 C., 30 sec at 60 C. and 30 sec at 72 C. with data collection at the third step of each cycle. The amplification specificity was checked by the melting profile of the amplicon and 2% agarose gel electrophoresis. C.sub.t values were then extracted using the Applied Biosystems 7300 sequence detection software versions 1.3.1. C.sub.t values of TST, SQRDL, or COX4-1 were normalized to the C.sub.t values of GAPDH generating C.sub.t. Next, C.sub.t was calculated by subtracting the average C.sub.t of the control group from the C.sub.t of each sample. The relative quantification were then calculated by 2.sup.C.sub.t as mentioned previously.sup.34.
Example 12
[0185] II10.sup./ Mice Experiments and Tissue Processing:
[0186] Germ-free SvEv129/C57BL6 II10.sup./; NF-B.sup.EGFP mice (8-12 weeks old, n=12) were transferred to specific pathogen free (SPF) conditions and mice from one cohort (n=6) were gavaged once weekly with A. parvulum (110.sup.8 CFUs) for 6 weeks. Atopobium parvulum ATCC 33793 was grown in fastidious anaerobic broth (FAB) (Lab M, Canada).
[0187] To investigate involvement of complex biota and H.sub.2S in the development of colitis, we performed two subsequent experiments using 129/SvEv II-10.sup./ mice. In the first experimental setting, gnotobiotic II10.sup./ mice (n=37) were randomized into 4 groups; 1: GF only (n=6), 2: GF+bismuth (III) subsalicylate (n=10); 3: A. parvulum (110.sup.8 CFUs) (n=10) and 4: A. parvulum+bismuth (III) subsalicylate (n=11). Mice were euthanized after 6 weeks of mono-association. Bismuth (III) subsalicylate (Sigma-Aldrich, Saint Louis, Mo.) was incorporated to the chow (Teklan Global 18% Protein Rodent Diet) at a concentration of 7 g/kg (Harlan Laboratories, Madison, Wis.) and then irradiated for gnotobiotic experiments. Mice were fed with this diet starting 1 week before the colonization with A. parvulum. In the second experimental setting, gnotobiotic II10.sup./ mice (n=31) were transferred to SPF conditions and randomized into 4 groups; 1: SPF only (n=7), 2: SPF+bismuth (III) subsalicylate (n=8); 3: SPF plus A. parvulum (110.sup.8 CFUs) (n=8) and 4: A. parvulum+bismuth (III) subsalicylate (n=8). Mice were euthanized after 6 weeks of weekly infection with A. parvulum. Bismuth (III) subsalicylate (Sigma-Aldrich, Saint Louis, Mo.) was incorporated to the chow (Teklan Global 18% Protein Rodent Diet) at a concentration of 7 g/kg (Harlan Laboratories, Madison, Wis.). Mice were fed with this diet starting 1 week before the colonization with A. parvulum.
[0188] All animal protocols were approved by the Institutional Animal Care and Use Committee of the University of North Carolina at Chapel Hill. Tissue samples from the colon were collected for RNA and histology as described previously.sup.24. Histological images were acquired using a DP71 camera and DP Controller 3.1.1.276 (Olympus), and intestinal inflammation was scored as previously described.sup.12. The tissue was divided into 4 quarters, a score was given to each quarter separately and then added to generate a final inflammation score on a scale of 0-16.
Example 13
[0189] Mouse Endoscopy:
[0190] Colonoscopy was performed using a Coloview System (Karl Storz Veterinary Endoscopy) as described previously.sup.25. Mice were anesthetized using 1.5% to 2% isoflurane and 4 cm of the colon from the anal verge from the splenic flexure was visualized. The procedures were digitally recorded on an AIDA Compaq PC.
Example 14
[0191] Real Time RT-PCR on Mouse Intestinal Samples:
[0192] Total RNA from intestinal tissues was extracted using TRIzol (Invitrogen) following the manufacturers protocol. cDNA was reverse-transcribed using M-MLV (Invitrogen) and mRNA expression levels were measured using SYBR Green PCR Master mix (Applied Biosystems) on an ABI 7900HT Fast Real-Time PCR System and normalized to -actin. The primers used were as follows: -actin (5-TGGAATCCTGTGGCATCCATGAAAC-3 (SEQ ID NO. 20) and 5-TAAAACGCAGCTCAGTAACAGTCCG-3 (SEQ ID NO. 21)), cxcl1 (5-GCTGGGATTCACCTCAAGAA-3 (SEQ ID NO. 22) and 5-TCTCCGTTACTTGGGGACAC-3 (SEQ ID NO. 23)), tnf (5-ATGAGCACAGAAAGCATGATC-3 (SEQ ID NO. 24) and 5-TACAGGCTTGTCACTCGAATT-3 (SEQ ID NO. 25)), il12p40 (5-GGAAGCACGGCAGCAGCAGAATA-3 (SEQ ID NO. 26) and 5-AACTTGAGGGAGAAGTAGGAATGG-3 (SEQ ID NO. 27)), il-1_(5-GCCCATCCTCTGTGACTCAT-3 (SEQ ID NO. 28) and 5-AGGCCACAGGTATTTTGTCG-3 (SEQ ID NO. 29)), il-17a (5-TCCAGAAGGCCCTCAGACTA-3 (SEQ ID NO. 30) and 5-ACACCCACCAGCATCTTCTC-3 (SEQ ID NO. 31)). The PCR reactions were performed for 40 cycles according to the manufacturer's recommendation, and RNA fold changes were calculated using the C.sub.t method.
[0193] Statistical Analyses of II10.sup./ Mice Results:
[0194] Unless specifically noted, statistical analyses were performed using GraphPad Prism version 5.0a (GraphPad, La Jolla, Calif.). Comparisons of mouse studies were made with a nonparametric analysis of variance, and then a Mann-Whitney U test. All graphs depict meanSEM. Experiments were considered statistically significant if p<0.05.
Example 15
[0195] Sample Collection.
[0196] Mucosal aspirates (washings) were collected from the right colon of 40 control children, 41 crohn's disease (CD) and 20 ulcerative colitis (UC) patients aged 3-18 years old at initial diagnosis, at Children's Hospital of Eastern Ontario (CHEO), Ottawa, Canada, using a standardized protocol..sup.28 The right colon was selected in particular because it is thought to be the most active site for butyrate synthesis..sup.29,30 In addition, fresh stool samples were collected from a subset of patients (5 control and 10 CD) at least 24 h prior to the endoscopy procedure (Table 51 for participating patient information). Immediately following collection, samples were transported on ice to the lab where they were either processed for DNA extraction or stored at 80 C. until further use.
[0197] Extraction of Metagenomic DNA.
[0198] 5 ml aliquots of the mucosal washes were spun at 20,000g for 10 min at 4 C. Then, DNA was extracted from the sediments (or stool samples) using the FastDNA Spin Kit (MP Biomedicals) utilizing two mechanical lysis cycles in a FastPrep Instrument (MP Biomedicals) set at speed of 6.0 for 40 seconds. Extracted DNA was then stored at 20 C. until further use.
[0199] Characterize the Diversity of Butyrate-Producing Bacteria in Healthy and IBD Children
[0200] Relative Quantification of BCoAT Gene from Mucosal-Washes Metagenomic DNA Using qPCR.
[0201] The overall abundance of butyrate-producing bacteria was determined by quantifying the amount of BCoAT gene utilizing the primers BCoATscrF/BCoATscrR as described elsewhere..sup.27 50 ng of metagenomic DNA from each sample was used in a 25 l qPCR reaction containing 1 QuantiTect SYBR Green PCR Master Mix (QIAGEN) and 0.5 M of BCoATscrF/BCoATscrR primers. The amplification conditions were as follows: 1 cycle of 95 C. for 15 min; 40 cycles of 94 C. for 15 sec, 53 C., and 72 C. each for 30 sec with data acquisition at 72 C. For the melting curve analysis, a stepwise temperature increase from 55 C. to 95 C. was performed. Quantification standards were prepared by purifying and quantifying the BCoAT gene fragment from healthy subjects using PureLink PCR Purification Kit (Invitrogen) and Qubit dsDNA BR Assay Kit (Invitrogen), respectively. Then, 10.sup.6, 10.sup.7, and 10.sup.8 gene copies were prepared assuming an average molecular weight of 660 per nucleotide. Simultaneously, the number of 16S rRNA gene copies was quantified in parallel to the BCoAT gene as described previously .sup.31, and results were expressed as copy number of BCoAT genes per 16S rRNA gene.
[0202] Preparation of BCoAT Gene and 16S rRNA Libraries from Mucosal-Washes Metagenomic DNA for Deep Sequencing.
[0203] BCoAT library construction was carried out using a two-step PCR strategy. In the 1.sup.st step, 50 ng of metagenomic DNA was used in a 50 l PCR reaction containing 1.5 mM MgCl.sub.2, 0.5 M of BCoATscrF/BCoATscrR primers, 0.2 mM dNTPs, and 2.5 U HotStarTaq DNA polymerase (QIAGEN). Amplification started with an initial enzyme activation step at 95 C. for 15 min. Then, amplification was carried out using 25 cycles at 94 C., 53 C., and 72 C. (each for 30 sec), and a 10 min final extension at 72 C. For the second PCR, 13 fusion primers were designed (12 forward and one reverse, SEQ ID 3-15) following Roche's Amplicon Fusion Primer Design Guidelines for GS FLX Titanium Series Lib-L Chemistry. Briefly, the forward primers contain (from 5-3) GS FLX Titanium Primer A, a four-base library key, 12 different Multiplex Identifiers (MIDs), and a BCoATscrF primer sequence. The reverse primer contains (from 5-3) GS FLX Titanium Primer B, a four-base library key, and a BCoATscrR primer sequence (Table 9). 10 l of product from the 1.sup.st PCR was utilized in 50 l for the second PCR reaction using a unique MID fusion primer for every 12 samples and the same concentration of PCR component as the 1.sup.st PCR. A total of 15 amplification cycles were performed utilizing the same amplification conditions as the first PCR. For each sample, a total of 5 reaction tubes were prepared. Following amplification, PCR products from the same sample were pooled together, inspected on 1.5% agarose gel, and purified using Montage PCR.sub.96 Cleanup Kit (Millipore). Finally, an equimolar amount of samples with unique MIDs (a total of 4 libraries) were pooled together and sequenced on a Roche 454 platform using a full plate of GS FLX Titanium chemistry (each library in plate) at The McGill University and Gnome Quebec Innovation Centre, Montreal, QC, Canada. A 16S rRNA library was constructed. The 16S rRNA library was sequenced at The Centre for Applied Genomics (TCAG) at the Hospital for Sick Children in Toronto (Canada) using a HiSeq 2500 platform to generate paired-end reads of 2100 bases.
TABLE-US-00009 TABLE9 Primer Name PrimerSequence 1.sup.st BCoATs 5-GCIGAICATTTCACITGGAAYWSITGGCAYATG-3 (SEQIDNO.32) PCR crF BCoATs 5-CCTGCCTTTGCAATRTCIACRAANGC-3 (SEQIDNO.33) crR 2.sup.nd BCoAT- 5- PCR F-1 CCATCTCATCCCTGCGTGTCTCCGACTCAGACGAGTGCGTGCIGAICATTTCACITGGAAYWSITGG CAYATG-3 (SEQIDNO.3) BCoAT- 5- F-2 CCATCTCATCCCTGCGTGTCTCCGACTCAGACGCTCGACAGCIGAICATTTCACITGGAAYWSITGG CAYATG-3 (SEQIDNO.4) BCoAT- 5- F-3 CCATCTCATCCCTGCGTGTCTCCGACTCAGAGACGCACTCGCIGAICATTTCACITGGAAYWSITGG CAYATG-3 (SEQIDNO.5) BCoAT- 5- F-4 CCATCTCATCCCTGCGTGTCTCCGACTCAGAGCACTGTAGGCIGAICATTTCACITGGAAYWSITGG CAYATG-3 (SEQIDNO.6) BCoAT- 5- F-5 CCATCTCATCCCTGCGTGTCTCCGACTCAGATCAGACACGGCIGAICATTTCACITGGAAYWSITGG CAYATG-3 (SEQIDNO.7) BCoAT- 5- F-6 CCATCTCATCCCTGCGTGTCTCCGACTCAGATATCGCGAGGCIGAICATTTCACITGGAAYWSITGG CAYATG-3 (SEQIDNO.8) BCoAT- 5- F-7 CCATCTCATCCCTGCGTGTCTCCGACTCAGCGTGTCTCTAGCIGAICATTTCACITGGAAYWSITGG CAYATG-3 (SEQIDNO.9) BCoAT- 5- F-8 CCATCTCATCCCTGCGTGTCTCCGACTCAGCTCGCGTGTCGCIGAICATTTCACITGGAAYWSITGG CAYATG-3 (SEQIDNO.10) BCoAT- 5- F-10 CCATCTCATCCCTGCGTGTCTCCGACTCAGTCTCTATGCGGCIGAICATTTCACITGGAAYWSITGG CAYATG-3 (SEQIDNO.11) BCoAT- 5- F-11 CCATCTCATCCCTGCGTGTCTCCGACTCAGTGATACGTCTGCIGAICATTTCACITGGAAYWSITGG CAYATG-3 (SEQIDNO.12) BCoAT- 5- F-13 CCATCTCATCCCTGCGTGTCTCCGACTCAGCATAGTAGTGGCIGAICATTTCACITGGAAYWSITGG CAYATG-3 (SEQIDNO.13) BCoAT- 5- F-14 CCATCTCATCCCTGCGTGTCTCCGACTCAGCGAGAGATACGCIGAICATTTCACITGGAAYWSITGG CAYATG-3 (SEQIDNO.14) BCoAT- 5-CCTATCCCCTGTGTGCCTTGGCAGTCTCAGCCTGCCTTTGCAATRTCIACRAANGC-3 (SEQID R NO.15)
[0204] Data Analysis.
[0205] For BCoAT sequencing, demultiplexed reads from each sample were filtered using RDP's Pyrosequencing Pipeline.sup.32 based on a minimum quality score of 20 and 200 nucleotides read length cutoff. Operational Taxonomic Units (OTUs) clustering at 95% sequence similarity was achieved using a de novo UCLUST algorithm integrated in Quantitative Insights Into Microbial Ecology (QIIME) software package V 1.7.0,.sup.33 after which, singleton OTUs were removed. QIIME was also used to compute alpha and beta diversity between samples using a fixed number of reads/sample of 4,600. The longest sequence from each OTU was then selected and used for taxonomy assignment as described previously..sup.23 Sequences with <75% identity to functional gene reference database were considered unclassified OTUs. Finally, the relative abundance (RA) of assigned species was calculated and differences in butyrate producing bacteria RA were analyzed.
[0206] 16S rRNA paired-end sequences were merged using Fast Length Adjustment of SHort reads (FLASH) software..sup.34 During this step, most reads overlapped perfectly by about 10-80 nucleotides, and less than 5% of the reads failed to combine. Uncombined reads were discarded from further analysis. Subsequently, Novobarcode command from Novocraft Technologies was used to demultiplex merged reads according to the 5 and 3 barcode sequences and trim the barcode sequence from the corresponding read. Reads with minimum quality score of 20 were selected for further analysis using fastq_quality_filter command line from the Fastx-toolkit V 0.0.13. Taxonomy assignment to the genus level was done using QIIME V 1.5.0 aligning against Greengenes database (release 4 Feb. 2011) using UCLUST Reference-based OTU picking method at 97% sequence identity. Butyrate producers were selected from the overall micobiota using the list of bacteria that produce butyrate through BCoAT pathway found in reference.sup.23. Since each bacteria has a different copy number of the 16S rRNA gene and only one copy of the BCoAT gene, the copy number of 16S rRNA was normalized to 1 by dividing the number of reads of a given genus by its average 16S rRNA copy number obtained from rrnDB..sup.35 The RA of identified butyrate producer genera was then calculated. Finally, correlation between BCoAT and 16S rRNA datasets was analyzed.
[0207] For phylogenetic analysis, full nucleotide sequences of BCoAT genes for the assigned butyrate producer species were obtained from the National Center for Biotechnology Information (NCBI's) Reference Sequence Database and MUSCLE aligned with the unclassified OTUs sequences. Then, a phylogenetic tree of aligned sequences was constructed using a maximum-likelihood algorithm with FastTree tool integrated into QIIME. Visual display of the rooted tree was achieved using Interactive Tree Of Life (iTOL) tool..sup.36 Using the same strategy, another phylogenetic tree was constructed from MUSCLE aligned unclassified OTU sequences and but nucleotide database sequences (a dataset of all predicted BCoAT gene sequences (4,041 sequences) obtained from the Functional Gene Pipeline/Repository..sup.26
[0208] Confirmation of BCoAT Sequencing Results Using qPCR.
[0209] 35 control, 37 CD and 19 UC mucosal aspirate samples were used to validate the sequencing result by qPCR. Primers specific to BCoAT gene of E. rectale and F. prausnitzii were used in the qPCR. In addition, primers targeting the 16S rRNA gene of Eubacterium rectale/Clostridium coccoides group (XIVa) (20-21), F. prausnitzii 22-23, and Roseburia 24-25 were used. For stool samples, 5 control and 10 CD subjects were used to determine the relative amount of F. prausnitzii using 16S rRNA specific primers only (table 10). The complete 16S rRNA gene was amplified using the universal primer UniF/UniR (18-19) adapted from reference.sup.37. Fifty ng of metagenomic DNA was used in a 25 l PCR reaction using QuantiTect SYBR Green PCR Master Mix (QIAGEN) as described in the previous section using 55 C. instead of 53 C. annealing temperature. The assay was done in duplicate for each sample. Delta-Ct (Ct) for each target was calculated by subtracting the Ct of the total 16S rRNA from the target Ct. Then, the Ct values were compared between groups.
TABLE-US-00010 TABLE10 Primer Target Name PrimerSequence Reference 16SrRNAgenefromall UniF 5-GTGSTGCAYGGYYGTCGTCA-3(SEQID ISMEJ2011;5:220- bacteria NO.34) 230 UniR 5-ACGTCRTCCMCNCCTTCCTC-3 (SEQID NO.35) Eubacteriumrectalel UniF338 5-ACTCCTACGGGAGGCAGC-3 (SEQID Infect.Immun.2008 Clostridiumcoccoides NO.36) group16SrRNAgene C.cocR491 5-GCTTCTTAGTCAGGTACCGTCAT-3 (SEQ IDNO.37) Faecalibacterium Fprau07 5-CCATGAATTGCCTTCAAAACTGTT-3 (SEQ FEMSMicrobiol.Ecol. prausnitzii IDNO.38) 2012;79:685-696 16SrRNAgene Fprau02 5-GAGCCTCAGCGTCAGTTGGT-3 (SEQID NO.39) Roseburiaspp.16S Ros-F1 5-GCGGTRCGGCAAGTCTGA-3 (SEQID FEMSMicrobiol.Ecol. rRNAgene NO.40) 2012;79:685-6964 Ros-R1 5-CCTCCGACACTCTAGTMCGAC-3 (SEQID NO.41) BCoATgenefromall BCoATscrF 5-GCIGAICATTTCACITGGAAYWSITGGCAYATG- Appl.Environ. bacteria 3 (SEQIDNO.42) Microbiol. BCoATscrR 5-CCTGCCTTTGCAATRTCIACRAANGC-3 2007;73:2009-2012. (SEQIDNO.43) Eubacteriumrectale RosEub_F 5-TCAAATCMGGIGACTGGGTWGA-3 (SEQ Microbiome2013,1:8 BCoATgene IDNO.44) Eub_R 5-TCATAACCGCCCATATGCCATGAG-3 (SEQ IDNO.45) Faecalibacterium Fprsn_F 5-GACAAGGGCCGTCAGGTCTA-3 (SEQID Microbiome2013,1:8. prausnitzii NO.46) BCoATgene Fprsn_R 5-GGACAGGCAGATRAAGCTCTTGC-3 (SEQ IDNO.47)
[0210] Statistical Analysis.
[0211] Unless otherwise specified, result from the qPCR and sequencing was analyzed using two-tailed Mann-Whitney test comparing IBD subtypes to the control group. A P value less than 0.05 was considered significant. Correlation between BCoAT and 16S rRNA sequencing was done by calculating Spearman's rank correlation coefficient (r) of paired RA of bacterial taxa identified by the two approaches.
[0212] Butyrate Producers are Reduced in UC Patients with Colonic Inflammation.
[0213] In order to determine the relative amount of butyrate producers, the copy number of BCoAT genes to 16S rRNA was assayed. The difference in the relative number of BCoAT genes between control subjects (2.1510.sup.42.4610.sup.4) and IBD subgroups (CD, 2.1710.sup.41.9710.sup.4; UC, 1.7410.sup.42.7810.sup.4) was not statistically significant (P>0.2) (
[0214] Diversity of Butyrate Producers is Different in IBD Patients Compared to Healthy Subjects.
[0215] A total of 670,287 high quality reads were generated from 43 samples (13 control, 20 CD, and 10 UC) with an average of 15,570 reads per sample (range, 44,158-2,938) and an average read length of 465 nucleotides (summarized in Table S4). Clustering reads at a 0.05 distance resulted in a total of 965 OTUs from all samples with a total OTU number of 714 for controls, 804 for CD, and 744 for UC. The majority of observed OTUs were shared between the three groups (486 OTUs), and only a few were unique to each individual group (
[0216] Furthermore, multidimensional scaling analysis of UniFrac metrics, presented by principal coordinates analysis (PCoA) plot, indicates that the IBD group is different than controls. Although no separation was observed with unweighted UniFrac (data not shown), PCoA showed good separation of CD and UC samples from control with weighted UniFrac. When clustering CD samples with controls, most control and CD subjects were grouped into two distinct clusters with 52.6% of the variance accounted for by coordinate 1 (PCoA1) and an additional 12.7% of variance attributable to PCoA2 (
[0217] Eubacterium Rectale is Depleted and Faecalibacterium prausnitzii Thrives in IBD Patients.
[0218] In order to take a more in depth look at butyrate producer diversity, we looked at the assigned bacterial taxa. Overall, OTUs from all samples were assigned to 12 classified bacterial species that belong to the Firmicutes phylum in addition to 67 unclassified OTUs (
a. Comparing the identified bacterial species RA of the control group to IBD patients (both CD or UC) revealed that the control group is characterized by a higher RA of E. rectale (P<0.05) (
b. In order to test the possibility that the unclassified OTUs could represent novel butyrate producers, the complete sequences of the BCoAT gene for the assigned bacterial species were MUSCLE aligned with the unclassified OTUs sequences. The aligned sequences were then used to construct a phylogeny tree using a maximum-likelihood algorithm. Twenty-five of the 67 unclassified OTUs were clustered with known butyrate producers. Among these, the unclassified OTUs 34 and 43, which were found to be deficient in IBD, clustered with E. rectale. Interestingly, 42 of the unclassified OTUs did not cluster with any of the assigned butyrate producers. In a second step, the sequences of unclassified OTUs were MUSCLE aligned with the but nucleotide database downloaded from the Functional Gene Pipeline/Repository. The but database contains all nucleotide sequences of probable BCoAT genes identified by Hidden Markov Model searches of the NCBI bacterial protein database. Subsequently the aligned sequences were subjected to phylogenetic tree construction. This time, only 4 of the 67 unclassified OTUs were clustered with classified bacteria. The remaining OTUs clustered only with partial BCoAT coding sequences isolated from human samples that belong to unclassified uncultured bacterium. Hence, this suggests that the 63 unclassified OTUs might belong to novel butyrate producers.
[0219] Diversity of Butyrate-Producing Bacteria Revealed by 16S rRNA Sequencing:
[0220] Analyzing the diversity of butyrate producing bacteria at the genus level using 16S rRNA sequencing reveals similar results to BCoAT sequencing with minor differences. In total, 10 genera of butyrate producers were identified with the 16S rRNA approach compared to 6 genera using a functional gene approach. The majority of reads were assigned to 4 genera: Eubacterium, Faecalibacterium, Roseburia, and Coprococcus (
[0221] Relative Quantification of Key Butyrate Producers Revealed by qPCR:
[0222] BCoAT sequencing results were further validated using qPCR utilizing BCoAT and 16S rRNA specific primers. Eubacterium rectale/Clostridium coccoides group (XIVa), which is dominated by E. rectale, was reduced in both CD subtypes compared to controls. On the other hand, the UC group had similar levels of group XIVa compared to the controls (
[0223] In order to investigate if sample type (stool versus mucosal aspirate) could affect the level of detected bacteria, stool collected from 5 control and 10 CD (6 with normal and 4 with inflamed colons, table S1) patients were subjected to qPCR using 16S rRNA specific primers to F. prausnitzii. Contrary to the mucosal aspirate finding, F. prausnitzii showed similar levels to the controls in both CD subtypes (
REFERENCES
[0224] 1 Cho, I. & Blaser, M. J. Nature reviews. Genetics 13, 260-270, doi:10.1038/nrg3182 (2012). [0225] 2 Manichanh, C., Borruel, N., Casellas, F. & Guarner, F. Nature reviews. Gastroenterology & hepatology 9, 599-608, doi:10.1038/nrgastro.2012.152 (2012). [0226] 3 Benchimol, E. I. et al. Gut 58, 1490-1497, doi:10.1136/gut.2009.188383 (2009). [0227] 4 Kostic, A. D. et al. Cell host & microbe 14, 207-215, doi:10.1016/j.chom.2013.07.007 (2013). [0228] 5 Rubinstein, M. R. et al. Cell host & microbe 14, 195-206, doi:10.1016/j.chom.2013.07.012 (2013). [0229] 6 Strauss, J. et al. Inflammatory bowel diseases 17, 1971-1978, doi:10.1002/ibd.21606 (2011). [0230] 7 Copeland, A. et al. Standards in genomic sciences 1, 166-173, doi:10.4056/sigs.29547 (2009). [0231] 8 Kazor, C. E. et al. Journal of clinical microbiology 41, 558-563 (2003). [0232] 9 Blachier, F. et al. Amino acids 39, 335-347, doi:10.1007/s00726-009-0445-2 (2010). [0233] 10 Linden, D. R. Antioxidants & redox signaling, doi:10.1089/ars.2013.5312 (2013). [0234] 11 Segata, N. et al. Metagenomic biomarker discovery and explanation. Genome biology 12, R60, doi:10.1186/gb-2011-12-6-r60 (2011). [0235] 12 Karrasch, T., Kim, J. S., Muhlbauer, M., Magness, S. T. & Jobin, C. Journal of immunology 178, 6522-6532 (2007). [0236] 13 Kim, S. C., Tonkonogy, S. L., Karrasch, T., Jobin, C. & Sartor, R. B. Inflammatory bowel diseases 13, 1457-1466, doi:10.1002/ibd.20246 (2007). [0237] 14 Levine, J., Ellis, C. J., Fume, J. K., Springfield, J. & Levitt, M. D. The American journal of gastroenterology 93, 83-87, doi:10.1111/j.1572-0241.1998.083_c.x (1998). [0238] 15 Kaiserling, E. Newly-formed lymph nodes in the submucosa in chronic inflammatory bowel disease. Lymphology 34, 22-29 (2001). [0239] 16 Mackay, F. et al. Both the lymphotoxin and tumor necrosis factor pathways are involved in experimental murine models of colitis. Gastroenterology 115, 1464-1475 (1998). [0240] 17 Salvador, J. A., Figueiredo, S. A., Pinto, R. M. & Silvestre, S. M. Future medicinal chemistry 4, 1495-1523, doi:10.4155/fmc.12.95 (2012). [0241] 18 Rajilic-Stojanovic, M. Clinical gastroenterology 27, 5-16, doi:10.1016/j.bpg.2013.03.006 (2013). [0242] 19 Ramasamy, S., Singh, S., Taniere, P., Langman, M. J. & Eggo, M. C. American journal of physiology. Gastrointestinal and liver physiology 291, G288-296, doi:10.1152/ajpgi.00324.2005 (2006). [0243] 20 Bar, F. et al. Gastroenterology 145, 1055-1063 e1053, doi:10.1053/j.gastro.2013.07.015 (2013). [0244] 21 Miller, T. W. et al. The Journal of biological chemistry 287, 4211-4221, doi:10.1074/jbc.M111.307819 (2012). [0245] 22 Smith, P. M. et al. Science 341, 569-573, doi:10.1126/science.1241165 (2013). [0246] 23 Caporaso, J. G. et al. Nature methods 7, 335-336, doi:10.1038/nmeth.f.303 (2010). [0247] 24 Sun, X., Threadgill, D. & Jobin, C. Gastroenterology 142, 86-95 e85, doi:10.1053/j.gastro.2011.09.042 (2012). [0248] 25 Lippert, E. et al. PloS one 4, e7413, doi:10.1371/journal.pone.0007413 (2009). [0249] 26 Vital M, Penton C R, Wang Q, et al. 2013; 1:1. [0250] 27 Louis P, Flint H J. Appl. Environ. Microbiol. 2007; 73:2009-2012. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1828812&tool=pmcentrez&rendertype=abstract [Accessed Nov. 11, 2013]. [0251] 28. Jimenez-Rivera C, Haas D, Boland M, et al. Gastroenterol Res Pr. 2009; 2009:1-4. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2796226&tool=pmcentrez&rendertype=abstract [Accessed Nov. 11, 2013]. [0252] 29. Louis P, Flint H J. FEMS Microbiol. Lett. 2009; 294:1-8. [0253] 30. Duncan S H, Louis P, Thomson J M, et al. Environ. Microbiol. 2009; 11:2112-2122. [0254] 31. Bourne D G, Muirhead A, Sato Y. ISME J 2011; 5:559-564. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=3105726&tool=pmcentrez&rendertype=abstract [Accessed Nov. 11, 2013]. [0255] 32. Cole J R, Wang Q, Cardenas E, et al. Nucleic Acids Res 2009; 37:D141-D145. [0256] 33. Caporaso J G, Kuczynski J, Stombaugh J, et al. Nat Methods 2010; 7:335-336. [0257] 34. Magoc T, Salzberg S L, Magoc T. Bioinformatics 2011; 27:2957-2963. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=3198573&tool=pmcentrez&rendertype=abstract [Accessed Nov. 11, 2013]. [0258] 35. Lee Z M-P, Bussema C, Schmidt T M. rrnDB: Nucleic Acids Res 2009; 37:D489-93. [0259] 36. Letunic I, Bork P. Interactive Tree Of Life (iTOL): Bioinformatics 2007; 23:127-128. Available at: http://www.ncbi.nlm.nih.gov/pubmed/17050570 [Accessed Dec. 13, 2013].