MELANOPHILIN ANTISENSE OLIGONUCLEOTIDES

Abstract

The present invention provides the peptide nucleic acid derivative which targets 3′ splice site of the human MLPH pre-mRNA “exon 2”. The peptide nucleic acid derivatives in the present invention strongly induce splice variants of the human MLPH mRNA in cell and are very useful to treat diseases or conditions of skin pigmentation associated with the human MLPH protein.

Claims

1. A peptide nucleic acid derivative represented by Formula I, or a pharmaceutically acceptable salt thereof: ##STR00006## wherein, n is an integer between 10 and 21; the compound of Formula I possesses at least a 10-mer complementary overlap with the 30-mer pre-mRNA sequence of [(5′.fwdarw.3′) CCUGUGACAUUCCAGGUGUGACCCCG-ACAA] in the human MLPH pre-mRNA the compound of Formula I is fully complementary to the human MLPH pre-mRNA, or partially complementary to the human MLPH pre-mRNA with one or two mismatches; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent hydrido, deuterido, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical; X and Y independently represent hydrido, deuterido, formyl, aminocarbonyl, aminothiocarbonyl, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylaminothiocarbonyl, substituted or non-substituted arylaminothiocarbonyl, substituted or non-substituted alkyloxythiocarbonyl, substituted or non-substituted aryloxythiocarbonyl, substituted or non-substituted alkylsulfonyl, substituted or non-substituted arylsulfonyl, substituted or non-substituted alkylphosphonyl, or substituted or non-substituted arylphosphonyl radical; Z represents hydrido, deuterido, hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted amino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; and, at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases with a substituted or non-substituted amino radical covalently linked to the nucleobase moiety.

2. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 10 and 21; the compound of Formula I possesses at least a 10-mer complementary overlap with the 30-mer pre-mRNA sequence of [(5′.fwdarw.3′) CCUGUGACAUUCCAGGUGUGACCCCG-ACAA] in the human MLPH pre-mRNA; the compound of Formula I is fully complementary to the human MLPH pre-mRNA, or partially complementary to the human MLPH pre-mRNA with one or two mismatches; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent hydrido, deuterido radical; X and Y independently represent hydrido, deuterido, formyl, aminocarbonyl, aminothiocarbonyl, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylaminothiocarbonyl, substituted or non-substituted arylaminothiocarbonyl, substituted or non-substituted alkyloxythiocarbonyl, substituted or non-substituted aryloxythiocarbonyl, substituted or non-substituted alkylsulfonyl, substituted or non-substituted arylsulfonyl, substituted or non-substituted alkylphosphonyl, or substituted or non-substituted arylphosphonyl radical; Z represents hydrido, hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, or substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV: ##STR00007## wherein, R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido and substituted or non-substituted alkyl radical; L.sub.1, L.sub.2 and L.sub.3 are a covalent linker represented by Formula V covalently linking the basic amino group to the nucleobase moiety: ##STR00008## wherein, Q.sub.1 and Q.sub.m are substituted or non-substituted methylene radical [—CH.sub.2—, —CH(substituent)-, —C(substituent).sub.2-], and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from substituted or non-substituted methylene, oxygen (—O—), sulfur (—S—), and substituted or non-substituted amino radical [—N(H)—, or —N(substituent)-]; and, m is an integer between 1 and 15.

3. The peptide nucleic acid derivative according to claim 2, or a pharmaceutical salt thereof: wherein, n is an integer between 11 and 19; the compound of Formula I possesses at least a 10-mer complementary overlap with the 30-mer pre-mRNA sequence of [(5′.fwdarw.3′) CCUGUGACAUUCCAGGUGUGACCCCG-ACAA] in the human MLPH pre-mRNA; the compound of Formula I is fully complementary to the human MLPH pre-mRNA; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X and Y independently represent hydrido, substituted or non-substituted alkylacyl, or substituted or non-substituted alkyloxycarbonyl radical; Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are hydrido radical; Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene and oxygen radical; and, m is an integer between 1 and 9.

4. The peptide nucleic acid derivative according to claim 3, or a pharmaceutical salt thereof: wherein, n is an integer between 11 and 19; the compound of Formula I possesses at least a 10-mer complementary overlap with the 30-mer pre-mRNA sequence of [(5′.fwdarw.3′) CCUGUGACAUUCCAGGUGUGACCCCG-ACAA] in the human MLPH pre-mRNA; the compound of Formula I is fully complementary to the human MLPH pre-mRNA; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X is hydrido radical; Y represents substituted or non-substituted alkyloxycarbonyl radical; Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; at least five of B.sub.1, B.sub.2,. . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are hydrido radical; L.sub.1 represents —(CH.sub.2).sub.2—O—(CH.sub.2).sub.2—, —CH.sub.2—O—(CH.sub.2).sub.2—, —CH.sub.2—O—(CH.sub.2).sub.3—, —CH.sub.2—O—(CH.sub.2).sub.4—, or —CH.sub.2—O—(CH.sub.2).sub.5—; and, L.sub.2 and L.sub.3 are independently selected from —(CH.sub.2).sub.2—O—(CH.sub.2).sub.2—, —(CH.sub.2).sub.3—O—(CH.sub.2).sub.2—, —(CH.sub.2).sub.2—O—(CH.sub.2).sub.3—, —(CH.sub.2).sub.2—, —(CH.sub.2).sub.3—, —(CH.sub.2).sub.4—, —(CH.sub.2).sub.5—, —(CH.sub.2).sub.6—, —(CH.sub.2).sub.7—, and —(CH.sub.2).sub.8—.

5. The peptide nucleic acid derivative according to claim 4, which is selected from the group of peptide nucleic acid derivatives provided below, or a pharmaceutically acceptable salt thereof: TABLE-US-00010 (N.fwdarw.C)Fethoc-GG(5)T-CA(6)C-A(6)C(1O2)C-TG(5)G-A(6)A- NH.sub.2; (N.fwdarw.C)Fethoc-C(1O2)GG(6)-GG(6)T-CA(5)C-A(5)C(1O2)C- TG(6)G-A(5)A-NH.sub.2; (N.fwdarw.C)Fethoc-GG(6)G-G(6)TC-A(5)CA(5)-C(1O2)CT- G(6)GA(5)-ATG(6)-NH.sub.2;  and (N.fwdarw.C)Fethoc-GG(6)T-CA(5)C-A(5)C(1O2)C-TG(6)G- A(5)AT-G(6)TC(1O2)-NH.sub.2 wherein, A, T, G and C are monomers of peptide nucleic acid with a natural nucleobase of adenine, thymine, guanine and cytosine, respectively; C(pOq), A(p), and G(p) are monomers of peptide nucleic acid with an unnatural nucleobase represented by Formula VI, Formula VII, and Formula VIII, respectively; ##STR00009## wherein, p and q are integers, p is 1, 5, or 6 and q is 2 in (N.fwdarw.C) Fethoc-GG(5)T-CA(6)C-A(6)C(1O2)C-TG(5)G-A(6)A-NH.sub.2; and, “Fethoc-” is the abbreviation for “[2-(9-fluorenyl)ethyl-1-oxy]carbonyl”.

6. A method to treat diseases or conditions associated with the human MLPH gene transcription, comprising the administration of the peptide nucleic acid derivative according to claim 1, or a pharmaceutically acceptable salt thereof to a subject.

7. A method to treat skin pigmentation, comprising the administration of the peptide nucleic acid derivative according to claim 1, or a pharmaceutically acceptable salt thereof to a subject.

8. A pharmaceutical composition for treating diseases or conditions associated with human MLPH gene transcription, comprising the peptide nucleic acid derivative according to claim 1, or a pharmaceutically acceptable salt thereof.

9. A cosmetic composition for treating diseases or conditions associated with human MLPH gene transcription, comprising the peptide nucleic acid derivative according to claim 1, or a pharmaceutically acceptable salt thereof.

10. A pharmaceutical composition for treating skin pigmentation, comprising the peptide nucleic acid derivative according to claim 1, or a pharmaceutically acceptable salt thereof.

11. A cosmetic composition for treating skin pigmentation, comprising the peptide nucleic acid derivative according to claim 1, or a pharmaceutically acceptable salt thereof.

Description

BRIEF EXPLANATION OF DRAWINGS

[0118] FIG. 1a. Illustration of the pre-mRNA structure.

[0119] FIG. 1b. Schematic illustration of splicing process for intron N removal.

[0120] FIG. 1c. Schematic illustration of 3′ splice site and 5′ splice site in spliceosome E complex.

[0121] FIG. 2a. Chemical structures for DNA and representative unnatural oligonucleotides.

[0122] FIG. 2b. The chemical structure and abbreviated nomenclature of prototype PNA.

[0123] FIG. 2c. Modified nucleobases developed to improve the membrane permeability of PNA.

[0124] FIGS. 3a-3c. Examples of natural or unnatural (modified) nucleobases selectable for the peptide nucleic acid derivative of Formula I.

[0125] FIG. 4a. Examples of substituents selectable for the peptide nucleic acid derivative of Formula I, substituted or non-substituted alkyls.

[0126] FIG. 4b. Examples of substituents selectable for the peptide nucleic acid derivative of Formula I, substituted or non-substituted alkylacyls, and substituted or non-substituted arylacyls.

[0127] FIG. 4c. Examples of substituents selectable for the peptide nucleic acid derivative of Formula I, substituted alkylaminos, substituted arylaminos, substituted or non-substituted aryls, substituted or non-substituted alkylsulfonyls, substituted or non-substituted arylsulfonyls, substituted or non-substituted alkylphosphonyls, and substituted or non-substituted arylsulfonyls.

[0128] FIG. 4d. Examples of substituents selectable for the peptide nucleic acid derivative of Formula I, substituted or non-substituted alkyloxycarbonyls and substituted or non-substituted aryloxycarbonyls, substituted or non-substituted alkylaminocarbonyls, and substituted or non-substituted arylaminocarbonyls.

[0129] FIG. 4e. Examples of substituents selectable for the peptide nucleic acid derivative of Formula I, substituted or non-substituted alkyloxythiocarbonyls and substituted or non-substituted alkylaminothiocarbonyls, substituted or non-substituted arylaminothiocarbonyls, and substituted or non-substituted aryoxythiocarbonyls.

[0130] FIG. 5. Chemical structures of abbreviated PNA monomers, A, G, T, C, C(pOq), A(p), A(pOq), G(p), and G(pOq).

[0131] FIG. 6. Chemical structure of abbreviated 14-mer “(N.fwdarw.C) Fethoc-GG(5)T-CA(6)C-A(6)C(1O2)C-TG(5)G-A(6)A-NH.sub.2”.

[0132] FIG. 7. Chemical structures of Fmoc-PNA monomers used to synthesize the PNA derivatives of this invention.

[0133] FIG. 8. Schematic illustration of a typical monomer elongation cycle adopted in SPPS of this invention.

[0134] FIG. 9a. C.sub.18-reverse phase HPLC chromatogram for “ASO 2” before HPLC purification.

[0135] FIG. 9b. C.sub.18-reverse phase HPLC chromatogram for “ASO 2” after HPLC purification.

[0136] FIG. 10. ES-TOF mass spectral data obtained with “ASO 2” after HPLC purification.

[0137] FIG. 11a-11d. Real-time qPCR data in melanoma melan-a treated with “ASO 2”, “ASO 3”, “ASO 4”, and “ASO 5”.

[0138] FIG. 12a-12c. Electrophoretic analysis data in melanoma melan-a treated with “ASO 3”, “ASO 4”, and “ASO 5”.

[0139] FIG. 13a-13d. Western blot data in melanoma melan-a treated with “ASO 2”, “ASO 3”, “ASO 4”, and “ASO 5”.

[0140] FIG. 14a. Microscope digital images for the evaluation of melanosome aggregation levels in melanoma melan-a treated with siRNA and ASOs.

[0141] FIG. 14b. Quantified melanosome aggregation levels.

[0142] FIG. 15. Real-time qPCR data in human melanocytes treated with “ASO 1”.

[0143] FIG. 16. Western blot data in human melanocytes treated with “ASO 1”.

[0144] FIG. 17. Microscope digital images for the evaluation of melanosome aggregation levels and relative melanosome aggregation level in human melanocytes treated with “ASO 1”.

[0145] FIG. 18. Relative survival rates in human melanocytes treated with “ASO 1”.

BEST MODE FOR CARRYING OUT THE INVENTION

General Procedures for Preparation of PNA Oligomers

[0146] PNA monomers with a modified nucleobase were synthesized as described in the prior art [PCT/KR 2009/001256] or with minor modifications. Chemical structures of Fmoc-PNA monomers used to synthesize the PNA derivatives of this invention are provided in FIG. 7. Fmoc-PNA [Fmoc={(9-fluorenyl)methoxy}carbonyl] monomers in FIG. 7 should be taken as examples, and therefore should not be taken to limit the scope of the present invention. Such Fmoc-PNA monomers with a modified nucleobase and Fmoc-PNA monomers with a naturally occurring nucleobase were used to synthesize the PNA oligomers by solid phase peptide synthesis (SPPS) as provided in FIG. 8 based on Fmoc-chemistry according to the method disclosed in the prior art [U.S. Pat. No. 6,133,444; WO96/40685] with minor but due modifications. The solid support employed in this study was H-Rink Amide-ChemMatrix resin purchased from PCAS BioMatrix Inc. (Quebec, Canada). PNA oligomers were purified by C.sub.18-reverse phase HPLC (water/acetonitrile or water/methanol with 0.1% TFA) and characterized by mass spectrometry including ESI/TOF/MS. FIGS. 9a and 9b are exemplary HPLC chromatograms for “ASO 2” before and after HPLC purification, respectively. FIG. 10 is ESI/TOF/MS spectrum of “ASO 2” after HPLC purification, which should be taken as examples for oligomers, and therefore should not be taken to limit the scope of the present invention.

[0147] FIG. 8 illustrates a typical monomer elongation cycle adopted in the SPPS of this invention, and each reaction step is briefly provided as follows. [Activation of H-Rink-ChemMatrix Resin] When the amine on the resin was not protected with Fmoc, 0.01 mmol (ca 20 mg resin) of the ChemMatrix resin in 1.5 mL 20% piperidine/DMF was vortexed in a libra tube for 20 min, and the DeFmoc solution was filtered off. The resin was washed for 30 sec each in series with 1.5 mL methylene chloride (MC), 1.5 mL dimethylformamide (DMF), 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC. The resulting free amines on the solid support were subjected to coupling either with an Fmoc-PNA monomer.

[0148] [DeFmoc] When the amine on the resin was protected with Fmoc, the suspension of 0.01 mmol (ca 20 mg) of the resin in 1.5 mL 20% piperidine/DMF was vortexed for 7 min, and the DeFmoc solution was filtered off. The resin was washed for 30 sec each in series with 1.5 mL MC, 1.5 mL DMF, 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC. The resulting free amines on the solid support were immediately subjected to coupling with an Fmoc-PNA monomer.

[0149] [Coupling with Fmoc-PNA Monomer] The free amines on the solid support were coupled with an Fmoc-PNA monomer as follows. 0.04 mmol of PNA monomer, 0.05 mmol HBTU, and 0.1 mmol DIEA were incubated for 2 min in 1 mL anhydrous DMF, and added to the resin with free amines. The resin solution was vortexed for 1 hour and the reaction medium was filtered off. Then the resin was washed for 30 sec each in series with 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC.

[0150] [Capping] Following the coupling reaction, the unreacted free amines were capped by shaking for 5 min in 1.5 mL capping solution (5% acetic anhydride and 6% 2,6-leutidine in DMF). Then the capping solution was filtered off and washed for 30 sec each in series with 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC.

[0151] [Introduction of “Fethoc-” Radical in N-Terminus] “Fethoc-” radical was introduced to the N-terminus by reacting the free amine on the resin with “Fethoc-OSu” by the following method. The suspension of the resin in the solution of 0.1 mmol of Fethoc-OSu and 0.1 mmol

[0152] DIEA in 1 mL anhydrous DMF was vortexed for 1 hr, and the solution was filtered off. The resin was washed for 30 sec each in series with 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC. The chemical structure of “Fethoc-OSu” [CAS No. 179337-69-0, C.sub.20H.sub.17NO.sub.5, MW 351.36] used in the present invention is provided as follows.

##STR00005##

[0153] [Cleavage from Resin] PNA oligomers bound to the resin were cleaved from the resin by shaking for 3 hours in 1.5 mL cleavage solution (2.5% tri-isopropylsilane and 2.5% water in trifluoroacetic acid). The resin was filtered off and the filtrate was concentrated under reduced pressure. The resulting residue was triturated with diethyl ether and the resulting precipitate was collected by filtration for purification by reverse phase HPLC.

[0154] [HPLC Analysis and Purification] Following a cleavage from resin, the crude product of a PNA derivative was purified by C.sub.18-reverse phase HPLC eluting water/acetonitrile or water/methanol (gradient method) containing 0.1% TFA. FIGS. 9a and 9b are exemplary HPLC chromatograms for “ASO 2” before and after HPLC purification, respectively.

Synthetic Examples for PNA Derivative of Formula I

[0155] In order to complementarily target the 3′ splice site of “exon 2” in the human MLPH pre-mRNA, PNA derivatives of this invention were prepared according to the synthetic procedures provided above or with minor modifications. Provision of such PNA derivatives targeting the human MLPH pre-mRNA is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention.

TABLE-US-00003 TABLE 1 PNA derivatives complementarily targeting the 3′ splice site of  “exon 2” in the human MLPH pre-mRNA along with structural  characterization data by mass spectrometry. PNA Exact Mass, m/z Example PNA Sequence (N.fwdarw.C) theor..sup.a obs..sup.b ASO 1 Fethoc-GG(5)T-CA(6)C-A(6)C(1O2)C-TG(5)G-A(6)A- 4664.183 4664.193 NH.sub.2 ASO 6 Fethoc-C(1O2)GG(6)-GG(6)T-CA(5)C-A(5)C(1O2)C- 5679.643 5679.673 TG(6)G-A(5)A-NH.sub.2 ASO 7 Fethoc-GG(6)G-G(6)TC-A(5)CA(5)-C(1O2)CT- 5987.803 5987.870 G(6)GA(5)-ATG(6)-NH.sub.2 ASO 8 Fethoc-GG(6)T-CA(5)C-A(5)C(1O2)C-TG(6)G- 5920.738 5920.798 A(5)AT-G(6)TC(1O2)-NH.sub.2 .sup.atheoretical exact mass, .sup.bobserved exact mass

[0156] Table 1 provides PNA derivatives complementarily targeting the 3′ splice site of “exon 2” in the human MLPH pre-mRNA read out from the human MLPH gene [NCBI Reference Sequence: NG_007286] along with structural characterization data by mass spectrometry. Provision of the peptide nucleic acid derivatives of the present invention in Table 1 is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention.

[0157] “ASO 1” has a 14-mer complementary overlap with the 14-mer sequence marked “bold” and “underlined” within the 30-mer RNA sequence of

TABLE-US-00004 [(5′ .fwdarw. 3′) ccugugacauuccag | GUGUGACCCCGACAA]
spanning the junction of “intron 1” and “exon 2” in the human MLPH pre-mRNA. Thus “ASO 1” possesses a 6-mer overlap with “intron 1” and an 8-mer overlap with “exon 2” within the human MLPH pre-mRNA.

Synthetic Examples for PNA Derivatives Complementarily Targeting the Mouse MLPH pre-mRNA

[0158] In order to facilitate the efficacy evaluation with readily available melan-a from mice, PNA derivatives of this invention complementarily targeting the 3′ splice site spanning the junction of “intron 1” and “exon 2” in the mouse MLPH pre-mRNA read out from the mouse MLPH gene [NCBI Reference Sequence: NC_000067] were prepared. The 30-mer sequence of [(5′.fwdarw.3′) CCUGUGACUUUCUAGGUGUGGCCUGGAUGA] spans 3′ splice site of 15-mer “intron 1” and 15-mer “exon 2” in the mouse MLPH pre-mRNA. Thus the 30-mer pre-mRNA sequence may be conventionally denoted as [(5′.fwdarw.3′) ccugugacuuucuag|GUGUGGCCUGGAUGA], wherein the intron and exon sequence are provided as “small” and “capital” letters, respectively, and the junction “intron 1” and “exon 2” is expressed with “|”.

[0159] Provision of such PNA derivatives targeting the mouse MLPH pre-mRNA is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention.

TABLE-US-00005 TABLE 2 PNA derivatives complementarily targeting the 3′ splice site of “exon 2” in the mouse MLPH pre-mRNA along with structural characterization data by mass spectrometry. PNA Exact Mass, m/z Example PNA Sequence (N.fwdarw.C) theor..sup.a obs..sup.b ASO 2 Fethoc-GG(5)C-CA(6)C-A(6)C(1O2)C-TA(6)G-A(6)A- 4662.215 4662.225 NH.sub.2 ASO 3 Fethoc-C(12)CA(5)-GG(6)C-CA(5)C-A(5)C(1O2)C- 5594.637 5594.510 TA(5)G-A(5)A-NH.sub.2 ASO 4 Fethoc-GG(6)C-CA(5)C-A(5)C(1O2)C-TA(5)G- 5900.745 5900.555 A(5)AA(5)-GTC(1O2)-NH.sub.2 ASO 5 Fethoc-CA(5)G-G(6)CC-A(5)CA(5)-C(1O2)CT- 5902.819 5912.324 A(5)GA(5)-AA(5)G-NH.sub.2 .sup.atheoretical exact mass, .sup.bobserved exact mass

[0160] Table 2 provides PNA derivatives complementarily targeting the 3′ splice site of “exon 2” in the mouse MLPH pre-mRNA read out from the mouse MLPH gene along with structural characterization data by mass spectrometry. Provision of the peptide nucleic acid derivatives of the present invention in Table 2 is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention.

[0161] “ASO 3” has a 17-mer complementary overlap with the sequence marked “bold” and “underlined” within the following RNA sequence of

TABLE-US-00006 [(5′ .fwdarw. 3′)  ccugugacuuucuag | GUGUGGCCUGGAUGA]
spanning the junction of “intron 1” and “exon 2” in the mouse MLPH pre-mRNA. Thus “ASO 3” possesses a 6-mer overlap with “intron 1” and an 11-mer overlap with “exon 2” within the mouse MLPH pre-mRNA.

Binding Affinity of “ASO” for Complementary DNA

[0162] The PNA derivatives of Formula I were evaluated for their binding affinity for 10-mer DNAs complementarily targeting either the N-terminal or C-terminal. The binding affinity was assessed by T.sub.m value for the duplex between PNA and 10-mer complementary DNA. The duplex between PNA derivatives and fully complementary DNAs show T.sub.m values too high to be reliably determined in aqueous buffer solution, since the buffer solution tends to boil during the T.sub.m measurement. T.sub.m values for full length PNAs can be predicted and compared based on the T.sub.m value for the duplex between PNA and 10-mer complementary DNA.

[0163] T.sub.m values were determined on a UV/Vis spectrometer as follows. A mixed solution of 320 μL, of 50 μM PNA oligomer, 320 μL of 50 μM complementary 10-mer DNA, and 3.36 mL of aqueous buffer (pH 7.16, 10 mM sodium phosphate, 100 mM NaCl) in 15 mL polypropylene falcon tube was incubated at 90° C. for a few minute and slowly cooled down to ambient temperature. Then the solution was transferred into a 3 mL quartz UV cuvette equipped with an air-tight cap, and the cuvette was mounted on an Agilent 8453 UV/Visible spectrophotometer. The absorbance changes at 260 nm were recorded with increasing the temperature of the cuvette by either 0.5 or 1° C. per minute. From the absorbance vs temperature curve, the temperature showing the largest increase rate in absorbance was read out as the T.sub.m between PNA and 10-mer DNA. The DNAs for T.sub.m measurement were purchased from Bioneer (www.bioneer.com, Dajeon, Republic of Korea) and used without further purification.

[0164] Observed T.sub.m values of the PNA derivatives of Formula I are very high and the result is provided in Table 3.

TABLE-US-00007 TABLE 3 T.sub.m values between PNAs and 10-mer complementary DNA targeting either the N-terminal or the C-terminal of PNA. T.sub.m Value, ° C. PNA 10-mer DNA against 10-mer DNA against Example N-Terminal C-Terminal ASO 1 81.02 90.37 ASO 6 76.07 86.47 ASO 7 85.47 77.22 ASO 8 83.52 73.12

[0165] For example, “ASO 1” showed a T.sub.m value of 81.02° C. for the duplex with the 10-mer complementary DNA targeting the N-terminal 10-mer in the PNA as marked “bold” and “underlined” in

TABLE-US-00008 [(N .fwdarw. C)Fethoc-GG(5)T-CA(6)C-A(6)C(1O2)C-TG(5)G- A(6)A-NH.sub.2].
In the meantime, “ASO 1” showed a T.sub.m of 90.37° C. for the duplex with the 10-mer complementary DNA targeting the C-terminal 10-mer in the PNA as marked “bold” and “underlined” in

TABLE-US-00009 [(N .fwdarw. C)GG(5)T-CA(6)C-A(6)C(1O2)C-TG(5)G-A(6)A-NH.sub.2].

EXAMPLES FOR BIOLOGICAL ACTIVITIES OF PNA DERIVATIVES OF FORMULA I

[0166] PNA derivatives in this invention were evaluated for in vitro MLPH antisense activities in mouse melanoma melan-a and human melanocyte by use of real-time quantitative polymerase chain reaction (RT-qPCR) and so on. The biological examples were provided as examples to illustrate the biological profiles of the PNA derivatives of Formula I, and therefore should not be interpreted to limit the scope of the current invention.

Example 1. Effects of ASOs on MLPH Expression in Mouse Melanoma Melan-a

[0167] “ASO 2”, “ASO 3”, “ASO 4”, and “ASO 5” were evaluated for their ability to affect MLPH expression in mouse melanoma melan-a as described below.

[0168] [Cell Culture & ASO Treatment] Mouse melanoma melan-a were grown in RPMI 1640 (GIBCO, Cat. No.11875-093) supplemented with 10% FBS (Fetal Bovine Serum) (Cat. No. 10099-41, GIBCO), 1% streptomycin/penicillin (Cat. No. 15140-122, GIBCO), and 200 nM TPA (Sigma, Cat. No. 79346) under 5% CO.sub.2 atmosphere at 37° C. Mouse melanoma melan-a (2×10.sup.5) were grown in 60 mm culture dish for 24 hours for stabilization, and were treated either with nothing (negative control) or with “ASO 2”, “ASO 3”, “ASO 4”, or “ASO 5” for 48 hours at 100 zM, 10 aM, 1 fM, or 1 μM.

[0169] [RNA Extraction & cDNA synthesis] Total RNA was extracted using RNeasy Mini kit (Qiagen, Cat. No. 714106) according to the manufacturer's instructions from ASOs treated cells and cDNA was prepared from 500 ng of RNA by use of PrimeScript™ 1.sup.st strand cDNA Synthesis kit (Takara, Cat. No. 6110A). To a mixture of 500 ng of RNA, 1 microliter of random hexamer, and 1 microliter of dNTP (10 mM) in PCR tube was added DEPC-treated water to a total volume of 10 microliter, which was reacted at 65° C. for 5 minutes. cDNA was synthesized by adding 10 microliter of PrimeScript RTase reaction mixture and reacting at 30° C. for 10 minutes and at 42° C. for 60 minutes, successively.

[0170] [Real-Time qPCR] In order to evaluate the expression level of mouse MLPH mRNA real-time qPCR was performed with synthesized cDNA by use of Taqman probe. The mixture of cDNA, Taqman probe (Thermo, Cat. No. Mm00453498_m1), IQ supermix (BioRad, Cat. No. 170-8862) and nuclease free water in PCR tube was under reaction by use of CFX96 Touch Real-Time system (BioRad) according to the cycle conditions specified as follows: at 95° C. for 3 min followed by 40 cycles of 10 sec at 95° C. and 30 sec at 60° C. Fluorescence intensity was measured at the end of every cycle and the result of PCR was evaluated by the melting curve. After the threshold cycle (Ct) of each gene was standardized by that of GAPDH, the relative expression level of mouse MLPH mRNA was compared and analyzed.

[0171] FIG. 11a, FIG. 11b, FIG. 11c, and FIG. 11d provide the relative expression levels of mouse MLPH mRNA in “ASO 2”, “ASO 3”, “ASO 4”, and “ASO 5” treated cells, respectively. The relative expression levels of mouse MLPH mRNA in “ASO 3”, “ASO 4”, and “ASO 5” (not “ASO 2”) treated cells were reduced in a dose dependent manner. (Student T-test was done to check the statistical significance of the findings)

[0172] [Exon Skipping] In order to evaluate the exon skipping level of mouse MLPH mRNA standard PCR was performed with synthesized cDNA by use of PCR PreMix (Bioneer, Cat. No. K-2612, South Korea) against a set of primers of [forward: (5′.fwdarw.3′) TAG CTC AGT GCA CCC TGA CA; and reverse: (5′.fwdarw.3′) GAG AGA CCG GAT CAC TTT GG] according to the following cycle conditions: 95° C. for 5 min followed by 25 cycles of 1 min at 95° C. , 1 min at 59° C., 2 min at 72° C., and an additional 3 min at 72° C.

[0173] The PCR products (10 microliter) were subjected to electrophoretic separation on a 2% agarose gel. The target bands were collected and analyzed by Sanger Sequencing to evaluate exon skipping sequence.

[0174] FIG. 12a, FIG. 12b, and FIG. 12c provide the results of electrophoretic separation in “ASO 3”, “ASO 4”, and “ASO 5” treated cells, respectively. While the cells treated with “ASO 4” did not yield the exon skipping band and the cells treated with 1 μM “ASO 5” faintly yielded the exon 2 skipping band, the cells treated with 1 μM “ASO 3” yielded the exon 2 skipping band only instead of full length MLPH mRNA band. Thus “ASO 3” targets MLPH pre-mRNA at 3′ splice site and yields exon 2 skipped splice variant MLPH mRNA at 1 μM.

[0175] [Western Blotting] Cells were grown as above. After 48 hours from being treated with each ASOs, the cells were collected, and then washed 2 times with cold PBS (phosphate buffered saline) and dissolved in RIPA buffer (Cell Signaling, Cat. No. 9806). The protein was quantified with BCA solution (Thermo, Cat. No. 23225) and purified by 10% SDS-PAGE Gel. The protein was transferred on PVDF membrane (polyvinylidene fluoride membrane) (Millipore, Cat. No. IPVH00010), which was blocked in 5% skim milk buffer solution for 1 hour. The membrane was probed with an anti-MLPH (Proteintech, Cat. No. 10338-1AP) and anti-β-actin (Sigma, Cat. No. A3854) as a primary antibody, and goat anti-rabbit (CST, Cat. No. 7074) was used as a secondary antibody. HRP substrate (Millipore, Cat. No. WBKLS0500) was utilized for the detection of chemiluminescent signal and the signal intensity was measured by using Gel Doc system (ATTO). Based on Western blotting results of each bands, the relative expression levels of MLPH were quantified with Image-J program and converted to graph.

[0176] FIG. 13a, FIG. 13b, FIG. 13c, and FIG. 13d provide the relative expression levels of mouse MLPH protein in “ASO 2”, “ASO 3”, “ASO 4”, and “ASO 5” treated cells, respectively. Overall in ASO treated cells the relative expression levels of mouse MLPH protein were reduced and especially in “ASO 3” treated cells the levels were reduced in a dose dependent manner. (Student T-test was done to check the statistical significance of the findings)

[0177] [Melanosome Aggregation] Cells were grown as above. In order to evaluate the degree of melanosome aggregation melanophilin siRNA was used as a positive control. Melanophilin siRNA was purchased from Bioneer in Daejeon of South Korea, which has a sense sequence of (5′.fwdarw.3′) GGGCAAAAUACAAAAGGAG and an antisense sequence of (5′.fwdarw.3′) 5′-CUCCUUUUGUAUUUUGCCC-3′. Melanoma melan-a was grown in 60 mm culture dish for 24 hours and the medium was changed to 3 mL of Opti-MEM (Gibco, Cat. No. 31985-070). To a mixture of 500 μL of Opti-MEM and 5 μL of lipofectamin2000 (Invitrogen, Cat.No.11668-019) in 1.5 mL eppendorf tube was added 3 mL of 10 μM siRNA stock solution (final concentration of siRNA: 10 nM). After 15 min, the resulting solution was added to culture dish in 3 mL of Opti-MEM and cultured at 37° C. for 6 hours, to which new culture medium was applied.

[0178] On 24 or 48 hours after treatment of siRNA or ASOs, in order to evaluate the degree of melanosome aggregation the cells were photographed with bright-field microscope in two orders of magnitude. FIG. 14a provides microscope digital image for negative control, siRNA treated cell, and ASO treated cell to evaluate the degree of melanosome aggregation and FIG. 14b provides the number of melanosome aggregated cells.

[0179] As can be seen in FIGS. 14a and 14b, cells treated with siRNA or ASOs for 24 or 48 hours yielded more melanosome aggregation compared to the negative control, which can be interpreted that melanophilin siRNA or ASOs inhibited the expression of MLPH proteins and to suppress the melanosome transport and enhance the aggregation of melanosome. Thus melanophilin siRNA or ASOs is expected to inhibit skin pigmentation by suppressing the melanosome transport.

Example 2. Effects of ASOs on MLPH Expression in Human Melanocyte

[0180] “ASO 1” was evaluated for their ability to affect MLPH expression in human melanocyte as described below.

[0181] [Cell Culture & ASO Treatment] Human melanocyte (Lonza, Cat. No. CC-2586) were grown in melanocyte dedicated medium (Lonza, Cat. No. CC-3249) supplemented with 1% streptomycin/penicillin (GIBCO, Cat. No. 15140-122) under 5% CO.sub.2 atmosphere at 37° C. Human melanocyte (3×10.sup.5) were grown in 60 mm culture dish for 24 hours for stabilization, and were treated either with nothing (negative control) or with “ASO 1” for 24 or 48 hours at 1 μM.

[0182] [RNA Extraction & cDNA synthesis] Total RNA was extracted from the cells treated with “ASO 1” using RNeasy Mini kit (Qiagen, Cat. No. 714106) according to the manufacturer's instructions. cDNA was prepared from 500 ng of RNA by use of PrimeScript™ 1.sup.st strand cDNA Synthesis kit (Takara, Cat. No. 6110A). To a mixture of 500 ng of RNA, 1 microliter of random hexamer, and 1 microliter of dNTP (10 mM) in PCR tube was added DEPC-treated water to a total volume of 10 microliter, which was reacted at 65° C. for 5 minutes. cDNA was synthesized by adding 10 microliter of PrimeScript RTase reaction mixture and reacting at 30° C. for 10 minutes and at 42° C. for 60 minutes, successively.

[0183] [Real-Time qPCR] In order to evaluate the expression level of human MLPH mRNA real-time qPCR was performed with synthesized cDNA by use of Taqman probe. The mixture of cDNA, Taqman probe (Thermo, Cat. No. Hs00983107_m1), IQ supermix (BioRad, Cat. No. 170-8862) and nuclease free water in PCR tube was under reaction by use of CFX96 Touch Real-Time system (BioRad) according to the cycle conditions specified as follows: at 95° C. for 3 min followed by 40 cycles of 10 sec at 95° C. and 30 sec at 60° C. . Fluorescence intensity was measured at the end of every cycle and the result of PCR was evaluated by the melting curve.

[0184] After the threshold cycle (Ct) of each gene was standardized by that of GAPDH, the relative expression level of human MLPH mRNA was compared and analyzed.

[0185] FIG. 15 provides the relative expression level of human MLPH mRNA in “ASO 1” treated cells and the level in 1μM of “ASO 1” treated cells for 48 hours was reduced. (Student T-test was done to check the statistical significance of the findings)

[0186] [Western Blotting] Cells were grown as above. After 24 and 48 hours from being treated with “ASO 1”, the cells were collected respectively, and then washed 2 times with cold PBS (phosphate buffered saline) and dissolved in RIPA buffer (Cell Signaling, Cat. No.9806). The protein was quantified with BCA solution (Thermo, Cat. No. 23225) and purified by 10% SDS-PAGE Gel. The protein was transferred on PVDF membrane (polyvinylidene fluoride membrane) (Millipore, Cat. No. IPVH00010), which was blocked in 5% skim milk buffer solution for 1 hour. The membrane was probed with an anti-MLPH (Novus, Cat. No. NBP2-45883) and anti-I3-actin (Sigma, Cat. No. A3854) as a primary antibody, and horse anti-rabbit (CST, Cat. No. 7076) was used as a secondary antibody. HRP substrate (Millipore, Cat. No. WBKLS0500) was utilized for the detection of chemiluminescent signal and the signal intensity was measured by using Gel Doc system (ATTO). Based on Western blotting results of each bands, the relative expression levels of MLPH were quantified with Image-J program and converted to the graph.

[0187] FIG. 16 provides the relative expression levels of human MLPH protein and the level in 1 μM of “ASO 1” treated cells for 48 hours was reduced. (Student T-test was done to check the statistical significance of the findings)

[0188] [Immunofluorescence Stainin g] Cells were grown as above and 48 hours after “ASO 1” treatment collected cells were fixed with 4% formaldehyde, which was blocked in 1% bovine serum albumin for an hour after permeabilization with 0.25% TritonX-100. The samples were immunostained in series with anti-tubulin (abcam, Cat. No. ab44928) and anti-Trp1 (Novus, Cat. No. NBP2-53252) as a primary antibody, and with FITC attached rabbit anti-mouse (Jackson ImmunoResearch, Cat. No.315-095-003) and Fluor 594 attached goat anti-rabbit (Jackson ImmunoResearch, Cat. No. 111-585-144) as a secondary antibody. Counter staining was performed by use of DAPI (Thermo Fisher, Cat. No. 62248) and the fluorescence digital image was evaluated with Axio Scan Z1 (Carl Zeiss) in two orders of magnitude. The ratio of the number of cells stained in red color with Trp1 near the nucleus to the number of total cells was converted to the graph.

[0189] FIG. 17 provides the degree of melanosome aggregation in “ASO 1” treated cells through red color staining of Trp1. In 1 μM of “ASO 1” treated cells for 48 hours red color staining of Trp1 near DAPI stained nucleus compared to cytoskeleton tubulin suggested the melanosome aggregation by the suppression of melanosome movement. (Student T-test was done to check the statistical significance of the findings)

[0190] [Water soluble Chloro Tetrazolium-1] Cells were grown as above and water soluble chloro tetrazolium-1 assay was performed for human melanocytes (1x10.sup.3) grown in 96 well. After 24, 48, and 72 hours of 1 fM, 1 pM, 1 nM, 1 μM, and 10 μM “ASO 1” treatment, EZ-CYTOX (DoGen, Cat. No. EZ-3000) at the amount of one-tenth culture medium were added to the cells in 96 well and the resulting mixture was reacted in the incubator for 2 hours. After homogenization by shaking 1 minute at room temperature, the relative absorbance at 450 nm were measured and converted to the graph.

[0191] FIG. 18 provides the survival rates of “ASO 1” treated cells. After 24, 48, and 72 hours of 1 fM, 1 pM, 1 nM, 1 μM, and 10 μM “ASO 1” treatment, the survival rates of “ASO 1” treated cells were higher than 90% in every concentration after 72 hours.