Virus-like particle conjugates for diagnosis and treatment of tumors
10117947 ยท 2018-11-06
Assignee
- Aura Biosciences, Inc. (Cambridge, MA)
- The United States Of America, As Represented By The Secretary, Department Of Health And Human Services (Washington, DC)
Inventors
- Elisabet de los Pinos (Brookline, MA)
- John Todd Schiller (Kensington, MD, US)
- Rhonda C. Kines (Washington, DC, US)
- John MacDougall (Hingham, MA, US)
Cpc classification
A61K41/0057
HUMAN NECESSITIES
C12N7/00
CHEMISTRY; METALLURGY
C07K14/025
CHEMISTRY; METALLURGY
A61N5/062
HUMAN NECESSITIES
A61K47/64
HUMAN NECESSITIES
C12N2710/20033
CHEMISTRY; METALLURGY
C07K2317/33
CHEMISTRY; METALLURGY
A61P43/00
HUMAN NECESSITIES
C12N2710/20034
CHEMISTRY; METALLURGY
C07K16/084
CHEMISTRY; METALLURGY
C07K2317/76
CHEMISTRY; METALLURGY
A61K47/6901
HUMAN NECESSITIES
A61K41/0071
HUMAN NECESSITIES
A61K2039/545
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
A61K41/00
HUMAN NECESSITIES
A61K47/69
HUMAN NECESSITIES
C12N7/00
CHEMISTRY; METALLURGY
Abstract
The present disclosure is directed to methods and compositions for the diagnosis and/or treatment of tumors, such as ocular tumors, using virus-like particles conjugated to photosensitive molecules.
Claims
1. A tumor-targeting papilloma virus-like particle comprising about 50 to about 500 near infrared phthalocyanine dye molecules conjugated to papilloma virus capsid proteins, wherein the near infrared phthalocyanine dye molecules become toxic or produce a toxic molecule upon light activation.
2. The tumor-targeting papilloma virus-like particle of claim 1, wherein the papilloma virus capsid proteins are non-human papilloma virus capsid proteins.
3. The tumor-targeting papilloma virus-like particle of claim 1, wherein the papilloma virus-like particle comprises human papilloma virus (HPV) L1 capsid proteins.
4. The tumor-targeting papilloma virus-like particle of claim 3, wherein the HPV L1 capsid proteins comprise modified HPV L1 capsid proteins, relative to wild-type HPV L1 capsid proteins, and wherein the modified HPV L1 capsid proteins do not cross-react with neutralizing antibodies to HPV 16 or HPV 18.
5. The tumor-targeting papilloma virus-like particle of claim 4, wherein the modified HPV L1 capsid proteins comprise a combination of modified HPV L1 capsid proteins and wild-type HPV L2 capsid proteins.
6. The tumor-targeting papilloma virus-like particle of claim 4, wherein the tumor-targeting papilloma virus-like particle has reduced immunogenicity and/or antigenicity relative to a virus-like particle comprising wild-type HPV L1 capsid proteins.
7. The tumor-targeting papilloma virus-like particle of claim 1, wherein the near infrared phthalocyanine dye molecules are covalently conjugated to the papilloma virus capsid proteins.
8. The tumor-targeting papilloma virus-like particle of claim 1, wherein the near infrared phthalocyanine dye molecules are conjugated to lysine residues of the papilloma virus capsid proteins.
9. The tumor-targeting papilloma virus-like particle of claim 7, wherein the near infrared phthalocyanine dye molecules are conjugated to the capsid proteins through covalent amide bonds.
10. The tumor-targeting papilloma virus-like particle of claim 1, wherein the near infrared phthalocyanine dye molecules do not compromise binding of the tumor-targeting papilloma virus-like particle to the surface of tumor cells, or wherein the near infrared phthalocyanine dye molecules do not compromise binding of the tumor-targeting papilloma virus-like particle to heparan sulphate proteoglycans on the surface of tumor cells.
11. The tumor-targeting papilloma virus-like particle of claim 1, wherein the near infrared phthalocyanine dye molecules comprise photosensitizer molecules that are promoted to an excited state upon absorption of light and undergo intersystem crossing with oxygen to produce singlet oxygen.
12. A method, comprising: administering, to a subject having a tumor, the tumor-targeting papilloma virus-like particle of claim 1.
13. A method, comprising: administering, to a subject having an ocular tumor, a tumor-targeting papilloma virus-like particle comprising about 50 to about 1000 photosensitive molecules that become toxic or produce a toxic molecule upon light activation.
14. The method of claim 13, wherein the ocular tumor is located in the vitreous, choroidal space, iris, ciliary body, sclera, fovea, retina, optic disk, or optic nerve.
15. The method of claim 13, wherein the tumor-targeting papilloma virus-like particle is administered topically, intraocularly, intravitreally, or suprachoroidally.
16. The tumor-targeting papilloma virus-like particle of claim 1, wherein the near infrared phthalocyanine dye molecules comprise IR700 dye molecules conjugated to capsid proteins.
17. The tumor-targeting papilloma virus-like particle of claim 1, comprising about 200 near infrared phthalocyanine dye molecules.
18. The tumor-targeting papilloma virus-like particle of claim 1, comprising about 300 near infrared phthalocyanine dye molecules.
19. The tumor-targeting papilloma virus-like particle of claim 1, comprising about 400 near infrared phthalocyanine dye molecules.
20. The method of claim 12, wherein the tumor is an ocular tumor located in the vitreous, choroidal space, iris, ciliary body, sclera, fovea, retina, optic disk, or optic nerve.
21. The method of claim 12, wherein the tumor is located in a lung, pleura, liver, pancreas, stomach, esophagus, colon, breast, ovary, prostate, brain, meninges, testis, kidneys, or bladder.
22. The method of claim 12, wherein the tumor-targeting papilloma virus-like particle is administered topically, intraocularly, intravitreally, or suprachoroidally.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
DETAILED DESCRIPTION OF THE INVENTION
(24) Photodynamic therapy (PDT) is a form of phototherapy using nontoxic photosensitive molecules that, when selectively exposed to light, become toxic, and target and/or kill, malignant and other diseased cells. A challenge posed by PDT in the treatment of cancer is the delivery of high concentrations of photosensitive molecules exclusively to tumor cells. To achieve targeted delivery, antibodies can be used, though they are limited by their delivery capacity, which is in the range of 2-8 photosensitive molecules per antibody. Further, there are important tumors that lack an identified tumor receptor molecule and, thus, cannot be targeted with an antibody. As a consequence, multiple tumors remain untreatable (e.g., ocular melanoma). In addition, many of the molecules (e.g., EGFR) targeted by antibody/dye conjugates are also found on the surface of non-tumor cells, leading to unwanted off target effects.
(25) The present disclosure is based, in part, on the unexpected discovery that virus-like particles (VLPs) (e.g., papilloma VLPs) (also referred to herein as viral-like nanoparticles) can be chemically modified to carry many photosensitive molecules (e.g., IR700) without losing their tumor-targeting capability or structural stability. For example, in some embodiments, VLPs can be chemically modified to carry more than 50 molecules, more than 100 molecules, or more than 1000 molecules (or about 1000 photosensitive molecules). Virus-like particles assembled from L1, or L1 and L2 capsid proteins, can selectively bind to and infect cancer cells without affecting non-cancerous cells, thereby minimizing the cytotoxicity of treatments (see U.S. Patent Application Publication No. US20100135902A1, the entirety of which is incorporated by reference herein). Further, in some instances, the delivery of high amounts of photosensitive molecules per particle enables the selective killing of tumor cells upon light radiation with extremely small amounts of drug (e.g., picomolar concentrations).
(26) A key cell binding characteristic of a VLP is the presence of a high number of heparin binding sites on the capsid proteins (e.g., L1). Conjugation of photosensitive molecules to surface amino acids (e.g., conjugation via an amide bond to surface amino acids such as surface lysine residues, arginine residues and histidine residues), surprisingly, does not compromise binding of the VLP to heparan sulphate proteoglycans (HSPGs) on the surface of tumor cells. Although, the present disclosure describes conjugation of photosensitive molecules to surface-exposed peptides of capsid proteins, it should be understood that photosensitive molecules may be conjugated to any peptides of capsid proteins. That is, photosensitive molecules may be conjugated to L1 proteins only or to a combination of L1 and L2 proteins. The protein and amino acid residue to which a photosensitive molecule is conjugated can depend on the composition of the virus-like particle.
(27) The foregoing discoveries have important implications for the development of novel targeted cancer treatments. For example, the photosensitive VLPs (also referred to as VLP conjugates) of the present disclosure provide an advantage relative to other targeting molecules such as antibodies, which have a very limited delivery capacity. In addition, the photosensitive VLPs of the present disclosure are useful for targeting a wide range of tumors that otherwise cannot be targeted by antibodies or other targeting molecules (e.g., ocular tumors) because suitable tumor-surface specific determinants have not been identified. Further, the photosensitive VLPs are useful for treating distant metastases. In addition the photosensitive VLPs are useful for diagnosis and treatment of early malignant or pre-cancerous lesions (e.g., ocular nevi that are transformed, pre-malignant or malignant).
(28) A virus-like particle (VLP), as used herein, refers to an organized capsid-like structure (e.g., roughly spherical or cylindrical in shape) that comprises self-assembling ordered arrays of L1 or L1 and L2 capsomers and does not include a viral genome. Virus-like particles are morphologically and antigenically similar to authentic virions, but they lack viral genetic material (e.g., viral nucleic acid), rendering the particles non-infectious. A VLP may be used to deliver to a recipient cell an agent (e.g., prophylactic agent, therapeutic agent or diagnostic agent) or an enclosed circular or linear DNA or RNA molecule. It should be understood that the terms virus-like particle, or VLP and pseudovirus, or PsV may be used interchangeably herein and may also be used interchangeably with the term viral-like nanoparticle.
(29) A tumor-targeting virus-like particle, as used herein, refers to a VLP that targets tumor (e.g., cancerous) cells without targeting non-tumor (e.g., non-cancerous, otherwise normal, healthy) cells (e.g., in intact tissue).
(30) VLPs in accordance with the present disclosure may have a modified immunogenicity and/or antigenicity with respect to the wild type papillomavirus VLPs. The VLPs may, for example, be assembled from capsomers having a variant capsid protein with modified immunogenicity and/or antigenicity. A variant capsid protein with modified immunogenicity and/or antigenicity is one that is modified naturally or synthetically (e.g., mutated, substituted, deleted, pegylated or inserted) at an amino acid to reduce or prevent recognition of the capsid protein by pre-existing (e.g., endogenous) viral serotype-specific antibodies. A variant capsid protein may be a human papillomavirus (HPV) L1 variant, a non-human papillomavirus L1 variant, or a papillomavirus L1 variant based on a combination of amino acids from different HPV serotypes. For example, an L1 variant with modified immunogenicity and/or antigenicity may be a recombinant protein based on HPV serotype 16 and HPV serotype 31 (referred to herein as a variant HPV16/31 L1 proteinSEQ ID NO: 1), which is described in International Pub. No. WO/2010/120266, the entirety of which is incorporated by reference herein.
(31) In some embodiments, a VLP is a papilloma virus VLP. The VLP may be a human papilloma virus VLP (e.g., derived from a virus that can infect human), while in other embodiments, the VLP is a non-human papilloma virus VLP. Examples of non-human VLPs include those derived from, without limitation, bovine papilloma viruses, murine papilloma viruses, cotton-rabbit papilloma viruses and macaque or rhesus papilloma virus particles. In some embodiments, the VLPs are bovine papilloma virus viral-like nanoparticles (e.g., type 1 viral-like nanoparticles) (e.g., assembled from BPV L1 capsid proteins or a combination of BPV L1 and BPV L2 capsid proteins).
(32) A capsid protein, as used herein, refers to a protein monomer, several of which form a capsomer oligomer. A capsomer, as used herein, refers to the basic oligomeric structural unit of a viral capsid, which is an outer covering of protein that protects the genetic material of a virus such as, for example, human papillomavirus (HPV). The capsid proteins of the present disclosure include papillomavirus L1 major capsid proteins and papillomavirus L2 minor capsid proteins. In some embodiments, the VLPs of the present disclosure contain only L1 capsid proteins, while in other embodiments, the VLPs contain a mixture (or combination) of L1 and L2 capsid proteins.
(33) In some embodiments, the percentage of L1 capsid proteins in a virus-like particle is greater than the percentage of L2 capsid proteins in the virus-like particle. For example, in some embodiments, the percentage of L1 capsid proteins in a virus-like particle is 80% to 100% (of the total number of capsid proteins in the virus-like particle). In some embodiments, the percentage of L1 capsid proteins in a virus-like particle is 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. In some embodiments, the percentage of L2 capsid proteins in a virus-like particle is 1% to 25% (of the total number of capsid proteins in the virus-like particle). For example, some embodiments, the percentage of L2 capsid proteins in a virus-like particle is 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20%.
(34) In some embodiment, a virus-like particle contains 12 to 72 L2 proteins. In some embodiment, a virus-like particle contains 360 L1 proteins and 12 to 72 L2 proteins. In some embodiments, capsid proteins assemble into viral-like nanoparticles having a diameter of 20 to 60 nm. For example, capsid proteins may assemble into viral-like nanoparticles having a diameter of 20, 25, 30, 35, 40, 45, 50, 55 or 60 nm.
(35) An external capsid protein, as used herein, refers to a capsid protein that is exposed at the surface of a VLP. In some embodiments, external capsid proteins (e.g., L1 proteins) are conjugated to a (e.g., at least one) photosensitive molecule.
(36) A photosensitive molecule, as used herein, refers to a nontoxic molecule that, when exposed selectively to light, becomes activated (also referred to as photoactivated). In some embodiments, an activated photosensitive molecule re-emits light upon light excitation (e.g., a fluorophore). In some embodiments, an activated photosensitive molecule can become toxic, or can produce toxic molecules, upon light excitation. For example, a class of photosensitive molecules, referred to as photo sensitizers, can be promoted to an excited state upon absorption of light and undergo intersystem crossing with oxygen to produce singlet oxygen. This singlet oxygen rapidly attacks any organic compounds it encounters, thus is highly cytotoxic.
(37) In accordance with various aspects of the present disclosure, photosensitive molecules may be conjugated to capsid proteins (e.g., L1 and/or L2 capsid proteins) of the VLPs. In some embodiments, the photosensitive molecules are covalently conjugated to capsid proteins of the VLPs. In some embodiments, the photosensitive molecules are covalently conjugated to lysine residues of capsid proteins of the VLPs. VLPs that are conjugated to photosensitive molecules may be referred to herein as VLP conjugates or photosensitive VLPs. In some embodiments, the photosensitive molecules comprise an NHS (N-Hydroxysuccinimide) ester group that reacts with an amine group of the capsid protein (e.g., amine group of lysine or other amino acid) to form a covalent amide bond.
(38) The ratio of photosensitive molecule (PM) to VLP may vary.
(39) In some embodiments the ratio of VLP:PM is about 1:10 to about 1:1000, about 1:10 to about 1:500, about 1:50 to about 1:500, or about 1:50 to about 1:1000. That it, in some embodiments, a VLP may comprise about 10 to about 1000 photosensitive molecules. In some embodiments, the ratio of VLP:PM is 1:10, 1:15, 1:20, 1:25, 1:50, 1:75, 1:100, 1:150, 1:200, 1:250, 1:300, 1:350, 1:400, 1:450, 1:500, 1:550, 1:600, 1:650, 1:700, 1:750, 1:800, 1:850, 1:900, 1:950 or 1:1000. In some embodiments, the VLP may comprise 10, 15, 20, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000 photosensitive molecules. In some embodiments, the VLP may comprise more than 1000 photosensitive molecules or less than 10 photosensitive molecules.
(40) More than one photosensitive molecule may be conjugated to a single capsid protein. For example, a single capsid protein (e.g., L1 or L2 capsid protein) may be conjugated to 1 to 5 (e.g., 1, 2, 3, 4 or 5) photosensitive molecules. Thus, more than one amino acids of a capsid protein may be conjugated to a photosensitive molecule. In some embodiments, a single capsid protein may be conjugated to 1 to 2, 1 to 3, or 2 to 3 photosensitive molecules. Thus, a photosensitive molecule may be conjugated to 1, 2, 3, 4 or 5 different amino acids (e.g., lysine, arginine and/or histidine, or other amino acid) of a single capsid protein.
(41) Examples of photosensitive molecules for use in accordance with the present disclosure include, without limitation, fluorescent dyes, infrared dyes, near infrared dyes, porphyrin molecules and chlorophyll molecules.
(42) Examples of fluorescent dyes for use in accordance with the present disclosure include, without limitation, acridine orange, acridine yellow, Alexa Fluor, 7-Aminoactinomycin D, 8-Anilinonaphthalene-1-sulfonic acid, ATTO dyes, auramine-rhodamine stain, benzanthrone, bimane, 9,10-Bis(phenylethynyl)anthracene, 5,12-Bis(phenylethynyl)naphthacene, bisbenzimide, blacklight paint, calcein, carboxyfluorescein, carboxyfluorescein diacetate succinimidyl ester, carboxyfluorescein succinimidyl ester, 1-chloro-9,10-bis(phenylethynyl)anthracene, 2-chloro-9,10-bis(phenylethynyl)anthracene, 2-chloro-9,10-diphenylanthracene, coumarin, DAPI, dark quencher, DiOC6, DyLight Fluor, Fluo-3, Fluo-4, FluoProbes, fluorescein, fluorescein isothiocyanate, fluorescence image-guided surgery, fluoro-jade stain, fura-2, fura-2-acetoxymethyl ester, GelGreen, GelRed, green fluorescent protein, heptamethine dyes, Indian yellow, Indo-1, Lucifer yellow, luciferin, MCherry, Merocyanine, Nile blue, Nile red, optical brightener, perylene, phloxine, phycobilin, phycoerythrin, phycoerythrobilin, propidium iodide, pyranine, rhodamine, rhodamine 123, Rhodamine 6G, RiboGreen, RoGFP, rubrene, (E)-stilbene, (Z)-stilbene, sulforhodamine 101, sulforhodamine B, SYBR Green I, synapto-pHluorin, tetraphenyl butadiene, tetrasodium tris(bathophenanthroline disulfonate) ruthenium(II), Texas Red, Titan yellow, TSQ, umbelliferone, yellow fluorescent protein and YOYO-1.
(43) Examples of photosensitizing dyes for use in accordance with the present disclosure include, without limitation, HpD, Porfimer sodium (Photofrin?, Photogem?, Photosan Hemporfin?), m-THPC, Temoporfin (Foscan?), Verteporfin (Visudyne?), HPPH (Photochlor?), Palladium-bacteria-pheophorbide (Tookad?,) 5-ALA, 5 aminolevulinic acid (Levulan?), 5-ALA methylester (Metvix?), 5-ALA benzylester (Benzvix?), 5-ALA hexylester (Hexvix?), lutetium (III)-texaphyrin or Motexafin-lutetium (Lutex?, Lutrin?, Angrin?, Optrin?), SnET2, Tin (IV) ethyl etiopurpurin (Purlytin?, Photrex?), NPe6, mono-L-aspartyl chlorine e6, talaporfin sodium (Talporfin?, Laserphyrin?), BOPP, boronated protoporphyrin (BOPP?), Zinc phthalocyanine (CGP55847?), silicon phthalocyanine (Pc4?), mixture of sulfonated aluminium phthalocyanine derivatives (Photosens?), ATMPn, Acetoxy-tetrakis (beta-methoxyethyl-)porphycene), TH9402 and dibromorhodamine methyl ester.
(44) Examples of photosensitizing dyes for use in accordance with the present disclosure include those that can be used in fluorescence imaging (e.g., near infrared (NIR) fluorescent dyes) such as La Jolla Blue? and IRDye? 700DX.
(45) The present disclosure also provides methods of administering, to a subject having a tumor, a tumor-targeting virus-like particle comprising photosensitive molecules conjugated to capsid proteins, or administering, to a subject having a tumor, a tumor-targeting virus-like particle comprising about 50 to about 1000 (e.g., 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000) photosensitive molecules.
(46) In some embodiments, the subject is a mammal, such as a human.
(47) The mode of administration can be by injection, infusion, implantation, topical administration, or by any other means typically used to deliver virus-like particles. In some embodiments, hollow needles, coated needles, mini-needles or micro-needles are used, depending on the area of injection. In some embodiments, the mode of administration is by injection into the intraocular space or into the vitreous of an eye (e.g., to target ocular tumors or tumors that have metastasized to the eye).
(48) Examples of reagents that may be used to deliver virus-like particles of the present disclosure include, without limitation, saline, MgCl.sub.2, trehalose, sodium hyaluronate, polysorbate 20, polysorbate 80 or any combination of two or more of the foregoing reagents.
(49) Photosensitive molecules of the disclosure can be activated at a suitable wavelength. In some embodiments, activation of the photosensitive molecules renders them cytotoxic or able to produce a cytotoxic molecule. Suitable wavelengths include, without limitation, ultraviolet wavelengths, visible wavelengths, infrared wavelengths and near infrared wavelengths. In some embodiments, the photosensitive molecules are activated and become cytotoxic at a wavelength of 600 nm to 800 nm, or 660 nm to 740 nm. In some embodiments, the photosensitive molecules are activated and become cytotoxic at a wavelength of about 600 nm, 610 nm, 620 nm, 630 nm, 640 nm, 650 nm, 660 nm, 670 nm, 680 nm, 690 nm, 700 nm, 710 nm, 720 nm, 730 nm, 740 nm, 750 nm, 760 nm, 770 nm, 780 nm, 790 nm or 800 nm. In some embodiments, the photosensitive molecules are activated at a wavelength of less than 600 nm or more than 800 nm. Suitable wavelengths for photosensitive molecule activation will depend on the particular molecule used.
(50) The photosensitive molecules of the disclosure, depending on the type of molecule, can be activated by infrared, near-infrared or ultraviolet light. For example, an infrared, near-infrared or ultraviolet laser may be used, in some embodiments, to activate the photosensitive molecules of VLP conjugates. The energy delivered by the laser may range from about 5 J to about 100 J, about 5 Joules (J) to about 50 J, or about 8 J to about 36 J. In some embodiments, the energy delivered by the laser is 8 J, 9 J, 10 J, 11 J, 12 J, 13 J, 14 J, 15 J, 16J, 17 J, 18 J, 19 J, 20 J, 21 J, 22 J, 23 J, 24 J, 25 J, 26 J, 27 J, 28 J, 29 J, 30 J, 31 J, 32 J, 33 J, 34 J, 35 J, 36 J, 37 J, 38 J, 39 J, 40 J, 41 J, 42 J, 43 J, 44 J, 45 J, 46 J, 47 J, 48 J, 49 J, 50 J, 51 J, 52 J, 53 J, 54 J, 55 J, 56 J, 57 J, 58 J, 59 J, 60 J, 61 J, 62 J, 63 J, 64 J, 65 J, 66 J, 67 J, 68 J, 69 J, 70 J, 71 J, 72 J, 73 J, 74 J or 75 J. In some embodiments, the energy delivered by the laser is 10 J, 20 J, 30 J, 40 J, 50 J, 60 J, 70 J, 80 J, 90 J or 100 J.
(51) A light or laser may be applied to the photosensitive molecules (or photosensitive VLPs) from about 5 seconds to about 5 minutes. For example, in some embodiments, the light or laser is applied to the photosensitive molecules for 5, 10, 15, 20, 25, 30, 35, 40, 45 50 or 55 seconds to activate the molecules. In some embodiments, the laser is applied to the photosensitive molecules for 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5 or 5 minutes, or more. It should be understood that the length of time a light or laser is applied to a photosensitive molecule can vary depending, for example, on the energy (e.g., wattage) of the later. For example, lasers with a lower wattage may be applied to a photosensitive molecule for a longer period of time in order to activate the molecule.
(52) A light or laser may be applied to the photosensitive molecules (or VLP conjugates) about 30 minutes to about 48 hours after administering the VLP conjugates. For example, in some embodiments, the light or laser is applied to the photosensitive molecules 30, 35, 40, 45, 50 or 55 minutes after administering the VLP conjugates. In some embodiments, the light or laser is applied to the photosensitive molecules 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 hours after administering the VLP conjugates. In some embodiments, the light or laser is applied to the photosensitive molecules 36 or 48 hours after administering the VLP conjugates.
(53) The light or laser may be applied directly to the site of the tumor. For example, VLP conjugates targeting ocular tumors may be activated by illuminating the eye.
(54) Any type of tumor can be targeting in accordance with the present disclosure. Examples of tumors include, without limitation, those located in the eye, lung, pleura, liver, pancreas, stomach, esophagus, colon, breast, ovary, prostate, brain, meninges, testis, kidneys, bladder, head, neck, cervix, larynx and/or skin.
(55) In some embodiments, the tumor is an ocular tumor. The ocular tumor may be located in the vitreous, choroidal space, iris, ciliary body, sclera, fovea, retina, optic disk or optic nerve.
(56) The tumor, in some embodiments, is cancerous or malignant. In some embodiments, the tumor is metastatic. Other tumors may also be targeted. For example, the present application provides methods and compositions for targeting cervical cancer cells, ovarian cancer cells, melanoma cancer cells, lung cancer cells, head and/or neck cancer cells, and bladder cancer cells.
(57) Compositions
(58) The virus-like particles (viral-like nanoparticles) of the present disclosure are, in some embodiments, photosensitive molecule-conjugated viral-like nanoparticles. The viral-like nanoparticles contain one or two types of capsid proteins from papilloma virus. In some embodiments, the capsid proteins are modified. Capsid proteins typically self-assemble into empty proto-capsids approximately 55 nm in diameter (e.g., spherical-like particles containing a hollow core). After maturation of the proto-capsids to form viral-like nanoparticles (virus-like particles), viral-like nanoparticles are then chemically conjugated with a photosensitive molecule (e.g., IR700 dye such as IRDye? 700DX, an infrared dye manufactured by LI-COR?).
(59) In some embodiments, the photosensitive viral-like nanoparticles are provided in a sterile, solution (e.g., 1 or 2 ml) in single use vials (e.g., borosilicate glass vials). In some embodiments, the photosensitive viral-like nanoparticles are provided in a sterile solution of water that optionally includes NaCl, KCl, Na.sub.2HPO.sub.4.2H.sub.2O, KH.sub.2PO.sub.4, or any combination of two or more of the foregoing. In some embodiments, NaCl may be present in the solution at a concentration of 400 to 600 mMol (e.g., 500 mMol). In some embodiments, KCl may be present in the solution at a concentration of 2 to 6 mMol (e.g., 2.7 mMol). In some embodiments, Na.sub.2HPO.sub.4.2H.sub.2O may be present in the solution at a concentration of 5 to 15 mMol (e.g., 10 mMol). In some embodiments, KH.sub.2PO.sub.4 may be present in the solution at a concentration of 1 to 3 mMol (e.g., 2 mMol).
(60) It some embodiments, photosensitive viral-like nanoparticles are diluted and administered intra-ocularly using a sterile syringe and needle commonly used in ophthalmic procedures. The present disclosure also provides other routes of administration and administration to other tumors and/or metastases, as described elsewhere herein.
(61) In some embodiments, each viral-like nanoparticle comprises 12-72 capsomers with each capsomere containing 5 molecules of L1 capsid protein (e.g., 55-56 kD each) and 1 molecule of L2 capsid protein (e.g., 52 kD each). In some embodiments, each viral-like nanoparticle comprises 12-72 capsomers with each capsomere containing only L1 capsid proteins (e.g., 5 molecules of L1 protein per capsomere).
(62) In some embodiments, each viral-like nanoparticle is chemically conjugated (e.g., via an amide bond) with 10 to 1000 molecules (e.g., 500 molecules) of photosensitive molecule (IR700 dye such as IRDye? 700DX) to at least one amino acid (e.g., lysine amino acid) of the protein.
(63) Methods of Producing Virus-Like Particles
(64) To produce photosensitive viral-like nanoparticles of the present disclosure, mammalian cells, such as 293T cells (e.g., HEK293F cells) may be grown (e.g., in suspension culture) and transiently transfected with a nucleic acid (e.g., bi-cistronic plasmid DNA) encoding BPV or HPV L1 (or L1 and L2) capsid proteins. This induces the formation of proto-capsids (e.g., as described in Buck et. al. Current Protocols in Cell Biology 26.1.1-26.1.19, December 2007). Following cell mass recovery and disruption, the proto-capsids may be subjected to host DNA clearance with benzonase treatment and a subsequent maturation process in vitro to form stable viral-like nanoparticles. Following purification, the viral-like nanoparticles may be chemically conjugated with photosensitive molecules (e.g., IR700 NHS ester) to produce the photosensitive viral-like nanoparticles.
(65) Thus, in some aspects, provided herein are methods of producing photosensitive molecules, comprising (a) transiently transfecting cells with a nucleic acid that encodes one or more capsid proteins, thereby forming proto-capsids, (b) collecting the proto-capsids and subjecting the proto-capsids to a maturation process in vitro, thereby forming stable viral-like nanoparticles, and (c) chemically conjugating the viral-like nanoparticles to 50 to 1000 photosensitive molecules. In some embodiments, the viral-like nanoparticles are conjugated to 500 photosensitive molecules. In some embodiments, the viral-like nanoparticles are conjugated to photosensitive molecules through an amide bond (e.g., by reacting an ester group of a photosensitive molecule with an amine group of an amino acid the capsid protein of a viral-like nanoparticle).
EXAMPLES
Example 1Conjugation of IRDye? 700DX
(66) The procedure of chemical conjugation of VLPs (e.g., viral-like nanoparticles containing a combination of variant HPV16/31 L1 proteins and HPV L2 proteins) to a photosensitive molecule (e.g., IRDye? 700DX) is as follows. Typically, solutions of VLPs were maintained at a concentration of 1 mg/ml in PBS, pH=7.2 and 0.3 to 0.5 M NaCl. The IR700 (e.g., IRDye? 700DX) molecules were supplied from the manufacturer as dry NHS (N-Hydroxysuccinimide) esters (NHS-esters react with amine groups on proteins to form covalent amide bonds) (
(67) TABLE-US-00001 TABLE 1 Volume of IR700- Ratio of IR700-NHS: Mass of IR700-NHS NHS solution for VLP for 1 mg of VLP 1 mg of VLP 200:1 16 ?g 3.2 ?l 500:1 40 ?g 8 ?l 1000:1 80 ?g 16 ?l
(68) To make a 200:1 ratio, 1 ml of VLP at 1 mg/ml in PBS was mixed with 3.2 ?l of the IR700-NHS ester solution. These reactions were run for 2-4 hours at room temperature. Following the completion of the reaction, the VLPs were purified by heparin affinity column chromatography to separate the unbound IR700-NHS from the newly formed VLP-IR700 conjugate (also referred to as a photosensitive VLP).
Example 2Conjugation of Visudyne?
(69) The conjugation of Visudyne? to the VLPs followed a slightly different protocol relative to the IR700-NHS. Visudyne? molecules required functionalization to NHS, prior to conjugation to VLPs. This functionalization was achieved through the use of EDC (1-ethyl-3-(-3-dimethylaminopropyl) carbodiimide hydrochloride). EDC was used to functionalize molecules that have a free carboxylic acid molecule, such as Visudyne? (see
Example 3VLP Binding Specificity is Mediated by HSPG and Inhibited by Heparin
(70) SK-OV-3 cells in suspension were treated under the following conditions: no VLP (e.g., viral-like nanoparticles containing a combination of variant HPV16/31 L1 proteins and HPV L2 proteins), VLP conjugated to either Alexa Fluor? 488 (
Example 4Cell Death Depends on Infrared Radiation and the Amount of VLP and IR700
(71) SK-OV-3 cells in suspension were treated with differing concentrations of VLP (e.g., viral-like nanoparticles containing a combination of variant HPV16/31 L1 proteins and HPV L2 proteins) had been conjugated with differing amounts of IR700 dye (e.g., IRDye? 700DX). VLP without conjugation to IR700 dye was used as a control. Following incubation, these cultures were subjected to 0 or 16 joules of 690 nm near-infrared light. Following the light treatment, the extent of cell death was assessed.
Example 5In Vitro Cell Death of SKOV-3 Cells Upon Irradiation Following Treatment with VLPs Conjugated to IR700
(72) SKOV-3 ovarian cancer cells were plated on a 24-well plate and treated with two different concentrations of photosensitive VLP particles (e.g., viral-like nanoparticles containing a combination of variant HPV16/31 L1 proteins and HPV L2 proteins conjugated to IR700 dye), 2.5 ?g (red) and 0.25 ?g (blue), for 1 h at 37? C. Upon binding, the cells were washed, followed by treatment with 4J of light. Cell death was determined upon enzymatic estimation of LDH release (determined by measuring absorbance at 490 nm). Three different molar ratios of VLP:IR700 conjugation were tested: 1:500, 1:1000 and 1:2000, respectively.
Example 6Structural Evaluation of IR700-PsV Complexes
(73)
Example 7Agent Binding Determines Extent of Cell Death in an Ocular Melanoma Cell Line
(74) Ocular melanoma cell line (92.1; HER2.sup.?) in suspension were exposed to varying dilutions of either Herceptin? antibody conjugated to IR700 dye (e.g., IRDye? 700DX) or VLPs (e.g., viral-like nanoparticles containing a combination of variant HPV16/31 L1 proteins and HPV L2 proteins) conjugated to IR700 dye. Parallel cultures were then assessed for agent binding (
Example 8Agent Binding Determines Extent of Cell Death in an Ovarian Cancer Cell Line
(75) SK-OV-3 cells (HER2.sup.?) in suspension were exposed to varying dilutions of either Herceptin? antibodies or VLPs particles (e.g., viral-like nanoparticles containing a combination of variant HPV16/31 L1 proteins and HPV L2 proteins) conjugated to IR700 dye (e.g., IRDye? 700DX). Parallel cultures were then assessed for Herceptin? or VLP binding (
Example 9Vaccine Induced Anti-HPV16 Neutralizing Antibodies do not Block Binding of BPV*IR700 VLPs to the Ocular Melanoma Cell Line, 92.1
(76) Samples of serum containing different antibodies were tested for the ability to inhibit photosensitive VLP particles (e.g., HPV16 VLPs or BPV VLPs) binding to the 92.1 ocular melanoma cell line.
Example 10Immunogenicity Evaluation
(77) In a study similar to that described in Example 9, neutralizing titers were determined by serial dilution of sera containing antibodies against either HPV16 or BPV. The results described in Table 2 show that antibodies against HPV16 neutralize only HPV16. Moreover, antibodies against BPV neutralize only BPV. Thus, there is neither cross-reactivity of HVP16 antibodies against BPV nor BPV antibodies against HPV16.
(78) TABLE-US-00002 TABLE 2 HPV 16 BPV Human anti-HPV16 1:57,759 1:24 Rabbit anti-HPV16 1:2,876,000 1:21 Rabbit anti-BPV 1:83 1:14,332
Example 11Binding Study
(79) The goal of this Example was to assess the binding of viral-like nanoparticles containing human papilloma virus 16 (HPV16) capsid proteins, variant HPV16/31 L1 capsid proteins, and bovine papilloma virus (BPV) capsid proteins to various types of cancer cells. In addition, viral-like nanoparticles containing L1 and L2 capsid proteins, or only L1 capsid proteins, were tested to determine if there was a dependence on L2 for viral-like nanoparticle binding to cancer cells. Results of this study show that binding of BPV viral-like nanoparticles and HPV viral-like nanoparticles are comparable.
(80) A large panel of cell lines was screened, which included: miscellaneous cell lines (e.g., 293TT, HaCaT, PAM-212 and TC-1), cervical cell lines (e.g., HeLa, SiHa, CaSki and C-33A), ovarian cell lines (e.g., MOSEC, SHIN-3, SK-OV-3, WF-3, ES-2, A2780, OVCAR-3 and OVCAR-4), melanoma cell lines (e.g., B16F10, SKMEL-2, SKMEL-5, SKMEL-28 and UACC), ocular melanoma cell lines (e.g., 92.1, MKT-BR, OCM-1 and UW-1), lung cell lines (e.g., NCI-H23, NCI-H322M, NCI-H460 and NCI-H522), head and neck cell lines (e.g., CAL-33 (HPV?), FaDu (HPV?), HSC-3 (HPV?), SNU-1076 (HPV?), UM-SCC-47 (HPV+), UPCI-SSC-90 (HPV+) and UPCI-SCC-154 (HPV+), and bladder cell lines (e.g., 5637, J82, RT112, SCaBER, SVHUC, T24, UMUC-3, UMUC-5).
(81) Prior to the experiment, viral-like nanoparticles were conjugated to AlexaFluor488 to allow for easy and direct analysis of viral-like nanoparticle binding to the cell surface. AlexaFluor488 was attached to the viral-like nanoparticle using N-Hydroxysuccinimide (NHS)-ester chemistry, which does not interfere with binding. Each of the viral-like nanoparticles was tested at a concentration of 10 ?g/ml, 1 ?g/ml and 0.1?/ml.
(82) Cells were trypsinized to remove them from the plastic surface of tissue culture plates, washed and allowed to recover for 4 hours at 37? C. in growth media on a rocking platform. The cells were then washed, counted and placed into a 96-well round bottom plate at 1?10.sup.5 cells/well in phosphate buffered saline (PBS)/2% fetal bovine serum (FBS). The viral-like nanoparticles were added to the cells in a final volume of 100 ?l PBS/2% FBS. Viral-like nanoparticles pre-incubated with heparin (1 mg/ml, 1 hour, 4? C.) were also added to wells as controls. The cells and viral-like nanoparticles were then incubated for 1 hour at 4? C. (in the dark), washed twice with PBS/2% FBS and fixed with 4% paraformaldehyde for 15 minutes at room temperature. Cells were finally washed again and resuspended in 200 ?l PBS/2% FBS and analyzed on a BD FACS CANTO? II (BD Biosciences, San Jose, Calif.) using BD FACSDIVA? (BD Biosciences, San Jose, Calif.) and FlowJo software.
(83) Results using the TC-1, HeLa, SK-OV-3, SKMEL-28, 92.1, NCI-H322M, HSC-3, UPCI-SCC-154 and T24 cell lines are presented as histograms in
Example 12Biodistribution Time Course
(84) The goal of this Example was to assess tumor localization and time course of clearance of viral-like nanoparticles following intravenous injection into tumor-bearing animals.
(85) Purified viral-like nanoparticles were prepared by labeling viral-like nanoparticles (e.g., viral-like nanoparticles containing a combination of variant HPV16/31 L1 proteins and HPV L2) with IR700 dye (e.g., IRDye? 700DX) at a viral-like nanoparticle:dye ratio of 1:500. The photosensitive viral-like nanoparticles were purified by density gradient ultracentrifugation using OPTIPREP? Density Gradient Medium.
(86) Tumors were generated in albino C57B116 mice by subcutaneous injection of 2?10.sup.5 TC-1 cancer cells in 100 ?l of PBS. After about two weeks, animals were randomized into treatment groups. Tumor-bearing animals received by intravenous injection either PBS or 200 ?g of the photosensitive viral-like nanoparticles in a volume of 100 ?l. Twelve or twenty-four hours following injection, the animals were euthanized. Following euthanasia, tumor tissue was harvested and imaged for fluorescence of the IR700 dye (e.g., IRDye? 700DX), indicating presence of the photosensitive viral-like nanoparticles.
(87)
Example 13Biodistribution Time Course
(88) The goal of this Example was to assess tumor localization and time course of clearance of viral-like nanoparticles following intravenous injection into tumor-bearing animals.
(89) Purified viral-like nanoparticles were labeled with AlexaFluor488 in lysate and purified by density gradient ultracentrifugation using OPTIPREP? Density Gradient Medium.
(90) Tumors were generated in albino C57Bl/6 mice by subcutaneous injection of 2?10.sup.5 TC-1 cancer cells in 100 ?l of PBS. After about 2 weeks, 200 ?g of the photosensitive viral-like nanoparticles were delivered by intravenous injection in a volume of 100 ?l. Tumors were harvested at the following time points following photosensitive viral-like nanoparticle injection: T=1, 2, 4, 8, 12, 24, 48 and 72 hours. Upon harvest, fragments of tumors were frozen for microscopic assessment. For this microscopic assessment, tissue sections were further stained. Rabbit polyclonal sera against HPV16 was used in conjunction with an AlexaFluor-488 secondary antibodies. Blood vessels were co-stained with a rat anti-CD31 antibody and an anti-rat AlexaFluor-594 secondary antibody. Nuclei where highlighted with DAPI.
(91) Data (in situ images not shown) demonstrate the presence of the photosensitive viral-like nanoparticles at the 1-hour time point. The localization of the signal appeared to be associated within the blood vessels. The maximum level of staining appeared to occur at the 8-hour time point, and at the 8-hour time point, the photosensitive viral-like nanoparticles appeared to be diffusing from within the blood vessels to the tumor cells. Finally, at the 24-hour and 48-hour time points, there appeared to be little viral-like nanoparticle signal in the tumor.
Example 14In Vivo Efficacy after Systemic Administration
(92) The study presented in this Example was designed to measure tumor viability 24 hours after a single treatment. The study establishes guidelines for long-term in vivo studies.
(93) Full study design is illustrated in
(94) A single dose of 200 ?g of IR700 (e.g., IRDye? 700DX) photosensitive viral-like nanoparticles (NPs) was capable of killing the majority of the tumor cells after treatment with 50 J of light (
Example 15Immune System Activation Study
(95) The TC-1 tumor model offers the ability to examine anti-tumor immune induction upon treatment with viral-like nanoparticles in immune competent animals. The TC-1 tumor line was developed from C57Bl/6 lung epithelial cells immortalized with HPV16 oncogenes E6 and E7 as well as a mutated gene expressing c-Ha-Ras (Lin K Y, et al., Cancer Research. 56(1):21-6, 1996). These cells can be implanted subcutaneously or, for studying metastatic models, they can be injected intravenously to seed cells in the lungs. For nearly twenty years these cells have been used to test E6 and E7 therapeutic vaccine efficacy. E7 has a distinctive MHC class I epitope on the C57Bl/6 background that has been shown to be protective if a CD8 T-cell response can be elicited against it (H-2D.sup.b, aa 49-57 RAHYNIVTF (SEQ ID NO: 3)) (Feltkamp M C, et al. European Journal of Immunology. 23(9):2242-9, 1993). These responses are detected by both tetramer staining and re-stimulation of cells with the peptide followed by intracellular cytokine staining.
(96) Does Response Study:
(97) Animals were inoculated subcutaneously with 2?10.sup.5 TC-1 cells in 100 ?l of PBS. Approximately two weeks after inoculating, animals were randomized into six groups: (1) no treatment controls, (2) 100 ?g viral-like nanoparticles (containing a combination of variant HPV16/31 L1 proteins and HPV L2 proteins labeled with IRDye? 700DX) without light controls, (3) PBS with 50 J/cm.sup.2 light controls, (4) 200 ?g viral-like nanoparticles with 50 J/cm.sup.2 light, (5) 100 ?g n viral-like nanoparticles with 50 J/cm.sup.2 light and (6) 50 ?g viral-like nanoparticles with 50 J/cm.sup.2 light. Mice received PBS or viral-like nanoparticles by intravenous injection of a 100 ?l volume, and light was applied to the tumor 12 hours later using a 690 nm laser. Tumors were harvested 24 hours later, digested to generate a single cell suspension, and stained with a viability stain to measure the percentage of dead cells (
(98) Several animals in the high dose group experienced symptoms related to tumor lysis syndrome, likely due to the massive and rapid tumor necrosis and release of intracellular components into the animals' system. While none of the 100 ?s nanoparticles with 50 J/cm2 light group died, mice in the group did display some signs of sickness (
(99) Survival Study:
(100) Animals were inoculated subcutaneously with 2?10.sup.5 TC-1 cells in 100 ?l of PBS. Approximately two to three weeks after inoculating, animals were randomized into the treatment group (25 ?g viral-like nanoparticles) and the placebo group (PBS only). Mice received two rounds of treatment, three days apart. A treatment was considered a single intravenous injection of 100 ?l of either 25 ?g of viral-like nanoparticles or sterile PBS, followed 12 hours later by light treatment at 50 J/cm.sup.2 using a 690 nm laser. Tumor volumes were measured every 3-4 days, and animals were euthanized when their tumors reached a size>1500 mm.sup.3 (
(101) Treatment with viral-like nanoparticles was able to delay growth or eradiate tumors in animals with tumors less than 500 mm.sup.3 (
(102) Immunology Study:
(103) For the immunological readout, blood was collected on day 0 (prior to first treatment), day 10 and day 17. Red blood cells were lysed and the remaining cells were split into two, one half stained for cell surface markers (CD62L, CD127, CD103, CD69, CD4, CD8, CD3, H2-D.sup.6E7(49-57) tetramer). The other half was re-stimulated for 4.5 hours with HPV16 E7 peptide 49-57 followed by staining with antibodies against CD4, CD8 and IFN-gamma as well as a viability dye to discriminate live cells.
(104) In the blood of the two animals with controlled tumor growth, both E7 tetramer.sup.+ CD8.sup.+ T-cells and INF-gamma secreting CD8.sup.+ cells (after re-stimulation with E7 peptide) could be detected, indicating that a potential anti-tumor response had been elicited (
Example 16Histological Analysis
(105) The effects of photosensitive viral-like nanoparticles (e.g., viral-like nanoparticles containing a combination of variant HPV16/31 L1 proteins and HPV L2 proteins conjugated to IR700 dye) at the histological level were assessed using a murine xenograft model. Briefly, 1.5?10.sup.6 92.1 uveal melanoma cells were implanted into the subcutaneous space of the hind flank of nu/nu mice. The tumors were allowed to reach approximately 200 mm.sup.3, at which time the animals were treated with an intravenous injection of 200 ?g of photosensitive viral-like nanoparticles. Twelve hours following the injection of photosensitive viral-like nanoparticles, the tumor site was irradiated with 50 J/cm.sup.2 of 690 nm near-infrared light. After an additional 24 hours, the animals were euthanized, the tumor tissue excised, fixed in formalin, paraffin embedded and processed for standard histological examination.
(106) The hematoxylin and eosin (H&E) images revealed a large degree of necrosis, when compared to untreated controls (images not shown). The tumor treated with photosensitive viral-like nanoparticles and laser had a pale appearance when compared to the control tumor. Upon examination at higher magnification, the cells of the photosensitive viral-like nanoparticle-treated tumors showed a dramatic loss of cytoplasm compared to the control treated tumor. Moreover, the extent of necrosis covered the entire tumor leading to the conclusion that the NW light penetrates through the entire depth of tumor tissue.
Example 17Viral-Like Nanoparticle Activity in an Orthotopic Xenograft Model of Uveal Melanoma
(107) The most common primary malignancy of the eye is uveal melanoma (UM). Approximately 2,000 patients present annually in the US, with more frequent occurrence in Europe. Though several treatment options exist for UM, no treatment reliably controls tumor growth, preserves vision, and minimizes the occurrence of radiation-related side effects.
(108) Viral-like nanoparticle phototherapy (PT) is a novel molecular-targeted cancer therapy that involves a two-stage process requiring administration of both drug and light activation. The drug portion of viral-like nanoparticle PT is a photosensitive viral-like nanoparticle (NP) conjugated to IRDye?700 DX, a near-infrared (NIR) phthalocyanine dye that acts as a light sensitizer, followed by the application of non-thermal NIR light designed to treat adults with primary uveal melanoma.
(109) In the current study the anti-cancer activity of the photosensitive viral-like nanoparticle was evaluated in an orthotopic xenograft model of uveal melanoma. In this model, human uveal melanoma cells were implanted into the choroidal space of immunosuppressed rabbits and allowed to grow. When tumors were observable by fundoscopy, the animals were assigned to treatment or control groups. In both cases, the animals were followed by fundoscopy and ultrasound for progressive tumor growth or response to treatment. Following termination of the study, the tumor-bearing eyes were also examined by gross and histopathology.
(110) This study was carried out in using 20 total rabbits implanted with the 92.1 uveal melanoma cell line. In total, 11 of twenty animals developed tumors. Two animals died unexpectedly during the follow-up period prior to treatment; these animals were used as untreated controls. Several animals had extra-ocular tumors that were not lasered; these were used as internal controls. Animals with tumors in the anterior chamber were excluded from the study.
(111) All treated tumors showed a major tumor response compared to control animals, demonstrated by fundoscopy, gross pathology and histopathology evaluation. Retinal tissues adjacent to tumors were not affected by the treatment.
(112) In conclusion, based on the extent of the tumor response and necrosis seen following photosensitive viral-like nanoparticle administration and laser administration, the treatment methodology provided herein may be used for the treatment uveal melanoma tumors.
(113) Study Schedule:
(114) Two treatment groups: 1) full tumor treatment; 2) No treatment.
(115) TABLE-US-00003 TABLE 3 Animals arrive Apr. 22/23.sup.rd, 2014 Tumor cell implantation Apr. 29/30.sup.th, 2014 Treatment start May 20.sup.th, May 27.sup.th, June 3.sup.rd, 2014 Study termination Jun. 24.sup.th, 2014 Draft report Jul. 25.sup.th, 2014
Methods and Experimental Design:
Test System
(116) TABLE-US-00004 TABLE 4 Species: Rabbit Strain: New Zealand Albino Number and Sex Total ordered: 20 Proposed total in study: 20 Sex: F Age at Receipt: 6 months Source: Charles River Identification: RFID and ear tag
Model
(117) Cell Culture
(118) Human uveal melanoma cell line 92.1 (courtesy of Dr. Jerry Y. Niederkorn, University of Texas Southwestern Medical Center, Dallas, Tex.) were cultured at 37? C. in 5% CO.sub.2 in complete culture medium (RPMI-1640 with 10% fetal bovine serum, 100 U/mL penicillin G, 250 ng/mL amphotericin B, and 100 ?g/mL streptomycin solution).
(119) Animals and Induction of Immunosuppression
(120) New Zealand albino rabbits with a mean initial weight approximately 3 kg were used for this study. The rabbits were immunosuppressed with daily subcutaneous injections of cyclosporin A (CsA; Sandimmune 50 mg/mL; Novartis Pharmaceuticals, Cambridge, Mass., USA). CsA administration was maintained throughout the experiment to prevent spontaneous tumor regression. The dosage schedule was 15 mg/kg per day for 3 days before cell inoculation and for 4 weeks thereafter, followed by 10 mg/kg per day until the end of the experiment. Dosage was further attenuated at the discretion of the veterinarian. CsA doses were adjusted daily according to each animal's body weight. The body weight was measured daily, and was posted in the room where the rabbits were housed.
(121) During the follow-up, the animals were monitored daily for signs of CsA toxicity, such as gingival hypertrophy, drooling, diarrhea, and weight loss. If the animals showed early signs of CsA toxicity (e.g. loss of appetite), the vet staff was consulted immediately for supportive management, such as appetite stimulant and GI motility enhancer. Adjusting the injection dose was also considered according to the vet's recommendation.
(122) Cell Implantation
(123) On day 3 after CsA treatment, the animals were anesthetized with an intramuscular injection of ketamine (40 mg/kg) and xylazine (6 mg/kg). After anesthesia, 1-3 drops of 0.5% proparacaine hydrochloride were applied to the right eyes and 1.0?10.sup.6 92.1 human uveal melanoma cells in a volume of 100 ?l suspension was injected into the suprachoroidal space of the right eye of the rabbits using a bent cannula. Briefly, a sterile drape was placed over the eye in order to avoid any contamination with hairs or eye lashes, and the conjunctiva was cleaned with 10% betadine solution. Next, the eye was rotated forward using sutures beneath the ocular muscles, and after dissecting the conjunctiva, a sclerotomy was performed approximately 10 mm from the limbus. The cannula was then inserted into the slerotomy (?-? of its length) and the cells (100 ?L containing 1.0?10^6 cells) were injected into the suprachoroidal space. The needle was slowly retracted, and sutures closing the sclerotomy were tightened to ensure minimal reflux at the injection site. A drop of antibiotic ophthalmic solution (erythromycin ointment) was applied over the surgical wound to prevent infection.
(124) Housing, Feed, Water and Environmental Conditions, Acclimation
(125) The animals were housed in group housing in groups of 6 and fed food that is fresh, palatable, and nutritionally adequate ad libitum. Water that is clean, potable, and uncontaminated was provided ad libitum. Environmental controls were set to maintain temperatures 22?4? C. (68?5? F.) with relative humidity of 50%?20%. A 12-hour light/dark cycle was maintained. The animals were acclimated for at least 5 days after arrival at the facility prior to baseline evaluation. Animals were assigned to test groups after baseline fundoscopic evaluations.
(126) Test and Control Articles
(127) TABLE-US-00005 TABLE 5 Vehicle of Test Article Identity: PBS Storage Conditions: 4? C. for up to 3 months protected from light Handling Precautions: Standard PPE
(128) TABLE-US-00006 TABLE 6 Test Article Identity: Nanoparticle labeled with IRDye?700 DX Storage Conditions: 4? C. for up to 2 months protected from light Handling Precautions: Standard PPE
(129) TABLE-US-00007 TABLE 7 Laser Power Setting: 600 mW Duration: 83 s Fluence: 50 J/cm.sup.2 Spot size: 5.0 mm Wavelength: 690 nm
Preparation of Dose Formulations
(130) The test article was diluted 1:1 in sterile water for injection.
(131) Administration of Test/Control Articles
(132) Dosing: Photosensitive viral-like nanoparticle or saline was administered by intraocular injection in the vitreous.
(133) Laser administration: Laser treatment was applied using a slit lamp system with a Coherent Opal Photoactivator? laser delivering 690 nm light at a power of 600 mW over a duration of 83 seconds for a total fluence of 50 J/cm.sup.2. The laser spot size was set to a diameter of 5 mm and as such, tumors that were greater than this size were lasered with overlapping spots. In cases where a clear distinction of the tumor border could not be delineated due to ocular complications (e.g., vitritis, retinal detachment) the entire suspicious area was lasered.
(134) Mortality/Morbidity Checks: All animals remained in good health throughout the study, aside from the two animals that died due to CsA complications (see below).
(135) Clinical Observations: All animals were observed daily by animal facility personnel; observations were recorded. Most animals experienced some degree of weight loss and loss of appetite, which was attributed to the CsA.
(136) Ophthalmology
(137) Frequency: Ophthalmic examination by fundoscopy and ultrasound was performed weekly.
(138) Procedure: The animal was sedated and their right eye was dilated using ocular phenylephrine hydrochloride and tropicamide drops. Next, a fundoscopic examination of the eye was performed using an indirect binocular ophthalmoscope. The ophthalmologist recorded any ocular complications. When a tumor was identified, the size was estimated by comparing it to the optic disc (disc diameter [DD]; 1 DD=approximately 1.75 mm). For the ultrasound readings, immediately following fundus exam, an ultrasound probe was applied to the eye to visualize the location of the tumor as determined by fundus exam. Ultrasound measurements proved technically difficult, primarily because some of the tumors were located too peripherally to be properly visualized. As a result, it was not always possible to measure the largest tumor dimension; and in most cases only the height in was quantifiable.
(139) Terminal Procedures and Anatomic Pathology
(140) Unscheduled Deaths: Of the 20 animals used in this study, one was euthanized due to weight loss (>20% of weight upon arrival), as per the protocol guidelines. One animal died unexpectedly due to gastrointestinal stasis caused by CsA toxicity.
(141) Scheduled Euthanasia: Upon the termination of the study, animals were euthanized in accordance with accepted American Veterinary Medical Association (AVMA) guidelines. The animals were exsanguinated with anesthesia using a combination of ketamine-xylazine-acepromazine (0.75 mg/kg, 5 mg/kg, and 20-35 mg/kg, respectively) and buprenorphine (0.2 mg/kg).
Results
(142) Overall, 11 animals developed histopathologically evident tumors. As previously mentioned, two animals that died unexpectedly and were used as the untreated control. 9 animals with different tumor sizes received treatment with photosensitive viral-like nanoparticles. One animal was not included in the evaluation due to the extent of tumor in the anterior segment of the equator that could not be lasered.
(143) For animals that had tumors in the back of the eye and received full treatment (photosensitive viral-like nanoparticle+laser) a noticeable tumor response was observed, which was characterized by three elements: 1) induction of extensive tumor necrosis; 2) change in the growth pattern, from diffuse to a sleeve-like pattern; and 3) sparing of the adjacent retina.
(144) TABLE-US-00008 TABLE 8 Fundoscopy and/or Animal ultrasound: Fundoscopy number & presence of and/or ultrasound: tumor location tumor before tumor evaluation Gross & and size treatment after treatment histopathology 3- Large tumor + Tumor growth Intraocular tumor with posterior to the arrest overall necrotic equator consistency on gross pathology >50% necrosis by histopathology No damage to adjacent retina 6- Large tumor + Tumor growth Intraocular tumor posterior to the arrest disaggregated on equator gross pathology evaluation >70% necrosis by histopathology No damage to adjacent retina 7- Medium size + Complete response Non-pigmented tumor tumor posterior on gross pathology to the equator No tumor found on histopathology - suspicious area ~8.2 mm in length suspected to correspond to tumor location 9- Small tumor + Complete response No tumor on gross posterior to the pathology equator Complete response on histopathology; no damage to adjacent retina 10- Medium + Tumor shrinkage Non-pigmented tumor sized tumor located at the equator posterior to the on gross pathology equator ~70% necrosis on gross pathology 11- Small tumor + Complete response No tumor on gross or posterior to the histopathology equator 15- Large tumor + Complete response Non-pigmented tumor posterior to the of treated nodule on gross pathology equator Partial necrosis located at the in peripheral periphery and tumor additional adjacent tumor nodule on the posterior of the eye Histopathology revealed no tumor where the treated nodule was present. Other areas that were too peripheral were difficult to have full access with the laser and show some extent of necrosis at the apex of the tumor 16- Tumor + Complete response Non-pigmented posterior to the nodule identified on equator gross pathology No tumor on histopathology; scar (fibrosis and inflammation) measuring ~1.5 mm in the area where the tumor is believed to have been located 19- Large tumor + Tumor growth Large tumor on gross posterior to the arrest pathology with equator disaggregated/necrotic appearance Massive necrosis, sleeve-like pattern
Untreated Controls
(145) Rabbit #14 was euthanized on week 4 due to unacceptable weight loss (>20% of initial body weight). Fundus examination for the presence of tumor was inconclusive due to massive hemorrhage and retinal detachment. This animal received no treatment.
(146) Ultrasound: This rabbit did not undergo an ultrasound examination due to the timing of death.
(147) Gross/histopathology: On gross pathology, an intraocular tumor measuring 3 mm in height (H)?8 mm in the largest tumor dimension (LTD), and on histopathology an intraocular tumor measuring 2.2 mm H and 9.5 in largest tumor dimension, was noted. On gross pathology, an extraocular tumor measuring 1.4 mm in height and 9.4 mm in largest tumor dimension were noted. Approximately 10% of both the intra- and extraocular tumors were necrotic. No sleeve pattern was detected.
(148) Full Treatment
(149) Rabbit 9
(150) Rabbit #9 had a clinically detectable tumor on fundus approximately 1 DD in size on week 4, which was treated immediately. The following week, the tumor was estimated as 0.5 DD. On week 6, the tumor was estimated at <0.5 DD and on the final week it was not detected.
(151) Ultrasound: Ultrasound did not discern a tumor on week 3, but on weight 4 a mass measuring 1.04 mm in height was identified. On subsequent weeks, the measurements on ultrasound regressed until it was no longer visible by week 6 and thereafter.
(152) Gross/Histopathology: Histopathology revealed no tumor or cells. However, serial sections of the entire eye and immunohistochemical results are pending to further confirm this result.
(153) Rabbit 6
(154) There was a clinical suspicion of a tumor on week 4 (elevated mass beneath the retina), but subretinal hemorrhage, fluid, and retinal detachment precluded clinical size estimation for the duration of the experiment.
(155) Ultrasound: By ultrasound, on week 3 a large 4.88 mm mass was detected, which grew to 5.29 mm on week 4, at which point we commenced treatment. On week 5, the tumor measured 4.88 mm, while on weeks 6 and 7 the tumor measured 4.02 and 4.98 mm, respectively.
(156) Gross/histopathology: On gross pathology, two distinct tumors were identified: an intraocular tumor and a conjunctival tumor, the latter suspected to be a result of reflux during cell implantation. Owing to the location of the conjunctival tumor, it was not treated, and thus we consider it as an internal control. The intraocular tumor was disaggregated and measured 7 mm H?11 mm LTD. An extraocular extension measuring 6 mm H?9 LTD mm was also identified, which had a characteristic texture. On histopathology, the intraocular tumor measured 4.9 mm H?8.3 LTD mm and was >70% necrotic, with most of the remaining viable cells forming the aforementioned sleeve-like pattern. The untreated conjunctival tumor exhibited far less necrosis (?15%) and the sleeve pattern was not evident.
(157) The goal of this study was to explore the activity of photosensitive viral-like nanoparticles+NIR light in an orthotopic xenograft model of uveal melanoma in the rabbit eye. All tumors that received photosensitive viral-like nanoparticles+laser treatment responded favorably to the treatment. This is particularly evident for small to medium tumors that had evident tumor shrinkage as a response of treatment and complete histopathological responses. In rabbit 9, for example, that presented with a small tumor at week 4, the tumor was completely eradicated by the first two doses of the treatment and was no longer detectable either clinically or histopathologically two weeks after the second treatment. In bigger tumors, for example rabbit 4, most of the tumor was necrotic, this is in stark contrast to the untreated control (rabbit 14), which only exhibited necrosis in approximately 10% of the tumor volume, a clear indication of the efficacy of the treatment. Moreover, several animals that had intraocular tumors that received full treatment had extraocular extensions that were not lasered; these fractions showed substantially less necrosis than treated tumor fractions, which is further evidence supporting the efficacy of laser activated photosensitive viral-like nanoparticles for the treatment of uvea melanoma. Retinal areas adjacent to tumors were not affected by the treatment.
(158) Based on the intraocular tumor response following treatment, especially compared to the controls (untreated, extraocular fractions), the data provided herein support a selective and potent anti-cancer activity for photosensitive viral-like nanoparticles, in the presence of a tumor, for the treatment of ocular melanoma.
Example 18In Vitro Potency Assay Comparing HPVL1 vs BPV L1
(159) Photosensitive viral-like nanoparticles (e.g., viral-like nanoparticles containing a combination of variant HPV16/31 L1 proteins and HPV L2 proteins conjugated to IR700 dye) potency was assayed by an in vitro cell killing assay. Uveal melanoma cells (e.g., cell line OCM-1 or 92.1) were harvested by routine methods using a solution of EDTA and trypsin. Once removed from the tissue culture plastic, the cells were suspended in complete growth media and were allowed to recover for approximately 30 minutes at 37? C. During this recovery period, serial dilutions of the photosensitive viral-like nanoparticle were made in approximately ? log increments (2000 pM, 600 pM, 200 pM, 60 pM, 20 pM, 6 pM, 2 pM and 0.6 pM) in PBS+2% fetal bovine serum. Following the recovery period, the cells were counted, centrifuged and suspended in PBS+2% FBS to a cell density of 3?10.sup.6/ml. An equal volume of cell suspension was added to the viral-like nanoparticle dilutions to yield 1.5?10.sup.6 cells per ml in the appropriate concentration (1000 pM, 300 pM, 100 pM, 30 pM, 10 pM, 3 pM, 1 pM and 0.3 pM) of viral-like nanoparticle. These conditions (e.g., 360 ?l) were incubated on ice for about 1.5 to 2 hours.
(160) Following this incubation, the tubes were centrifuged to collect the cells and the cells were subsequently washed twice with PBS+2% FBS, without the photosensitive viral-like nanoparticles. After the final centrifugation, the cells were suspended in 200 ?l of PBS+2% FBS. A 100 ?l of each sample is removed and transferred to the well of a 96-well, ? area plate. Each sample was then irradiated with 25 J/cm2 (600 mW, 43 seconds) of near infrared light (689 nm) using a Coherent Opal Photoactivator ophthalmic laser. Following the irradiation, the sample of cells was then transferred to a new tube. Both the light irradiated and non-irradiated samples were placed at 37? C. for an additional 1 to 2 hours.
(161) Following this incubation a final 20 ?l sample of cells were mixed 1:1 with AOPI stain (Acridine Orange and Propidium Iodide) and the viability of the cells was evaluated using a Nexcelom Cellometer Auto 2000.
(162)
Example 19Activity of Photosensitive Viral-Like Nanoparticles in a Xenograft Model of Head and Neck Cancer
(163) Head & Neck cancer cells were implanted in the dorsal lateral flank of nu/nu mice. Tumors were allowed to grow for two weeks. Once the tumor reached an average size of 150 mm.sup.3, the animals were randomized into 6 study groups (7 animals per group), as follows: Saline; photosensitive viral-like nanoparticles (HPV16/31 L1/L2; 200 ?g dose); Saline+NIR light (50 J/cm2); photosensitive viral-like nanoparticles (200 ?g dose)+NW light (50 J/cm2); photosensitive viral-like nanoparticles (100 ?g dose)+NIR light (50 J/cm2); and photosensitive viral-like nanoparticles (50 ?g dose)+NIR light (50 J/cm2). Dosing and NIR light treatment was performed every three days. Tumor measurements were recorded every 3-5 days.
(164) While all the controls showed no substantial effect for their respective treatments, there was a significant tumor growth inhibition observed in all of the dose groups (
Example 20Production of Photosensitive Viral-Like Nanoparticles
(165) To produce photosensitive viral-like nanoparticles of the present disclosure, HEK293F were grown in suspension culture and were transiently transfected with a bi-cistronic plasmid DNA encoding L1 (or L1 and L2) capsid proteins. This induces the formation of proto-capsids (as described in Buck et. al. Current Protocols in Cell Biology 26.1.1-26.1.19, December 2007). Following cell mass recovery and disruption, the proto-capsids went through benzonase treatment to eliminate the host DNA contaminants and a subsequent maturation process in vitro to form viral-like nanoparticles stable for conjugation. Following purification, the viral-like nanoparticles were chemically conjugated with IR700 NHS ester to produce the photosensitive viral-like nanoparticles.
(166) Photosensitive viral-like nanoparticles produced from the process described in this Example have been characterized using SDS-PAGE, SE-HPLC and DLS and show purities of 90-95%. Histones from the HEK293 cells are present as part of the viral-like nanoparticle composition and comprise of 10-15% of the total protein of the viral-like nanoparticle.
(167) Sequences
(168) TABLE-US-00009 VariantHPV16/31L1proteinnucleotidesequence (SEQIDNO:1) ATGAGCCTGTGGCTGCCCAGCGAGGCCACCGTGTACCTGCCCCCCGT GCCCGTGAGCAAGGTGGTGAGCACCGACGAGTACGTGGCCAGGACCA ACATCTACTACCACGCCGGCACCAGCAGGCTGCTGGCCGTGGGCCAC CCCTACTTCCCCATCAAGAAGCCCAACAACAACAAGATCCTGGTGCC CAAGGTGAGCGGCCTGCAGTACAGGGTGTTCAGGATCCACCTGCCCG ACCCCAACAAGTTCGGCTTCCCCGACACCAGCTTCTACAACCCCGAC ACCCAGAGGCTGGTGTGGGCCTGCGTGGGCGTGGAGGTGGGCAGGGG CCAGCCCCTGGGCGTGGGCATCAGCGGCCACCCCCTGCTGAACAAGC TGGACGACACCGAGAACGCCAGCGCCTACGCCGCCAACGCCGGCGTG GACAACAGGGAGTGCATCAGCATGGACTACAAGCAGACCCAGCTGTG CCTGATCGGCTGCAAGCCCCCCATCGGCGAGCACTGGGGCAAGGGCA GCCCCTGCACCAACGTGGCCGTGAACCCCGGCGACTGCCCCCCCCTG GAGCTGATCAACACCGTGATCCAGGACGGCGACATGGTGGACACCGG CTTCGGCGCCATGGACTTCACCACCCTGCAGGCCAACAAGAGCGAGG TGCCCCTGGACATCTGCACCAGCATCTGCAAGTACCCCGACTACATC AAGATGGTGAGCGAGCCCTACGGCGACAGCCTGTTCTTCTACCTGAG GAGGGAGCAGATGTTCGTGAGGCACCTGTTCAACAGGGCCGGCGCCG TGGGCGAGAACGTGCCCACCGACCTGTACATCAAGGGCAGCGGCAGC ACCGCCACCCTGGCCAACAGCAACTACTTCCCCACCCCCAGCGGCAG CATGGTGACCAGCGACGCCCAGATCTTCAACAAGCCCTACTGGCTGC AGAGGGCCCAGGGCCACAACAACGGCATCTGCTGGGGCAACCAGCTG TTCGTGACCGTGGTGGACACCACCAGGAGCACCAACATGAGCCTGTG CGCCGCCATCAGCACCAGCGAGACCACCTACAAGAACACCAACTTCA AGGAGTACCTGAGGCACGGCGAGGAGTACGACCTGCAGTTCATCTTC CAGCTGTGCAAGATCACCCTGACCGCCGACGTGATGACCTACATCCA CAGCATGAACAGCACCATCCTGGAGGACTGGAACTTCGGCCTGCAGC CCCCCCCCGGCGGCACCCTGGAGGACACCTACAGGTTCGTGACCAGC CAGGCCATCGCCTGCCAGAAGCACACCCCCCCCGCCCCCAAGGAGGA CCCCCTGAAGAAGTACACCTTCTGGGAGGTGAACCTGAAGGAGAAGT TCAGCGCCGACCTGGACCAGTTCCCCCTGGGCAGGAAGTTCCTGCTG CAGGCCGGCCTGAAGGCCAAGCCCAAGTTCACCCTGGGCAAGAGGAA GGCCACCCCCACCACCAGCAGCACCAGCACCACCGCCAAGAGGAAGA AGAGGAAGCTGTGA BPV1L1nucleotidesequence (SEQIDNO:2) ATGGCCCTCTGGCAGCAGGGGCAGAAACTCTACCTGCCACCCACACC CGTGTCAAAAGTCCTGTGTTCCGAGACATACGTCCAGCGGAAGTCAA TCTTCTACCACGCCGAGACCGAAAGGCTCCTCACCATCGGCCACCCC TACTACCCCGTCAGCATTGGCGCTAAGACCGTGCCCAAAGTCTCCGC CAACCAATACCGCGTGTTCAAGATCCAGCTGCCCGACCCAAACCAGT TCGCCCTGCCCGATCGCACCGTGCATAACCCCTCCAAGGAAAGACTC GTCTGGGCCGTGATCGGCGTCCAAGTCTCACGGGGCCAACCCCTGGG CGGCACCGTGACCGGCCATCCAACCTTCAACGCCCTCCTGGACGCCG AGAACGTCAACCGGAAAGTCACAACACAAACCACCGACGATCGCAAG CAGACCGGGCTGGACGCCAAACAGCAGCAAATCCTCCTCCTGGGGTG CACACCCGCTGAGGGCGAGTACTGGACCACCGCTCGGCCCTGCGTGA CCGACAGGCTGGAGAACGGGGCTTGTCCCCCCCTGGAGCTGAAGAAT AAGCATATCGAGGACGGCGACATGATGGAGATCGGCTTCGGCGCCGC TAACTTCAAGGAGATCAACGCCTCCAAGAGCGACCTGCCCCTGGATA TCCAGAACGAAATTTGTCTCTATCCCGATTATCTGAAGATGGCCGAA GATGCCGCCGGCAACTCAATGTTTTTCTTCGCCCGCAAGGAGCAAGT CTACGTGCGGCATATTTGGACACGGGGCGGGAGCGAAAAGGAGGCTC CCACAACCGACTTCTACCTGAAAAACAACAAGGGCGACGCTACACTG AAGATCCCATCCGTCCACTTCGGCTCCCCATCCGGGAGCCTCGTCAG CACCGACAACCAGATCTTCAACAGACCATATTGGCTGTTTAGGGCTC AAGGGATGAATAACGGCATCGCTTGGAACAACCTGCTCTTCCTGACC GTCGGCGATAACACCAGGGGCACCAACCTGACAATCTCCGTGGCTAG CGACGGCACACCCCTGACCGAATACGACTCAAGCAAGTTTAACGTGT ATCACCGGCACATGGAGGAGTACAAACTGGCTTTCATCCTGGAACTG TGTAGCGTCGAGATTACCGCCCAGACCGTCAGCCACCTCCAGGGCCT GATGCCAAGCGTCCTGGAGAACTGGGAGATCGGCGTCCAACCACCAA CAAGCAGCATCCTGGAAGATACATACAGATACATCGAAAGCCCCGCC ACCAAGTGCGCCTCAAACGTGATCCCCGCCAAGGAGGATCCCTACGC CGGCTTCAAATTCTGGAATATCGACCTGAAGGAGAAACTGAGCCTCG ATCTGGACCAGTTCCCACTCGGCCGGCGGTTCCTGGCCCAACAGGGC GCTGGCTGCAGCACCGTCCGGAAGAGGCGGATCTCACAAAAGACCAG TTCCAAACCCGCCAAGAAGAAGAAGAAGTAG