Maize cytoplasmic male sterility (CMS) C-type restorer RF4 gene, molecular markers and their use
10117411 ยท 2018-11-06
Assignee
Inventors
- Ruihua Ren (Westfield, IN, US)
- Bruce A. Nagel (Beaver Dam, WI, US)
- Siva P. Kumpatla (Carmel, IN)
- Peizhong Zheng (Westfield, IN, US)
- Gary L. Cutter (Normal, IL, US)
- Thomas W. Greene (West Des Moines, IA, US)
- Steven A. Thompson (Carmel, IN, US)
Cpc classification
International classification
A01H6/46
HUMAN NECESSITIES
C12N15/82
CHEMISTRY; METALLURGY
Abstract
This disclosure concerns high-resolution mapping and candidate gene cloning of Rf4, a maize restorer of fertility gene that restores fertility to C-type cytoplasmic male sterility. The disclosure also relates to molecular markers that are tightly-linked to, or reside within, the Rf4 gene. In some embodiments, methods are provided whereby hybrid seeds may be produced from crosses of a male plant comprising nucleic acid molecular markers that are linked to or that reside within the Rf4 gene and a female plant carrying C-type CMS.
Claims
1. A maize plant comprising an Rf4 functional restorer gene for maize C-type cytoplasmic male sterility from restorer line XJH58, wherein the plant comprises a marker nucleotide sequence selected from the group consisting of Marker ID Nos. 1-50: TABLE-US-00005 B73 Chrom. 8 Position Marker ID No. Start Stop Marker 1 8885 8885 C 2 11684 11684 G 3 11883 11883 C 4 12831 12831 C 5 13168 13168 A 6 13171 13171 C 7 13179 13179 T 8 13191 13191 G 9 14191 14191 A 10 15309 15309 A 11 15639 15639 T 12 15735 15735 T 13 15744 15744 A 14 15790 15790 A 15 17395 17395 T 16 18749 18749 T 17 18796 18796 T 18 18798 18799 GC 19 19119 19119 A 20 22230 22230 T 21 22266 22266 C 22 41082 41082 C 23 41335 41335 C 24 41944 41944 T 25 44285 44285 C 26 44387 44387 T 27 45202 45202 28 46136 46136 A 29 46447 46447 G 30 46912 46912 T 31 46957 46957 A 32 46959 46959 T 33 46973 46973 C 34 46975 46975 A 35 46989 46989 G 36 47001 47001 C 37 47026 47026 A 38 65062 65063 39 65438 65438 GGT 40 66993 66993 A 41 79739 79739 A 42 82093 82093 T 43 85155 85155 A 44 85667 85667 A 45 85782 85784 46 86079 86079 A 47 86097 86097 TC 48 86113 86113 T 49 86247 86247 T 50 86653 86653 , and wherein the plant comprises a marker nucleotide sequence selected from the group consisting of SEQ ID NOs:6-9, SEQ ID NO:105, SEQ ID NO:109, SEQ ID NO:111, SEQ ID NO:115, SEQ ID NOs:118-120, SEQ ID NO:123, SEQ ID NO:126, SEQ ID NO:134, SEQ ID NO:135, SEQ ID NO:137, SEQ ID NO:138, SEQ ID NO:144, SEQ ID NO:149, SEQ ID NO:151, SEQ ID NO:160, SEQ ID NO:163, SEQ ID NO:164, SEQ ID NO:167, SEQ ID NO:173, SEQ ID NO:177, SEQ ID NO:178, SEQ ID NO:183, SEQ ID NOs:189-191, SEQ ID NO:197, and the markers referred to as Marker ID Nos. 51-106: TABLE-US-00006 B73 Chrom. 8 Position Marker ID No. Start Stop Marker 51 96248 96248 T 52 97087 97087 A 53 97177 97177 GCC 54 97337 97338 TT 55 97341 97341 G 56 97371 97371 G 57 97382 97382 GGCGTACTTGCGCGCGGAC (SEQ ID NO: 212) 58 97405 97405 GTC 59 97411 97411 C 60 97421 97433 61 97452 97452 GTT 62 97673 97673 T 63 97827 97827 C 64 97962 97962 T 65 97964 97964 ATGCATTACTT (SEQ ID NO: 214) 66 97973 97973 GTGCTATACTACCTAACCTA (SEQ ID NO: 215) 67 97989 97989 C 68 98188 98188 A 69 98323 98326 70 98335 98335 A 71 98350 98350 C 72 98359 98359 C 73 98367 98369 74 98393 98393 T 75 98403 98403 T 76 98426 98430 77 98468 98468 TGGTTTCT 78 98489 98489 G 79 98533 98533 C 80 98540 98540 A 81 98552 98552 T 82 98557 98566 CCCCTGAACC (SEQ ID NO: 216) 83 98660 98660 T 84 98679 98679 A 85 98735 98735 A 86 98811 98811 C 87 98857 98857 ATAT 88 98906 98906 C 89 98927 98927 A 90 98935 98935 G 91 99026 99026 T 92 99027 99027 G 93 99037 99037 94 99074 99074 C 95 99079 99079 A 96 99089 99089 G 97 99091 99091 T 98 99137 99137 ATATT 99 99298 99298 A 100 99418 99418 C 101 99443 99443 T 102 99447 99447 A 103 99491 99491 G 104 99622 99622 CTAATGGT 105 99925 99925 A 106 99962 99962 G.
2. The maize plant of claim 1, wherein the plant comprises a marker nucleotide sequence selected from the group consisting of SEQ ID NO:8 and Marker ID Nos. 1-3, 10, 11, 20, 21, 25-27, 39, 40, 44-49, 51-53, 55, 56, 59, 61-64, 68, 74, 78, and 83.
3. The maize plant of claim 1, wherein the plant comprises a marker nucleotide sequence selected from the group consisting of SEQ ID NO:105; SEQ ID NO:109; SEQ ID NO:111; SEQ ID NO:115; SEQ ID NOs:118-120; SEQ ID NO:123; SEQ ID NO:126 and SEQ ID NO:134.
4. A hybrid maize plant that is an F.sub.1 progeny plant having XJH58 and a second plant as parents, the progeny plant comprising a marker nucleotide sequence selected from the group consisting of SEQ ID NOs:6-9, SEQ ID NO:105, SEQ ID NO:109, SEQ ID NO:111, SEQ ID NO:115, SEQ ID NOs:118-120, SEQ ID NO:123, SEQ ID NO:126, SEQ ID NO:134, SEQ ID NO:135, SEQ ID NO:137, SEQ ID NO:138, SEQ ID NO:144, SEQ ID NO:149, SEQ ID NO:151, SEQ ID NO:160, SEQ ID NO:163, SEQ ID NO:164, SEQ ID NO:167, SEQ ID NO:173, SEQ ID NO:177, SEQ ID NO:178, SEQ ID NO:183, SEQ ID NOs:189-191, SEQ ID NO:197, and the markers referred to as Marker ID Nos. 1-106: TABLE-US-00007 B73 Chrom. 8 Position Marker ID No. Start Stop Marker 1 8885 8885 C 2 11684 11684 G 3 11883 11883 C 4 12831 12831 C 5 13168 13168 A 6 13171 13171 C 7 13179 13179 T 8 13191 13191 G 9 14191 14191 A 10 15309 15309 A 11 15639 15639 T 12 15735 15735 T 13 15744 15744 A 14 15790 15790 A 15 17395 17395 T 16 18749 18749 T 17 18796 18796 T 18 18798 18799 GC 19 19119 19119 A 20 22230 22230 T 21 22266 22266 C 22 41082 41082 C 23 41335 41335 C 24 41944 41944 T 25 44285 44285 C 26 44387 44387 T 27 45202 45202 28 46136 46136 A 29 46447 46447 G 30 46912 46912 T 31 46957 46957 A 32 46959 46959 T 33 46973 46973 C 34 46975 46975 A 35 46989 46989 G 36 47001 47001 C 37 47026 47026 A 38 65062 65063 39 65438 65438 GGT 40 66993 66993 A 41 79739 79739 A 42 82093 82093 T 43 85155 85155 A 44 85667 85667 A 45 85782 85784 46 86079 86079 A 47 86097 86097 TC 48 86113 86113 T 49 86247 86247 T 50 86653 86653 51 96248 96248 T 52 97087 97087 A 53 97177 97177 GCC 54 97337 97338 TT 55 97341 97341 G 56 97371 97371 G 57 97382 97382 GGCGTACTTGCGCGCGGAC (SEQ ID NO: 212) 58 97405 97405 GTC 59 97411 97411 C 60 97421 97433 61 97452 97452 GTT 62 97673 97673 T 63 97827 97827 C 64 97962 97962 T 65 97964 97964 ATGCATTACTT (SEQ ID NO: 214) 66 97973 97973 GTGCTATACTACCTAACCTA (SEQ ID NO: 215) 67 97989 97989 C 68 98188 98188 A 69 98323 98326 70 98335 98335 A 71 98350 98350 C 72 98359 98359 C 73 98367 98369 74 98393 98393 T 75 98403 98403 T 76 98426 98430 77 98468 98468 TGGTTTCT 78 98489 98489 G 79 98533 98533 C 80 98540 98540 A 81 98552 98552 T 82 98557 98566 CCCCTGAACC (SEQ ID NO: 216) 83 98660 98660 T 84 98679 98679 A 85 98735 98735 A 86 98811 98811 C 87 98857 98857 ATAT 88 98906 98906 C 89 98927 98927 A 90 98935 98935 G 91 99026 99026 T 92 99027 99027 G 93 99037 99037 94 99074 99074 C 95 99079 99079 A 96 99089 99089 G 97 99091 99091 T 98 99137 99137 ATATT 99 99298 99298 A 100 99418 99418 C 101 99443 99443 T 102 99447 99447 A 103 99491 99491 G 104 99622 99622 CTAATGGT 105 99925 99925 A 106 99962 99962 G.
5. The F.sub.1 hybrid maize plant of claim 4, wherein the nucleotide sequence is selected from the group consisting of SEQ ID NO:8 and Marker ID Nos. 1-3, 10, 11, 20, 21, 25-27, 39, 40, 44-49, 51-53, 55, 56, 59, 61-64, 68, 74, 78, and 83.
6. The F.sub.1 hybrid maize plant of claim 4, wherein the nucleotide sequence is selected from the group consisting of SEQ ID NO:105; SEQ ID NO:109; SEQ ID NO:111; SEQ ID NO:115; SEQ ID NOs:118-120; SEQ ID NO:123; SEQ ID NO:126 and SEQ ID NO:134.
7. The F.sub.1 hybrid maize plant of claim 4, comprising some but not all of the nucleotide sequences selected from the group consisting of SEQ ID NOs:6-9; SEQ ID NO:105; SEQ ID NO:109; SEQ ID NO:111; SEQ ID NO:115; SEQ ID NOs:118-120; SEQ ID NO:123; SEQ ID NO:126; SEQ ID NO:134; SEQ ID NO:135; SEQ ID NO:137; SEQ ID NO:138; SEQ ID NO:144; SEQ ID NO:149; SEQ ID NO:151; SEQ ID NO:160; SEQ ID NO:163; SEQ ID NO:164; SEQ ID NO:167; SEQ ID NO:173; SEQ ID NO:177; SEQ ID NO:178; SEQ ID NO:183; SEQ ID NOs:189-191; SEQ ID NO:197; and the markers referred to as polymorphism ID nos. 1-106 in Table 3.
8. The maize plant of claim 1, wherein the maize plant is an inbred maize plant.
9. The inbred maize plant of claim 8, wherein the plant comprises a marker nucleotide sequence selected from the group consisting of SEQ ID NO:8 and Marker ID Nos. 1-3, 10, 11, 20, 21, 25-27, 39, 40, 44-49, 51-53, 55, 56, 59, 61-64, 68, 74, 78, and 83.
10. The inbred maize plant of claim 8, wherein the plant comprises a marker nucleotide sequence selected from the group consisting of SEQ ID NO:105; SEQ ID NO:109; SEQ ID NO:111; SEQ ID NO:115; SEQ ID NOs:118-120; SEQ ID NO:123; SEQ ID NO:126 and SEQ ID NO:134.
11. A population consisting of at least 126 maize plants of claim 1, wherein the population does not comprise a semi-fertile maize plant.
12. A maize plant comprising an Rf4 functional restorer gene for maize C-type cytoplasmic male sterility from restorer line XJH58, wherein the plant comprises a genetic marker selected from the group consisting of Marker ID Nos. 1-50: TABLE-US-00008 B73 Chrom. 8 Position Marker ID No. Start Stop Marker 1 8885 8885 C 2 11684 11684 G 3 11883 11883 C 4 12831 12831 C 5 13168 13168 A 6 13171 13171 C 7 13179 13179 T 8 13191 13191 G 9 14191 14191 A 10 15309 15309 A 11 15639 15639 T 12 15735 15735 T 13 15744 15744 A 14 15790 15790 A 15 17395 17395 T 16 18749 18749 T 17 18796 18796 T 18 18798 18799 GC 19 19119 19119 A 20 22230 22230 T 21 22266 22266 C 22 41082 41082 C 23 41335 41335 C 24 41944 41944 T 25 44285 44285 C 26 44387 44387 T 27 45202 45202 28 46136 46136 A 29 46447 46447 G 30 46912 46912 T 31 46957 46957 A 32 46959 46959 T 33 46973 46973 C 34 46975 46975 A 35 46989 46989 G 36 47001 47001 C 37 47026 47026 A 38 65062 65063 39 65438 65438 GGT 40 66993 66993 A 41 79739 79739 A 42 82093 82093 T 43 85155 85155 A 44 85667 85667 A 45 85782 85784 46 86079 86079 A 47 86097 86097 TC 48 86113 86113 T 49 86247 86247 T 50 86653 86653 , and wherein the plant comprises a genetic marker selected from the group consisting of the markers referred to as Marker ID Nos. 51-106: TABLE-US-00009 B73 Chrom. 8 Position Marker ID No. Start Stop Marker 51 96248 96248 T 52 97087 97087 A 53 97177 97177 GCC 54 97337 97338 TT 55 97341 97341 G 56 97371 97371 G 57 97382 97382 GGCGTACTTGCGCGCGGAC (SEQ ID NO: 212) 58 97405 97405 GTC 59 97411 97411 C 60 97421 97433 61 97452 97452 GTT 62 97673 97673 T 63 97827 97827 C 64 97962 97962 T 65 97964 97964 ATGCATTACTT (SEQ ID NO: 214) 66 97973 97973 GTGCTATACTACCTAACCTA (SEQ ID NO: 215) 67 97989 97989 C 68 98188 98188 A 69 98323 98326 70 98335 98335 A 71 98350 98350 C 72 98359 98359 C 73 98367 98369 74 98393 98393 T 75 98403 98403 T 76 98426 98430 77 98468 98468 TGGTTTCT 78 98489 98489 G 79 98533 98533 C 80 98540 98540 A 81 98552 98552 T 82 98557 98566 CCCCTGAACC (SEQ ID NO: 216) 83 98660 98660 T 84 98679 98679 A 85 98735 98735 A 86 98811 98811 C 87 98857 98857 ATAT 88 98906 98906 C 89 98927 98927 A 90 98935 98935 G 91 99026 99026 T 92 99027 99027 G 93 99037 99037 94 99074 99074 C 95 99079 99079 A 96 99089 99089 G 97 99091 99091 T 98 99137 99137 ATATT 99 99298 99298 A 100 99418 99418 C 101 99443 99443 T 102 99447 99447 A 103 99491 99491 G 104 99622 99622 CTAATGGT 105 99925 99925 A 106 99962 99962 G.
13. The maize plant of claim 12, wherein the plant comprises a genetic marker selected from the group consisting of Marker ID Nos. 73-106.
14. The maize plant of claim 13, wherein the maize plant is an inbred maize plant.
15. The maize plant of claim 13, wherein the maize plant is a hybrid maize plant that is a progeny plant having XJH58 and a second plant as parents.
16. A population consisting of at least 126 maize plants of claim 13, wherein the population does not comprise a semi-fertile maize plant.
17. The maize plant of claim 12, wherein the plant comprises in its genome a polynucleotide at least 95% identical to SEQ ID NO:217.
18. The maize plant of claim 17, wherein the plant comprises in its genome a polynucleotide at least 99% identical to SEQ ID NO:217.
19. The maize plant of claim 18, wherein the plant comprises in its genome the polynucleotide of SEQ ID NO:217.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
SEQUENCE LISTING
(12) The nucleic acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood to be included by any reference to the displayed strand. For simplicity, when describing a gene or locus, the gene may be described by the mutant form of the gene (e.g., Rf4, as opposed to rf4), even though the actual sequence may be the wild-type form of the gene at the corresponding genomic location. Nonetheless, it will be understood that both alleles have different sequences, and it will be clear from the context precisely which allele is meant. In the accompanying sequence listing:
(13) SEQ ID NOs:1-197 show exemplary nucleotide sequences of markers that are linked to (e.g., linked; tightly linked; or extremely tightly linked) or that reside within the maize Rf4 gene.
(14) SEQ ID NOs:198-211 show nucleotide sequences within a region of approximately 0.56 Mb on the top of maize chromosome 8, to which the Rf4 allele was initially mapped. SEQ ID NO:203 is the Rf4-bHLH allele.
(15) SEQ ID NOs:212-216 represent exemplary nucleotide sequence differences between CMS (BE4207) and restorer (XJH58) maize lines.
(16) SEQ ID NO:217 shows the nucleotide sequence of the approximately 12-kb interval from maize variety B73 to which the Rf4 allele was fine-mapped.
(17) SEQ ID NO:218 shows the nucleotide sequence of a rf4-bHLH allele from maize varieties B73 and BE4207.
(18) SEQ ID NO:219 shows the nucleotide sequence of a bHLH allele from maize variety B104.
(19) SEQ ID NO:220 shows the nucleotide sequence of a Rf4-bHLH allele from maize varieties XJH58, BE9515, and MLW03.
(20) SEQ ID NO:221 shows the nucleotide sequence of a predicted rf4-bHLH cDNA from maize varieties B73 and B4207.
(21) SEQ ID NO:222 shows the nucleotide sequence of a predicted bHLH cDNA from maize variety B104.
(22) SEQ ID NO:223 shows the nucleotide sequence of a predicted Rf4-bHLH cDNA from maize varieties XJH58, BE9515, and MLW03.
(23) SEQ ID NO:224 shows the amino acid sequence of a predicted maize rf4-bHLH polypeptide.
(24) SEQ ID NO:225 shows the amino acid sequence of a predicted maize Rf4-bHLH polypeptide.
(25) SEQ ID NO:226 shows the amino acid sequence of a predicted Brachypodium distachyon rf4-bHLH polypeptide.
(26) SEQ ID NO:227 shows the amino acid sequence of a predicted Sorghum bicolor rf4-bHLH polypeptide.
(27) SEQ ID NO:228 shows the amino acid sequence of a predicted Oryza sativa rf4-bHLH polypeptide.
(28) SEQ ID NOs:229 and 230 show predicted nuclear localization signals (NLSs) in Rf4-bHLH.
DETAILED DESCRIPTION
I. Overview of Several Embodiments
(29) Described herein are particular embodiments of genes impacting male fertility in plants, maize Rf4, and tightly-linked genetic markers thereof, which can be useful in a variety of systems to control male fertility. Furthermore, the polymorphism inherent in the disclosed tightly-linked genetic markers allows the plant breeder to follow the particular allele of the gene, Rf4 or rf4, in a segregating population. The Rf4 gene was initially mapped to chromosome 8 in three populations derived from crosses of four maize cultivars: BE4207BE9515; BE4207MLW03F; and BE4207XJH58. Fine mapping and map-based cloning was demonstrated by way of example in population BE4207XJH58, eventually locating the Rf4 gene within about 12 kb.
(30) The restoration of the cytoplasmic male sterility (CMS) has been a common agriculture practice in the production of hybrid seed for many years. The use of the fertility restorer gene (Rf) with the cytoplasmic male sterility simplifies seed production programs and reduces the overall costs by totally eliminating manual and machine detasseling. However, the full benefits of applications of the genetics of fertility restoration for C-type cytoplasmic male sterility in corn to hybrid seed production have not been realized, because previous studies of the genetics of fertility restoration for C-type cytoplasmic male sterility in corn have produced conflicting results.
(31) In view of the practical importance of cytoplasmic male sterility and pollen fertility restoration in maize hybrid seed production, and the necessity of cytoplasm source diversification, fine mapping of the maize Rf4 restorer gene for CMS-C to a very small region by using molecular markers with a KASPar genotyping technique and the identification of the maize Rf4 gene through map-based cloning are described. It was discovered that Rf4 is a single dominant restorer gene for CMS-C in three maize inbreds: BE9515, MLW03 and XJH58.
(32) Rf4 was first mapped using SSR and SNP markers to a region of approximately 5.0 Mb, starting from the SSR marker umc-1075 to the top of the short arm of chromosome 8. A BE4207XJH58 F.sub.2 validation population with 500 individuals was created and scored for fertility in the field. A total of 197 SNP markers were screened with the validation population and 104 recombinants were identified within the 5.0 Mb region. By comparing the phenotypic scores and the genotype data for the informative recombinant lines, the maize Rf4 gene was positively identified within a region of approximately 0.56 Mb (14 genes), and likely within 100 kb (6 genes).
(33) Thus, use of embodiments of the methods disclosed herein demonstrated that the Rf4 gene is selected from the group consisting of GRMZM2G122853 (SEQ ID NO:198); AC187051.4_FG005 (SEQ ID NO:199); GRMZM2G122851 (SEQ ID NO:200); GRMZM2G122850 (SEQ ID NO:201); GRMZM2G582028 (SEQ ID NO:202); GRMZM2G021276 (SEQ ID NO:203); GRMZM2G381376 (SEQ ID NO:204); GRMZM2G081127 (SEQ ID NO:205); GRMZM2G085111 (SEQ ID NO:206); GRMZM2G085038 (SEQ ID NO:207); GRMZM2G317468 (SEQ ID NO:208); GRMZM2G328030 (SEQ ID NO:209); GRMZM2G029450 (SEQ ID NO:210); and GRMZM2G077212 (SEQ ID NO:211).
(34) Using a large fine mapping population of about 5,000 individuals, the maize Rf4 locus was mapped to a small region of approximately 12 kb, located on the top of chromosome 8. It was thereby demonstrated that the Rf4 gene is selected from the group consisting of a plant transposable element [GRMZM2G582028 (SEQ ID NO:202)] and a basic-helix-loop-helix (bHLH) transcription factor (GRMZM2G021276 (SEQ ID NO:203)). Of these two genes, the only likely candidate for Rf4 is the basic-helix-loop-helix (bHLH) transcription factor, GRMZM2G021276 (SEQ ID NO:203), is the Rf4 gene. Thus, in particular embodiments, the Rf4 gene is GRMZM2G021276 (SEQ ID NO:203), which is sometimes referred to herein as Rf4-bHLH. It will be understood that an Rf4 gene may also be a DNA sequence that encodes the same polypeptide as the maize Rf4-bHLH gene, for example, the coding sequence of SEQ ID NO:203.
(35) The bHLH locus was cloned from the maize CMS line BE4207; maize line B104; and three maize restorer lines: XJH58, BE9515, and MLW03. A number of sequence variations between different inbreds were identified. Notably, the three restorer lines have identical Rf4-bHLH DNA sequences, whereas B73 and BE4207 (which do not contain a functional Rf4 restorer) are identical. The B104 sequence is more similar to the BE4207/B73 allele than to the restorer allele. At the protein level, BE4207, B73, and B104 all have the same sequence and are different from the gene product of the restorer allele by 4 amino-acid changes, including the substitution of a hydrophobic phenylalanine for a conserved hydrophilic tyrosine in the bHLH domain.
(36) Consistent with Rf4 function in pollen fertility restoration, the restorer allele of Rf4-bHLH is specifically expressed in the developing tassels (with anthers and pollens) of plants that restore CMS-C. The maize CMS line BE4207 does not exert anthers nor develop functional pollens. As a result, very low or no rf4-bHLH expression was detected in leaves and male reproductive tissues from BE4207 plants. Because B73 (an inbred that neither contains CMS-C cytoplasm nor restores CMS-C) has significant expression of rf4-bHLH, it is unlikely that fertility restoration is due to a difference in expression level between the restorer allele (Rf4-bHLH) and the non-restorer allele (rf4-bHLH).
(37) The male fertility restoration is believed to be due to amino acid sequence differences between the gene products of the restorer allele and the non-restorer allele. In particular, Y.sub.186 of maize rf4-bHLH is located in the first helix (Carretero-Paulet et al. (2010) Plant Physiol. 153:1398-412; and Pires and Dolan (2010) Mol. Biol. Evol. 27:862-74) within the bHLH DNA binding domain, and this residue is absolutely conserved in B73 (non-CMS, non-restorer), BE4207 (CMS, non-restorer), and in sorghum, rice and Brachypodium orthologs. This hydrophilic residue is changed to a hydrophobic phenylalanine (F.sub.187) in the three maize restorer lines. Such a non-conserved substitution could significantly alter the helix structure in the bHLH domain, and affect DNA binding and downstream gene transcription. In view of the foregoing, we predict that rf4 allele from B104 does not restore CMS-C fertility, since B104 bHLH has the identical protein sequence as B73 and BE4207 rf4-bHLH, including the conserved tyrosine at position 186.
(38) In some embodiments, the Rf4-bHLH-based or tightly-linked high throughput molecular makers described herein may be used for identification of genotypes with an Rf4 restorer, introgression of Rf4 into new genotypes in corn and other plants for male conversion, and removal of Rf4 from CMS female plants. With the markers and Rf4 gene at hand, it is now possible to reliably transfer Rf4 into elite germplasms and to increase the scale of using the CMS-C/Rf4 system for hybrid seed production. Full implementation of this system may provide significant financial benefits for the agricultural industry and consumers of its products.
II. Terms
(39) Backcrossing: Backcrossing methods may be used to introduce a nucleic acid sequence into plants. The backcrossing technique has been widely used for decades to introduce new traits into plants. Jensen, N., Ed. Plant Breeding Methodology, John Wiley & Sons, Inc., 1988. In a typical backcross protocol, the original variety of interest (recurrent parent) is crossed to a second variety (non-recurrent parent) that carries a gene of interest to be transferred. The resulting progeny from this cross are then crossed again to the recurrent parent, and the process is repeated until a plant is obtained wherein essentially all of the desired morphological and physiological characteristics of the recurrent plant are recovered in the converted plant, in addition to the transferred gene from the nonrecurrent parent.
(40) Linked, tightly linked, and extremely tightly linked: As used herein, linkage between genes or markers refers to the phenomenon in which genes or markers on a chromosome show a measurable probability of being passed on together to individuals in the next generation. The closer two genes or markers are to each other, the closer to (1) this probability becomes. Thus, the term linked may refer to one or more genes or markers that are passed together with a gene with a probability greater than 0.5 (which is expected from independent assortment where markers/genes are located on different chromosomes). Because the proximity of two genes or markers on a chromosome is directly related to the probability that the genes or markers will be passed together to individuals in the next generation, the term linked may also refer herein to one or more genes or markers that are located within about 2.0 Mb of one another on the same maize chromosome. Thus, two linked genes or markers may be separated by about 2.1 Mb; 2.00 Mb; about 1.95 Mb; about 1.90 Mb; about 1.85 Mb; about 1.80 Mb; about 1.75 Mb; about 1.70 Mb; about 1.65 Mb; about 1.60 Mb; about 1.55 Mb; about 1.50 Mb; about 1.45 Mb; about 1.40 Mb; about 1.35 Mb; about 1.30 Mb; about 1.25 Mb; about 1.20 Mb; about 1.15 Mb; about 1.10 Mb; about 1.05 Mb; about 1.00 Mb; about 0.95 Mb; about 0.90 Mb; about 0.85 Mb; about 0.80 Mb; about 0.75 Mb; about 0.70 Mb; about 0.65 Mb; about 0.60 Mb; about 0.55 Mb; about 0.50 Mb; about 0.45 Mb; about 0.40 Mb; about 0.35 Mb; about 0.30 Mb; about 0.25 Mb; about 0.20 Mb; about 0.15 Mb; about 0.10 Mb; about 0.05 Mb; about 0.025 Mb; about 0.012 Mb; and about 0.01 Mb. Particular examples of markers that are linked to Rf4 include nucleotide sequences on the top of chromosome 8 of the maize genome, e.g., SEQ ID NOs:1-197; and the markers referred to herein as polymorphism ID nos. 1-106 (Table 3).
(41) As used herein, the term tightly linked may refer to one or more genes or markers that are located within about 0.5 Mb of one another on the same maize chromosome. Thus, two tightly linked genes or markers may be separated by about 0.6 Mb; about 0.55 Mb; 0.5 Mb; about 0.45 Mb; about 0.4 Mb; about 0.35 Mb; about 0.3 Mb; about 0.25 Mb; about 0.2 Mb; about 0.15 Mb; about 0.12 Mb; about 0.1 Mb; and about 0.05 Mb. Particular examples of markers that are tightly linked to Rf4 include SEQ ID NOs:6-9; SEQ ID NO:105; SEQ ID NO:109; SEQ ID NO:111; SEQ ID NO:115; SEQ ID NOs:118-120; SEQ ID NO:123; SEQ ID NO:126; SEQ ID NO:134; SEQ ID NO:135; SEQ ID NO:137; SEQ ID NO:138; SEQ ID NO:144; SEQ ID NO:149; SEQ ID NO:151; SEQ ID NO:160; SEQ ID NO:163; SEQ ID NO:164; SEQ ID NO:167; SEQ ID NO:173; SEQ ID NO:177; SEQ ID NO:178; SEQ ID NO:183; SEQ ID NOs:189-191; and SEQ ID NO:197; and the markers referred to herein as polymorphism ID nos. 1-106 (Table 3).
(42) As used herein, the term extremely tightly linked may refer to one or more genes or markers that are located within about 100 kb of one another on the same maize chromosome. Thus, two extremely tightly linked genes or markers may be separated by about 125 kb; about 120 kb; about 115 kb; about 110 kb; about 105 kb; 100 kb; about 95 kb; about 90 kb; about 85 kb; about 80 kb; about 75 kb; about 70 kb; about 65 kb; about 60 kb; about 55 kb; about 50 kb; about 45 kb; about 40 kb; about 35 kb; about 30 kb; about 25 kb; about 20 kb; about 15 kb; about 12 kb; about 10 kb; about 5 kb; and about 1 kb. Particular examples of markers that are extremely tightly linked to Rf4 include SEQ ID NO:105; SEQ ID NO:109; SEQ ID NO:111; SEQ ID NO:115; SEQ ID NOs:118-120; SEQ ID NO:123; SEQ ID NO:126; and SEQ ID NO:134; and the markers referred to herein as polymorphism ID nos. 1-106 (Table 3).
(43) Linked, tightly linked, and extremely tightly genetic markers of Rf4 may be useful in marker-assisted breeding programs to identify restorer for maize C-type cytoplasmic male sterility gene types, and to breed this trait into maize varieties.
(44) Locus: As used herein, the term locus refers to a position on the genome that corresponds to a measurable characteristic (e.g., a trait). An SNP locus is defined by a probe that hybridizes to DNA contained within the locus.
(45) Marker: As used herein, a marker refers to a gene or nucleotide sequence that can be used to identify plants having a particular allele, e.g., Rf4. A marker may be described as a variation at a given genomic locus. A genetic marker may be a short DNA sequence, such as a sequence surrounding a single base-pair change (single nucleotide polymorphism, or SNP), or a long one, for example, a minisatellite/simple sequence repeat (SSR). A marker allele refers to the version of the marker that is present in a particular plant.
(46) The term marker as used herein may refer to a cloned segment of maize chromosomal DNA (for example, as defined by one of SEQ ID NOs:1-197 or polymorphism ID nos. 1-106 (Table 3)), and may also or alternatively refer to a DNA molecule that is complementary to a cloned segment of maize chromosomal DNA (for example, DNA complementary to one of SEQ ID NOs:1-197 or polymorphism ID nos. 1-106 (Table 3)).
(47) In some embodiments, the presence of a marker in a plant may be detected through the use of a nucleic acid probe. A probe may be a DNA molecule or an RNA molecule. RNA probes can be synthesized by means known in the art, for example, using a DNA molecule template. A probe may contain all or a portion of the nucleotide sequence of the marker and additional, contiguous nucleotide sequence from the maize genome. This is referred to herein as a contiguous probe. The additional, contiguous nucleotide sequence is referred to as upstream or downstream of the original marker, depending on whether the contiguous nucleotide sequence from the maize chromosome is on the 5 or the 3 side of the original marker, as conventionally understood. The additional, contiguous nucleotide sequence may be located between the original marker and the 100 kb region on chromosome 8 of the maize genome that is located between map positions 564,922 and 601,460. Thus, the contiguous nucleotide sequence may be located between the original marker and the 12 kb region on chromosome 8 of the maize genome that is located between map positions 86247 and 98188. As is recognized by those of ordinary skill in the art, the process of obtaining additional, contiguous nucleotide sequence for inclusion in a marker may be repeated nearly indefinitely (limited only by the length of the chromosome), thereby identifying additional markers along the maize chromosome. All above-described markers may be used in some embodiments of the present invention.
(48) An oligonucleotide probe sequence may be prepared synthetically or by cloning. Suitable cloning vectors are well-known to those of skill in the art. An oligonucleotide probe may be labeled or unlabeled. A wide variety of techniques exist for labeling nucleic acid molecules, including, for example and without limitation: Radiolabeling by nick translation; random priming; tailing with terminal deoxytransferase; or the like, where the nucleotides employed are labeled, for example, with radioactive .sup.32P. Other labels which may be used include, for example and without limitation: Fluorophores; enzymes; enzyme substrates; enzyme cofactors; enzyme inhibitors; and the like. Alternatively, the use of a label that provides a detectable signal, by itself or in conjunction with other reactive agents, may be replaced by ligands to which receptors bind, where the receptors are labeled (for example, by the above-indicated labels) to provide detectable signals, either by themselves, or in conjunction with other reagents. See, e.g., Leary et al. (1983) Proc. Natl. Acad. Sci. USA 80:4045-9.
(49) A probe may contain a nucleotide sequence that is not contiguous to that of the original marker; this probe is referred to herein as a noncontiguous probe. The sequence of the noncontiguous probe is located sufficiently close to the sequence of the original marker on the maize genome so that the noncontiguous probe is genetically linked to the same gene (e.g., Rf4). For example, in some embodiments, a noncontiguous probe can be located within 500 kb; 450 kb; 400 kb; 350 kb; 300 kb; 250 kb; 200 kb; 150 kb; 125 kb; 120 kb; 100 kb; 0.9 kb; 0.8 kb; 0.7 kb; 0.6 kb; 0.5 kb; 0.4 kb; 0.3 kb; 0.2 kb; or 0.1 kb of the original marker on the maize genome.
(50) A probe may be an exact copy of a marker to be detected. A probe may also be a nucleic acid molecule comprising, or consisting of, a nucleotide sequence which is substantially identical to a cloned segment of maize chromosomal DNA (for example, as defined by SEQ ID NOs:1-197 and polymorphism ID nos. 1-106 (Table 3)). As used herein, the term substantially identical may refer to nucleotide sequences that are more than 85% identical. For example, a substantially identical nucleotide sequence may be 85.5%; 86%; 87%; 88%; 89%; 90%; 91%; 92%; 93%; 94%; 95%; 96%; 97%; 98%; 99% or 99.5% identical to the reference sequence.
(51) A probe may also be a nucleic acid molecule that is specifically hybridizable or specifically complementary to an exact copy of the marker to be detected (DNA target). Specifically hybridizable and specifically complementary are terms that indicate a sufficient degree of complementarity such that stable and specific binding occurs between the nucleic acid molecule and the DNA target. A nucleic acid molecule need not be 100% complementary to its target sequence to be specifically hybridizable. A nucleic acid molecule is specifically hybridizable when there is a sufficient degree of complementarity to avoid non-specific binding of the nucleic acid to non-target sequences under conditions where specific binding is desired, for example, under stringent hybridization conditions.
(52) Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na.sup.+ and/or Mg.sup.++ concentration) of the hybridization buffer will determine the stringency of hybridization, though wash times also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are known to those of ordinary skill in the art, and are discussed, for example, in Sambrook et al. (ed.) Molecular Cloning: A Laboratory Manual, 2.sup.nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, chapters 9 and 11; and Hames and Higgins (eds.) Nucleic Acid Hybridization, IRL Press, Oxford, 1985. Further detailed instruction and guidance with regard to the hybridization of nucleic acids may be found, for example, in Tijssen, Overview of principles of hybridization and the strategy of nucleic acid probe assays, in Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, Part I, Chapter 2, Elsevier, N.Y., 1993; and Ausubel et al., Eds., Current Protocols in Molecular Biology, Chapter 2, Greene Publishing and Wiley-Interscience, NY, 1995.
(53) As used herein, stringent conditions encompass conditions under which hybridization will only occur if there is less than 25% mismatch between the hybridization molecule and the DNA target. Stringent conditions include further particular levels of stringency. Thus, as used herein, moderate stringency conditions are those under which molecules with more than 25% sequence mismatch will not hybridize; conditions of medium stringency are those under which molecules with more than 15% mismatch will not hybridize; and conditions of high stringency are those under which sequences with more than 10% mismatch will not hybridize. Conditions of very high stringency are those under which sequences with more than 6% mismatch will not hybridize.
(54) In particular embodiments, stringent conditions are hybridization at 65 C. in 6 saline-sodium citrate (SSC) buffer, 5Denhardt's solution, 0.5% SDS, and 100 g sheared salmon testes DNA, followed by 15-30 minute sequential washes at 65 C. in 2SSC buffer and 0.5% SDS, followed by 1SSC buffer and 0.5% SDS, and finally 0.2SSC buffer and 0.5% SDS.
(55) With respect to all probes discussed, supra, the probe may comprise additional nucleic acid sequences, for example, promoters; transcription signals; and/or vector sequences. Any of the probes discussed, supra, may be used to define additionally markers that are tightly-linked to a gene involved in restoring fertility to C-type cytoplasmic sterile maize (e.g., Rf4). Markers thus identified may be equivalent to exemplary markers named in the present disclosure and, thus, are within the scope of the invention.
(56) Marker-assisted breeding: As used herein, the term marker-assisted breeding may refer to an approach to breeding directly for one or more complex traits (e.g., CMS-C restorer of fertility). In current practice, plant breeders attempt to identify easily detectable traits, such as flower color, seed coat appearance, or isozyme variants, that are linked to an agronomically desired trait. The plant breeders then follow the agronomic trait in the segregating, breeding populations by following the segregation of the easily detectable trait. However, there are very few of these linkage relationships available for use in plant breeding.
(57) Marker-assisted breeding provides a time- and cost-efficient process for improvement of plant varieties. Several examples of the application of marker-assisted breeding involve the use of isozyme markers. See, e.g., Tanksley and Orton, eds. (1983) Isozymes in Plant Breeding and Genetics, Amsterdam: Elsevier. One example is an isozyme marker associated with a gene for resistance to a nematode pest in tomato. The resistance, controlled by a gene designated Mi, is located on chromosome 6 of tomato and is very tightly linked to Aps1, an acid phosphatase isozyme. Use of the Aps1 isozyme marker to indirectly select for the Mi gene provided the advantages that segregation in a population can be determined unequivocally with standard electrophoretic techniques; the isozyme marker can be scored in seedling tissue, obviating the need to maintain plants to maturity; and co-dominance of the isozyme marker alleles allows discrimination between homozygotes and heterozygotes. See Rick (1983) in Tanksley and Orton, supra.
(58) Operably linked: A first nucleotide sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. When recombinantly produced, operably linked nucleic acid sequences are generally contiguous, and, where necessary to join two protein-coding regions, in the same reading frame (e.g., in a polycistronic ORF). However, nucleic acids need not be contiguous to be operably linked.
(59) Promoter: As used herein, the term promoter refers to a region of DNA that may be upstream from the start of transcription, and that may be involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. A promoter may be operably linked to a gene for expression in a cell, or a promoter may be operably linked to a nucleotide sequence encoding a signal sequence which may be operably linked to a gene for expression in a cell. A plant promoter may be a promoter capable of initiating transcription in plant cells. Examples of promoters under developmental control include promoters that preferentially initiate transcription in certain tissues, such as leaves, roots, seeds, fibers, xylem vessels, tracheids, or sclerenchyma. Such promoters are referred to as tissue-preferred. Promoters which initiate transcription only in certain tissues are referred to as tissue-specific. A cell type-specific promoter primarily drives expression in certain cell types in one or more organs, for example, vascular cells in roots or leaves. An inducible promoter may be a promoter which may be under environmental control. Examples of environmental conditions that may initiate transcription by inducible promoters include anaerobic conditions or the presence of light. Tissue-specific, tissue-preferred, cell type specific, and inducible promoters constitute the class of non-constitutive promoters. A constitutive promoter is a promoter which may be active under most environmental conditions.
(60) Any inducible promoter can be used in some embodiments of the instant invention. See Ward et al. (1993) Plant Mol. Biol. 22:361-366. With an inducible promoter, the rate of transcription increases in response to an inducing agent. Exemplary inducible promoters include, but are not limited to: Promoters from the ACEI system that responds to copper; In2 gene from maize that responds to benzenesulfonamide herbicide safeners; Tet repressor from Tn10; and the inducible promoter from a steroid hormone gene, the transcriptional activity of which may be induced by a glucocorticosteroid hormone (Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88:0421).
(61) Exemplary constitutive promoters include, but are not limited to: Promoters from plant viruses, such as the 35S promoter from CaMV; promoters from rice actin genes; ubiquitin promoters; pEMU; MAS; maize H3 histone promoter; and the ALS promoter, Xba1/NcoI fragment 5 to the Brassica napus ALS3 structural gene (or a nucleotide sequence similarity to said Xba1/NcoI fragment) (International PCT application WO 96/30530).
(62) Any tissue-specific or tissue-preferred promoter may also be utilized in some embodiments the instant invention. Plants transformed with a gene operably linked to a tissue-specific promoter may produce the protein product of the transgene exclusively, or preferentially, in a specific tissue. Exemplary tissue-specific or tissue-preferred promoters include, but are not limited to: A root-preferred promoter, such as that from the phaseolin gene; a leaf-specific and light-induced promoter such as that from cab or rubisco; an anther-specific promoter such as that from LAT52; a pollen-specific promoter such as that from Zm13; and a microspore-preferred promoter such as that from apg.
(63) Sequence identity: The term sequence identity or identity, as used herein in the context of two nucleic acid or polypeptide sequences, may refer to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
(64) When percentage of sequence identity is used in reference to proteins, it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge, hydrophobicity, or steric effects), and therefore do not change the functional properties of the molecule.
(65) Therefore, when sequences differ by conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution at the site of the non-identical residue. Sequences that differ by such conservative substitutions are said to have sequence similarity or similarity. Techniques for making this adjustment are well known to those of ordinary skill in the art. Typically, such techniques involve scoring a conservative substitution as a partial, rather than a full, mismatch, thereby increasing the percentage sequence identity. For example, where an identical amino acid is given a score between 0 and 1, and a non-conservative substitution is given a score of 0, a conservative substitution is given a score between 0 and 1. The scoring of conservative substitutions may be calculated, for example, as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif.).
(66) As used herein, the term percentage of sequence identity may refer to the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleotide or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percentage of sequence identity.
(67) Single-nucleotide polymorphism (SNP): As used herein, the term single-nucleotide polymorphism may refer to a DNA sequence variation occurring when a single nucleotide in the genome (or other shared sequence) differs between members of a species or paired chromosomes in an individual.
(68) Within a population, SNPs can be assigned a minor allele frequency the lowest allele frequency at a locus that is observed in a particular population. This is simply the lesser of the two allele frequencies for single-nucleotide polymorphisms. There are variations between human populations, so an SNP allele that is common in one geographical or ethnic group may be much rarer in another.
(69) Single nucleotide polymorphisms may fall within coding sequences of genes, non-coding regions of genes, or in the intergenic regions between genes. SNPs within a coding sequence will not necessarily change the amino acid sequence of the protein that is produced, due to degeneracy of the genetic code. An SNP in which both forms lead to the same polypeptide sequence is termed synonymous (sometimes called a silent mutation). If a different polypeptide sequence is produced, they are termed non-synonymous. A non-synonymous change may either be missense or nonsense, where a missense change results in a different amino acid and a nonsense change results in a premature stop codon. SNPs that are not in protein-coding regions may still have consequences for gene splicing, transcription factor binding, or the sequence of non-coding RNA. SNPs are usually biallelic and thus easily assayed in plants and animals. Sachidanandam (2001) Nature 409:928-33.
(70) InDel: As used herein, the term InDel is used generally to describe an insertion or a deletion in a gene. Thus, an InDel simply refers to a particular mutation that may be either an insertion, a deletion, or a combination thereof.
(71) Trait or phenotype: The terms trait and phenotype are used interchangeably herein. For the purposes of the present disclosure, a trait of particular interest is fertility restoration of C-type CMS.
III. Maize CMS-C Restorer Rf4 Gene and Molecular Markers Thereof
(72) Molecular markers that are linked (e.g., tightly-linked) to the maize CMS-C restorer gene, Rf4, are provided. DNA segments containing sequences involved in restoration of fertility to CMS-C plants are identified. These segments are located between markers that are linked (e.g., tightly-linked) to the Rf4 gene. Thus, nucleic acid molecules comprising the Rf4 gene are also provided. The segments identified, and the markers thereof, are described herein, in part, by their position in a particular region on the top of maize chromosome 8.
(73) The position of the segments identified, and the markers thereof, when expressed as recombination frequencies or map units, are provided herein as a matter of general information. The embodiments described herein were performed in maize population, BE4207XJH58. However, the positions of particular segments and markers as map units are expressed with reference to the publically available B73 maize inbred genome sequence (B73 RefGen v1 or v2), which may be found on the world wide web at www2.genome.arizona.edu/genomes/maize, or ftp.maizesequence.org/current/assembly/. The genome sequences of maize varieties BE4207 and XJH58 are not yet available. It is expected that numbers given for particular segments and markers as map units may vary from cultivar to cultivar and are not part of the essential definition of the DNA segments and markers, which DNA segments and markers are otherwise described, for example, by nucleotide sequence.
(74) The dominant allele of the Rf4 gene controls fertility restoration in the CMS-C/Rf4 system. In embodiments, the Rf4 gene is determined to be a gene selected from the group consisting of GRMZM2G122853 (SEQ ID NO:198); AC187051.4_FG005 (SEQ ID NO:199); GRMZM2G122851 (SEQ ID NO:200); GRMZM2G122850 (SEQ ID NO:201); GRMZM2G582028 (SEQ ID NO:202); GRMZM2G021276 (SEQ ID NO:203); GRMZM2G381376 (SEQ ID NO:204); GRMZM2G081127 (SEQ ID NO:205); GRMZM2G085111 (SEQ ID NO:206); GRMZM2G085038 (SEQ ID NO:207); GRMZM2G317468 (SEQ ID NO:208); GRMZM2G328030 (SEQ ID NO:209); GRMZM2G029450 (SEQ ID NO:210); and GRMZM2G077212 (SEQ ID NO:211). In particular embodiments, the Rf4 gene is Rf4-bHLH (SEQ ID NO:203). For example, an Rf4-bHLH gene is provided by SEQ ID NO:220.
(75) In some embodiments, the invention also includes those nucleotide sequences which are substantially identical to Rf4-bHLH. For example, in some embodiments, a nucleic acid molecule is an Rf4 homologue that is at least about 85% identical to Rf4-bHLH. An Rf4 homologue may be 86%; 87%; 88%; 89%; 90%; 91%; 92%; 93%; 94%; 95%; 96%; 97%; 98%; 99% or 99.5% identical to Rf4-bHLH. Such an Rf4 homologue may be readily identified and isolated from any complete or partial genomes readily available to those of skill in the art for a variety of organisms.
(76) Some embodiments also include functional variants of the Rf4 gene. Functional variants of Rf4 include, for example, the Rf4-bHLH sequence comprising one or more nucleotide substitutions, deletions, or insertions, wherein the functional variant restores male fertility to GMS-C corn, as may be measured by routine techniques well-known to those of ordinary skill in the art. For example, the capability of a particular variant of the Rf4 gene to restore male fertility to CMS-C corn may be determined by routine introduction of the mutation or fragment into plants homozygous for a sterile rf4 allele, followed by routine observation of the plant for male sterility. Functional variants of the Rf4 gene may be created by site-directed mutagenesis, induced mutation, or they may occur as allelic variants (polymorphisms, e.g., SNPs). In particular examples, a functional variant of Rf4 is the Rf4-bHLH sequence comprising one or more nucleotide substitutions, deletions, or insertions, such that the variant encodes an Rf4-bHLH polypeptide comprising a hydrophobic amino acid substitution (e.g., Phe) for Y.sub.186 within the bHLH domain.
(77) In some embodiments, therefore, functional variants of the Rf4 gene may be mutations of Rf4, or fragments smaller than entire sequence of Rf4, which retain the male sterility controlling properties of the Rf4 gene. Such mutations and fragments are therefore considered to be within the scope of the invention. In view of this disclosure, one of ordinary skill in the art can readily determine whether a mutation or fragment of the Rf4 sequence set forth herein retains the properties of the Rf4 gene.
(78) In some embodiments, the invention also includes Rf4-bHLH polypeptides (e.g., SEQ ID NO:225) and polypeptides that are substantially identical to Rf4-bHLH. For example, in some embodiments, a polypeptide that is substantially identical to Rf4-bHLH may be at least about 25% identical to Rf4-bHLH and have a hydrophobic amino acid residue (e.g., Phe) at the position corresponding to F.sub.187 of SEQ ID NO:225, as determined by a sequence alignment. In some embodiments, a polypeptide that is substantially identical to Rf4-bHLH may be 86%; 87%; 88%; 89%; 90%; 91%; 92%; 93%; 94%; 95%; 96%; 97%; 98%; 99% or 99.5% identical to Rf4-bHLH. Such polypeptides that are substantially identical to Rf4-bHLH may be readily identified and deduced from complete or partial genomes or cDNA libraries readily available to those of skill in the art for a variety of organisms.
IV. Methods of Using the Rf4 Gene
(79) The Rf4 gene described herein may be used in any of the many ways known by one of skill in the art to manipulate a gene to cause a desired effect. For example and without limitation, the Rf4 gene may be used to: introduce a mutant Rf4 sequence into a plant to cause sterility; to introduce a mutation into the native Rf4 sequence; to introduce an antisense nucleic acid molecule targeting Rf4DNA or RNA into a plant to affect fertility; to use hairpin formations; or to link Rf4 sequence(s) with other nucleic acid sequences to control the expression of Rf4 gene product.
(80) For example, in some embodiments, the Rf4 gene determined to be selected from the group consisting of GRMZM2G122853 (SEQ ID NO:198); AC187051.4FG005 (SEQ ID NO:199); GRMZM2G122851 (SEQ ID NO:200); GRMZM2G122850 (SEQ ID NO:201); GRMZM2G582028 (SEQ ID NO:202); GRMZM2G021276 (SEQ ID NO:203); GRMZM2G381376 (SEQ ID NO:204); GRMZM2G081127 (SEQ ID NO:205); GRMZM2G085111 (SEQ ID NO:206); GRMZM2G085038 (SEQ ID NO:207); GRMZM2G317468 (SEQ ID NO:208); GRMZM2G328030 (SEQ ID NO:209); GRMZM2G029450 (SEQ ID NO:210); and GRMZM2G077212 (SEQ ID NO:211) may be used to facilitate the utilization of the CMS-C/Rf4 male fertility system in conjunction with other genes or mutants impacting male fertility in maize. For example, in particular embodiments, the Rf4-bHLH gene may be used to facilitate the utilization of the CMS-C/Rf4 male fertility system in conjunction with other genes or mutants impacting male fertility in maize.
(81) In some embodiments, the Rf4 gene may be introduced into a maize plant that is suitable for use in a male fertility system other than the CMS-C/Rf4 male fertility system. Alternatively, a gene or mutant gene other than Rf4 may be introduced into a maize plant that is suitable for use in the CMS-C/Rf4 male fertility system, such that the introduced gene or mutant gene may be used to provide additional or complementary fertility control. Specific examples of other male fertility genes and mutations in maize include: CMS-T/Rf1; CMS-T/Rf2; CMS-S/Rf3; ms1 (Singleton and Jones (1930) J. Hered. 21:266-8); ms2 and ms3 (Eyster (1931) J. Hered. 22:99-102); ms5, ms7, ms8, ms9, ms10, ms11, ms12, ms13, and ms14 (Beadle (1932) Genetics 17:413-31); ms17 (Emerson (1932) Science 75:566); ms20 (Eyster (1934) Bibliographia Genetica 11:187-392); ms23 and ms24 (West and Albertsen (1985) MNL 59:87); ms25 and ms26 (Loukides et al. (1995) Am. J. Bot. 82:1017-23); ms27 and ms38 (Albertsen et al. (1996) MNL 70:30-1); ms28 (Golubovskaya (1979) MNL 53:66-70); ms29 and ms31 (Trimnell et al. (1998) MNL 72:37-38); ms30 (Albertsen et al. (1999) MNL 73:48); ms32, ms36, and ms37 (Trimnell et al. (1999) MNL 73:48-50); ms33 and ms34 (Patterson (1995) MNL 69:126-8); ms43 (Golubovskaya (1979) Int. Rev. Cytol. 58:247-90); ms45 (Albertsen et al. (1993) Proc. Annu. Corn Sorghum Ind. Res. Conf. 48:224-33; and ms48, ms49, and ms50 (Trimnell et al. (2002) MNL 76:38-9).
(82) When a nucleic acid sequence (e.g., Rf4) is introduced into an organism, such as a plant, the technique or methodology used for the introduction of a nucleic acid molecule comprising the particular sequence is not essential to the invention, and may occur by any technique or methodology known to those of skill in the art. For example, a nucleic acid molecule may be introduced by direct transformation methods, such as Agrobacterium-mediate transformation of plant tissue; microprojectile bombardment; electroporation; etc. Alternatively, a nucleic acid molecule may be introduced by crossing a plant having the particular nucleotide sequence with another plant, such that progeny have the nucleotide sequence incorporated into their genome. Such breeding techniques are well-known to one skilled in the art. Marker-assisted breeding techniques, as disclosed herein, may greatly facilitate the incorporation of Rf4 through such crosses.
(83) In embodiments wherein the Rf4 gene is introduced to an organism, it may be desirable for the Rf4 gene to be introduced in such a manner that the Rf4 gene is operably linked to one or more regulatory sequences, for example, introduction via the use of a plasmid comprising the Rf4 gene operably linked to the desired regulatory sequences. Regulatory sequences useful in the expression of heterologous nucleic acid sequences are well-known in the art, and include, for example and without limitation: Promoters (e.g., constitutive promoters; tissue-specific promoters; and developmental stage-specific promoters); termination sequences; enhancer sequences; subcellular targeting sequences; stabilizing or leader sequences; and introns.
(84) In some embodiments, the Rf4 gene may be introduced to an organism with one or more additional desirable nucleic acid sequences (for example, genes). Additional desirable nucleic acid sequences may include, for example: Genes encoding foreign proteins; agronomic genes; plant disease resistance genes; genes conferring resistance to a plant pest; genes conferring resistance to an herbicide; and genes that confer or contribute to a value-added trait (e.g., modified fatty acid metabolism; decreased phytate content; and modified carbohydrate composition). Examples of all the aforementioned nucleic acid sequences are known to those of skill in the art.
(85) The Rf4 gene may also be introduced to an organism with one or more marker genes operably linked to a regulatory element (a promoter, for example) that allows transformed cells containing the marker to be either recovered by negative selection (i.e., inhibiting growth of cells that do not contain the selectable marker gene) or by positive selection (i.e., screening for the product encoded by the genetic marker). Many selectable marker genes for transformation are well known in the transformation arts and include, for example, genes that code for enzymes that metabolically detoxify a selective chemical agent which may be an antibiotic or an herbicide, or genes that encode an altered target which may be insensitive to the inhibitor. A few positive selection methods are also known in the art. Examples of marker genes suitable for use in plant cells may include, for example, and without limitation: The neomycin phosphotransferase II (nptII) gene (Fraley et al. (1983) Proc. Natl. Acad. Sci. USA 80:4803); the hygromycin phosphotransferase gene (Vanden Elzen et al. (1985) Plant Mol. Biol. 5:299); gentamycin acetyl transferase, streptomycin phosphotransferase, aminoglycoside-3-adenyl transferase, and the bleomycin resistance determinant (See, e.g., Hayford et al. (1988) Plant Physiol. 86:1216; Jones et al. (1987) Mol. Gen. Genet. 210:86); Svab et al. (1990) Plant Mol. Biol. 14:197; and Hille et al. (1986) Plant Mol. Biol. 7:171); selectable marker genes that confer resistance to herbicides, such as glyphosate, glufosinate or bromoxynil (See, e.g., Comai et al. (1985) Nature 317:741-744; Gordon-Kamm et al. (1990) Plant Cell 2:603-618; and Stalker et al. (1988) Science 242:419-423); mouse dihydrofolate reductase (Eichholtz et al. (1987) Somatic Cell Mol. Genet. 13:67); plant 5-enolpyruvylshikimate-3-phosphate synthase (Shah et al. (1986) Science 233:478); plant acetolactate synthase (Charest et al. (1990) Plant Cell Rep. 8:643).
(86) Another class of marker genes suitable for plant transformation employs screening of presumptively transformed plant cells rather than direct genetic selection of transformed cells for resistance to a toxic substance, such as an antibiotic. These genes are particularly useful to quantify or visualize the spatial pattern of expression of a gene in specific tissues, and are frequently referred to as reporter genes, because they can be fused to a gene or gene regulatory sequence for the investigation of gene expression. Commonly used genes for screening transformed cells include -glucuronidase (GUS), -galactosidase, luciferase and chloramphenicol acetyltransferase. See, e.g., Jefferson (1987) Plant Mol. Biol. Rep. 5:387; Teen et al. (1989) EMBO J. 8:343; Koncz et al. (1987) Proc. Natl. Acad. Sci. U.S.A. 84:131; and DeBlock et al. (1984) EMBO J. 3:1681.
(87) Recently, in vivo methods for visualizing GUS activity that do not require destruction of plant tissue have been made available. Molecular Probes publication 2908, Imagene Green, p. 1-4, 1993; and Naleway et al. (1991) J. Cell Biol. 115:151a. Further, genes encoding Fluorescent Proteins (e.g., GFP, EGFP, EBFP, ECFP, and YFP) have been utilized as markers for gene expression in prokaryotic and eukaryotic cells. See Chalfie et al. (1994) Science 263:802. Fluorescent proteins and mutations of fluorescent proteins may be used as screenable markers.
(88) In some embodiments, the maize Rf4 gene and fragments or segments of the maize Rf4 gene disclosed herein may be used to identify homologous Rf4 sequences from organisms other than maize (e.g., by sequence comparison). Sequences from organisms other than maize that are homologous to the maize Rf4 gene may be identified and isolated according to well-known techniques, for example, based on their sequence homology to Rf4-bHLH. For example, all or part of the Rf4-bHLH coding sequence may be used as a probe which specifically hybridizes to other sequences present in a population of cloned genomic DNA fragments (i.e., a genomic library) from an organism according to routine techniques. Thus, in some embodiments, the invention includes those nucleotide sequences which specifically hybridize to a Rf4-bHLH sequence (e.g., SEQ ID NO:220).
(89) Alternatively, sequences from organisms other than maize that are homologous to the maize Rf4 gene may be identified and isolated by sequence comparison. For example, the complete or partial sequenced genome of an organism may be searched according to routine techniques with a maize Rf4-bHLH sequence (e.g., SEQ ID NO:220) to identify genes within the genome of the organism that share a high degree of sequence identity with maize Rf4, and are therefore likely Rf4 homologues.
(90) For example, all or part of a maize Rf4 sequence (e.g., SEQ ID NO:220) may be used as a reference sequence. Generally, nucleic acid sequences (e.g., cloned or genomic DNA fragments of a genomic library) that are compared to the reference sequence comprise a comparison window, which is a specific contiguous segment of the nucleic acid sequence. The comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The comparison window is typically at least 20 contiguous nucleotides in length, but may be 30, 40, 50, 100, or 200 nucleotides in length, or longer. To avoid a high similarity to the reference sequence due to inclusion of deletions in the polynucleotide sequence comparison window, a gap penalty may be introduced to be subtracted from the number of nucleotide matches.
(91) Methods of aligning sequences for comparison are well-known in the art. The determination of percent sequence identity between any two sequences can be accomplished using available mathematical algorithms. Non-limiting examples of such mathematical algorithms are the algorithm of Myers and Miller (1988), CABIOS 4:11-7; the local alignment algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482; the global alignment algorithm of Needleman and Wunsch (1970), J. Mol. Biol. 48:443-53; the search-for-local-alignment method of Pearson and Lipman (1988), Proc. Natl. Acad. Sci. USA 85:2444-8; the algorithm of Karlin and Altschul (1990), Proc. Natl. Acad. Sci. USA 87:2264, and Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-7.
(92) One of ordinary skill in the art can implement these mathematical algorithms on a computer for comparison of sequences to determine sequence identity, or to search a database comprising a plurality of sequences (e.g., an organism genome database) according to shared sequence identity with a reference sequence. Such implementations include, but are not limited to, CLUSTAL in the PC/Gene program (Intelligenetics, Mountain View, Calif.); and the ALIGN program and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the GCG Wisconsin Genetics Software Package, v. 10 (Accelrys Inc., San Diego, Calif.). Sequence alignments using these programs may be performed using their default parameters. Alternatively, it may be desirable to modify the default parameters in some searches (e.g., altering the value of a gap penalty). The selection of a particular computer implementation of mathematical algorithms for calculation of sequence identity, and the selection of parameter values for use in a selected algorithm, are within the discretion of one of skill in the art.
(93) In some embodiments, the CMS-C/Rf4 system for hybrid seed production may be engineered into a maize variety lacking a functional Rf4 restorer gene or a plant species other than maize, for example, by introduction of the Rf4 gene into such maize variety or plant species.
(94) Thus, in accordance with some embodiments, the Rf4 gene described herein may be used in a method for producing hybrid seed. A method for producing hybrid seed may comprise obtaining a nucleic acid molecule comprising a maize Rf4-bHLH sequence (e.g., SEQ ID NO:220), or a nucleotide sequence that specifically hybridizes to a maize Rf4-bHLH sequence. That nucleic acid molecule may then be introduced into a plant cell or plant tissue, wherein the plant from which the plant cell or plant tissue is obtained may be Zea mays, or a different plant species. Subsequently, a transformed whole plant may be generated from the plant cell or plant tissue into which the nucleic acid molecule has been introduced. A cytoplasmic male-sterile plant may then be pollinated by the transformed whole plant. A seed that generates a fertile plant may then be obtained from the cytoplasmic male-sterile plant that has been pollinated by the transformed whole plant.
(95) In particular embodiments, functional variants or homologs of the maize Rf4-bHLH gene may be used in place of a maize Rf4-bHLH sequence (e.g., SEQ ID NO:220), or the nucleotide sequence that specifically hybridizes to the maize Rf4-bHLH sequence, in a method for producing hybrid seed. A transformed whole plant that is generated, for example, by the methods described above, may be capable of producing seeds. However, such seeds may or may not be able to grow into fertile plants. Accordingly, some embodiments of methods for producing hybrid seed involve plant tissue culture techniques. Such techniques are routine and widely known to those of ordinary skill in the art.
(96) In embodiments where the CMS-C/Rf4 system for hybrid seed production is engineered into plant species other than maize, it may be necessary to also introduce nucleic acid molecules comprising one or more nucleic acid sequence(s) involved in the CMS-C male sterility system into the plant species. For example, the recessive rf4-bHLH allele may be introduced to replace an Rf4-bHLH ortholog in the plant species to generate a male sterile rf4/rf4 plant, into which the Rf4-bHLH gene may be introduced in order to engineer the CMS-C/Rf4 system for hybrid seed production into the species.
(97) In some embodiments, the Rf4 gene described herein may be used in a method for producing hybrid seed comprising fertilizing a female plant having the trait of CMS-C type male sterility with pollen from a male plant comprising the Rf4 gene. In these and other embodiments, a maize Rf4-bHLH sequence (e.g., SEQ ID NO:220), a nucleotide sequence that specifically hybridizes to the maize Rf4-bHLH sequence, or functional variants or homologs of the maize Rf4-bHH sequence may be used.
(98) In some embodiments, a method for producing hybrid seed comprises generating a first plant comprising Rf4 by, for example, backcrossing; mutagenesis; transformation; or homologous recombination. A second plant having the trait of CMS-C type male sterility may then be obtained, or generated by, for example, backcrossing; mutagenesis; or homologous recombination. The second plant may then be crossed with the first plant to obtain fertile hybrid seeds from the second plant. In embodiments, the first plant may be a male plant, and the second plant may be a female plant.
(99) In particular examples of methods for producing hybrid seed, the plant may be a corn plant. In further examples, plants other than corn may be used. Embodiments of methods for producing hybrid seed according to the invention are applicable to any plant, such as sexually reproducing plants, including plants of agronomic value, for example and without limitation: maize; soybean; alfalfa; wheat; rapeseed; rice; sorghum; beet; Brachypodium; monocots; dicots; various vegetables including cucumber, tomato, peppers, etc.; various trees including apple, pear, peach, cherry, redwood, pine, oak, etc.; and various ornamental plants.
V. Methods of Using Rf4 Molecular Markers
(100) Methods of using nucleic acid molecular markers that are linked to or that reside within the Rf4 gene to identify plants with a functional restorer gene for C-type CMS may result in a cost savings for plant developers, because such methods may eliminate the need to cross plants comprising a functional restorer gene with CMS plant lines and then phenotype the progenies of the cross.
(101) Additional markers can be identified as equivalent to any of the exemplary markers named herein (e.g., SEQ ID NOs:1-197 and polymorphism ID nos. 1-106 (Table 3)), for example, by determining the frequency of recombination between the additional marker and an exemplary named marker. Such determinations my utilize an improved method of orthogonal contrasts based on the method of Mather (1931), The Measurement of Linkage in Heredity, Methuen & Co., London, followed by a test of maximum likelihood to determine a recombination frequency. Allard (1956) Hilgardia 24:235-78. If the value of the recombination frequency is less than or equal to 0.10 (i.e., 10%) in any maize cultivar, then the additional marker is considered equivalent to the particular reference marker for the purposes of use in the presently disclosed methods.
(102) A means for restoring fertility to CMS-C corn may include a nucleic acid sequence from a plant, the detection of which nucleic acid provides at least a strong indication that the plant comprising the nucleic acid sequence comprises a functional restorer of CMS-C gene. In some examples, a means for restoring fertility to CMS-C corn is a marker that is linked to (e.g., linked; tightly linked; or extremely tightly linked) or that resides within the Rf4-bHLH gene.
(103) A means for identifying corn plants carrying a gene for restoring fertility to GMS-C corn may be a molecule that presents a detectable signal when added to a sample obtained from a plant carrying a gene for restoring fertility to CMS-C corn. Specific hybridization of nucleic acids is a detectable signal, and a nucleic acid probe that specifically hybridizes to a CMS-C restorer gene, or a different genomic nucleic acid sequence that is an indicator of the presence of a functional CMS-C restorer gene, may therefore be a means for identifying corn plants carrying a gene for restoring fertility to CMS-C corn. In some examples, a means for identifying plants carrying a gene for restoring fertility to CMS-C corn is a probe that specifically hybridizes to a marker that is linked to (e.g., linked; tightly linked; or extremely tightly linked) or that resides within the maize Rf4-bHLH gene.
(104) In some embodiments, markers flanking the Rf4 gene may be used to transfer segment(s) of donor parent DNA that unequivocally contain the Rf4 gene. In particular embodiments, the markers are selected from the group of markers comprising SEQ ID NOs:1-197 and polymorphism ID nos. 1-106 (Table 3), or from markers equivalent to the markers selected from the group of markers comprising SEQ ID NOs:1-197 and polymorphism ID nos. 1-106 (Table 3). In some embodiments, a method for using markers flanking the Rf4 gene to transfer segment(s) of donor parent DNA that unequivocally contain the Rf4 gene may comprise analyzing the genomic DNA of two parent plants with probes that are specifically hybridizable to markers linked (e.g., linked; tightly linked; or extremely tightly linked) to the Rf4 gene; sexually crossing the two parental plant genotypes to obtain a progeny population, and analyzing those progeny for the presence of the markers linked (e.g., linked; tightly linked; or extremely tightly linked) to the Rf4 gene; backcrossing the progeny that contain the markers linked (e.g., linked; tightly linked; or extremely tightly linked) to the Rf4 gene to the recipient genotype to produce a first backcross population, and then continuing with a backcrossing program until a final progeny is obtained that comprises any desired trait(s) exhibited by the parent genotype and the Rf4 gene. In particular embodiments, individual progeny obtained in each crossing and backcrossing step are selected by Rf4 marker analysis at each generation. In some embodiments, analysis of the genomic DNA of the two parent plants with probes that are specifically hybridizable to markers linked (e.g., linked; tightly linked; or extremely tightly linked) to the Rf4 gene reveals that one of the parent plants comprises fewer of the linked markers to which the probes specifically hybridize, or none of the linked markers to which the probes specifically hybridize.
(105) In some embodiments, markers that are linked to (e.g., linked; tightly linked; or extremely tightly linked) or that reside within the maize Rf4-bHLH gene, or the maize Rf4-bHLH gene sequence itself, may be used to introduce the maize Rf4 gene into a maize plant by genetic transformation. In particular embodiments, the markers are selected from the group of markers comprising SEQ ID NOs:1-197 and polymorphism ID nos. 1-106 (Table 3), or from markers equivalent to the markers selected from the group of markers comprising SEQ ID NOs:1-197 and polymorphism ID nos. 1-106 (Table 3). In some embodiments, a method for introducing the maize Rf4 gene into a maize plant by genetic recombination may comprise analyzing the genomic DNA of a plant (e.g., a maize plant) with probes that are specifically hybridizable to markers linked (e.g., linked; tightly linked; or extremely tightly linked) to the Rf4 gene or the Rf4 gene itself to identify the Rf4 gene in the plant; isolating a segment of the genomic DNA of the plant comprising the Rf4 gene, for example, by extracting the genomic DNA and digesting the genomic DNA with one or more restriction endonuclease enzymes; optionally amplifying the isolated segment of DNA; introducing the isolated segment of DNA into a cell or tissue of a host maize plant; and analyzing the DNA of the host maize plant with probes that are specifically hybridizable to markers linked (e.g., linked; tightly linked; or extremely tightly linked) to the Rf4 gene or the Rf4 gene itself to identify the Rf4 gene in the host maize plant. In particular embodiments, the isolated segment of DNA may be introduced into the host maize plant such that it is stably integrated into the genome of the host maize plant.
(106) In some embodiments, markers that are linked to (e.g., linked; tightly linked; or extremely tightly linked) or that reside within the maize Rf4-bHLH gene, or the maize Rf4-bHLH gene sequence itself, may be used to introduce the maize Rf4 gene into other organisms, for example, plants. In particular embodiments, the markers are selected from the group of markers comprising SEQ ID NOs:1-197 and polymorphism ID nos. 1-106 (Table 3), or from markers equivalent to the markers selected from the group of markers comprising SEQ ID NOs:1-197 and polymorphism ID nos. 1-106 (Table 3). In some embodiments, a method for introducing the maize Rf4 gene into an organism other than maize may comprise analyzing the genomic DNA of a plant (e.g., a maize plant) with probes that are specifically hybridizable to markers linked (e.g., linked; tightly linked; or extremely tightly linked) to the Rf4 gene or the Rf4 gene itself to identify the Rf4 gene in the plant; isolating a segment of the genomic DNA of the plant comprising the Rf4 gene, for example, by extracting the genomic DNA and digesting the genomic DNA with one or more restriction endonuclease enzymes; optionally amplifying the isolated segment of DNA; introducing the isolated segment of DNA into an organism other than maize; and analyzing the DNA of the organism other than maize with probes that are specifically hybridizable to markers linked (e.g., linked; tightly linked; or extremely tightly linked) to the Rf4 gene or the Rf4 gene itself to identify the Rf4 gene in the organism. In particular embodiments, the isolated segment of DNA may be introduced into the organism such that it is stably integrated into the genome of the organism.
(107) In some embodiments, markers that are linked to (e.g., linked; tightly linked; or extremely tightly linked) or that reside within the Rf4 gene, or the Rf4 gene sequence itself, may be used to identify a plant with a functional restorer gene for CMS-C male sterility. In particular embodiments, the plant is a maize plant. In some embodiments, nucleic acid molecules (e.g., genomic DNA or mRNA) may be extracted from a plant. The extracted nucleic acid molecules may then be contacted with one or more probes that are specifically hybridizable to markers linked (e.g., linked; tightly linked; or extremely tightly linked) to the Rf4 gene or the Rf4 gene itself. Specific hybridization of the one or more probes to the extracted nucleic acid molecules is indicative of the presence of a functional restorer gene for CMS-C male sterility in the plant.
(108) In some embodiments, markers that are linked to (e.g., linked; tightly linked; or extremely tightly linked) or that reside within the Rf4 gene, or the Rf4 gene sequence itself, may be used to produce hybrid seed. The production of hybrid seed according to such methods may result in a cost savings due to elimination of hand or mechanical detasseling, and may further increase seed yield. In particular embodiments, the method may comprise crossing of a male plant comprising nucleic acid molecular markers that are linked to (e.g., linked; tightly linked; or extremely tightly linked) or that reside within the Rf4 gene and a female plant having the phenotype of C-type CMS male sterility.
VI. Organisms Comprising the Rf4 Gene
(109) Some embodiments of the present invention also provide an organism including a nucleic acid molecule comprising a Rf4-bHLH sequence (e.g., SEQ ID NO:220), a nucleic acid sequence that is specifically hybridizable to a Rf4-bHLH sequence, or a functional variant of a Rf4-bHLH sequence. A suitable organism can be any suitable plant, yeast, or bacterium. By way of non-limiting example, a plant comprising the aforementioned sequences may be a plant of agronomic value, for example and without limitation: maize; soybean; alfalfa; wheat; rapeseed; rice; sorghum; beet; Brachypodium; monocots; dicots; various vegetables including cucumber, tomato, peppers, etc.; various trees including apple, pear, peach, cherry, redwood, pine, oak, etc.; and various ornamental plants. In particular embodiments, the organism may be a sexually-reproducing plant. A seed-bearing plant that comprises a particular nucleic acid sequence may produce seeds that comprise the nucleic acid sequence.
(110) Plant cells comprising a Rf4-bHLH sequence (e.g., SEQ ID NO:220), a nucleic acid sequence that is specifically hybridizable to a Rf4-bHLH sequence, or a functional variant of a Rf4-bHLH sequence, may be cultured and kept as plant tissue culture cells, or certain plant hormones known in the art can be added to the culture media, thereby causing the plant tissue culture cells to differentiate and form a new plant variety, which new plant variety may be fertile or sterile. Such plant culturing methods useful in these and other embodiments are routine and well-known in the art.
(111) Some embodiments of the invention provide a virus (e.g., a bacteriophage, or plant virus) comprising a Rf4-bHLH sequence (e.g., SEQ ID NO:220), a nucleic acid sequence that is specifically hybridizable to a Rf4-bHLH sequence, or a functional variant of a Rf4-bHLH sequence.
(112) The following examples are provided to illustrate certain particular features and/or embodiments. The examples should not be construed to limit the disclosure to the particular features or embodiments exemplified.
EXAMPLES
Example 1: Materials and Methods
(113) Validation Population.
(114) A male sterile line of CMS-C type, BE4207, and a male sterile restorer line responding to CMS-C type, XJH58, were used as parents to generate F.sub.1 progeny. The F.sub.1 progeny where then selfed to generate an F.sub.2 population. The F.sub.2 population, consisting of 500 individuals, was used for identification of the Rf4 gene and markers linked (e.g., linked; tightly linked; or extremely tightly linked) to the Rf4 gene.
(115) Fine Mapping BE4207/XJH58 F.sub.3 Population
(116) A total of 5465 seeds selected from 15 heterozygous F.sub.2 families from the validation F.sub.2 population segregating for different fragments within the 4.2-Mb region on top of chromosome 8 were planted in a 2010 summer nursery in Arlington, Wis. Leaf samples were collected from 5104 germinated seedlings for genotyping.
(117) Fertility Classification.
(118) The 500 plants in this F.sub.2 population were phenotypically classified according to pollen shed from the tassels. Plants that shed pollen were classified as fertile. Plants that did not shed polled were classified as sterile. The Rf4 restoration in this population was complete; no partial fertile plants were observed.
(119) DNA Extraction and Quantification.
(120) 8 punches of leaf tissue were collected from each plant of the F.sub.2 population, and DNA was extracted by using the Biocel 1800 (Agilent Inc., Santa Clara, Calif.). The DNA extraction process used was: (1) Add one inch diameter tungsten alloy bead to each tube; (2) add 300 L of RLT Lysis Buffer (Qiagen Inc., Germantown, Md.) to each tube; (3) cap and grind for 6 minutes at 1500 strokes/minute in an SPEX 2000 Geno/Grinder (OPS Diagnostics, LLC, Lebanon, N.J.); (4) spin down samples at 6000 rpm for 5 minutes; (5) uncap tubes; the following steps are carried out on the Biocel 1800: (6) Transfer 200 L of supernatant to a 1.1 mL square well round bottom assay plate containing 10 L MagAttract Suspension G Beads (Qiagen Inc.); (7) incubate 2 minutes; (8) shake at 1200 rpm for 40 seconds; (9) incubate for 2 minutes; (10) place assay plate onto magnet shelf and allow beads to separate for 40 seconds; (11) remove supernatant; (12) first washadd 190 L RPW wash buffer premixed with RNase and Isopropanol, and shake at 1200 rpm for 40 seconds; (13) place assay plate onto magnet shelf and allow beads to separate for 20 seconds; (14) remove supernatant; (15) second washadd 190 L 100% ethanol wash buffer, and shake at 1200 rpm for 40 seconds; (16) place assay plate onto magnet shelf and allow beads to separate for 20 seconds; (17) third washadd 190 L 100% ethanol wash buffer; (18) shake at 1200 rpm for 40 seconds; (19) place assay plate onto magnet shelf and allow beads to separate for 20 seconds; (20) remove supernatant; (21) incubate plate for 5 minutes at room temperature; (22) add 100 L, AE elution buffer (Qiagen Inc.); (23) shake for 2 minutes; (24) place assay plate onto magnet shelf and allow beads to separate for 30 seconds; and (25) transfer supernatant to a clean, labeled plate and seal. DNA was stored at 4 C. DNA was quantified by using PicoGreen (Invitrogen Inc., Carlsbad, Calif.), and the concentration was normalized to 5-6 ng/L for use in the KASPar genotyping system (KBioscience Inc., Hoddesdon, UK).
(121) KASPar SNP Genotyping System.
(122) The competitive allele-specific PCR genotyping system (KASPar) is a SNP detection system that uses a technique based on allele-specific oligo extension and fluorescence resonance energy transfer (FRET) for signal generation. Each SNP marker in a KASPar assay requires only two components: The assay mix (a mixture of three unlabelled primers: two allele specific oligo, and one common reverse locus specific oligo); and the reaction mix (the other components required for PCR, including the universal fluorescent reporting system and Taq polymerase).
(123) KBioscience Laboratory Information Management System (KLIMS) (KBioscience Inc.) was used for primer design, and oligonucleotides were synthesized by Integrated DNA Technology (Coralville, Iowa). KASPar reactions were performed according to the manufacturer's recommendation. PCR started with denaturing at 94 C. for 15 minutes, followed by 20 cycles of 10 seconds of denaturing at 94 C., 5 seconds of annealing at 57 C., then 10 seconds of extension at 72 C., which 20 cycles were followed by 22 cycles with 10 seconds of denaturing at 94 C., 20 seconds of annealing at 57 C., then 40 seconds of extension at 72 C. Fluorescent signals after the completion of KASPar reactions were read in a spectrofluorometer (Tecan GENios, Mannedorf, Switzerland) with an excitation wavelength at 485 nm, and an emission wavelength at 535 nm for the FAM fluorophore; and an excitation wavelength at 525 nm, and an emission wavelength at 560 nm for the VIC fluorophore. The data were analyzed using Klustercaller software (KBiosciences Inc.) to determine the genotypes of each SNP marker in a population.
(124) RNA Extraction and Real-Time PCR(RT-PCR)
(125) Parents and F.sub.3 plants segregating for the Rf4 region were grown in a greenhouse. Leaf tissues were collected from 5-week, 7-week, and 9-week old plants. Tassel tissues with developing anthers/pollens and shed pollens (in fertile plants) were also collected. Total RNA was extracted using an RNeasy Plant Mini Kit (Qiagen Inc.). cDNA was synthesized using QuantiTect Reverse Transcription Kit (Qiagen Inc.). For RT-PCR, Rf4 gene-specific primers, corn invertase control primers, and dual-labeled probes with FAM or VIC and Minor Groove Binding Non Fluorescence Quencher I (MGBNFQ) dyes were synthesized by Applied Biosystems (Foster City, Calif.). TaqMan genotyping master mix (Applied Biosystems) was used to set up 10 l PCR reactions, and PCR was performed on a LightCycler 480 (Roche). The PCR program included: 10 minutes activation at 95 C., followed by 50 cycles of 95 C. for 10 seconds and 58 C. for 38 seconds. Fluorescence signals were recorded at the end of each cycle. Relative expression level was calculated using the Delta CT method using invertase as the control.
Example 2: Mapping of the Rf4 Gene
(126) Fertility Segregation Analysis.
(127) The ratio of fertility segregation in the F.sub.2 population was 3:1. Table 1. The results demonstrated that fertility restoration in the CMS-C/Rf4 system is controlled by one dominant restorer gene, Rf4.
(128) TABLE-US-00001 TABLE 1 Phenotype data from the validation population. Fertile Sterile No Tassel Total 373 126 1 500
(129) Preliminary genetic mapping of Rf4 in the F.sub.2 population using SNP markers.
(130) 101 SNP markers located near the top of maize chromosome 8 were used in parental screening with 5 different Rf4 mapping populations, and were determined to be within the 5.0-Mb Rf4 region. A set of 12 markers were polymorphic in all five populations, whereas 27, including the 12 common polymorphic markers, showed polymorphism between parents of the BE4207XJH58 F.sub.2 population. The 12 common markers were initially used to genotype all 500 individuals in the F.sub.2 population to identify recombinant lines within the 5.0 Mb region. The remaining 15 polymorphic markers were then used to genotype all 104 recombinant lines. Thirty-four randomly selected recombinants are shown in
(131) Interestingly and unexpectedly, in view of the fact that all previously-identified restorer genes, except for maize Rf2 and rice Rf17, encode pentatricopeptide repeat (PPR) proteins, there is no predicted PPR gene within the 1.505 Mb region containing Rf4, though there are three PPR genes located on 1.509, 4.288 and 4.748 Mb respectively.
(132) Genetic fine mapping of Rf4 with informative recombinants and additional SNP markers.
(133) To further fine map the chromosome location of the restorer gene, Rf4, 96 SNP markers located from nucleotide position 12507 to 1504526 on chromosome 8 were selected for a parental polymorphism survey. 28 SNP markers were polymorphic between the two mapping parents. 93 recombinants, including some potential informative recombinants not included in the previous round of screening, were selected for genotyping with the 28 markers. Utilizing the same phenotype/genotype comparison described above, the Rf4 gene was positively mapped to a region of 0.56-Mb by using the 19 most informative recombinants, defined by plants S-301 and S-115 and SNP marker PZE-108000459 (SEQ ID NO:134) as the right border, as shown in
(134) TABLE-US-00002 TABLE 2 Predicted genes within the Rf4 region. Chr Start Stop Gene_name Description 8 17505 19257 GRMZM2G122853 Peroxidase 8 45481 50854 AC187051.4_FG005 Hypothetical Protein 8 51763 53988 GRMZM2G122851 MULE transposase (TE) 129 AA 8 67385 69586 GRMZM2G122850 Transposon protein, putative Prohibitin (TE) 8 93160 93850 GRMZM2G582028 No significant hit, 68 AA 8 95823 98367 GRMZM2G021276 HLH TF 8 98418 98518 PZE-108000086 8 166253 166692 GRMZM2G381376 S-adenosylmethionine synthetase 8 167824 174330 GRMZM2G081127 SPL1 TF (Squamosa promoter-binding- like) 8 267226 273756 GRMZM2G085111 ABC transporter- like 8 307170 319669 GRMZM2G085038 Pto kinase interactor 1 8 384128 387634 GRMZM2G317468 Transposon, En/Spm-like (TE) 8 499230 502184 GRMZM2G328030 Lipase, class 3 (Pseudo gene?) 8 505089 505924 GRMZM2G029450 GST (Pseudo Gene?) 8 546182 548235 GRMZM2G077212 Isopenicillin N epimerase 8 564822 564922 PZE-108000459
(135) Those results are consistent with those reported in a poster entitled, Restoration of c-type cytoplasmic male sterility in maize: Fine-mapping of Rf4, recently presented by Kohls et al. at the 2010 Maize Genetics Conference. Kohls et al. reportedly mapped an Rf4 gene to a 0.5 Mb region near the top of chromosome 8 using a limited number of markers. However, the genetic materials used by Kohls et al. were very different from those used in the presently described work. Importantly, Kohls et al. found significant percentage of only semi-fertile Rf4 individuals, while the fertility restoration in the present F.sub.2 population was complete (no semi-fertile individuals were found). Additionally, better map resolution (<100 kb vs. 500 kb) was used to identify Rf4, and also to describe many more useful markers, including those that are extremely tightly linked to Rf4.
(136) The results presented herein demonstrate the mapping of the Rf4 locus to a very small chromosomal fragment and identify the Rf4 gene. Unlike the majority of Rf genes cloned so far, Rf4 is almost certainly not a PPR gene. The linked molecular markers described herein (including tightly linked and extremely tightly linked markers) can be used to facilitate marker-assisted selection of restorer lines in the CMS-C/Rf4 system and to promote the development of hybrid corn using this system alone, or in conjunction with other systems.
Example 3: Fine Mapping of the Rf4Gene
(137) A large BE4207/XJH58 F.sub.3 fine mapping population of 5,104 individuals derived from the recombinant lines described above was generated.
(138) In the F.sub.2 population, Rf4 was mapped to a region of less than 100 kb on top of chromosome 8. However, there are no existing molecular markers within this region except PZE-108000086, with a SNP at nucleotide position 98468. Two approaches were carried out to identify polymorphisms for additional markers within this interval. In the first approach, a NimbleGen (Roche Inc.) Sequence Capture experiment (Fu et al. (2010) Plant J. 62:898-909) was designed to capture all polymorphisms around the 6.0-Mb region on the top of chromosome 8 between the CMS line BE4207 and the restorer line XJH58, together with two additional restorer lines BE9515 and MLW03. Sequence capturing, sequencing of the captured targets, and SNP calling were performed by NimbleGen according to the manufacturer's recommended procedure. In tandem with the NimbleGen capture experiments, non-repetitive DNA sequences in the Rf4 region (the top 100 kb from chromosome 8) were retrieved from the B73 genome, and PCR primers were designed for amplification of genomic fragments from the two mapping parents, BE4207 and XJH58. PCR fragments were sequenced from both parents and polymorphisms (both SNPs and InDels) were identified.
(139) Based on the results from both experiments, several thousand SNPs and InDels between the CMS line BE4207 and the restorer line XJH58 were identified within the 6-Mb captured region, including 77 SNPs and 29 InDels in the first 100 kb. Table 3. The PCR amplification experiment was targeted to the first 100 kb, with particular emphasis on the two expressed genes in this region, a plant peroxidase (GRMZM2G122853 (SEQ ID NO:198)) and a basic-helix-loop-helix (bHLH) transcription factor (GRMZM2G021276 (SEQ ID NO:203)). Sequencing of PCR products identified 35 SNPs and 24 InDels. Table 3. Notably, most of the changes identified in the PCR fragments were also found in the sequence capture project (50 out of 59, or 84.7%). Together, the two methods discovered 106 unique changes (Polymorphism IDs 1-106) between the two mapping parents, including 77 SNPs and 29 InDels in the 100 kb targeted Rf4 region. Table 3.
(140) Based on their physical map location and the sequence context, 33 of the unique changes (24 SNPs and 9 InDels) were used to design primers for high throughput genotyping of the F.sub.3 mapping populations using KASPar assays (Table 3), essentially as described in Example 1.
(141) TABLE-US-00003 TABLE 3 Polymorphisms between CMS (BE4207) and restorer line (XJH58) and KASPar markers for Rf4 mapping. B73 nucleotide position is based on Maize B73 RefGen_v1, but v2 has the identical sequence within the 100 kb of chromosome 8. B73 Chrom. 8 NimbleGen PCR Position Capture Sequencing KASPar ID Start Stop BE4207/XJH58 BE4207/XJH58 Marker 1 8885 8885 T/C T/C DAS-CMS1/2 2 11684 11684 A/G A/G DAS-CMS3 3 11883 11883 A/C A/C DAS-CMS4 4 12831 12831 T/C 5 13168 13168 T/A 6 13171 13171 T/C 7 13179 13179 C/T 8 13191 13191 T/G 9 14191 14191 G/A 10 15309 15309 G/A G/A DAS-CMS5 11 15639 15639 C/T C/T DAS-CMS6 12 15735 15735 C/T 13 15744 15744 G/A 14 15790 15790 G/A 15 17395 17395 C/T 16 18749 18749 C/T C/T 17 18796 18796 C/T C/T 18 18798 18799 CT/GC CT/GC 19 19119 19119 T/A T/A 20 22230 22230 C/T C/T DAS-CMS7 21 22266 22266 T/C DAS-CMS8 22 41082 41082 G/C 23 41335 41335 G/C 24 41944 41944 C/T 25 44285 44285 G/C G/C DAS-CMS9 26 44387 44387 C/T C/T DAS-CMS10 27 45202 45202 A/ DAS-CMS11 28 46136 46136 G/A 29 46447 46447 A/G 30 46912 46912 C/T 31 46957 46957 G/A 32 46959 46959 C/T 33 46973 46973 T/C 34 46975 46975 G/A 35 46989 46989 T/G 36 47001 47001 T/C 37 47026 47026 G/A 38 65062 65063 AT/ 39 65438 65438 /GGT /GGT DAS-CMS12 40 66993 66993 A/ DAS-CMS13 41 79739 79739 G/A 42 82093 82093 C/T 43 85155 85155 G/A 44 85667 85667 T/A T/A DAS-CMS14 45 85782 85784 CGG/ CGG/ DAS-CMS15 46 86079 86079 C/A DAS-CMS16 47 86097 86097 /TC DAS-CMS17 48 86113 86113 G/T DAS-CMS18 49 86247 86247 /T DAS-CMS19 50 86653 86653 T/ 51 96248 96248 C/T C/T DAS-CMS21 52 97087 97087 C/A C/A DAS-CMS22 53 97177 97177 /GCC /GCC DAS-CMS23 54 97337 97338 AC/TT AC/TT 55 97341 97341 C/G C/G DAS-CMS24 56 97371 97371 A/G A/G DAS-CMS25 57 97382 97382 / / GGCGTACTTGCGCGC GGCGTACTTGCG GGAC (SEQ ID CGCGGAC (SEQ NO: 212) ID NO: 212) 58 97405 97405 /GTC /GTC 59 97411 97411 T/C T/C DAS-CMS26 60 97421 97433 GTTAAAAAATTAA GTTAAAAAATTAA (SEQ ID (SEQ ID NO: 213)/ NO: 213)/ 61 97452 97452 /GTT /GTT DAS-CMS27 62 97673 97673 C/T C/T DAS-CMS28 63 97827 97827 T/C T/C DAS-CMS29 64 97962 97962 C/T C/T DAS-CMS30 65 97964 97964 /ATGCATTACTT /ATGCATTACTT (SEQ ID NO: 214) (SEQ ID NO: 214) 66 97973 97973 / / GTGCTATACTACCTA GTGCTATACTAC ACCTA (SEQ ID CTAACCTA (SEQ NO: 215) ID NO: 215) 67 97989 97989 T/C T/C 68 98188 98188 C/A C/A DAS-CMS31 69 98323 98326 ATAT/ ATAT/ 70 98335 98335 /A /A 71 98350 98350 T/C T/C 72 98359 98359 T/C T/C 73 98367 98369 AAT/ AAT/ 74 98393 98393 G/T G/T DAS-CMS32 75 98403 98403 C/T C/T 76 98426 98430 CGGAT/ CGGAT/ 77 98468 98468 C/TGGTTTCT C/TGGTTTCT 78 98489 98489 T/G T/G DAS-CMS33 79 98533 98533 A/C A/C 80 98540 98540 G/A G/A 81 98552 98552 G/T G/T 82 98557 98566 CCCCTGAACC (SEQ CCCCTGAACC ID NO: 216)/ (SEQ ID NO: 216)/ 83 98660 98660 /T DAS-CMS34 84 98679 98679 /A 85 98735 98735 G/A G/A 86 98811 98811 A/C A/C 87 98857 98857 /ATAT 88 98906 98906 T/C 89 98927 98927 T/A 90 98935 98935 A/G 91 99026 99026 C/T 92 99027 99027 C/G 93 99037 99037 C/ 94 99074 99074 T/C 95 99079 99079 G/A 96 99089 99089 C/G 97 99091 99091 C/T 98 99137 99137 /ATATT 99 99298 99298 G/A 100 99418 99418 A/C 101 99443 99443 C/T 102 99447 99447 T/A 103 99491 99491 A/G 104 99622 99622 /CTAATGGT 105 99925 99925 T/A 106 99962 99962 A/G
(142) In Example 2, Rf4 was mapped to a region of less than 100 kb on the top of maize chromosome 8, defined by SNP marker PZA108000086. To map Rf4 to a much smaller interval, four flanking markers (DAS-CMS1 and DAS-CMS3 on the left, and PZE-108000378 and PZE-108000459 on the right) were selected to genotype all 5104 BE4207/XJH58 F.sub.3 plants.
(143) Using the maize B73 genome as a reference, DAS-CMS19 (/T InDel; nucleotide position 86247) and DAS-CMS31 (C/A SNP; nucleotide position 98188) are approximately 12-kb apart, and are located in the same BAC clone; ZMMBBb0329M04 (accession no. AC187051). The sequence of the interval between DAS-CMS19 and DAS-CMS31 (in both B73 RefSeq v1 and v2) is provided in the Sequence Listing as SEQ ID NO:217. Since the most updated version of B73 RefGen (v2) still has two unresolved gaps (nucleotides 88058-88157 and 94849-94948) between the two markers, the exact length is not known. However, these gaps are more likely results of assembly difficulties due to repetitive sequences rather than actual physical gaps, since both markers have been located in the same BAC clone that has been sequenced.
Example 4: Characterization of the Maize Rf4Gene
(144) Rf4 Encodes a bHLH Transcription Factor
(145) In the B73 genome, the 12 kb interval between DAS-CMS19 and DAS-CMS31 contains two predicted genes; GRMZM2G582028 (SEQ ID NO:202) (nucleotides 93160-93850) and GRMZM2G021276 (SEQ ID NO:203) (nucleotides 95823-98367). The first 9.4-kb fragment (nucleotides 86247-95642) of the 12-kb interval largely consists of repetitive sequences, including GRMZM2G582028. GRMZM2G582028 is annotated as a novel transposable element in B73 RefGen v2, and it is predicted to encode a small protein of 68-amino acids that does not have any significant hits in protein databases. Moreover, GRMZM2G582028 sequence itself is highly repetitive, and many identical or nearly identical copies are found in all 10 maize chromosomes. Therefore, GRMZM2G582028 is unlikely to be Rf4.
(146) The remaining candidate for Rf4 is the only other predicted gene in this region, GRMZM2G021276. This gene encodes a basic-helix-loop-helix (bHLH) transcription factor of 365 amino acids, with a conserved bHLH domain located in approximately the middle portion of the protein. The promoter/5UTR and the entire coding region, as well as an 82-bp 3 UTR, of this gene are located within the 12-kb interval, with the right-border marker (DAS-CMS31) residing in the 3 UTR region. BLAST results indicate that GRMZM2G021276 (hereafter referred to as Rf4-bHLH) is most likely a single-copy gene in the B73 genome. This gene and its gene product have not been characterized previously.
(147) Rf4-bHLH Allelic Variations
(148) The B73 genome sequence indicates that the Rf4-bHLH gene has 4 exons and three introns (
(149) Sequencing results indicate that there are significant allelic variations between different inbreds.
(150) B104 is an inbred line that does not have CMS-C cytoplasm. Experiments are in progress to determine whether B104 is a restorer of fertility to CMS-C. Out of the 44 sequence variations found in B104 allele, 28 of them have the same sequence as CMS/B73 allele, 8 are the same as the restorer allele, and 8 are unique to B104 (
(151) Alignments of predicted protein sequences of Rf4-bHLH are shown in
(152) Rf4-bHLH is Specifically Expressed in the Developing Tassels/Pollens
(153) The expression pattern of Rf4-bHLH was examined to provide further evidence that this transcription factor does play a role in CMS-C fertility restoration. Total RNA were extracted from the two mapping parents, BE4207 and XJH58, as well as F.sub.3 individuals derived from an F.sub.2 ear segregating for the first 0.56-Mb region of chromosome 8. Rf4-bHLH-specific and invertase control oligonucleotides (primers and probes) designed for RT-PCR are shown in Table 4.
(154) TABLE-US-00004 TABLE4 OligonucleotidesforRT-PCR SEQID Oligos Sequences NO: bHLH-F AGTACACCGCCCTCATGCA 231 bHLH-R CCAGCTCCTGGATGTACTCGAT 232 bHLH-probe 6FAM-ACAAAGACTGATAGGGCGA-MGBNFQ 233 INV59F CGACGACTTGTCCGAGCAG 234 INV59R TGCCGTCCGTGCCCT 235 INV-probe VIC-CCGTGTACTTCTACCTGC-MGBNFQ 236
(155) Data from quantitative real-time PCR demonstrate that in restorer parent XJH58 plants, and F.sub.3 plants homozygous or heterozygous for the restorer allele, Rf4-bHLH shows the strongest expression in tassels with developing anthers/pollens, weak expression in the shed pollens, and almost no expression in leaves from different developmental stages. These expression patterns are consistent with a role of Rf4-bHLH in pollen fertility restoration.
(156) Conversely, rf4-bHLH shows very low to no expression in leaves, as well as in developing tassels, in the CMS parent BE4207, and in F.sub.3 plants homozygous for the non-restorer BE4207 allele.
Example 5: Characterization of the Rf4-bHLH Gene in Other Monocot Plants
(157) Monocot Rf4-bHLH orthologs were retrieved from Sorghum (Sb03g011940), Brachypodium (BRADI2G11260), and rice (Os01g11870), which are all available from the National Center for Biotechnology Information (NCBI). These orthologs were compared to the maize sequences. As shown in
(158) The maize bHLH protein sequence is highly similar to the monocot orthologs from Sorghum bicolor (Sb03g011940; 84% identity), Oryza sativa (Os01g18870; 64%), and Brachypodium distachyon (BRADI2G11260, 63%), and to a lesser extent to bHLH domain proteins from dicot species (At2g31210 from Arabidopsis thaliana; 24%, for example). According to Pires and Dolan (2010), supra, the plant bHLH family of proteins can be classified into 26 subfamilies based on sequence homologies identified among 544 bHLH proteins from nine species of land plants (not including maize) and algae. If included in the analysis, Rf4-bHLH from maize would fall into subfamily II, which consists of the rice protein, OS01 g18870 (described above) and 10 other proteins. Similarly, Carretero-Paulet et al. (2010), supra, identified 32 bHLH subfamilies, and maize Rf4-bHLH be classified in their subfamily 9, which also consists of OS01 g18870 and 10 other proteins. The majority of members in Pires and Dolan's subfamily II, and Carretero-Paulet's subfamily 9, are the same sequences.
(159) Rf4-bHLH is a transcription factor and its expected destination is the nucleus. In fact, several prediction programs, including PredictNLS, identify two strong nuclear localization signals (NLSs) in Rf4-bHLH: 153-GRKRGRA-159 (SEQ ID NO:229) and 229-KKRRRR-234 (SEQ ID NO:230) (according to the XJH58 Rf4-bHLH amino acid position).
(160) All the Rf genes cloned thus far encoded proteins targeted to mitochondria (Liu et al. (2001), supra; Akagi et al. (2004), supra; Fujii and Toriyama (2009), supra), and presumably interact directly with CMS transcripts. However, the expected nuclear localization of Rf4-bHLH makes it unlikely that Rf4-bHLH is targeted to mitochondria and has a direct interaction with GMS-C transcripts. Rf4-bHLH likely functions further upstream to activate or increase expression of a nuclear gene that encodes a mitochondrial-targeted protein, which in turn leads to interference with CMS-C transcript expression to restore male fertility. This putative mitochondrial protein could be a member of the PPR protein family, or something similar to maize Rf2, rice RF17, or a novel protein. Chromatin immunoprecipitation, gene networking, or other molecular approaches may be used to identify the direct targets of Rf4-bHLH.
Example 6: Introduction of the Rf4-bHLH Gene into CMS Maize by Transformation
(161) An Rf4-bHLH restorer gene (e.g., SEQ ID NO:220) is transformed into a maize CMS line. A transformed maize plant expresses the Rf4-bHLH polypeptide of SEQ ID NO:225, and the Rf4-bHLH is sufficient to restore male fertility in CMS-C cytoplasm.