METHODS AND COMPOSITIONS FOR TISSUE REGENERATION
20220362262 · 2022-11-17
Inventors
- Shyh Chang NG (Beijing, CN)
- Tao Yan LIU (Beijing, CN)
- Lan Fang LUO (Beijing, CN)
- Kun LIANG (Beijing, CN)
- Wen Wu MA (Beijing, CN)
Cpc classification
C12N9/1205
CHEMISTRY; METALLURGY
A61P21/00
HUMAN NECESSITIES
A61K31/7068
HUMAN NECESSITIES
A61K31/5575
HUMAN NECESSITIES
C12Y207/11001
CHEMISTRY; METALLURGY
International classification
A61K31/5575
HUMAN NECESSITIES
A61K31/4439
HUMAN NECESSITIES
Abstract
Provided are methods and compositions for promoting tissue (e.g., muscle) regeneration using one or more activators of fatty acid oxidation, such as one or more PPARγ activators. The methods and compositions described herein are also useful for promoting tissue growth, inducing proliferation of stem cells, inducing differentiation of tissuegenic cells (e.g., myogenic cells), and treating a disease or condition associated with a tissue (e.g., muscle), such as tissue injury, degeneration or aging, in an individual.
Claims
1. A method of promoting regeneration of a tissue, comprising contacting the tissue with one or more activators of fatty acid oxidation (FAO activators), wherein the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, and a hair follicle.
2-5. (canceled)
6. The method of claim 1, wherein the tissue is contacted with the one or more FAO activators for no more than about 72 hours.
7. The method of claim 1, wherein the contacting is in vivo, in vitro, or ex vivo.
8. (canceled)
9. A method of treating a disease or condition associated with a tissue in an individual, comprising administering an effective amount of a pharmaceutical composition comprising a tissuegenic cell to the tissue of the individual, wherein the tissuegenic cell is contacted with one or more FAO activators prior to the administration of the pharmaceutical composition, and wherein the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, and a hair follicle.
10-13. (canceled)
14. A method of treating a disease or condition associated with a tissue in an individual, comprising administering an effective amount of one or more FAO activators to the individual, wherein the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, and a hair follicle.
15. The method of claim 9, wherein the disease or condition is tissue injury, tissue degeneration, tissue fibrosis, or aging.
16-19. (canceled)
20. The method of claim 14, wherein the tissue is an injured tissue.
21. The method of claim 20, wherein the one or more FAO activators is administered to the individual for no more than about 72 hours after the tissue injury.
22-23. (canceled)
24. The method of claim 1, wherein the tissue is a muscle tissue.
25. The method of claim 24, wherein the tissue comprises a tissuegenic cell, which is a myogenic cell.
26. The method of claim 25, wherein the myogenic cell is a myoblast and/or a myocyte.
27-36. (canceled)
37. The method of claim 1, wherein the one or more FAO activators comprise one or more activators of PPARγ.
38. A method of increasing FAO in a tissuegenic cell, comprising contacting the tissuegenic cell with one or more activators of PPARγ for no more than about 72 hours, wherein the tissuegenic cell is from a tissue selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, and a hair follicle.
39. A method of activating PPARγ in a tissuegenic cell, comprising contacting the tissuegenic cell with a prostaglandin selected from the group consisting of prostaglandin 12 (PGI2), prostaglandin D2 (PGD2), analogues, salts, solvates, tautomers, and stereoisomers thereof.
40-42. (canceled)
43. The method of claim 37, wherein the one or more activators of PPARγ comprise a thiazolidinedione, or derivative, salt, solvate, tautomer, or stereoisomer thereof.
44. The method of claim 43, wherein the thiazolidine is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof.
45. The method of claim 37, wherein the one or more activators of PPARγ comprise a prostaglandin selected from the group consisting of PGI2, PGD2, analogues, salt, solvate, tautomer, and stereoisomer thereof.
46. The method of claim 45, i) wherein the prostaglandin is PGI2, or a salt, solvate, tautomer, or stereoisomer thereof; or ii) wherein the prostaglandin is treprostinil, or a salt, solvate, tautomer, or stereoisomer thereof.
47. The method of claim 37, wherein the one or more activators of PPARγ are rosiglitazone and PGI2.
48. (canceled)
49. The method of claim 37, wherein the one or more activators of PPARγ are rosiglitazone and treprostinil.
50. (canceled)
51. The method of claim 37, wherein the one or more activators of PPART comprise i) a thiazolidinedione, or derivative, salt, solvate, tautomer, or stereoisomer thereof; and ii) a prostaglandin, or analogue, salt, solvate, tautomer, or stereoisomer thereof.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
[0161]
[0162]
[0163]
[0164]
DETAILED DESCRIPTION
[0165] The present application provides compositions and methods of using activators of fatty acid oxidation (“FAO”) to promote tissue (e.g., muscle) regeneration in vitro or in vivo. The present application is at least in part based on the inventors' surprising discovery of a transient burst of FAO at early phases within 72 hours of primary human myoblast differentiation. Furthermore, the present application demonstrates that activation of FAO, e.g., by a PPARγ agonist (such as rosiglitazone) and/or a prostaglandin (such as prostaglandin 12 (PGI2), prostaglandin D2 (PGD2), or an analogue thereof), induces differentiation of myogenic cells (e.g., myoblasts or myocytes) in cell cultures and enhances myogenesis in an animal model of muscle injury. Notably, the PPARγ agonist rosiglitazone can enhance muscle regeneration in aged animals, e.g., in mice whose age is equivalent to 60-years old in humans. Furthermore, PGI2 and its analogues act upstream of PPARγ and can synergize with PPARγ agonists to enhance muscle regeneration after injury. PGI2 and analogues can also activate stem cells and regeneration in multiple muscle tissues and other organs (e.g., skin, liver, heart etc.) even without injury. The methods and compositions described herein can be used to induce differentiation and/or maturation of tissuegenic cells (e.g., myogenic cells), promote tissue growth (e.g., muscle growth), and treating diseases or conditions associated with a tissue (e.g., muscle) such as tissue injury, degeneration or aging.
[0166] Accordingly, in some embodiments, there is provided a method of promoting regeneration and/or growth of a tissue and/or inducing proliferation of stem cells, and/or inducing differentiation and/or maturation of tissuegenic cells in a tissue, comprising contacting the tissue with one or more FAO activators (e.g., PPARγ agonist such as rosiglitazone, and/or PGI2, PGD2 or an analogue thereof). In some embodiments, the tissue is contacted with the one or more FAO activators for no more than about 72 hours (e.g., no more than about 48 hours or no more than about 24 hours). In some embodiments, the tissue is a muscle tissue. In some embodiments, the tissuegenic cells are myogenic cells.
[0167] In some embodiments, there is provided a method of treating a disease or condition associated with a tissue in an individual, comprising administering an effective amount of a pharmaceutical composition comprising tissuegenic cells to the tissue of the individual, wherein the tissuegenic cells are contacted with one or more FAO activators (e.g., PPARγ agonist such as rosiglitazone, and/or PGI2, PGD2 or an analogue thereof) prior to the administration of the pharmaceutical composition. In some embodiments, the tissuegenic cells are contacted with the one or more FAO activators for no more than about 72 hours (e.g., no more than about 48 hours or no more than about 24 hours). In some embodiments, the tissue is a muscle tissue. In some embodiments, the tissuegenic cells are myogenic cells. In some embodiments, the disease or condition is tissue injury, tissue regeneration, tissue fibrosis or aging.
[0168] In some embodiments, there is provided a method of treating a disease or condition associated with a tissue in an individual, comprising administering an effective amount of a pharmaceutical composition comprising one or more FAO activators (e.g., PPARγ agonist such as rosiglitazone, and/or PGI2, PGD2 or an analogue thereof) to the individual. In some embodiments, the pharmaceutical composition is administered about once every 24 hours, 48 hours or 72 hours. In some embodiments, the disease or condition is tissue injury. In some embodiments, the pharmaceutical composition is administered to the individual no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours after the tissue injury. In some embodiments, the tissue is a muscle tissue.
I. Definitions
[0169] Terms are used herein as generally used in the art, unless otherwise defined as follows.
[0170] The terms “fatty acid oxidation” and “FAO” are used herein interchangeably to refer to the biochemical process of breaking down a fatty acid into acetyl-CoA units. In some embodiments, the FAO is in the mitochondria of a cell. In some embodiments, the FAO is in the peroxisome of a cell.
[0171] As used herein, “tissuegenic cells” refer to cells that can proliferate and/or differentiate to a specialized, mature cell type and to regenerate a tissue. Exemplary tissuegenic cells include but are not limited to stem cells, progenitor cells, precursor cells, and combinations thereof. As used herein, “myogenic cells” refer to cells that can proliferate and/or differentiate to give rise to a muscle tissue. Myogenic cells include, but are not limited to, muscle stem cells, myoblasts, myocytes, myotubes, and myofibers. The myogenic cells contemplated herein may give rise to skeletal muscle, smooth muscle, and/or cardiac muscle.
[0172] As used herein, a “stem cell” is an undifferentiated cell characterized by the ability of self-renewal through mitotic cell division and the potential to differentiate into progeny cells, including self-renewing progenitors, non-renewing progenitors, and terminally differentiated cells. “Muscle stem cells” refer to stem cells found in adult muscle tissues, including for example, satellite cells.
[0173] As used herein, “progenitor cells” refer to undifferentiated cells that have the potential to differentiate into specialized cell types in a tissue. Muscle progenitor cells include, but are not limited to, muscle stem cells and myoblasts. Primary adult muscle progenitor cells have limited proliferative capacities, upon which they enter a senescent state and lose both proliferative and differentiation capacities. In contrast, embryonic and fetal muscle progenitor cells have heightened proliferative capacities despite many rounds of mitosis, and manifest robust regenerative response upon injury and transplantation.
[0174] As used herein, “myoblasts” refer to mononuclear muscle progenitor cells that can differentiate to give rise to muscle cells.
[0175] As used herein, “myocytes” refer to mononuclear muscle cells that result from differentiation of muscle progenitor cells.
[0176] As used herein, “myotubes” refer to multi-nucleated muscle cells that result from the fusion of myocytes.
[0177] As used herein, “myofibers” refer to terminally differentiated, multi-nucleated, and striated muscle cells that develop from myotubes.
[0178] As used herein, “activator” refers to an agent that increases the activity, expression, and/or quantity of a target. The agent may be of any molecular entity, including but not limited to, small molecules, peptides, proteins, nucleic acids (e.g., RNA, DNA, microRNA, chemically modified nucleic acids, etc.), and combinations thereof. The target of an activator may be a gene, a small molecule (e.g., a metabolite), a protein, a molecular pathway, or any combination thereof. In some embodiments, an activator increases the activity, expression, and/or quantity of a target by about any one of at least 10%, 20%, 50%, 2×, 5×, 10×, 100×, 1000×, or more, including any value or range in between these values. An activator of a target may directly interact with (e.g., bind to) the target, or act in a signalling pathway upstream of the target to regulate the activity, expression and/or quantity of the target.
[0179] As used herein, “PPARγ agonist” refers to an agent that increases the activity, expression and/or quantity of PPARγ by binding to and activating PPARγ or a complex thereof. A PPARγ agonist may be of any suitable molecular entity, including small molecules, peptides, proteins, nucleic acids, and combinations thereof. In some embodiments, the PPARγ agonist mimics a natural ligand of PPARγ.
[0180] As used herein, “PPARγ,” “PPARg,” “PPARG,” or “PPAR-gamma” refers to peroxisome proliferator-activated receptor gamma, including all isoforms (PPARγ1-3) thereof. In some embodiments, PPARγ is PPARγ1. In some embodiments, PPARγ is PPARγ2. In some embodiments, PPARγ forms a complex with retinoid X receptor (RXR), which binds to specific regions on the DNA of target genes.
[0181] As used herein, “treatment” or “treating” is an approach for obtaining beneficial or desired results including clinical results. For purposes of this invention, beneficial or desired clinical results include, but are not limited to, one or more of the following: decreasing one or more symptoms resulting from the disease, diminishing the extent of the disease, stabilizing the disease or condition (e.g., preventing or delaying the worsening of the disease or condition), preventing or delaying the spread of the disease or condition, preventing or delaying the occurrence or recurrence of the disease or condition, delaying or slowing the progression of the disease or condition, ameliorating the disease state, providing a remission (whether partial or total) of the disease or condition, decreasing the dose of one or more other medications required to treat the disease or condition, delaying the progression of the disease or condition, increasing the quality of life, and/or prolonging survival. Also encompassed by “treatment” is a reduction of pathological consequence of the disease or condition. The methods of the present application contemplate any one or more of these aspects of treatment.
[0182] The terms “individual,” “subject” and “patient” are used interchangeably herein to describe a mammal, including humans. An individual includes, but is not limited to, human, bovine, ovine, porcine, equine, feline, canine, rodent, or primate. In some embodiments, the individual is human. In some embodiments, an individual suffers from a disease or condition. In some embodiments, the individual is in need of treatment. In some embodiments, the individual is an aged individual, e.g., a human individual of at least about any one of 50, 55, 60, 65, 70, 75, 80, 85 or more years old.
[0183] As is understood in the art, an “effective amount” refers to an amount of a composition (e.g., one or more FAO activators or myogenic cells) sufficient to produce a desired therapeutic outcome. For therapeutic use, beneficial or desired results include, e.g., decreasing one or more symptoms resulting from the disease or condition (biochemical, histologic and/or behavioral), including its complications and intermediate pathological phenotypes presented during development of the disease or condition, increasing the quality of life of those suffering from the disease or condition, decreasing the dose of other medications required to treat the disease or condition, enhancing effect of another medication, delaying the progression of the disease or condition, and/or prolonging survival of patients.
[0184] As used herein, the terms “cell” and “cell culture” are used interchangeably and all such designations include progeny. It is understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Variant progeny that have the same function or biological activity as the original cells are included.
[0185] “Alkyl” refers to monovalent saturated aliphatic hydrocarbyl groups having from 1 to 10 carbon atoms and preferably 1 to 6 carbon atoms. This term includes, by way of example, linear and branched hydrocarbyl groups such as methyl (CH.sub.3—), ethyl (CH.sub.3CH.sub.2—), n-propyl (CH.sub.3CH.sub.2CH.sub.2—), isopropyl ((CH.sub.3).sub.2CH—), n-butyl (CH.sub.3CH.sub.2CH.sub.2CH.sub.2—), isobutyl ((CH.sub.3).sub.2CHCH.sub.2—), sec-butyl ((CH.sub.3)(CH.sub.3CH.sub.2)CH—), t-butyl ((CH.sub.3).sub.3C—), n-pentyl (CH.sub.3CH.sub.2CH.sub.2CH.sub.2CH.sub.2—), neopentyl ((CH.sub.3).sub.3CCH.sub.2—), and n-hexyl (CH.sub.3(CH.sub.2).sub.5—).
[0186] “Alkylene” refers to divalent aliphatic hydrocarbylene groups preferably having from 1 to 10 and more preferably 1 to 3 carbon atoms that are either straight-chained or branched. This term includes, by way of example, methylene (—CH.sub.2—), ethylene (—CH.sub.2CH.sub.2—), n-propylene (—CH.sub.2CH.sub.2CH.sub.2—), iso-propylene (—CH.sub.2CH(CH.sub.3)—), (—C(CH.sub.3).sub.2CH.sub.2CH.sub.2—), (—C(CH.sub.3).sub.2CH.sub.2C(O)—), (—C(CH.sub.3).sub.2CH.sub.2C(O)NH—), (—CH(CH.sub.3)CH.sub.2—), and the like.
[0187] “Alkenyl” refers to straight chain or branched hydrocarbyl groups having from 2 to 10 carbon atoms and preferably 2 to 4 carbon atoms and having at least 1 and preferably from 1 to 2 sites of double bond unsaturation. This term includes, by way of example, bi-vinyl, allyl, and but-3-en-1-yl. Included within this term are the cis and trans isomers or mixtures of these isomers.
[0188] “Alkenylene” refers to straight chain or branched hydrocarbylene groups having from 2 to 10 carbon atoms and preferably 2 to 4 carbon atoms and having at least 1 and preferably from 1 to 2 sites of double bond unsaturation. Examples of alkenylene include, but is not limited to, vinylene (—CH═CH—), allylene (—CH.sub.2C═C—), and but-3-en-1-ylene (—CH.sub.2CH.sub.2C═CH—). Included within this term are the cis and trans isomers or mixtures of these isomers.
[0189] “Alkynyl” refers to straight or branched hydrocarbyl groups having from 2 to 6 carbon atoms and preferably 2 to 3 carbon atoms and having at least 1 and preferably from 1 to 2 sites of triple bond unsaturation. Examples of such alkynyl groups include acetylenyl (—C≡CH), and propargyl (—CH.sub.2C≡CH).
[0190] “Alkynylene” refers to straight or branched hydrocarbylene groups having from 2 to 6 carbon atoms and preferably 2 to 3 carbon atoms and having at least 1 and preferably from 1 to 2 sites of triple bond unsaturation. Examples of alkynylene include, but are not limited to, acetylenylene (—C≡C—), and propargylene (—CH.sub.2C≡C—).
[0191] “Amino” refers to the group —NH.sub.2.
[0192] “Substituted amino” refers to the group —NRR where each R is independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, alkenyl, substituted alkenyl, cycloalkenyl, substituted cycloalkenyl, alkynyl, substituted alkynyl, aryl, heteroaryl, and heterocyclyl provided that at least one R is not hydrogen.
[0193] “Aryl” refers to a monovalent aromatic carbocyclic group of from 6 to 18 carbon atoms having a single ring (such as is present in a phenyl group) or a ring system having multiple condensed rings (examples of such aromatic ring systems include naphthyl, anthryl and indanyl) which condensed rings may or may not be aromatic, provided that the point of attachment is through an atom of an aromatic ring. This term includes, by way of example, phenyl and naphthyl. Unless otherwise constrained by the definition for the aryl substituent, such aryl groups can optionally be substituted with from 1 to 5 substituents, or from 1 to 3 substituents, selected from acyloxy, hydroxy, thiol, acyl, alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, substituted alkyl, substituted alkoxy, substituted alkenyl, substituted alkynyl, substituted cycloalkyl, substituted cycloalkenyl, amino, substituted amino, aminoacyl, acylamino, alkaryl, aryl, aryloxy, azido, carboxyl, carboxyl ester, cyano, halogen, nitro, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, aminoacyloxy, oxyacylamino, thioalkoxy, substituted thioalkoxy, thioaryloxy, thioheteroaryloxy, sulfonylamino, —SO-alkyl, —SO— substituted alkyl, —SO-aryl, —SO-heteroaryl, —SO.sub.2-alkyl, —SO.sub.2-substituted alkyl, —SO.sub.2-aryl, —SO.sub.2— heteroaryl and trihalomethyl.
[0194] “Cycloalkyl” refers to cyclic alkyl groups of from 3 to 10 carbon atoms having single or multiple cyclic rings including fused, bridged, and spiro ring systems. Examples of suitable cycloalkyl groups include, for instance, adamantyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclooctyl and the like. Such cycloalkyl groups include, by way of example, single ring structures such as cyclopropyl, cyclobutyl, cyclopentyl, cyclooctyl, and the like, or multiple ring structures such as adamantyl, and the like.
[0195] “Heteroaryl” refers to an aromatic group of from 1 to 15 carbon atoms, such as from 1 to 10 carbon atoms and 1 to 10 heteroatoms selected from the group consisting of oxygen, nitrogen, and sulfur within the ring. Such heteroaryl groups can have a single ring (such as, pyridinyl, imidazolyl or furyl) or multiple condensed rings in a ring system (for example as in groups such as, indolizinyl, quinolinyl, benzofuranyl, benzimidazolyl or benzothienyl), wherein at least one ring within the ring system is aromatic and at least one ring within the ring system is aromatic, provided that the point of attachment is through an atom of an aromatic ring. In certain embodiments, the nitrogen and/or sulfur ring atom(s) of the heteroaryl group are optionally oxidized to provide for the N-oxide (N.fwdarw.O), sulfinyl, or sulfonyl moieties. This term includes, by way of example, pyridinyl, pyrrolyl, indolyl, thiophenyl, and furanyl. Unless otherwise constrained by the definition for the heteroaryl substituent, such heteroaryl groups can be optionally substituted with 1 to 5 substituents, or from 1 to 3 substituents, selected from acyloxy, hydroxy, thiol, acyl, alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, substituted alkyl, substituted alkoxy, substituted alkenyl, substituted alkynyl, substituted cycloalkyl, substituted cycloalkenyl, amino, substituted amino, aminoacyl, acylamino, alkaryl, aryl, aryloxy, azido, carboxyl, carboxyl ester, cyano, halogen, nitro, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, aminoacyloxy, oxyacylamino, thioalkoxy, substituted thioalkoxy, thioaryloxy, thioheteroaryloxy, sulfonylamino, —SO-alkyl, —SO-substituted alkyl, —SO-aryl, —SO— heteroaryl, —SO.sub.2-alkyl, —SO.sub.2-substituted alkyl, —SO.sub.2-aryl and —SO.sub.2-heteroaryl, and trihalomethyl.
[0196] Examples of heteroaryls include, but are not limited to, pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indolizine, isoindole, indole, purine, isoquinoline, quinoline, phthalazine, naphthyridine, quinoxaline, quinazoline, cinnoline, pteridine, carbazole, carboline, phenanthridine, acridine, phenanthroline, isothiazole, phenazine, isoxazole, phenoxazine, phenothiazine, piperidine, piperazine, phthalimide, 4,5,6,7-tetrahydrobenzo[b]thiophene, thiazole, thiophene, benzo[b]thiophene, and the like.
[0197] “Heterocycle,” “heterocyclic,” “heterocycloalkyl” or “heterocyclyl” refers to a saturated or partially unsaturated group having a single ring or multiple condensed rings, including fused, bridged, or spiro ring systems, and having from 3 to 20 ring atoms, including 1 to 10 hetero atoms. These ring atoms are selected from the group consisting of carbon, nitrogen, sulfur, or oxygen, wherein, in fused ring systems, one or more of the rings can be cycloalkyl, aryl, or heteroaryl, provided that the point of attachment is through the non-aromatic ring. In certain embodiments, the nitrogen and/or sulfur atom(s) of the heterocyclic group are optionally oxidized to provide for N-oxide, —S(O)—, or —SO.sub.2— moieties.
[0198] Examples of heterocycles include, but are not limited to, azetidine, dihydroindole, indazole, quinolizine, imidazolidine, imidazoline, piperidine, piperazine, indoline, 1,2,3,4-tetrahydroisoquinoline, thiazolidine, morpholinyl, thiomorpholinyl (also referred to as thiamorpholinyl), 1,1-dioxothiomorpholinyl, piperidinyl, pyrrolidine, tetrahydrofuranyl, and the like.
[0199] Where a heteroaryl or heterocyclyl group is “substituted,” unless otherwise constrained by the definition for the heteroaryl or heterocyclic substituent, such heteroaryl or heterocyclic groups can be substituted with 1 to 5, or from 1 to 3 substituents, selected from alkyl, substituted alkyl, alkoxy, substituted alkoxy, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aminoacyloxy, azido, cyano, halogen, hydroxyl, oxo, thioketo, carboxyl, carboxyl ester, thioaryloxy, thioheteroaryloxy, thioheterocyclooxy, thiol, thioalkoxy, substituted thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, hydroxyamino, alkoxyamino, nitro, sulfonylamino, —SO-alkyl, —SO-substituted alkyl, —SO-aryl, —SO-heteroaryl, —SO— heterocyclyl, —SO.sub.2-alkyl, —SO.sub.2-substituted alkyl, —SO.sub.2-aryl, —SO.sub.2-heteroaryl, and —SO.sub.2-heterocyclyl.
[0200] “Polyalkylene glycol” refers to straight or branched polyalkylene glycol polymers such as polyethylene glycol, polypropylene glycol, and polybutylene glycol. A polyalkylene glycol subunit is a single polyalkylene glycol unit. For example, an example of a polyethylene glycol subunit would be an ethylene glycol, —O—CH.sub.2—CH.sub.2—O—, or propylene glycol, —O—CH.sub.2—CH.sub.2—CH.sub.2—O—, capped with a hydrogen at the chain termination point. Other examples of poly(alkylene glycol) include, but are not limited to, PEG, PEG derivatives such as methoxypoly(ethylene glycol) (mPEG), poly(ethylene oxide), PPG, poly(tetramethylene glycol), poly(ethylene oxide-co-propylene oxide), or copolymers and combinations thereof.
[0201] “Polyamine” refers to polymers having an amine functionality in the monomer unit, either incorporated into the backbone, as in polyalkyleneimines, or in a pendant group as in polyvinyl amines.
[0202] In addition to the disclosure herein, the term “substituted,” when used to modify a specified group or radical, can also mean that one or more hydrogen atoms of the specified group or radical are each, independently of one another, replaced with the same or different substituent groups as defined below.
[0203] In addition to the groups disclosed with respect to the individual terms herein, substituent groups for substituting for one or more hydrogens (any two hydrogens on a single carbon can be replaced with ═O, ═NR.sup.70, ═N—OR.sup.70, ═N.sub.2 or ═S) on saturated carbon atoms in the specified group or radical are, unless otherwise specified, —R.sup.60, halo, ═O, —OR.sup.70, —SR.sup.70, —NRR, trihalomethyl, —CN, —OCN, —SCN, —NO, —NO.sub.2, ═N.sub.2, —N.sub.3, —S(O)R.sup.70, —S(O).sub.2R.sup.70, —SO.sub.3N, —S(O).sub.2OR.sup.70, —OS(O).sub.2R.sup.70, —OSO.sub.3.sup.−M.sup.+, —OS(O).sub.2OR.sup.70, —PO.sub.3.sup.2−(M.sup.+).sub.2, —P(O)(OR.sup.70)O.sup.−M.sup.+, —P(O)(OR.sup.70).sub.2, —C(O)R.sup.70, —C(S)R.sup.70, —C(NR.sup.70)R.sup.70, —C(O)O.sup.−M.sup.+, —C(O)OR.sup.70, —C(S)OR.sup.70, —C(O)NR.sup.80R.sup.80, —C(NR.sup.70)NR.sup.80R.sup.80, —OC(O)R.sup.70, —OC(S)R.sup.70, —OC(O)O.sup.−M.sup.+, —OC(O)OR.sup.70, —OC(S)OR.sup.70, —NR.sup.70C(O)R.sup.70, —NR.sup.70C(S)R.sup.70, —NR.sup.70CO.sub.2.sup.−M.sup.+, —NR.sup.70CO.sub.2R.sup.70, —NR.sup.70C(S)OR.sup.70, —NR.sup.70C(O)NR.sup.80R.sup.80, —NR.sup.70C(NR.sup.70)R.sup.70 and —NR.sup.70C(NR.sup.70)NR.sup.80R.sup.80, where R.sup.60 is selected from the group consisting of optionally substituted alkyl, cycloalkyl, heterocycloalkyl, heterocycloalkylalkyl, cycloalkylalkyl, aryl, arylalkyl, heteroaryl and heteroarylalkyl, each R.sup.70 is independently hydrogen or R.sup.60; each R.sup.80 is independently R.sup.70 or alternatively, two R.sup.80's, taken together with the nitrogen atom to which they are bonded, form a 3-, 4-, 5-, 6-, or 7-membered heterocycloalkyl which may optionally include from 1 to 4 of the same or different additional heteroatoms selected from the group consisting of O, N and S, of which N may have —H, C.sub.1-C.sub.4 alkyl, .C(O)C.sub.1-4alkyl, .CO.sub.2C.sub.1-4alkyl, or —S(O).sub.2C.sub.1-4alkyl substitution; and each M.sup.+ is a counter ion with a net single positive charge. Each M.sup.+ may independently be, for example, an alkali ion, such as K.sup.+, Na.sup.+, Li.sup.+; an ammonium ion, such as .sup.+N(R.sup.60).sub.4; or an alkaline earth ion, such as [Ca.sup.2+].sub.0.5, [Mg.sup.2+].sub.0.5, or [Ba.sup.2+].sub.0.5 (“subscript 0.5 means that one of the counter ions for such divalent alkali earth ions can be an ionized form of a compound of the embodiments and the other a typical counter ion such as chloride, or two ionized compounds disclosed herein can serve as counter ions for such divalent alkali earth ions, or a doubly ionized compound of the embodiments can serve as the counter ion for such divalent alkali earth ions).
[0204] In addition to the disclosure herein, substituent groups for hydrogens on unsaturated carbon atoms in “substituted” alkene, alkyne, aryl and heteroaryl groups are, unless otherwise specified, —R.sup.60, halo, —O.sup.−M.sup.+, —OR.sup.70, —SR.sup.70, —S.sup.−M.sup.+, —NR.sup.80R.sup.80, trihalomethyl, —CF.sub.3, —CN, —OCN, —SCN, —NO, —NO.sub.2, —N.sub.3, —S(O)R.sup.70, —S(O).sub.2R.sup.70, —SO.sub.3.sup.−M.sup.+, —SO.sub.3R.sup.70, —OS(O).sub.2R.sup.70, —OSO.sub.3.sup.−M.sup.+, —OSO.sub.3R.sup.70, —PO.sub.3.sup.2−(M.sup.+).sub.2, —P(O)(OR.sup.70)O.sup.−M.sup.+, —P(O)(OR.sup.70).sub.2, —C(O)R.sup.70, —C(S)R.sup.70, —C(NR.sup.70)R.sup.70, —CO.sub.2.sup.−M.sup.+, —CO.sub.2R.sup.70, —C(S)OR.sup.70, —C(O)NR.sup.80R.sup.80, —C(NR.sup.70)NR.sup.80R.sup.80, —OC(O)R.sup.70, —OC(S)R.sup.70, —OCO.sub.2.sup.−M.sup.+, —OCO.sub.2R.sup.70, —OC(S)OR.sup.70, —NR.sup.70C(O)R.sup.70, —NR.sup.70C(S)R.sup.70, —NR.sup.70CO.sub.2.sup.−M.sup.+, —NR.sup.70CO.sub.2R.sup.70, —NR.sup.70C(S)OR.sup.70, —NR.sup.70C(O)NR.sup.80R.sup.80, —NR.sup.70C(NR.sup.70)R.sup.70 and —NR.sup.70C(NR.sup.70)NR.sup.80R.sup.80, where R.sup.60, R.sup.70, R.sup.80 and M.sup.+ are as previously defined, provided that in case of substituted alkene or alkyne, the substituents are not —O.sup.−M.sup.+, —OR.sup.70, —SR.sup.70, or —S.sup.−M.sup.+.
[0205] In addition to the substituent groups disclosed with respect to the individual terms herein, substituent groups for hydrogens on nitrogen atoms in “substituted” heterocycloalkyl and cycloalkyl groups are, unless otherwise specified, —R.sup.60, —O.sup.−M.sup.+, —OR.sup.70, —SR.sup.70, —S.sup.−M.sup.+, —NR.sup.80R.sup.80, trihalomethyl, —CF.sub.3, —CN, —NO, —NO.sub.2, —S(O)R.sup.70, —S(O).sub.2R.sup.70, —S(O).sub.2O.sup.+M.sup.+, —S(O).sub.2OR.sup.70, —OS(O).sub.2R.sup.70, —OS(O).sub.2O.sup.+M.sup.+, —OS(O).sub.2OR.sup.70, —PO.sub.3.sup.2−(M.sup.+).sub.2, —P(O)(OR.sup.70)O.sup.−M.sup.+, —P(O)(OR.sup.70)(OR.sup.70), —C(O)R.sup.70, —C(S)R.sup.70, —C(NR.sup.70)R.sup.70, —C(O)OR.sup.70, —C(S)OR.sup.70, —C(O)NR.sup.80R.sup.80, —C(NR.sup.70)NR.sup.80R.sup.80, —OC(O)R.sup.70, —OC(S)R.sup.70, —OC(O)OR.sup.70, —OC(S)OR.sup.70, —NR.sup.70C(O)R.sup.70, —NR.sup.70C(S)R.sup.70, —NR.sup.70C(O)OR.sup.70, —NR.sup.70C(S)OR.sup.70, —NR.sup.70C(O)NR.sup.80R.sup.80, —NR.sup.70C(NR.sup.70)R.sup.70 and —NR.sup.70C(NR.sup.70)NR.sup.80R.sup.80, where R.sup.60, R.sup.70, R.sup.80 and M.sup.+ are as previously defined.
[0206] In addition to the disclosure herein, in a certain embodiment, a group that is substituted has 1, 2, 3, or 4 substituents, 1, 2, or 3 substituents, 1 or 2 substituents, or 1 substituent.
[0207] It is understood that in all substituted groups defined above, polymers arrived at by defining substituents with further substituents to themselves (e.g., substituted aryl having a substituted aryl group as a substituent which is itself substituted with a substituted aryl group, which is further substituted by a substituted aryl group, etc.) are not intended for inclusion herein. In such cases, the maximum number of such substitutions is three. For example, serial substitutions of substituted aryl groups specifically contemplated herein are limited to substituted aryl-(substituted aryl)-substituted aryl.
[0208] Unless indicated otherwise, the nomenclature of substituents that are not explicitly defined herein are arrived at by naming the terminal portion of the functionality followed by the adjacent functionality toward the point of attachment. For example, the substituent “arylalkyloxycarbonyl” refers to the group (aryl)-(alkyl)-O—C(O)—.
[0209] As to any of the groups disclosed herein which contain one or more substituents, it is understood, of course, that such groups do not contain any substitution or substitution patterns which are sterically impractical and/or synthetically non-feasible. In addition, the subject compounds include all stereochemical isomers arising from the substitution of these compounds.
[0210] The term “pharmaceutically acceptable salt” means a salt which is acceptable for administration to a patient, such as a mammal (salts with counterions having acceptable mammalian safety for a given dosage regime). Such salts can be derived from pharmaceutically acceptable inorganic or organic bases and from pharmaceutically acceptable inorganic or organic acids. “Pharmaceutically acceptable salt” refers to pharmaceutically acceptable salts of a compound, which salts are derived from a variety of organic and inorganic counter ions well known in the art and include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like; and when the molecule contains a basic functionality, salts of organic or inorganic acids, such as hydrochloride, hydrobromide, formate, tartrate, besylate, mesylate, acetate, maleate, oxalate, and the like.
[0211] The term “salt thereof” means a compound formed when a proton of an acid is replaced by a cation, such as a metal cation or an organic cation and the like. Where applicable, the salt is a pharmaceutically acceptable salt, although this is not required for salts of intermediate compounds that are not intended for administration to a patient. By way of example, salts of the present compounds include those wherein the compound is protonated by an inorganic or organic acid to form a cation, with the conjugate base of the inorganic or organic acid as the anionic component of the salt.
[0212] “Solvate” refers to a complex formed by combination of solvent molecules with molecules or ions of the solute. The solvent can be an organic compound, an inorganic compound, or a mixture of both. Some examples of solvents include, but are not limited to, methanol, N,N-dimethylformamide, tetrahydrofuran, dimethylsulfoxide, and water. When the solvent is water, the solvate formed is a hydrate.
[0213] “Stereoisomer” and “stereoisomers” refer to compounds that have same atomic connectivity but different atomic arrangement in space. Stereoisomers include cis-trans isomers, E and Z isomers, enantiomers, and diastereomers.
[0214] “Tautomer” refers to alternate forms of a molecule that differ only in electronic bonding of atoms and/or in the position of a proton, such as enol-keto and imine-enamine tautomers, or the tautomeric forms of heteroaryl groups containing a —N═C(H)—NH— ring atom arrangement, such as pyrazoles, imidazoles, benzimidazoles, triazoles, and tetrazoles. A person of ordinary skill in the art would recognize that other tautomeric ring atom arrangements are possible.
[0215] It will be appreciated that the term “or a salt or solvate or tautomer or stereoisomer thereof” is intended to include all permutations of salts, solvates, tautomers, and stereoisomers, such as a solvate of a pharmaceutically acceptable salt of a tautomer of a stereoisomer of subject compound.
[0216] It is understood that aspect and embodiments of the invention described herein include “consisting” and/or “consisting essentially of” aspects and embodiments.
[0217] Reference to “about” a value or parameter herein includes (and describes) variations that are directed to that value or parameter per se. For example, description referring to “about X” includes description of “X”.
[0218] The term “about X-Y” used herein has the same meaning as “about X to about Y.”
[0219] As used herein, reference to “not” a value or parameter generally means and describes “other than” a value or parameter. For example, the method is not used to treat cancer of type X means the method is used to treat cancer of types other than X.
[0220] As used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise.
[0221] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination. All combinations of the embodiments pertaining to the FAO activators and methods of use thereof are specifically embraced by the present application and are disclosed herein just as if each and every combination were individually and explicitly disclosed herein.
II. Methods of Tissue Regeneration
[0222] The present application provides methods of tissue (e.g., muscle) regeneration using one or more activators of fatty acid oxidation (“FAO activators”) in vitro or in vivo. The methods described herein can promote tissue regeneration both after injury and without injury (i.e., woundless tissue regeneration).
[0223] In some embodiments, there is provided a method of promoting regeneration of a tissue (e.g., muscle tissue), comprising contacting the tissue with an FAO activator. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissue is contacted with the FAO activator for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the FAO activator is an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the FAO activator is an activator of a gene selected from the group consisting of PPARα, PPARδ, PPARγ, RXRB, RXRG, NCOA1, NCOA2, FABP3, FABP4, CD36, SCARB1, FATP1, FATP2, FATP3, FATP4, FATP5, FATP6, LPL, CPT1A, CPT1B, CPT1C, CPT2, CRAT, ACADs (e.g., ACAD1, ACAD2, ACAD3, ACAD4, ACAD5, ACAD6, ACAD7, ACAD8, ACAD9, ACAD10, ACAD11, MCAD, LCAD, VLCAD), HADHs (e.g., HADHA, HADHB), ETFA and ETFB. In some embodiments, the method comprises contacting the tissue with two or more FAO activators. In some embodiments, the tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the tissue is an injured tissue. In some embodiments, the tissue has not undergone injury.
[0224] In some embodiments, there is provided a method of promoting regeneration of a tissue (e.g., muscle tissue), comprising contacting the tissue with a PPARγ agonist. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissue is contacted with the PPARγ agonist for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the tissue is an injured tissue. In some embodiments, the tissue has not undergone injury.
[0225] In some embodiments, there is provided a method of promoting regeneration of a tissue (e.g., muscle tissue), comprising contacting the tissue with a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissue is contacted with the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the tissue is an injured tissue. In some embodiments, the tissue has not undergone injury.
[0226] In some embodiments, there is provided a method of promoting regeneration of a tissue (e.g., muscle tissue), comprising contacting the tissue with a PPARγ agonist (e.g., rosiglitazone) and a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissue is contacted with the PPARγ agonist and the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the tissue is an injured tissue. In some embodiments, the tissue has not undergone injury.
[0227] In some embodiments, there is provided a method of promoting regeneration of a muscle tissue, comprising contacting the muscle tissue with one or more FAO activators. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the muscle tissue is contacted with the FAO activator for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the one or more FAO activators comprises an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the one or more FAO activators comprises one or more activators of PPARγ. In some embodiments, the one or more activators of PPARγ comprises a PPARγ agonist, such as rosiglitazone. In some embodiments, the one or more activators of PPARγ comprises a prostaglandin selected from the group consisting of PGI2, PGD2, and analogues thereof (e.g., treprostinil). In some embodiments, thione or more activators of PPARγ comprises rosiglitazone and PGI2, or rosiglitazone and treprostinil. In some embodiments, the muscle tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the muscle tissue is an injured tissue. In some embodiments, the muscle tissue has not undergone injury.
[0228] In some embodiments, there is provided a method of promoting growth of a tissue (e.g., muscle tissue), comprising contacting the tissue with an FAO activator. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissue is contacted with the FAO activator for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the FAO activator is an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the FAO activator is an activator of a gene selected from the group consisting of PPARα, PPARδ, PPARγ, RXRB, RXRG, NCOA1, NCOA2, FABP3, FABP4, CD36, SCARB1, FATP1, FATP2, FATP3, FATP4, FATP5, FATP6, LPL, CPT1A, CPT1B, CPT1C, CPT2, CRAT, ACADs (e.g., ACAD1, ACAD2, ACAD3, ACAD4, ACAD5, ACAD6, ACAD7, ACAD8, ACAD9, ACAD10, ACAD11, MCAD, LCAD, VLCAD), HADHs (e.g., HADHA, HADHB), ETFA and ETFB. In some embodiments, the method comprises contacting the tissue with two or more FAO activators. In some embodiments, the muscle tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the tissue is an injured tissue. In some embodiments, the tissue has not undergone injury.
[0229] In some embodiments, there is provided a method of promoting growth of a tissue (e.g., muscle tissue), comprising contacting the tissue with a PPARγ agonist. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissue is contacted with the PPARγ agonist for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the tissue is an injured tissue. In some embodiments, the tissue has not undergone injury.
[0230] In some embodiments, there is provided a method of promoting growth of a tissue (e.g., muscle tissue), comprising contacting the tissue with a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissue is contacted with the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the tissue is an injured tissue. In some embodiments, the tissue has not undergone injury.
[0231] In some embodiments, there is provided a method of promoting growth of a tissue (e.g., muscle tissue), comprising contacting the tissue with a PPARγ agonist (e.g., rosiglitazone) and a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissue is contacted with the PPARγ agonist and the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the tissue is an injured tissue. In some embodiments, the tissue has not undergone injury.
[0232] In some embodiments, there is provided a method of promoting growth oaf muscle tissue, comprising contacting the muscle tissue with one or more FAO activators. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the muscle tissue is contacted with the FAO activator for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the one or more FAO activators comprises an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the one or more FAO activators comprises one or more activators of PPARγ. In some embodiments, the one or more activators of PPARγ comprises a PPARγ agonist, such as rosiglitazone. In some embodiments, the one or more activators of PPARγ comprises a prostaglandin selected from the group consisting of PGI2, PGD2, and analogues thereof (e.g., treprostinil). In some embodiments, thione or more activators of PPARγ comprises rosiglitazone and PGI2, or rosiglitazone and treprostinil. In some embodiments, the muscle tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the muscle tissue is an injured tissue. In some embodiments, the muscle tissue has not undergone injury.
[0233] In some embodiments, there is provided a method of increasing expression of H3K9ac, Ki67, MyoD, MYOG, MYH7, and/or MYH8 in a tissuegenic cell (e.g., myogenic cell, such as myoblast or myocyte), comprising contacting the tissuegenic cell with an FAO activator. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissuegenic cell is contacted with the FAO activator for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the FAO activator is an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the FAO activator is an activator of a gene selected from the group consisting of PPARα, PPARδ, PPARγ, RXRB, RXRG, NCOA1, NCOA2, FABP3, FABP4, CD36, SCARB1, FATP1, FATP2, FATP3, FATP4, FATP5, FATP6, LPL, CPT1A, CPT1B, CRAT, CPT1C, CPT2, ACADs (e.g., ACAD1, ACAD2, ACAD3, ACAD4, ACAD5, ACAD6, ACAD7, ACAD8, ACAD9, ACAD10, ACAD11, MCAD, LCAD, VLCAD), HADHs (e.g., HADHA, HADHB), ETFA and ETFB. In some embodiments, the method comprises contacting the tissuegenic cell with two or more FAO activators.
[0234] In some embodiments, there is provided a method of increasing expression of H3K9ac, Ki67, MyoD, MYOG, MYH7, and/or MYH8 in a tissuegenic cell (e.g., myogenic cell, such as myoblast or myocyte), comprising contacting the tissuegenic cell with a PPARγ agonist. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissuegenic cell is contacted with the PPARγ agonist for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof.
[0235] In some embodiments, there is provided a method of increasing expression of H3K9ac, Ki67, MyoD, MYOG, MYH7, and/or MYH8 in a tissuegenic cell (e.g., myogenic cell, such as myoblast or myocyte), comprising contacting the tissuegenic cell with a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissuegenic cell is contacted with the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours.
[0236] In some embodiments, there is provided a method of increasing expression of H3K9ac, Ki67, MyoD, MYOG, MYH7, and/or MYH8 in a tissuegenic cell (e.g., myogenic cell, such as myoblast or myocyte), comprising contacting the tissuegenic cell with a PPARγ agonist (e.g., rosiglitazone) and a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissuegenic cell is contacted with the PPARγ agonist and the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours.
[0237] In some embodiments, there is provided a method of promoting myogenesis in a muscle tissue, comprising contacting the muscle tissue with an FAO activator. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the muscle tissue is contacted with the FAO activator for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the FAO activator is an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the FAO activator is an activator of a gene selected from the group consisting of PPARα, PPARδ, PPARγ, RXRB, RXRG, NCOA1, NCOA2, FABP3, FABP4, CD36, SCARB1, FATP1, FATP2, FATP3, FATP4, FATP5, FATP6, LPL, CPT1A, CPT1B, CPT1C, CPT2, CRAT, ACADs (e.g., ACAD1, ACAD2, ACAD3, ACAD4, ACAD5, ACAD6, ACAD7, ACAD8, ACAD9, ACAD10, ACAD11, MCAD, LCAD, VLCAD), HADHs (e.g., HADHA, HADHB), ETFA and ETFB. In some embodiments, the method comprises contacting the muscle tissue with two or more FAO activators. In some embodiments, the muscle tissue is from an aged individual (e.g., a human individual of at least about 50 years old).
[0238] In some embodiments, there is provided a method of promoting myogenesis in a muscle tissue, comprising contacting the muscle tissue with a PPARγ agonist. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the muscle tissue is contacted with the PPARγ agonist for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the muscle tissue is from an aged individual (e.g., a human individual of at least about 50 years old).
[0239] In some embodiments, there is provided a method of promoting myogenesis in a muscle tissue, comprising contacting the muscle tissue with a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the muscle tissue is contacted with the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the muscle tissue is from an aged individual (e.g., a human individual of at least about 50 years old).
[0240] In some embodiments, there is provided a method of promoting myogenesis in a muscle tissue, comprising contacting the muscle tissue with a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the muscle tissue is contacted with the PPARγ agonist and the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the muscle tissue is from an aged individual (e.g., a human individual of at least about 50 years old).
[0241] In some embodiments, there is provided a method of inducing differentiation and/or maturation of tissuegenic cells (e.g., myogenic cells, such as myoblasts and/or myocytes) in a tissue (e.g., muscle tissue), comprising contacting the tissue with an FAO activator. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissue is contacted with the FAO activator for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the FAO activator is an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the FAO activator is an activator of a gene selected from the group consisting of PPARα, PPARδ, PPARγ, RXRB, RXRG, NCOA1, NCOA2, FABP3, FABP4, CD36, SCARB1, FATP1, FATP2, FATP3, FATP4, FATP5, FATP6, LPL, CPT1A, CPT1B, CPT1C, CPT2, CRAT, ACADs (e.g., ACAD1, ACAD2, ACAD3, ACAD4, ACAD5, ACAD6, ACAD7, ACAD8, ACAD9, ACAD10, ACAD11, MCAD, LCAD, VLCAD), HADHs (e.g., HADHA, HADHB), ETFA and ETFB. In some embodiments, the method comprises contacting the tissue with two or more FAO activators. In some embodiments, the tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the tissue is an injured tissue. In some embodiments, the tissue has not undergone injury.
[0242] In some embodiments, there is provided a method of inducing differentiation and/or maturation of tissuegenic cells (e.g., myogenic cells, such as myoblasts and/or myocytes) in a tissue (e.g., muscle tissue), comprising contacting the tissue with a PPARγ agonist. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissue is contacted with the PPARγ agonist for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the tissue is an injured tissue. In some embodiments, the tissue has not undergone injury.
[0243] In some embodiments, there is provided a method of inducing differentiation and/or maturation of tissuegenic cells (e.g., myogenic cells, such as myoblasts and/or myocytes) in a tissue (e.g., muscle tissue), comprising contacting the tissue with a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissue is contacted with the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the tissue is an injured tissue. In some embodiments, the tissue has not undergone injury.
[0244] In some embodiments, there is provided a method of inducing differentiation and/or maturation of tissuegenic cells (e.g., myogenic cells, such as myoblasts and/or myocytes) in a tissue (e.g., muscle tissue), comprising contacting the tissue with a PPARγ agonist (e.g., rosiglitazone) and a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissue is contacted with the PPARγ agonist and the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the tissue is an injured tissue. In some embodiments, the tissue has not undergone injury.
[0245] In some embodiments, there is provided a method of inducing differentiation and/or maturation of a myogenic cell (e.g., myoblast or myocyte) in a muscle tissue, comprising contacting the muscle tissue with one or more FAO activators. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the muscle tissue is contacted with the FAO activator for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the one or more FAO activators comprises an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the one or more FAO activators comprises one or more activators of PPARγ. In some embodiments, the one or more activators of PPARγ comprises a PPARγ agonist, such as rosiglitazone. In some embodiments, the one or more activators of PPARγ comprises a prostaglandin selected from the group consisting of PGI2, PGD2, and analogues thereof (e.g., treprostinil). In some embodiments, the one or more activators of PPARγ comprises rosiglitazone and PGI2, or rosiglitazone and treprostinil. In some embodiments, the muscle tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the muscle tissue is an injured tissue. In some embodiments, the muscle tissue has not undergone injury.
[0246] In some embodiments, there is provided a method of inducing proliferation of stem cells (e.g., muscle stem cells) or tissuegenic cells (e.g., muscle progenitor cells) in a tissue (e.g., muscle tissue), comprising contacting the tissue with an FAO activator. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissue is contacted with the FAO activator for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the FAO activator is an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the FAO activator is an activator of a gene selected from the group consisting of PPARα, PPARδ, PPARγ, RXRB, RXRG, NCOA1, NCOA2, FABP3, FABP4, CD36, SCARB1, FATP1, FATP2, FATP3, FATP4, FATP5, FATP6, LPL, CPT1A, CPT1B, CPT1C, CPT2, CRAT, ACADs (e.g., ACAD1, ACAD2, ACAD3, ACAD4, ACAD5, ACAD6, ACAD7, ACAD8, ACAD9, ACAD10, ACAD11, MCAD, LCAD, VLCAD), HADHs (e.g., HADHA, HADHB), ETFA and ETFB. In some embodiments, the method comprises contacting the tissue with two or more FAO activators. In some embodiments, the tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the tissue is an injured tissue. In some embodiments, the tissue has not undergone injury.
[0247] In some embodiments, there is provided a method of inducing proliferation of stem cells (e.g., muscle stem cells) or tissuegenic cells (e.g., muscle progenitor cells) in a tissue (e.g., muscle tissue), comprising contacting the tissue with a PPARγ agonist. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissue is contacted with the PPARγ agonist for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the tissue is an injured tissue. In some embodiments, the tissue has not undergone injury.
[0248] In some embodiments, there is provided a method of inducing proliferation of stem cells (e.g., muscle stem cells) or tissuegenic cells (e.g., muscle progenitor cells) in a tissue (e.g., muscle tissue), comprising contacting the tissue with a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissue is contacted with the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the tissue is an injured tissue. In some embodiments, the tissue has not undergone injury.
[0249] In some embodiments, there is provided a method of inducing proliferation of stem cells (e.g., muscle stem cells) or tissuegenic cells (e.g., muscle progenitor cells) in a tissue (e.g., muscle tissue), comprising contacting the tissue with a PPARγ agonist (e.g., rosiglitazone) and a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissue is contacted with the PPARγ agonist and the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the tissue is an injured tissue. In some embodiments, the tissue has not undergone injury.
[0250] In some embodiments, there is provided a method of inducing proliferation of muscle stem cells or myogenic cells (e.g., muscle progenitor cells) in a muscle tissue, comprising contacting the muscle tissue with one or more FAO activators. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the muscle tissue is contacted with the FAO activator for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the one or more FAO activators comprises an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the one or more FAO activators comprises one or more activators of PPARγ. In some embodiments, the one or more activators of PPARγ comprises a PPARγ agonist, such as rosiglitazone. In some embodiments, the one or more activators of PPARγ comprises a prostaglandin selected from the group consisting of PGI2, PGD2, and analogues thereof (e.g., treprostinil). In some embodiments, the one or more activators of PPARγ comprises rosiglitazone and PGI2, or rosiglitazone and treprostinil. In some embodiments, the muscle tissue is from an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the muscle tissue is an injured tissue. In some embodiments, the muscle tissue has not undergone injury.
[0251] Tissue regeneration, tissue growth, proliferation of stem cells and tissuegenic cells, and differentiation and maturation of tissuegenic cells may be assessed using known methods in the art. For example, muscle regeneration, muscle growth, myogenesis, proliferation of muscle stem cells, and differentiation and maturation of myogenic cells may be assessed by assessing cell morphology using microscopy (e.g., myotube thickness), or by assessing expression levels (e.g., mRNA and/or protein levels) of myogenic markers such as PAX7, MyoD (MYOD1), myogenin (MYOG), Myf5 (MYF5), MRF4 (MYF6), alpha actin 1 (ACTA1), alpha actinin 2 (ACTN2), adult type I myosin heavy chain (MYH7), adult type IIa myosin heavy chain (MYH2), adult type IIb myosin heavy chain (MYH4), adult type IIx myosin heavy chain (MYH1), embryonicmyosin heavy chain (MYH3), perinatal myosin heavy chain (MYH8), pan-myosin heavy chain (MHC), myosin light chain (MLC), and the troponins, or by assessing expression levels of proliferation markers such as Ki67.Protein expression levels may be determined by immunostaining or by Western blots. mRNA expression levels may be determined by quantitative reverse-transcription PCR, microarray, or next-generation sequencing.
[0252] In some embodiments, there is provided a method of increasing mitochondrial oxygen consumption in a tissuegenic cell (such as myogenic cell, e.g., myoblast or myocyte), comprising contacting the tissuegenic cell (such as myogenic cell, e.g., myoblast or myocyte) with an activator of PPARγ for no more than about 72 hours. In some embodiments, the activator of PPARγ is a PPARγ agonist. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissuegenic cell is contacted with the PPARγ agonist for no more than about 48 hours. In some embodiments, the tissuegenic cell is contacted with the PPARγ agonist for no more than about 24 hours. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the activator of PPARγ is a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the method comprises contacting the myogenic cell with two or more activators of PPARγ, such as a PPARγ agonist (e.g., rosiglitazone) and a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil).
[0253] Mitochondrial oxygen consumption may be determined using any known methods in the art, for example, by Seahorse analysis. In some embodiments, the method increases maximal mitochondrial oxygen consumption. In some embodiments, the method increases basal mitochondrial oxygen consumption. In some embodiments, the method increases both maximal mitochondrial oxygen consumption and basal mitochondrial oxygen consumption. In some embodiments, the mitochondrial oxygen consumption increases by at least any one of 10%, 20%, 50%, 2×, 3×, 5×, 10× or more, including any value or range in between these values.
[0254] In some embodiments, there is provided a method of increasing FAO in a tissuegenic cell (such as myogenic cell, e.g., myoblast or myocyte), comprising contacting the tissuegenic cell (such as myogenic cell, e.g., myoblast or myocyte) with an activator of PPARγ for no more than about 72 hours. In some embodiments, the activator of PPARγ is a PPARγ agonist. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissuegenic cell is contacted with the PPARγ agonist for no more than about 48 hours. In some embodiments, the tissuegenic cell is contacted with the PPARγ agonist for no more than about 24 hours. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the activator of PPARγ is a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the method comprises contacting the myogenic cell with two or more activators of PPARγ, such as a PPARγ agonist (e.g., rosiglitazone) and a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil).
[0255] The level of FAO may be determined using any known methods in the art, for example, by metabolomics and lipidomics analysis using mass spectrometry. In some embodiments, the level of FAO increases by at least any one of 10%, 20%, 50%, 2×, 3×, 5×, 10× or more, including any value or range in between these values.
[0256] The FAO activators (including activators of PPARγ, such as PPARγ agonists and prostaglandins) used in the methods described herein may have anyone or combination of features described in Section IV “fatty acid oxidation activators” below.
[0257] In some embodiments, the contacting of the tissue (e.g., muscle tissue) or tissuegenic cell (e.g., myogenic cell) with the one or more FAO activators (including activators of PPARγ, such as PPARγ agonists and prostaglandins) is transient. “Transient” used herein is no more than 72 hours, such as no more than about any one of 60 hours, 48 hours, 36 hours, 24 hours, 12 hours, or 6 hours, including any value or range in between these values. In some embodiments, the tissue (e.g., muscle tissue) or tissuegenic cell (e.g., myogenic cell) is contacted with the one or more FAO activators for no more than about 24 hours. In some embodiments, the tissue (e.g., muscle tissue) or tissuegenic cell (e.g., myogenic cell) is contacted with the one or more FAO activators for no more than about 48 hours.
[0258] In some embodiments, the tissue (e.g., muscle tissue) or tissuegenic cell (e.g., myogenic cell) is contacted with the one or more FAO activators at about any one of 0, 1, 2, 4, 6, 12, 18, 24, 36, 48, 60, or 72 hours, including any value or range in between these values, after the the tissue (e.g., muscle tissue) or tissuegenic cell (e.g., myogenic cell) is subject to a condition that induces tissue regeneration (e.g., myogenesis, such as inducing differentiation and/or maturation of myogenic cells). In some embodiments, the tissue (e.g., muscle tissue) or tissuegenic cell (e.g., myogenic cell) is contacted with the one or more FAO activators between about 0 hour and about 24 hours after the tissue (e.g., muscle tissue) or tissuegenic cell (e.g., myogenic cell) is subject to a condition that induces tissue regeneration (e.g., myogenesis, such as inducing differentiation and/or maturation of myogenic cells). In some embodiments, the tissue (e.g., muscle tissue) or tissuegenic cell (e.g., myogenic cell) is contacted with the one or more FAO activators between about 0 hour and about 48 hours after the tissue (e.g., muscle tissue) or tissuegenic cell (e.g., myogenic cell) is subject to a condition that induces tissue regeneration (e.g., myogenesis, such as inducing differentiation and/or maturation of myogenic cells). In some embodiments, the tissue (e.g., muscle tissue) or tissuegenic cell (e.g., myogenic cell) is contacted with the one or more FAO activators between about 24 hours and about 48 hours after the tissue (e.g., muscle tissue) or tissuegenic cell (e.g., myogenic cell) is subject to a condition that induces tissue regeneration (e.g., myogenesis, such as inducing differentiation and/or maturation of myogenic cells).
[0259] Exemplary conditions that induce tissue regeneration (such as myogenesis) include, for example, culturing in a differentiation medium such as in DMEM/F12 or DMEM medium, supplemented with about 2% KnockOut Serum Replacement or about 2% horse serum, and 1% L-glutamine.
[0260] In some embodiments, there is provided a method of increasing the activity of mitochondria fatty acid oxidation to promote early cellular differentiation in human myocytes.
[0261] In some embodiments, there is provided a method of increasing the mitochondrial oxygen consumption to promote early cellular differentiation in human myocytes.
[0262] In some embodiments, there is provided a method of increasing PPARγ activity to promote early cellular differentiation in human myocytes.
[0263] In some embodiments, transiently increasing the mitochondria fatty acid oxidation increases myogenic differentiation. In some embodiments, transiently increasing MyoD1 promotes myogenic differentiation. In some embodiments, transiently activating PPARγ promotes myogenic differentiation through increasing mitochondrial fatty acid oxidation transiently.
[0264] For example, rosiglitazone treatment of myocytes under an exemplary cell culture condition at the 0-24 hour time-window uniquely upregulated the mRNA levels of myogenin (MYOG), adult type I myosin heavy chain (MYH7) and perinatal myosin heavy chain (MYH8), whereas other time-windows of treatment had no significant effects at the end of 96 hours. Rosiglitazone treatment of myocytes at the 0-24 hour and 24-48 hour time windows in an exemplary culture condition can significantly enhance myogenesis. However, rosiglitazone suppresses myogenesis in the other time windows under the same conditions.
[0265] In some embodiments, contacting human myocytes seeded at high density with rosiglitazone results in more mature and hypertrophic human myotubes compared to the same culturing condition without rosiglitazone.
[0266] In some embodiments, there is provided a method of activating PPARγ in a tissuegenic cell (e.g., myogenic cell), comprising contacting the tissuegenic cell with a prostaglandin selected from the group consisting of prostaglandin 12 (PGI2), prostaglandin D2 (PGD2), analogues thereof, and salts, solvates, tautomers, and stereoisomers thereof. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo. In some embodiments, the tissuegenic cell is contacted with the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the method further comprises contacting the tissuegenic cell with a PPARγ agonist (e.g., rosiglitazone). In some embodiments, the prostaglandin increases the PPARγ expression and/or activity by at least any one of 10%, 20%, 50%, 2×, 3×, 5×, 10× or more, including any value or range in between these values.
[0267] The methods described herein are applicable to tissues (e.g., muscle tissues) and tissuegenic cells (e.g., myogenic cells) from various organisms, such as human, non-human primate (e.g., cynomolgus monkey, rhesus monkey, etc.), mouse, rat, cat, dog, hamster, rabbit, pig, cow, goat, sheep, horse, donkey, deer, mammal, bird, reptile, amphibian, fish, arthropod, mollusk, echinoderm, cnidarian, nematode, annelid, platyhelminth, etc.
[0268] In some embodiments, the tissue (e.g., muscle tissue) is from an individual. In some embodiments, the tissue (e.g., muscle tissue) is obtained by in vitro cell culture. In some embodiments, the tissue (e.g., muscle tissue) is an injured tissue. In some embodiments, the tissue (e.g., muscle tissue) has not undergone injury. In some embodiments, the tissue (e.g., muscle tissue) is from an aged individual, such as a rodent of at least 1 years old, 1.5 years old, 2 years old, or more, or a human of at least about any one of 50, 55, 60, 65, 70, 75, 80, 85 or more years old.
[0269] The methods described herein are applicable for a variety of tissues, including, but are not limited to tissues derived from endoderm, mesoderm, or neuroectoderm. In some embodiments, the tissue is a connective tissue (for example, loose connective tissue, dense connective tissue, elastic tissue, reticular connective tissue and adipose tissue), a muscle tissue (for example, skeletal muscle, smooth muscle and cardiac muscle), urogenital tissue, gastrointestinal tissue, lung tissue, bone tissue, nerve tissue and epithelial tissue (for example, a single layer of epithelial and stratified epithelium). In some embodiments, the tissue is of an organ selected from the group consisting of heart, liver, kidney, lung, stomach, intestine, bladder, and brain. In some embodiments, the tissue is a liver tissue. In some embodiments, the tissue is a heart tissue. In some embodiments, the tissue is a skin tissue. In some embodiments, the tissue is a hair follicle. In some embodiments, the artificial tissue is a muscle tissue.
[0270] In some embodiments, the tissue is a skeletal muscle tissue. In some embodiments, the tissue is anon-skeletal muscle tissue. In some embodiments, the non-skeletal muscle tissue is a mesodermal tissue. In some embodiments, the non-skeletal muscle tissue is heart and cardiac muscle tissue. In some embodiments, the non-skeletal muscle tissue is an endodermal tissue. In some embodiments, the non-skeletal muscle tissue is liver tissue. In some embodiments, the non-skeletal muscle tissue is a neuroectodermal tissue. In some embodiments, the non-skeletal muscle tissue is skin tissue. In some embodiments, the non-skeletal muscle tissue is the hair follicles.
[0271] In some embodiments, the muscle tissue comprises myogenic cells, such as myoblasts and/or myocytes. In some embodiments, the muscle tissue comprises at least about any one of 0.1%, 0.5%, 1%, 2%, 5%, 10%, 20%, 30% or more myogenic cells, including any value or range in between these values.
[0272] In some embodiments, the myogenic cell is a myoblast. In some embodiments, the myogenic cell is a Pax7.sup.− Pax3.sup.+ MyoD.sup.+ myogenin and/or Pax7.sup.+ Pax3.sup.−MyoD.sup.+ myogenin.sup.− cell. In some embodiments, the myogenic cell is a myocyte. In some embodiments, the myocyte is a Pax3.sup.−Pax7.sup.− MyoD.sup.+ myogenin.sup.+ cell. In some embodiments, the myogenic cell is a primary cell. In some embodiments, the myogenic cell is derived from a cell line. In some embodiments, the myogenic cell is not derived from a cell line. In some embodiments, the myogenic cell is not derived from an immortal cell line.
III. Methods of Treatment
[0273] The present application further provides methods of treating a disease or condition associated with a tissue (e.g., muscle disease or condition) using one or more FAO activators. Any one of the methods of tissue regeneration described in Section II “methods of tissue regeneration” above may be used for treatment of a disease or condition associated with a tissue. The one or more FAO activators (including activators of PPARγ, such as PPARγ agonists and prostaglandins) used herein may have anyone or combination of features described in Section IV “fatty acid oxidation activators” below. Suitable diseases or conditions include, but are not limited to, sarcopenia, cachexia, disuse atrophy, inflammatory myopathies, muscular dystrophies, cardiomyopathies, skin wrinkling, intractable cutaneous ulcers, skin wounds, bullosis, alopecia, keloids, dermatitis, macular degeneration, colitis, liver steatosis, steatohepatitis, liver fibrosis, cirrhosis, pancreatitis, type 2 diabetes (T2D), lipodystrophies, chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, acute respiratory distress syndrome (ARDS), rheumatoid arthritis, osteoarthritis, osteoporosis, neurodegenerative diseases, cerebral infarction, myocardial infarction, pulmonary infarction, bone fracture, gastric ulcers, enteritis, chronic kidney disease, renal fibrosis, and other genetically determined, environmentally determined or idiopathic disease processes causing loss or atrophy of tissue/organ/body part structure and function.
Administration of FAO activators
[0274] In some embodiments, there is provided a method of treating a disease or condition associated with a tissue (e.g., a muscle disease or condition) in an individual, comprising administering an effective amount of a pharmaceutical composition comprising an FAO activator to the individual. In some embodiments, the disease or condition is tissue injury. In some embodiments, the disease or condition is tissue degeneration. In some embodiments, the disease or condition is tissue fibrosis. In some embodiments, the disease or condition is aging. In some embodiments, the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, a skin tissue and a hair follicle. In some embodiments, the pharmaceutical composition is administered to the individual once every 24 hours, every 48 hours, or every 72 hours. In some embodiments, the pharmaceutical composition is administered to the tissue of the individual. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the FAO activator is an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the FAO activator is an activator of a gene selected from the group consisting of PPARα, PPARδ, PPARγ, RXRB, RXRG, NCOA1, NCOA2, FABP3, FABP4, CD36, SCARB1, FATP1, FATP2, FATP3, FATP4, FATP5, FATP6, LPL, CPT1A, CPT1B, CPT1C, CPT2, CRAT, ACADs (e.g., ACAD1, ACAD2, ACAD3, ACAD4, ACAD5, ACAD6, ACAD7, ACAD8, ACAD9, ACAD10, ACAD11, MCAD, LCAD, VLCAD), HADHs (e.g., HADHA, HADHB), ETFA and ETFB. In some embodiments, the pharmaceutical composition comprises two or more FAO activators. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments according to any one of the methods of treatment described above, the disease or condition is selected from the group consisting of sarcopenia, cachexia, disuse atrophy, inflammatory myopathies, muscular dystrophies, cardiomyopathies, skin wrinkling, intractable cutaneous ulcers, skin wounds, bullosis, alopecia, keloids, dermatitis, macular degeneration, colitis, liver steatosis, steatohepatitis, liver fibrosis, cirrhosis, pancreatitis, type 2 diabetes (T2D), lipodystrophies, chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, acute respiratory distress syndrome (ARDS), rheumatoid arthritis, osteoarthritis, osteoporosis, neurodegenerative diseases, cerebral infarction, myocardial infarction, pulmonary infarction, bone fracture, gastric ulcers, enteritis, chronic kidney disease, renal fibrosis, and other genetically determined, environmentally determined or idiopathic disease processes causing loss or atrophy of tissue/organ/body part structure and function.
[0275] In some embodiments, there is provided a method of treating a disease or condition associated with a tissue (e.g., a muscle disease or condition) in an individual, comprising administering an effective amount of a pharmaceutical composition comprising a PPARγ agonist to the individual. In some embodiments, the disease or condition is tissue injury. In some embodiments, the disease or condition is tissue degeneration. In some embodiments, the disease or condition is tissue fibrosis. In some embodiments, the disease or condition is aging. In some embodiments, the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, a skin tissue and a hair follicle. In some embodiments, the pharmaceutical composition is administered to the individual once every 24 hours, every 48 hours, or every 72 hours. In some embodiments, the pharmaceutical composition is administered to the tissue of the individual. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments according to any one of the methods of treatment described above, the disease or condition is selected from the group consisting of sarcopenia, cachexia, disuse atrophy, inflammatory myopathies, muscular dystrophies, cardiomyopathies, skin wrinkling, intractable cutaneous ulcers, skin wounds, bullosis, alopecia, keloids, dermatitis, macular degeneration, colitis, liver steatosis, steatohepatitis, liver fibrosis, cirrhosis, pancreatitis, type 2 diabetes (T2D), lipodystrophies, chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, acute respiratory distress syndrome (ARDS), rheumatoid arthritis, osteoarthritis, osteoporosis, neurodegenerative diseases, cerebral infarction, myocardial infarction, pulmonary infarction, bone fracture, gastric ulcers, enteritis, chronic kidney disease, renal fibrosis, and other genetically determined, environmentally determined or idiopathic disease processes causing loss or atrophy of tissue/organ/body part structure and function.
[0276] In some embodiments, there is provided a method of treating a disease or condition associated with a tissue (e.g., a muscle disease or condition) in an individual, comprising administering an effective amount of a pharmaceutical composition comprising a prostaglandin to the individual, wherein the prostaglandin is selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the disease or condition is tissue injury. In some embodiments, the disease or condition is tissue degeneration. In some embodiments, the disease or condition is tissue fibrosis. In some embodiments, the disease or condition is aging. In some embodiments, the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, a skin tissue and a hair follicle. In some embodiments, the pharmaceutical composition is administered to the individual once every 24 hours, every 48 hours, or every 72 hours. In some embodiments, the pharmaceutical composition is administered to the tissue of the individual. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments according to any one of the methods of treatment described above, the disease or condition is selected from the group consisting of sarcopenia, cachexia, disuse atrophy, inflammatory myopathies, muscular dystrophies, cardiomyopathies, skin wrinkling, intractable cutaneous ulcers, skin wounds, bullosis, alopecia, keloids, dermatitis, macular degeneration, colitis, liver steatosis, steatohepatitis, liver fibrosis, cirrhosis, pancreatitis, type 2 diabetes (T2D), lipodystrophies, chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, acute respiratory distress syndrome (ARDS), rheumatoid arthritis, osteoarthritis, osteoporosis, neurodegenerative diseases, cerebral infarction, myocardial infarction, pulmonary infarction, bone fracture, gastric ulcers, enteritis, chronic kidney disease, renal fibrosis, and other genetically determined, environmentally determined or idiopathic disease processes causing loss or atrophy of tissue/organ/body part structure and function.
[0277] In some embodiments, there is provided a method of treating a disease or condition associated with a tissue (e.g., a muscle disease or condition) in an individual, comprising administering an effective amount of a pharmaceutical composition comprising a PPARγ agonist (e.g., rosiglitazone) and a prostaglandin to the individual, wherein the prostaglandin is selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the disease or condition is tissue injury. In some embodiments, the disease or condition is tissue degeneration. In some embodiments, the disease or condition is tissue fibrosis. In some embodiments, the disease or condition is aging. In some embodiments, the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, a skin tissue and a hair follicle. In some embodiments, the pharmaceutical composition is administered to the individual once every 24 hours, every 48 hours, or every 72 hours. In some embodiments, the pharmaceutical composition is administered to the tissue of the individual. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the pharmaceutical composition comprises rosiglitazone and PGI2. In some embodiments, the pharmaceutical composition comprises rosiglitazone and treprostinil. In some embodiments according to any one of the methods of treatment described above, the disease or condition is selected from the group consisting of sarcopenia, cachexia, disuse atrophy, inflammatory myopathies, muscular dystrophies, cardiomyopathies, skin wrinkling, intractable cutaneous ulcers, skin wounds, bullosis, alopecia, keloids, dermatitis, macular degeneration, colitis, liver steatosis, steatohepatitis, liver fibrosis, cirrhosis, pancreatitis, type 2 diabetes (T2D), lipodystrophies, chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, acute respiratory distress syndrome (ARDS), rheumatoid arthritis, osteoarthritis, osteoporosis, neurodegenerative diseases, cerebral infarction, myocardial infarction, pulmonary infarction, bone fracture, gastric ulcers, enteritis, chronic kidney disease, renal fibrosis, and other genetically determined, environmentally determined or idiopathic disease processes causing loss or atrophy of tissue/organ/body part structure and function.
[0278] In some embodiments, there is provided a method of treating a muscle disease or condition in an individual, comprising administering an effective amount of a pharmaceutical composition comprising one or more FAO activators to the individual. In some embodiments, the muscle disease or condition is muscle injury. In some embodiments, the muscle disease or condition is muscle degeneration. In some embodiments, the muscle disease or condition is muscle fibrosis. In some embodiments, the muscle disease or condition is aging. In some embodiments, the pharmaceutical composition is administered to the individual once every 24 hours, every 48 hours, or every 72 hours. In some embodiments, the pharmaceutical composition is administered to a muscle tissue of the individual, e.g., intramuscularly or subcutaneously. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the one or more FAO activators comprises an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the one or more FAO activators comprises one or more activators of PPARγ. In some embodiments, the one or more activators of PPARγ comprises a PPARγ agonist, such as rosiglitazone. In some embodiments, the one or more activators of PPARγ comprises a prostaglandin selected from the group consisting of PGI2, PGD2, and analogues thereof (e.g., treprostinil). In some embodiments, the one or more activators of PPARγ comprises rosiglitazone and PGI2, or rosiglitazone and treprostinil.
[0279] In some embodiments, there is provided a method of treating injury to a tissue (e.g., muscle tissue) in an individual, comprising administering an effective amount of a pharmaceutical composition comprising an FAO activator to the individual. In some embodiments, the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, a skin tissue and a hair follicle. In some embodiments, the pharmaceutical composition is administered to the individual no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours after the tissue injury. In some embodiments, the pharmaceutical composition is administered to the individual no more than about 24 hours after the injury. In some embodiments, the pharmaceutical composition is administered to the tissue of the individual. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the FAO activator is an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the FAO activator is an activator of a gene selected from the group consisting of PPARα, PPARS, PPARγ, RXRB, RXRG, NCOA1, NCOA2, FABP3, FABP4, CD36, SCARB1, FATP1, FATP2, FATP3, FATP4, FATP5, FATP6, LPL, CPT1A, CPT1B, CPT1C, CPT2, CRAT, ACADs (e.g., ACAD1, ACAD2, ACAD3, ACAD4, ACAD5, ACAD6, ACAD7, ACAD8, ACAD9, ACAD10, ACAD11, MCAD, LCAD, VLCAD), HADHs (e.g., HADHA, HADHB), ETFA and ETFB. In some embodiments, the pharmaceutical composition comprises two or more FAO activators. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old).
[0280] In some embodiments, there is provided a method of treating injury to a tissue (e.g., muscle tissue) in an individual, comprising administering an effective amount of a pharmaceutical composition comprising a PPARγ agonist to the individual. In some embodiments, the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, a skin tissue and a hair follicle. In some embodiments, the pharmaceutical composition is administered to the individual no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours after the tissue injury. In some embodiments, the pharmaceutical composition is administered to the individual no more than about 24 hours after the injury. In some embodiments, the pharmaceutical composition is administered to the tissue of the individual. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old).
[0281] In some embodiments, there is provided a method of treating injury to a tissue (e.g., muscle tissue) in an individual, comprising administering an effective amount of a pharmaceutical composition comprising a prostaglandin to the individual, wherein the prostaglandin is selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, a skin tissue and a hair follicle. In some embodiments, the pharmaceutical composition is administered to the individual no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours after the tissue injury. In some embodiments, the pharmaceutical composition is administered to the individual no more than about 24 hours after the injury. In some embodiments, the pharmaceutical composition is administered to the tissue of the individual. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old).
[0282] In some embodiments, there is provided a method of treating injury to a tissue (e.g., muscle tissue) in an individual, comprising administering an effective amount of a pharmaceutical composition comprising a PPARγ agonist (e.g., rosiglitazone) and a prostaglandin to the individual, wherein the prostaglandin is selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, a skin tissue and a hair follicle. In some embodiments, the pharmaceutical composition is administered to the individual no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours after the tissue injury. In some embodiments, the pharmaceutical composition is administered to the individual no more than about 24 hours after the injury. In some embodiments, the pharmaceutical composition is administered to the tissue of the individual. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the pharmaceutical composition comprises rosiglitazone and PGI2. In some embodiments, the pharmaceutical composition comprises rosiglitazone and treprostinil.
[0283] In some embodiments, there is provided a method of treating injury to a muscle tissue in an individual, comprising administering an effective amount of a pharmaceutical composition comprising one or more FAO activators to the individual. In some embodiments, the pharmaceutical composition is administered to the individual no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours after the muscle injury. In some embodiments, the pharmaceutical composition is administered to a muscle tissue of the individual, e.g., intramuscularly or subcutaneously. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the one or more FAO activators comprises an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the one or more FAO activators comprises one or more activators of PPARγ. In some embodiments, the one or more activators of PPARγ comprises a PPARγ agonist, such as rosiglitazone. In some embodiments, the one or more activators of PPARγ comprises a prostaglandin selected from the group consisting of PGI2, PGD2, and analogues thereof (e.g., treprostinil). In some embodiments, the one or more activators of PPARγ comprises rosiglitazone and PGI2, or rosiglitazone and treprostinil.
[0284] In some embodiments, there is provided a method of treating aging or a disease or condition associated with aging in an individual, comprising administering an effective amount of a pharmaceutical composition comprising an FAO activator to the individual. In some embodiments, the pharmaceutical composition is administered to a tissue of the individual. In some embodiments, the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, a skin tissue and a hair follicle. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the FAO activator is an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the FAO activator is an activator of a gene selected from the group consisting of PPARα, PPARδ, PPARγ, RXRB, RXRG, NCOA1, NCOA2, FABP3, FABP4, CD36, SCARB1, FATP1, FATP2, FATP3, FATP4, FATP5, FATP6, LPL, CPT1A, CPT1B, CPT1C, CPT2, CRAT, ACADs (e.g., ACAD1, ACAD2, ACAD3, ACAD4, ACAD5, ACAD6, ACAD7, ACAD8, ACAD9, ACAD10, ACAD11, MCAD, LCAD, VLCAD), HADHs (e.g., HADHA, HADHB), ETFA and ETFB. In some embodiments, the pharmaceutical composition comprises two or more FAO activators. In some embodiments, the individual is a human individual of at least about 50 years old.
[0285] In some embodiments, there is provided a method of treating aging or a disease or condition associated with aging in an individual, comprising administering an effective amount of a pharmaceutical composition comprising a PPARγ agonist to the individual. In some embodiments, the pharmaceutical composition is administered to a tissue of the individual. In some embodiments, the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, a skin tissue and a hair follicle. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the individual is a human individual of at least about 50 years old.
[0286] In some embodiments, there is provided a method of treating aging or a disease or condition associated with aging in an individual, comprising administering an effective amount of a pharmaceutical composition comprising a prostaglandin to the individual, wherein the prostaglandin is selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the pharmaceutical composition is administered to a tissue of the individual. In some embodiments, the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, a skin tissue and a hair follicle. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the individual is a human individual of at least about 50 years old.
[0287] In some embodiments, there is provided a method of treating aging or a disease or condition associated with aging in an individual, comprising administering an effective amount of a pharmaceutical composition comprising a PPARγ agonist (e.g., rosiglitazone) and a prostaglandin to the individual, wherein the prostaglandin is selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the pharmaceutical composition is administered to a tissue of the individual. In some embodiments, the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, a skin tissue and a hair follicle. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the individual is a human individual of at least about 50 years old. In some embodiments, the pharmaceutical composition comprises rosiglitazone and PGI2. In some embodiments, the pharmaceutical composition comprises rosiglitazone and treprostinil.
[0288] Also within the scope of the present application is the method of using fatty acid oxidation activation to mimic the benefits of exercise and nutrition to influence tissue (e.g., muscle) regeneration and degeneration in vivo.
[0289] In some embodiments, there is provided a method of providing one or more benefits of exercise and/or nutrition to a tissue (e.g., muscle tissue) of an individual, comprising administering an effective amount of a pharmaceutical composition comprising an FAO activator to the individual. In some embodiments, the tissue (e.g., muscle tissue) is injured. In some embodiments, the tissue (e.g., muscle tissue) is degenerated. In some embodiments, the pharmaceutical composition is administered to the individual once every 24 hours, every 48 hours, or every 72 hours. In some embodiments, the pharmaceutical composition is administered to the tissue (e.g., muscle tissue) of the individual, e.g., intramuscularly or subcutaneously. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the FAO activator is an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the FAO activator is an activator of a gene selected from the group consisting of PPARα, PPARS, PPARγ, RXRB, RXRG, NCOA1, NCOA2, FABP3, FABP4, CD36, SCARB1, FATP1, FATP2, FATP3, FATP4, FATP5, FATP6, LPL, CPT1A, CPT1B, CPT1C, CPT2, CRAT, ACADs (e.g., ACAD1, ACAD2, ACAD3, ACAD4, ACAD5, ACAD6, ACAD7, ACAD8, ACAD9, ACAD10, ACAD11, MCAD, LCAD, VLCAD), HADHs (e.g., HADHA, HADHB), ETFA and ETFB. In some embodiments, the pharmaceutical composition comprises two or more FAO activators. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old).
[0290] In some embodiments, there is provided a method of providing one or more benefits of exercise and/or nutrition to a tissue (e.g., muscle tissue) of an individual, comprising administering an effective amount of a pharmaceutical composition comprising a PPARγ agonist to the individual. In some embodiments, the tissue (e.g., muscle tissue) is injured. In some embodiments, the tissue (e.g., muscle tissue) is degenerated. In some embodiments, the pharmaceutical composition is administered to the individual once every 24 hours, every 48 hours, or every 72 hours. In some embodiments, the pharmaceutical composition is administered to the tissue (e.g., muscle tissue) of the individual, e.g., intramuscularly or subcutaneously. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old).
[0291] In some embodiments, there is provided a method of providing one or more benefits of exercise and/or nutrition to a tissue (e.g., muscle tissue) of an individual, comprising administering an effective amount of a pharmaceutical composition comprising a prostaglandin to the individual, wherein the prostaglandin is selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the tissue (e.g., muscle tissue) is injured. In some embodiments, the tissue (e.g., muscle tissue) is degenerated. In some embodiments, the pharmaceutical composition is administered to the individual once every 24 hours, every 48 hours, or every 72 hours. In some embodiments, the pharmaceutical composition is administered to the tissue (e.g., muscle tissue) of the individual, e.g., intramuscularly or subcutaneously. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old).
[0292] In some embodiments, there is provided a method of providing one or more benefits of exercise and/or nutrition to a tissue (e.g., muscle tissue) of an individual, comprising administering an effective amount of a pharmaceutical composition comprising a PPARγ agonist (e.g., rosiglitazone) and a prostaglandin to the individual, wherein the prostaglandin is selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the tissue (e.g., muscle tissue) is injured. In some embodiments, the tissue (e.g., muscle tissue) is degenerated. In some embodiments, the pharmaceutical composition is administered to the individual once every 24 hours, every 48 hours, or every 72 hours. In some embodiments, the pharmaceutical composition is administered to the tissue (e.g., muscle tissue) of the individual, e.g., intramuscularly or subcutaneously. In some embodiments, the pharmaceutical composition is administered to the individual systemically, e.g., orally. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the pharmaceutical composition comprises rosiglitazone and PGI2. In some embodiments, the pharmaceutical composition comprises rosiglitazone and treprostinil.
[0293] In some embodiments, the one or more benefits of exercise and/or nutrition comprises increase in myogenesis, increase in muscle regeneration, decrease in muscle degeneration, increase in tissue regeneration, decrease in tissue degeneration, increase in muscle volume, increase in muscle mass, increase in muscle glucose and fat metabolism, increase in muscle insulin sensitivity, increase in muscle stamina, and/or increase in muscle strength.
[0294] Also provided are compositions (such as pharmaceutical compositions) comprising any one or more of the FAO activators including activators of PPARγ, such as PPARγ agonists, and/or PGI2, PGD2 or analogues thereof described herein for use in any one of the methods described herein.
[0295] Generally, dosages, schedules, and routes of administration of the pharmaceutical compositions comprising the one or more FAO activators may be determined according to the size and condition of the individual, and according to standard pharmaceutical practice. Exemplary routes of administration include oral, rectal, nasal, topical (including buccal and sublingual), transdermal, vaginal or parenteral (including intramuscular, subcutaneous and intravenous. In some embodiments, the pharmaceutical composition is administered locally to a muscle tissue in the individual. In some embodiments, the pharmaceutical composition is administered subcutaneously. In some embodiments, the pharmaceutical composition is administered intramuscularly. In some embodiments, the pharmaceutical composition is administered by injection. In some embodiments, the pharmaceutical composition is administered to the individual systemically. In some embodiments, the pharmaceutical composition is administered to the individual orally.
[0296] The dose of the one or more FAO activators administered to an individual may vary according to, for example, the particular type of FAO activator(s) being administered, the route of administration, and the particular type of muscle disease or conditions being treated. The amount should be sufficient to produce a desirable response, such as a therapeutic response against the disease or condition, but without severe toxicity or adverse events. In some embodiments, the one or more FAO activators is administered at a therapeutically effective amount.
[0297] In some embodiments, the pharmaceutical composition is administered to the individual once. In some embodiments, the pharmaceutical composition is administered to the individual more than once, such as any one of 2, 3, 4, 5, 6, or more times. In some embodiments, the pharmaceutical composition may conveniently be presented in a once daily or as divided dose administered at appropriate intervals, for example as one does per 24, 48 or 72 hours. In some embodiments, the pharmaceutical composition is administered once every 24 hours, once every 36 hours, once every 48 hours, once every 60 hours, or once every 72 hours, including any value or range in between these values.
[0298] In some embodiments, the pharmaceutical composition is administered to the individual within about 72 hours from the muscle injury, such as within about any one of 60 hours, 48 hours, 36 hours, 24 hours, 12 hours, 6 hours, or less, including any value or range in between these values, from the muscle injury. In some embodiments, administration of rosiglitazone to an individual at the 24 and 48 hour time points after injury to a muscle tissue improved skeletal muscle regeneration in vivo.
Administration of Tissuegenic Cells
[0299] In some embodiments, there is provided a method of treating a disease or condition associated with a tissue (e.g., a muscle disease or condition) in an individual, comprising administering an effective amount of a pharmaceutical composition comprising tissuegenic cells (such as myogenic cells, e.g., myoblasts and/or myocytes) to the tissue (e.g., muscle tissue) of the individual, wherein the tissuegenic cells are contacted with an FAO activator prior to the administration of the pharmaceutical composition. In some embodiments, the disease or condition is tissue injury (e.g., muscle injury). In some embodiments, the disease or condition is tissue degeneration (e.g., muscle degeneration). In some embodiments, the disease or condition is tissue fibrosis (e.g., muscle fibrosis). In some embodiments, the disease or condition is aging. In some embodiments, the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, a skin tissue and a hair follicle. In some embodiments, the tissuegenic cells (e.g., myogenic cells) are contacted with the FAO activator for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the FAO activator is an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the FAO activator is an activator of a gene selected from the group consisting of PPARα, PPARδ, PPARγ, RXRB, RXRG, NCOA1, NCOA2, FABP3, FABP4, CD36, SCARB1, FATP1, FATP2, FATP3, FATP4, FATP5, FATP6, LPL, CPT1A, CPT1B, CPT1C, CPT2, CRAT, ACADs (e.g., ACAD1, ACAD2, ACAD3, ACAD4, ACAD5, ACAD6, ACAD7, ACAD8, ACAD9, ACAD10, ACAD11, MCAD, LCAD, VLCAD), HADHs (e.g., HADHA, HADHB), ETFA and ETFB. In some embodiments, the tissuegenic cells (e.g., myogenic cells) are contacted with two or more FAO activators. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the method further comprises contacting the tissuegenic cells with the FAO activator prior to the administration of the pharmaceutical composition.
[0300] In some embodiments, there is provided a method of treating a disease or condition associated with a tissue (e.g., a muscle disease or condition) in an individual, comprising administering an effective amount of a pharmaceutical composition comprising tissuegenic cells (such as myogenic cells, e.g., myoblasts and/or myocytes) to the tissue (e.g., muscle tissue) of the individual, wherein the tissuegenic cells are contacted with a PPARγ agonist prior to the administration of the pharmaceutical composition. In some embodiments, the disease or condition is tissue injury (e.g., muscle injury). In some embodiments, the disease or condition is tissue degeneration (e.g., muscle degeneration). In some embodiments, the disease or condition is tissue fibrosis (e.g., muscle fibrosis). In some embodiments, the disease or condition is aging. In some embodiments, the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, a skin tissue and a hair follicle. In some embodiments, the tissuegenic cells (e.g., myogenic cells) are contacted with the PPARγ agonist for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the method further comprises contacting the tissuegenic cells with the PPARγ agonist prior to the administration of the pharmaceutical composition.
[0301] In some embodiments, there is provided a method of treating a disease or condition associated with a tissue (e.g., a muscle disease or condition) in an individual, comprising administering an effective amount of a pharmaceutical composition comprising tissuegenic cells (such as myogenic cells, e.g., myoblasts and/or myocytes) to the tissue (e.g., muscle tissue) of the individual, wherein the tissuegenic cells are contacted with a prostaglandin prior to the administration of the pharmaceutical composition, and wherein the prostaglandin is selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the disease or condition is tissue injury (e.g., muscle injury). In some embodiments, the disease or condition is tissue degeneration (e.g., muscle degeneration). In some embodiments, the disease or condition is tissue fibrosis (e.g., muscle fibrosis). In some embodiments, the disease or condition is aging. In some embodiments, the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, a skin tissue and a hair follicle. In some embodiments, the tissuegenic cells (e.g., myogenic cells) are contacted with the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the method further comprises contacting the tissuegenic cells with the prostaglandin prior to the administration of the pharmaceutical composition.
[0302] In some embodiments, there is provided a method of treating a disease or condition associated with a tissue (e.g., a muscle disease or condition) in an individual, comprising administering an effective amount of a pharmaceutical composition comprising tissuegenic cells (such as myogenic cells, e.g., myoblasts and/or myocytes) to the tissue (e.g., muscle tissue) of the individual, wherein the tissuegenic cells are contacted with a PPARγ agonist (e.g., rosiglitazone) and a prostaglandin prior to the administration of the pharmaceutical composition, and wherein the prostaglandin is selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the disease or condition is tissue injury (e.g., muscle injury). In some embodiments, the disease or condition is tissue degeneration (e.g., muscle degeneration). In some embodiments, the disease or condition is tissue fibrosis (e.g., muscle fibrosis). In some embodiments, the disease or condition is aging. In some embodiments, the tissue is selected from the group consisting of a muscle tissue, a liver tissue, a heart tissue, a skin tissue and a hair follicle. In some embodiments, the tissuegenic cells (e.g., myogenic cells) are contacted with the PPARγ agonist and the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the PPARγ agonist is rosiglitazone and the prostaglandin is PGI2. In some embodiments, the PPARγ agonist is rosiglitazone and the prostaglandin istreprostinil. In some embodiments, the method further comprises contacting the tissuegenic cells with the PPARγ agonist and the prostaglandin prior to the administration of the pharmaceutical composition.
[0303] In some embodiments, there is provided a method of treating a muscle disease or condition in an individual, comprising: (1) contacting myogenic cells (e.g., myoblasts or myocytes) with an FAO activator to provide a pharmaceutical composition comprising the myogenic cells or differentiated cells thereof; and (2) administering an effective amount of the pharmaceutical composition to a muscle tissue of the individual. In some embodiments, the muscle disease or condition is muscle injury. In some embodiments, the muscle disease or condition is muscle degeneration. In some embodiments, the method comprises contacting the myogenic cells with the FAO activator for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the FAO activator is an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the FAO activator is an activator of a gene selected from the group consisting of PPARα, PPARδ, PPARγ, RXRB, RXRG, NCOA1, NCOA2, FABP3, FABP4, CD36, SCARB1, FATP1, FATP2, FATP3, FATP4, FATP5, FATP6, LPL, CPT1A, CPT1B, CPT1C, CPT2, CRAT, ACADs (e.g., ACAD1, ACAD2, ACAD3, ACAD4, ACAD5, ACAD6, ACAD7, ACAD8, ACAD9, ACAD10, ACAD11, MCAD, LCAD, VLCAD), HADHs (e.g., HADHA, HADHB), ETFA and ETFB. In some embodiments, the method comprises contacting the myogenic cells with two or more FAO activators. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old).
[0304] In some embodiments, there is provided a method of treating a muscle disease or condition in an individual, comprising: (1) contacting myogenic cells (e.g., myoblasts or myocytes) with a PPARγ agonist to provide a pharmaceutical composition comprising the myogenic cells or differentiated cells thereof; and (2) administering an effective amount of the pharmaceutical composition to a muscle tissue of the individual. In some embodiments, the muscle disease or condition is muscle injury. In some embodiments, the muscle disease or condition is muscle degeneration. In some embodiments, the method comprises contacting the myogenic cells with the PPARγ agonist for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old).
[0305] In some embodiments, there is provided a method of treating a muscle disease or condition in an individual, comprising: (1) contacting myogenic cells (e.g., myoblasts or myocytes) with a prostaglandin to provide a pharmaceutical composition comprising the myogenic cells or differentiated cells thereof, wherein the prostaglandin is selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil); and (2) administering an effective amount of the pharmaceutical composition to a muscle tissue of the individual. In some embodiments, the muscle disease or condition is muscle injury. In some embodiments, the muscle disease or condition is muscle degeneration. In some embodiments, the method comprises contacting the myogenic cells with the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old).
[0306] In some embodiments, there is provided a method of treating a muscle disease or condition in an individual, comprising: (1) contacting myogenic cells (e.g., myoblasts or myocytes) with a PPARγ agonist (e.g., rosiglitazone) and a prostaglandin to provide a pharmaceutical composition comprising the myogenic cells or differentiated cells thereof, wherein the prostaglandin is selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil); and (2) administering an effective amount of the pharmaceutical composition to a muscle tissue of the individual. In some embodiments, the muscle disease or condition is muscle injury. In some embodiments, the muscle disease or condition is muscle degeneration. In some embodiments, the method comprises contacting the myogenic cells with the PPARγ agonist and the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the PPARγ agonist is rosiglitazone and the prostaglandin is PGI2. In some embodiments, the PPARγ agonist is rosiglitazone and the prostaglandin istreprostinil.
[0307] In some embodiments, there is provided a method of treating injury to a muscle tissue in an individual, comprising administering an effective amount of a pharmaceutical composition comprising myogenic cells to the muscle tissue of the individual, wherein the myogenic cells are contacted with an FAO activator prior to the administration of the pharmaceutical composition. In some embodiments, the pharmaceutical composition is administered to the individual no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours after the muscle injury. In some embodiments, the myogenic cells are contacted with the FAO activator for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the FAO activator is an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the FAO activator is an activator of a gene selected from the group consisting of PPARα, PPARδ, PPARγ, RXRB, RXRG, NCOA1, NCOA2, FABP3, FABP4, CD36, SCARB1, FATP1, FATP2, FATP3, FATP4, FATP5, FATP6, LPL, CPT1A, CPT1B, CPT1C, CPT2, CRAT, ACADs (e.g., ACAD1, ACAD2, ACAD3, ACAD4, ACAD5, ACAD6, ACAD7, ACAD8, ACAD9, ACAD10, ACAD11, MCAD, LCAD, VLCAD), HADHs (e.g., HADHA, HADHB), ETFA and ETFB. In some embodiments, the myogenic cells are contacted with two or more FAO activators. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old).
[0308] In some embodiments, there is provided a method of treating injury to a muscle tissue in an individual, comprising administering an effective amount of a pharmaceutical composition comprising myogenic cells to the muscle tissue of the individual, wherein the myogenic cells are contacted with a PPARγ agonist prior to the administration of the pharmaceutical composition. In some embodiments, the pharmaceutical composition is administered to the individual no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours after the muscle injury. In some embodiments, the myogenic cells are contacted with the PPARγ agonist for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old).
[0309] In some embodiments, there is provided a method of treating injury to a muscle tissue in an individual, comprising administering an effective amount of a pharmaceutical composition comprising myogenic cells (e.g., myoblasts or myocytes) to a muscle tissue of the individual, wherein the myogenic cells are contacted with a prostaglandin prior to the administration of the pharmaceutical composition, wherein the prostaglandin is selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the muscle disease or condition is muscle injury. In some embodiments, the muscle disease or condition is muscle degeneration. In some embodiments, the myogenic cells are contacted with the PGI2 or analogue thereof for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old).
[0310] In some embodiments, there is provided a method of treating injury to a muscle tissue in an individual, comprising administering an effective amount of a pharmaceutical composition comprising myogenic cells (e.g., myoblasts or myocytes) to a muscle tissue of the individual, wherein the myogenic cells are contacted with a PPARγ agonist (e.g., rosiglitazone) and a prostaglandin prior to the administration of the pharmaceutical composition, wherein the prostaglandin is selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil). In some embodiments, the muscle disease or condition is muscle injury. In some embodiments, the muscle disease or condition is muscle degeneration. In some embodiments, the myogenic cells are contacted with the PPARγ agonist and the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the PPARγ agonist is rosiglitazone and the prostaglandin is PGI2. In some embodiments, the PPARγ agonist is rosiglitazone and the prostaglandin istreprostinil.
[0311] In some embodiments, there is provided a method of treating injury to a muscle tissue in an individual, comprising: (1) contacting myogenic cells with an FAO activator to provide a pharmaceutical composition comprising the myogenic cells or differentiated cells thereof; and (2) administering an effective amount of the pharmaceutical composition to the muscle tissue of the individual. In some embodiments, the pharmaceutical composition is administered to the individual no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours after the muscle injury. In some embodiments, the method comprises contacting the myogenic cells with the FAO activator for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the FAO activator is an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the FAO activator is an activator of a gene selected from the group consisting of PPARα, PPARS, PPARγ, RXRB, RXRG, NCOA1, NCOA2, FABP3, FABP4, CD36, SCARB1, FATP1, FATP2, FATP3, FATP4, FATP5, FATP6, LPL, CPT1A, CPT1B, CPT1C, CPT2, CRAT, ACADs (e.g., ACAD1, ACAD2, ACAD3, ACAD4, ACAD5, ACAD6, ACAD7, ACAD8, ACAD9, ACAD10, ACAD11, MCAD, LCAD, VLCAD), HADHs (e.g., HADHA, HADHB), ETFA and ETFB. In some embodiments, the method comprises contacting the myogenic cells with two or more FAO activators. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old).
[0312] In some embodiments, there is provided a method of treating injury to a muscle tissue in an individual, comprising: (1) contacting myogenic cells with a PPARγ agonist to provide a pharmaceutical composition comprising the myogenic cells or differentiated cells thereof; and (2) administering an effective amount of the pharmaceutical composition to the muscle tissue of the individual. In some embodiments, the pharmaceutical composition is administered to the individual no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours after the muscle injury. In some embodiments, the method comprises contacting the myogenic cells with the PPARγ agonist for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old).
[0313] In some embodiments, there is provided a method of treating injury to a muscle tissue in an individual, comprising: (1) contacting myogenic cells (e.g., myoblasts or myocytes) with a prostaglandin to provide a pharmaceutical composition comprising the myogenic cells or differentiated cells thereof, wherein the prostaglandin is selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil); and (2) administering an effective amount of the pharmaceutical composition to a muscle tissue of the individual. In some embodiments, the muscle disease or condition is muscle injury. In some embodiments, the muscle disease or condition is muscle degeneration. In some embodiments, the method comprises contacting the myogenic cells with the PGI2 or analogue thereof for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old).
[0314] In some embodiments, there is provided a method of treating injury to a muscle tissue in an individual, comprising: (1) contacting myogenic cells (e.g., myoblasts or myocytes) with a PPARγ agonist (e.g., rosiglitazone) and a prostaglandin to provide a pharmaceutical composition comprising the myogenic cells or differentiated cells thereof, wherein the prostaglandin is selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil); and (2) administering an effective amount of the pharmaceutical composition to a muscle tissue of the individual. In some embodiments, the muscle disease or condition is muscle injury. In some embodiments, the muscle disease or condition is muscle degeneration. In some embodiments, the method comprises contacting the myogenic cells with the PPARγ agonist and the prostaglandin for no more than about 72 hours, no more than about 48 hours, or no more than about 24 hours. In some embodiments, the individual is an aged individual (e.g., a human individual of at least about 50 years old). In some embodiments, the PPARγ agonist is rosiglitazone and the prostaglandin is PGI2. In some embodiments, the PPARγ agonist is rosiglitazone and the prostaglandin istreprostinil.
[0315] Suitable tissuegenic cells include, but are not limited to stem cells, progenitor cells, ESC and iPSC, reprogrammed cells, transdifferentiated cells, or differentiated cells produced from such stem cells, precursor cells, or combinations thereof. Suitable myogenic cells include, but are not limited to muscle stem cells (e.g., satellite cells), embryonic and fetal myoblasts, myoblasts produced from ESC or iPSC, reprogrammed myogenic cells (e.g., rejuvenated and/or de-differentiated myogenic cells) or transdifferentiated myogenic cells, or differentiated cells produced from such muscle stem cells, myoblasts, or reprogrammed myogenic cells.
[0316] The tissuegenic cells (e.g., myogenic cells) may be obtained from various sources. In some embodiments, the tissuegenic cells (e.g., myogenic cells) are autologous. In some embodiments, the tissuegenic cells (e.g., myogenic cells) are allogenic. In some embodiments, the tissuegenic cells (e.g., myogenic cells) are non-immunogenic to the individual. In some embodiments, the tissuegenic cells (e.g., myogenic cells) are produced from a cell line. In some embodiments, the tissuegenic cells (e.g., myogenic cells) are not produced from an immortal cell line. In some embodiments, the tissuegenic cells (e.g., myogenic cells) are produced from primary cells obtained from the individual. In some embodiments, the tissuegenic cells (e.g., myogenic cells) are produced from primary cells obtained from a donor.
[0317] Muscle stem cells may be obtained using known methods in the art. See, for example, by culturing isolated muscle stem cells from young individuals and culturing the muscle stem cells by differential adhesion (e.g., Skuk, 2010), by FACS sorting of adult muscle stem cells (e.g., Conboy, 2010), and by preparing muscle stem cells from ESC or iPSC (e.g., Darabi, 2008; Borchin, 2013; Shelton, 2016), which are incorporated herein by reference in their entirety.
[0318] Myoblasts may be produced from ESC or iPSC using known methods in the art. See, for example, Darabi, 2008; Borchin, 2013; Shelton, 2016, which are incorporated herein by reference in their entirety. Reprogrammed (e.g., rejuvenated and/or de-differentiated) myoblasts may be produced using methods described in PCT/CN2019/088977 and PCT/CN2020/092615. Additionally, muscle progenitor cells such as muscle stem cells and myoblasts may be produced by direct reprogramming of adult somatic cells using myogenic transcription factor(s) and/or small molecule drugs, for example, transdifferentiation of mouse fibroblasts by transient expression of MyoD in combination with GSK3P inhibitor (e.g., CHIR99021), TGF-β inhibitor (e.g., RepSox), and/or cAMP agonist (e.g., Forskolin). See, Bar-Nur, 2018, the contents of which are incorporated herein by reference in its entirety. Myoblasts may be proliferated without differentiation by culturing myoblasts under suitable conditions, for example in a proliferation medium comprising DMEM and about 20% FBS, and passaged before about 80% confluency each time.
[0319] Myocytes may be produced from myoblasts by culturing the myoblasts under suitable conditions. For example, myoblasts may be allowed to reach 100% confluency and cultured in a differentiation medium comprising a DMEM/F12 or DMEM medium, supplemented with about 2% KnockOut Serum Replacement or about 2% horse serum, and about 1% L-glutamine for about 2 days.
[0320] In some embodiments, the method further comprises administering to the individual an effective amount of an immunosuppressant to minimize rejection of the tissuegenic cells (e.g., myogenic cells). Examples of immunosuppressive agents include, but are not limited to, methotrexate, cyclophosphamide, cyclosporine, cyclosporin A, chloroquine, hydroxychloroquine, sulfasalazine (sulphasalazopyrine), gold salts, D-penicillamine, leflunomide, azathioprine, anakinra, infliximab (REMICADE), etanercept, TNF alpha, blockers, a biological agent that targets an inflammatory cytokine, and Non-Steroidal Anti-Inflammatory Drug (NSAIDs).
[0321] Any of the methods described herein may further comprise one or more steps for in vitro production of the tissuegenic cells (e.g., myogenic cells). Any suitable methods for in vitro proliferation and/or differentiation of tissuegenic cells (e.g., myogenic cells) may be used. See, for example, Chua et al., 2019; and Fukawa et al., 2016. In some embodiments, the method comprises obtaining the tissuegenic cells (such as myogenic cells, e.g., muscle stem cells, myoblasts, and/or myocytes) from the individual or a donor. In some embodiments, the method comprises any one of the methods of producing reprogrammed myogenic cells from adult myogenic cells or adult somatic cells (e.g., fibroblasts). In some embodiments, the method comprises culturing the tissuegenic cells (e.g., myogenic cells) in vitro under conditions that allow proliferation of the tissuegenic cells. In some embodiments, the method comprises culturing the myoblasts in vitro under conditions that allow proliferation of the myogenic cells (e.g., myoblasts and/or myocytes) without differentiation. In some embodiments, the myoblasts are cultured in a proliferation medium comprising DMEM/F12 with about 20% FBS and about 1% L-glutamine. In some embodiments, the method comprises culturing tissuegenic cells (such as myogenic cells, e.g., muscle stem cells, myoblasts, and/or myocytes) in vitro under conditions that allow differentiation of the tissuegenic cells. In some embodiments, the myoblasts are cultured in a differentiation medium comprising DMEM/F12 or DMEM, with about 2% KnockOut Serum Replacement or about 2% horse serum, and 1% L-glutamine. In some embodiments, the method comprises culturing tissuegenic cells (e.g., myogenic cells) in a differentiation medium in the presence of the one or more FAO activators such as PPARγ agonist and/or PGI2 or analogue thereof. In some embodiments, the tissuegenic cells (e.g., myogenic cells) are cultured in vitro for no more than about any one of 72 hours, 60 hours, 48 hours, 36 hours, 24 hours, 12 hours, or 6 hours prior to administration to the individual. In some embodiments, the tissuegenic cells (e.g., myogenic cells) are seeded at high density (e.g., at least about 80% confluency). In some embodiments, the tissuegenic cells (e.g., myogenic cells) are seeded at low density (e.g., lower than about 80% confluency).
[0322] The pharmaceutical composition comprising myogenic cells described herein may comprise tissuegenic cells (e.g., myogenic cells), their progeny, and cells that differentiated from the tissuegenic cells (e.g., myogenic cells). The pharmaceutical composition may be a suspension of cells, or a tissue construct (e.g., a muscle construct). In some embodiments, the pharmaceutical composition is a solution suitable for injection. In some embodiments, the pharmaceutical composition is a hydrogel suitable for surgical implantation. In some embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically composition comprises a cell adhesion molecule, such as fibrin. In some embodiments, the tissuegenic cells (e.g., myogenic cells) are intermixed with the carrier. In some embodiments, the pharmaceutically composition comprises extracellular matrix molecules. In some embodiments, the pharmaceutically composition comprises MATRIGEL®.
[0323] In some embodiments, the method comprises implanting a tissue construct in the individual. In some embodiments, the method comprises implanting a muscle construct at the muscle tissue of the individual. Any of the methods described herein may further comprise one or more steps for preparing a muscle construct. Any suitable methods for preparing muscle constructs may be used. See, for example, Velcro-anchored fibrin constructs (e.g., Hinds et al., 2011), and suture-anchored fibrin constructs (e.g., Khodabukus and Baar, 2009), three-dimensional bio-printing of muscle constructs such as by coaxial printing (e.g., Testa, 2018) and using a tissue-derived bio-ink (e.g., Choi, 2019), and culturing muscle progenitor cells on three-dimensional printed molds (e.g., Capel, 2019). In some embodiments, the method comprises culturing myogeniccells (e.g., myoblasts) in a hydrogel carrier, such as a carrier comprising MATRIGEL® and fibrin, to produce a muscle construct. In some embodiments, the myogeniccells (e.g., myoblasts) are cultured on the surface of a hydrogel, such as fibrin, anchored with sutures to produce a muscle construct. In some embodiments, the myogeniccells are cultured within a three-dimensional (“3D”) solid mold to produce a pre-shaped muscle construct. In some embodiments, the myogeniccells are 3D-printed with ink to produce a defined 3D muscle construct.
[0324] The present application also provides compositions (such as pharmaceutical compositions) comprising tissuegenic cells (such as myogenic cells, e.g., myoblasts and/or myocytes) or differentiated cells thereof that can be used in any one of the methods of treatment described herein. Also provided are tissue constructs (e.g., muscle constructs) comprising tissuegenic cells (such as myogenic cells, e.g., myoblasts and/or myocytes) or differentiated cells thereof.
[0325] Generally, dosages, schedules, and routes of administration of the pharmaceutical compositions comprising the tissuegenic cells (e.g., myogenic cells) may be determined according to the size and condition of the individual, and according to standard pharmaceutical practice. Exemplary routes of administration include intravenous, intra-arterial, intraperitoneal, intramuscular, subcutaneous, or transdermal. In some embodiments, the pharmaceutical composition is administered subcutaneously. In some embodiments, the pharmaceutical composition is administered intramuscularly. In some embodiments, the pharmaceutical composition is administered by injection. In some embodiments, the pharmaceutical composition is administered by surgical implantation.
[0326] The dose of the cells administered to an individual may vary according to, for example, the particular type of cells being administered, the route of administration, and the particular type of diseases or conditions (e.g., muscle diseases or conditions) being treated. The amount should be sufficient to produce a desirable response, such as a therapeutic response against the disease or condition, but without severe toxicity or adverse events. In some embodiments, the myogenic cells or differentiated cells thereof are administered at a therapeutically effective amount. In some embodiments, the pharmaceutical composition comprises at least about any one of 10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7 or more cells, including any value or range in between these values.
[0327] In some embodiments, the pharmaceutical composition is administered to the individual once. In some embodiments, the pharmaceutical composition is administered to the individual more than once, such as any one of 2, 3, 4, 5, 6, or more times. In some embodiments, the pharmaceutical composition is administered once every 24 hours, once every 36 hours, once every 48 hours, once every 60 hours, or once every 72 hours, including any value or range in between these values. In some embodiments, the pharmaceutical composition is administered to the individual within about 72 hours from the tissue injury (e.g., muscle injury), such as within about any one of 60 hours, 48 hours, 36 hours, 24 hours, 12 hours, 6 hours, or less, including any value or range in between these values, from the tissue injury (e.g., muscle injury).
Pharmaceutical Compositions
[0328] The present application provides compositions such as pharmaceutical compositions useful for any one of the methods of treatment described herein.
[0329] The pharmaceutical compositions may comprise one or more pharmaceutically acceptable carrier. As used herein, by “pharmaceutically acceptable” or “pharmacologically compatible” is meant a material that is not biologically or otherwise undesirable, e.g., the material may be incorporated into a pharmaceutical composition administered to an individual without causing any significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the composition in which it is contained. Pharmaceutically acceptable carriers or excipients have preferably met the required standards of toxicological and manufacturing testing and/or are included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug administration. Techniques for formulation and administration of drugs may be found in “Remington's Pharmaceutical Sciences,” Mack Publishing Co., Easton, Pa., latest edition, which is incorporated herein by reference.
[0330] The pharmaceutical compositions described herein may include other agents, excipients, or stabilizers to improve properties of the composition. Examples of pharmaceutically acceptable excipients include stabilizers, lubricants, surfactants, diluents, anti-oxidants, binders, coloring agents, bulking agents, emulsifiers, or taste-modifying agents. In preferred embodiments, pharmaceutical compositions according to the embodiments are sterile compositions. Pharmaceutical compositions may be prepared using compounding techniques known or that become available to those skilled in the art. The final form may be sterile and may also be able to pass readily through an injection device such as a hollow needle. The proper viscosity may be achieved and maintained by the proper choice of solvents or excipients. In some embodiments, the composition is suitable for administration to a human.
[0331] The pharmaceutical compositions and compounds described herein may be formulated as solutions, emulsions, suspensions, dispersions, or inclusion complexes such as cyclodextrins in suitable pharmaceutical solvents or carriers, or as pills, tablets, lozenges, suppositories, sachets, dragees, granules, powders, powders for reconstitution, or capsules along with solid carriers according to conventional methods known in the art for preparation of various dosage forms.
[0332] The formulations may, where appropriate, be conveniently presented in discrete dosage units and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing into association the active ingredient with one or more pharmaceutically acceptable carriers, like liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product into the desired formulation.
[0333] In some embodiments, there is provided a pharmaceutical composition comprising one or more FAO activators and a pharmaceutically acceptable salt thereof. In some embodiments, the one or more FAO activators is a PPARγ agonist. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the one or more FAO activators is a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil) and salts, solvates, tautomers, and stereoisomers thereof. In some embodiments, the one or more FAO activators is PGI2, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the one or more FAO activators is treprostinil, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the one or more FAO activators are rosiglitazone and PGI2. In some embodiments, the one or more FAO activators are rosiglitazone and treprostinil. The pharmaceutical composition may be formulated for oral, rectal, nasal, topical (including buccal and sublingual), transdermal, vaginal or parenteral (including intramuscular, subcutaneous and intravenous) administration in liquid or solid form or in a form suitable for administration by inhalation or insufflation. In some embodiments, the pharmaceutical composition is formulated for intramuscular or subcutaneous administration. In some embodiments, the pharmaceutical composition is formulated for oral administration.
[0334] For oral administration, the one or more FAO activators (e.g., PPARγ agonist and/or PGD2, PGI2 or analogue thereof) may be provided in a solid form, or as a solution, emulsion, or suspension. For example, the pharmaceutical composition may be formulated in the form of tablets, granules, fine granules, powders, capsules, caplets, soft capsules, pills, oral solutions, syrups, dry syrups, chewable tablets, troches, effervescent tablets, drops, suspension, fast dissolving tablets, oral fast-dispersing tablets, etc.
[0335] Pharmaceutical compositions suitable for oral administration may conveniently be presented as discrete units such as capsules, including soft gelatin capsules, cachets or tablets each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution, a suspension or as an emulsion, for example as syrups, elixirs or self-emulsifying delivery systems (SEDDS). The active ingredients may also be presented as a bolus, electuary or paste. Tablets and capsules for oral administration may contain conventional excipients such as binding agents, fillers, lubricants, disintegrants, or wetting agents. The tablets may be coated according to methods well known in the art. Oral liquid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils), or preservatives.
[0336] The pharmaceutical compositions according to the present application may also be formulated for parenteral administration (e.g. by injection, for example bolus injection or continuous infusion) and may be presented in unit dose form in ampoules, pre-filled syringes, small volume infusion or in multi-dose containers with an added preservative. The compositions may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredients may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilisation from solution, for constitution with a suitable vehicle, e.g. sterile, pyrogen-free water, before use.
[0337] Pharmaceutical compositions suitable for rectal administration wherein the carrier is a solid are most preferably presented as unit dose suppositories. Suitable carriers include cocoa butter and other materials commonly used in the art, and the suppositories may be conveniently formed by admixture of the active compound(s) with the softened or melted carrier(s) followed by chilling and shaping in moulds.
[0338] In some embodiments, there is provided a pharmaceutical composition comprising tissuegenic cells (such as myogenic cells, e.g., myoblasts and/or myocytes), wherein the tissuegenic cells (e.g., myogenic cells) are contacted with one or more FAO activators for no more than about 72 hours. In some embodiments, the tissuegenic cells (e.g., myogenic cells) are contacted with the one or more FAO activators for no more than about 48 hours. In some embodiments, the tissuegenic cells (e.g., myogenic cells) are contacted with the one or more FAO activators for no more than about 24 hours. In some embodiments, the one or more FAO activators comprises an activator of a gene in the FAO pathway or lipid metabolism pathway. In some embodiments, the one or more FAO activators comprises an activator of a gene selected from the group consisting of PPARα, PPARδ, PPARγ, RXRB, RXRG, NCOA1, NCOA2, FABP3, FABP4, CD36, SCARB1, FATP1, FATP2, FATP3, FATP4, FATP5, FATP6, LPL, CPT1A, CPT1B, CPT1C, CPT2, CRAT, ACADs (e.g., ACAD1, ACAD2, ACAD3, ACAD4, ACAD5, ACAD6, ACAD7, ACAD8, ACAD9, ACAD10, ACAD11, MCAD, LCAD, VLCAD), HADHs (e.g., HADHA, HADHB), ETFA and ETFB. In some embodiments, the one or more FAO activators comprises a PPARγ agonist. In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the one or more FAO activators comprises a prostaglandin selected from the group consisting of PGI2, PGD2 and analogues thereof (e.g., treprostinil) and salts, solvates, tautomers, and stereoisomers thereof. In some embodiments, the one or more FAO activators are rosiglitazone and PGI2. In some embodiments, the one or more FAO activators are rosiglitazone and treprostinil. In some embodiments, the pharmaceutical composition is formulated for intramuscular administration. In some embodiments, the pharmaceutical composition is formulated for subcutaneous administration. In some embodiments, the pharmaceutical composition is formulated for surgical implantation. In some embodiments, the pharmaceutical composition is formulated for injection.
[0339] In some embodiments, there is provided a composition that comprises of any one or more activators that increases the expression of FAO and lipid regulating genes such as but not limited to the nuclear hormone receptors PPARA, PPARD, PPARG, RXRB, RXRG, NCOA1, NCOA2; the upstream fatty acid transporters FABP3, FABP4, CD36, SCARB1, FATP1-6; a variety of lipases including LPL; the rate-limiting carnitine palmitoyl-transferases CPT1A and CPT1B; the carnitine acetylase CRAT; the acyl-CoA dehydrogenases ACADs and hydroxyacyl-CoA dehydrogenases HADHs; and the mitochondrial electron transfer flavoproteins ETFA and ETFB, which can promote myogenic differentiation.
[0340] In some embodiments, there is provided a composition that comprises of any one or more PPAR agonists, solvates, hydrates or pharmaceutically acceptable salts thereof, including any one or more of the PPAR agonists described in Section IV. In some embodiments, the composition comprises PGD2, PGI2, an analogue thereof (e.g., treprostinil), or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the composition activates fatty acid oxidation, and enhances tissue (e.g., muscle) regeneration. An exemplary PPAR agonist provided herein is a thiazolidinedione, solvates, hydrates or pharmaceutically acceptable salts thereof.
[0341] In some embodiments, there is provided a composition comprising rosiglitazone, solvates, hydrates or pharmaceutically acceptable salts thereof. In some embodiments, the composition further comprises PGI2, PGD2 or an analogue thereof (e.g., treprostinil).
IV. Fatty acid oxidation activators
[0342] The methods and compositions described herein use one or more (e.g., 1, 2, 3, or more) FAO activators. In some embodiments, the one or more FAO activators has one or more of the following properties: (i) increases mitochondrial FAO in a tissuegenic cell (e.g., myogenic cell); (ii) increases mitochondrial oxygen consumption in a tissuegenic cell (e.g., myogenic cell); (iii) does not affect mitochondrial biogenesis in a tissuegenic cell (e.g., myogenic cell); (v) does not affect membrane potential of a tissuegenic cell (e.g., myogenic cell); (vi) increases expression and/or activity of MyoD (e.g., MyoD1) in a tissuegenic cell (e.g., myogenic cell); (vii) increases expression and/or activity of PPARγ in a tissuegenic cell (e.g., myogenic cell); (viii) transiently increases expression and/or activity of PPARα in a tissuegenic cell (e.g., myogenic cell); (ix) increases expression and/or activity of PAX7 in a tissuegenic cell (e.g., myogenic cell); (x) increases expression and/or activity of MyoG in a tissuegenic cell (e.g., myogenic cell)s; (xi) increases expression and/or activity of Myh3 in a tissuegenic cell (e.g., myogenic cell)s; (xii) increases level of H3K9acin a tissuegenic cell (e.g., myogenic cell); and (xiii) increases expression and/or activity of Ki67 in a tissuegenic cell (e.g., myogenic cell).
[0343] In some embodiments, the one or more FAO activators increases mitochondrial FAO in a tissuegenic cell (e.g., myogenic cell, such as myoblast or myocyte). In some embodiments, the one or more FAO activators increases mitochondrial FAO in the tissuegenic cell (e.g., myogenic cell) for about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, or about 72 hours, including any value or range in between these values. In some embodiments, the one or more FAO activators does not increase mitochondrial FAO in the tissuegenic cell (e.g., myogenic cell) after about 72 hours, about 84 hours, about 96 hours or longer, including any value or range in between these values. The level of FAO may be determined using any known methods in the art, for example, by metabolomics and lipidomics analysis using mass spectrometry. In some embodiments, the level of mitochondrial FAO increases by at least any one of 10%, 20%, 50%, 2×, 3×, 5×, 10× or more, including any value or range in between these values.
[0344] In some embodiments, the one or more FAO activators increases mitochondrial oxygen consumption in a tissuegenic cell (e.g., myogenic cell, such as a myoblast or a myocyte). In some embodiments, the one or more FAO activators increases mitochondrial oxygen consumption in the tissuegenic cell (e.g., myogenic cell) for about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, or about 72 hours, including any value or range in between these values. In some embodiments, the one or more FAO activators does not increase mitochondrial oxygen consumption in the tissuegenic cell (e.g., myogenic cell) after about 72 hours, about 84 hours, about 96 hours or longer, including any value or range in between these values. Mitochondrial oxygen consumption may be determined using any known methods in the art, for example, by Seahorse analysis. In some embodiments, the method increases maximal mitochondrial oxygen consumption. In some embodiments, the method increases basal mitochondrial oxygen consumption. In some embodiments, the method increases both maximal mitochondrial oxygen consumption and basal mitochondrial oxygen consumption. In some embodiments, the mitochondrial oxygen consumption increases by at least any one of 10%, 20%, 50%, 2×, 3×, 5×, 10× or more, including any value or range in between these values.
[0345] In some embodiments, the one or more FAO activators does not affect mitochondrial biogenesis in a tissuegenic cell (e.g., myogenic cell, such as myoblast or myocyte). Mitochondrial biogenesis may be determined using any known methods in the art, for example, by determining mitochondrial volume via immunostaining or staining by MitoTracker, or by determining mitochondrial DNA copy number via quantitative PCR. In some embodiments, the one or more FAO activators does not change mitochondrial biogenesis in the tissuegenic cell (e.g., myogenic cell) by more than 50%, 40%, 30%, 20%, 10% or less, including any value or range in between these values.
[0346] In some embodiments, the one or more FAO activators does not affect membrane potential of a tissuegenic cell (e.g., myogenic cell, such as myoblast or myocyte). Membrane potential may be determined using any known methods in the art, for example, by fluorescent staining using JC1 dyes. In some embodiments, the one or more FAO activators does not change membrane potential of the tissuegenic cell (e.g., myogenic cell) by more than 50%, 40%, 30%, 20%, 10% or less, including any value or range in between these values.
[0347] In some embodiments, the one or more FAO activators increases expression and/or activity of PAX7 in a tissuegenic cell (e.g., myogenic cell, e.g., myoblast or myocyte). In some embodiments, the one or more FAO activators increases the expression and/or activity of PAX7 in the tissuegenic cell (e.g., myogenic cell) for about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, or about 72 hours, including any value or range in between these values. In some embodiments, the one or more FAO activators does not increase the expression and/or activity of PAX7 in the tissuegenic cell (e.g., myogenic cell) after about 72 hours, about 84 hours, about 96 hours or longer, including any value or range in between these values. In some embodiments, the level of expression and/or activity of PAX7 increases by at least any one of 10%, 20%, 50%, 2×, 3×, 5×, 10× or more, including any value or range in between these values.
[0348] In some embodiments, the one or more FAO activators increases expression and/or activity of MyoD (e.g., MyoD1) in a tissuegenic cell (e.g., myogenic cell, e.g., myoblast or myocyte). In some embodiments, the one or more FAO activators increases the expression and/or activity of MyoD in the tissuegenic cell (e.g., myogenic cell) for about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, or about 72 hours, including any value or range in between these values. In some embodiments, the one or more FAO activators does not increase the expression and/or activity of MyoD in the tissuegenic cell (e.g., myogenic cell) after about 72 hours, about 84 hours, about 96 hours or longer, including any value or range in between these values. In some embodiments, the level of expression and/or activity of MyoD increases by at least any one of 10%, 20%, 50%, 2×, 3×, 5×, 10× or more, including any value or range in between these values.
[0349] In some embodiments, the one or more FAO activators increases expression and/or activity of MyoG in a tissuegenic cell (e.g., myogenic cell, e.g., myoblast or myocyte). In some embodiments, the one or more FAO activators increases the expression and/or activity of MyoG in the tissuegenic cell (e.g., myogenic cell) for about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, or about 72 hours, including any value or range in between these values. In some embodiments, the one or more FAO activators does not increase the expression and/or activity of MyoG in the tissuegenic cell (e.g., myogenic cell) after about 72 hours, about 84 hours, about 96 hours or longer, including any value or range in between these values. In some embodiments, the level of expression and/or activity of MyoG increases by at least any one of 10%, 20%, 50%, 2×, 3×, 5×, 10× or more, including any value or range in between these values.
[0350] In some embodiments, the one or more FAO activators increases expression and/or activity of Myh3 in a tissuegenic cell (e.g., myogenic cell, such as myoblast or myocyte). In some embodiments, the one or more FAO activators increases the expression and/or activity of Myh3 in the tissuegenic cell (e.g., myogenic cell) for about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, or about 72 hours, including any value or range in between these values. In some embodiments, the one or more FAO activators does not increase the expression and/or activity of Myh3 in the tissuegenic cell (e.g., myogenic cell) after about 72 hours, about 84 hours, about 96 hours or longer, including any value or range in between these values. In some embodiments, the level of expression and/or activity of Myh3 increases by at least any one of 10%, 20%, 50%, 2×, 3×, 5×, 10× or more, including any value or range in between these values.
[0351] In some embodiments, the one or more FAO activators increases expression and/or activity of PPARγ in a tissuegenic cell (e.g., myogenic cell, such as myoblast or myocyte). In some embodiments, the one or more FAO activators increases the expression and/or activity of PPARγ in the tissuegenic cell (e.g., myogenic cell) for about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, or about 72 hours, including any value or range in between these values. In some embodiments, the one or more FAO activators does not increase the expression and/or activity of PPARγ in the tissuegenic cell (e.g., myogenic cell) after about 72 hours, about 84 hours, about 96 hours or longer, including any value or range in between these values. In some embodiments, the level of expression and/or activity of PPARγ increases by at least any one of 10%, 20%, 50%, 2×, 3×, 5×, 10× or more, including any value or range in between these values.
[0352] In some embodiments, the one or more FAO activators increases expression and/or activity of PPARα in a tissuegenic cell (e.g., myogenic cell, such as myoblast or myocyte). In some embodiments, the one or more FAO activators increases the expression and/or activity of PPARα in the tissuegenic cell (e.g., myogenic cell) for about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, or about 72 hours, including any value or range in between these values. In some embodiments, the one or more FAO activators does not increase the expression and/or activity of PPARα in the tissuegenic cell (e.g., myogenic cell) after about 72 hours, about 84 hours, about 96 hours or longer, including any value or range in between these values. In some embodiments, the level of expression and/or activity of PPARα increases by at least any one of 10%, 20%, 50%, 2×, 3×, 5×, 10× or more, including any value or range in between these values.
[0353] In some embodiments, the one or more FAO activators increases level of H3K9ac (acetylated histone H3 lysine 9) in a tissuegenic cell (e.g., myogenic cell, such as myoblast or myocyte). In some embodiments, the one or more FAO activators increases the level of H3K9ac in the tissuegenic cell (e.g., myogenic cell) for about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, or about 72 hours, including any value or range in between these values. In some embodiments, the one or more FAO activators does not increase the level of H3K9ac in the tissuegenic cell (e.g., myogenic cell) after about 72 hours, about 84 hours, about 96 hours or longer, including any value or range in between these values. In some embodiments, the level of H3K9ac increases by at least any one of 10%, 20%, 50%, 2×, 3×, 5×, 10× or more, including any value or range in between these values.
[0354] In some embodiments, the one or more FAO activators increases expression and/or activity of Ki67 in a tissuegenic cell (e.g., myogenic cell, such as myoblast or myocyte). In some embodiments, the one or more FAO activators increases the expression and/or activity of Ki67 in the tissuegenic cell (e.g., myogenic cell) for about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, or about 72 hours, including any value or range in between these values. In some embodiments, the one or more FAO activators does not increase the expression and/or activity of Ki67 in the tissuegenic cell (e.g., myogenic cell) after about 72 hours, about 84 hours, about 96 hours or longer, including any value or range in between these values. In some embodiments, the level of expression and/or activity of Ki67 increases by at least any one of 10%, 20%, 50%, 2×, 3×, 5×, 10× or more, including any value or range in between these values.
[0355] In some embodiments, the one or more FAO activators upregulates one or more genes in the FAO and/or lipid metabolism pathways in a tissuegenic cell (e.g., myogenic cell, such as myoblast or myocyte). In some embodiments, the one or more FAO activators upregulates one or more genes in the FAO and/or lipid metabolism pathways in the tissuegenic cell (e.g., myogenic cell) for about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, or about 72 hours, including any value or range in between these values. In some embodiments, the one or more FAO activators does not upregulate one or more genes in the FAO and/or lipid metabolism pathways in the tissuegenic cell (e.g., myogenic cell) after about 72 hours, about 84 hours, about 96 hours or longer, including any value or range in between these values. In some embodiments, the level of expression and/or activity of one or more genes in the FAO and/or lipid metabolism pathways increases by at least any one of 10%, 20%, 50%, 2×, 3×, 5×, 10× or more, including any value or range in between these values. In some embodiments, the one or more FAO activators upregulates one or more FAO and lipid metabolism genes including but not limited to the nuclear hormone receptors PPARA, PPARD, PPARG, RXRB, RXRG, NCOA1, NCOA2; the upstream fatty acid transporters FABP3, FABP4, CD36, SCARB1, FATP1-6; a variety of lipases including LPL; the rate-limiting carnitine palmitoyl-transferases CPT1A and CPT1B; the carnitine acetylase CRAT; the acyl-CoA dehydrogenases ACADs and hydroxyacyl-CoA dehydrogenases HADHs; and the mitochondrial electron transfer flavoproteins ETFA and ETFB, which can promote myogenic differentiation.
[0356] The expression and/or activity of PAX7, MyoD, MyoG, Myh3, PPARγ, PPARα, H3K9ac, and genes in the FAO and lipid metabolism pathways can be determined using any known methods in the art, for example, by quantitative reverse-transcription PCR, immunostaining, microarray, RNA sequencing, Western blot, as well as metabolomics and lipidomics analysis.
[0357] In some embodiments, the one or more FAO activators comprises an activator of a gene selected from the group consisting of transcriptional regulators of lipid metabolism, fatty acid transporters, lipases, carnitine palmitoyl-transferases, carnitine acetylase, acyl-CoA dehydrogenases, hydroxyacyl-CoA dehydrogenases, and the mitochondrial electron transfer flavoproteins.
[0358] In some embodiments, the one or more FAO activators comprises an activator of a gene selected from the group consisting of PPARα, PPARδ, PPARγ, RXRB, RXRG, NCOA1, NCOA2, FABP3, FABP4, CD36, SCARB1, FATP1, FATP2, FATP3, FATP4, FATP5, FATP6, LPL, CPT1A, CPT1B, CPT1C, CPT2, CRAT, ACADs (e.g., ACAD1, ACAD2, ACAD3, ACAD4, ACAD5, ACAD6, ACAD7, ACAD8, ACAD9, ACAD10, ACAD11, MCAD, LCAD, VLCAD), HADHs (e.g., HADHA, HADHB), ETFA and ETFB.
[0359] In some embodiments, the one or more FAO activators (such as PPARγ agonist e.g., rosiglitazone and/or prostaglandin e.g., PGI2, PGD2 or analogue thereof) is in a pharmaceutical composition. The pharmaceutical composition may be formulated for a suitable route of delivery, such as oral, parenteral, rectal, nasal, topical, or by inhalation. Preferably, the compositions are formulated for intramuscular, subcutaneous, or oral administration.
[0360] In some embodiments, the one or more FAO activators comprises one or more activators of PPAR. In some embodiments, the one or more FAO activators comprises one or more activators of PPARγ. In some embodiments, the one or more FAO activators is an activator of PPAR. In some embodiments, the one or more FAO activators is an activator of PPARγ.
[0361] Any suitable activators of PPARγ may be used in the methods described herein. In some embodiments, the one or more activators of PPARγ increases the expression of PPARγ. In some embodiments, the one or more activators of PPARγ increases the activity of PPARγ. In some embodiments, the activator of PPARγ is a nucleic acid (e.g., mRNA) encoding PPARγ. In some embodiments, the activator of PPARγ is a miRNA that increases the expression of PPARγ. In some embodiments, the activator of PPARγ is a PPARγ agonist. In some embodiments, the activator of PPARγ is a prostaglandin selected from the group consisting of PGI2, PGD2, analogues thereof, and salts, solvates, tautomers, and stereoisomers thereof.
[0362] In some embodiments, the one or more FAO activators comprises a PPARγ agonist and a prostaglandin selected from the group consisting of PGI2, PGD2, and analogues thereof. In some embodiments, the one or more FAO activators is a combination of a PPARγ agonist and PGI2. In some embodiments, the one or more FAO activators is a combination of a PPARγ agonist and an analogue of PGI2. In some embodiments, the one or more FAO activators is a combination of a PPARγ agonist and PGD2.
PPARγ Agonists
[0363] PPARγ agonists are known in the art. Suitable examples of PPARγ agonists useful for the methods described herein include thiazolidine (“TZD”) derivatives known as thiazolidinediones. Exemplary thiazolidinediones include but are not limited torosiglitazone, pioglitazone, proglitazone, troglitazone, C1-991 (Parke-Davis), BRL 49653, ciglitazone, englitazone and chemical derivatives thereof. These compounds are conventionally known for the treatment of diabetes. See, e.g., U.S. Pat. Nos. 4,812,570; 4,775,687; 4,725,610; 4,582,839; and 4,572,912 for exemplary sources of such compounds. U.S. Pat. No. 5,521,201 and European Patent Applications 0008203, 0139421, 0155845, 0177353, 0193256, 0207581 and 0208420, and Chem. Pharm. Bull 30 (10) 3580-3600 relate to thiazolidinedione derivatives, and describe commercial sources/synthetic schemes for a variety of TZD and TZD-like analogues, which may be useful in carrying out the method of the present application. Another exemplary PPAR agonist is a compound of the glitazar class, such as aleglitazar, muraglitazar, tesaglitazar, ragaglitazar and saroglitazar. Non-thiazolidinedione PPARγ agonists, such as GW2570, elafibranor, WY-14643 (pirinixic acid), bisphenol A diglycidyl ether (BADGE), L-796,449, GW1929, T33, INT131, FK614, 2-(2-(4-phenoxy-2-propylphenoxy)ethyl)indole-5-acetic acid, efatutazone, 15d-PGJ2,9- and 13-hydroxyoctadecanoic acid, PGI2 (prostacyclin) and prostacyclin analogues such as treprostinil, carbacyclin, isocarbacyclin, iloprost (ciloprost), cicaprost, cisaprost, beraprost and epoprostenol may also be used in the methods described herein. The PPARγ agonists contemplated herein include pharmaceutically acceptable salts, solvates, tautomers, stereoisomers, prodrugs, and combinations of suitable PPARγ agonist compounds known in the art.
[0364] In some embodiments, the PPARγ agonist is a compound of Formula (I):
##STR00003##
or a salt, solvate, tautomer, or stereoisomer thereof, wherein R is selected from the group consisting of hydrogen, unsubstituted and substituted C.sub.1-6alkyl, unsubstituted and substituted C.sub.2-6alkenyl, unsubstituted and substituted C.sub.2-6alkynyl, unsubstituted and substituted aryl, unsubstituted and substituted heteroaryl, and unsubstituted and substituted heterocyclyl.
[0365] In some embodiments, the PPARγ agonist is a compound of Formula (II):
##STR00004##
or a salt, solvate, tautomer, or stereoisomer thereof, wherein each of R.sub.1 and R.sub.4 is independently selected from the group consisting of hydrogen, halo, unsubstituted alkyl, alkyl substituted with 1-3 of halo, unsubstituted alkoxy, and alkoxy substituted with 1-3 of halo; wherein R.sub.2 is selected from the group consisting of halo, hydroxy, unsubstituted and substituted alkyl; wherein R′.sub.2 is hydrogen, or R.sub.2 and R′.sub.2 together form oxo; wherein R.sub.3 is H; and wherein Ring A is a phenyl.
[0366] In some embodiments, the PPARγ agonist is rosiglitazone, or a salt, solvate, tautomer, or stereoisomer thereof.
[0367] In some embodiments, the PPARγ agonist is a compound of Formula (III):
##STR00005##
or a salt, solvate, tautomer, or stereoisomer thereof.
Prostaglandins
[0368] In some embodiments, the one or more FAO activators comprises a prostaglandin that activates PPARγ, including naturally occurring prostaglandins, analogues thereof, salts, solvates, tautomers, and stereoisomers thereof. Exemplary prostaglandins that activates PPARγ include, but are not limited to, PGI2 and PGD2.
[0369] PGI2 is also known as prostacyclin. It is a prostaglandin member of the eicosanoid family of lipid molecules. When used as a drug, PGI2 is known as epoprostenol, which is used to treat pulmonary arterial hypertension.
[0370] In some embodiments, the one or more FAO activators comprises (or is) a compound of Formula (IV):
##STR00006##
or a salt, solvate, tautomer, or stereoisomer thereof.
[0371] In some embodiments, the one or more FAO activators comprises an analogue of PGI2. PGI2 analogues are known in the art, including, but not limited to iloprost and treprostinil. In some embodiments, the PGI2 analogue is treprostinil, or a salt, solvate, tautomer, or stereoisomer thereof. In some embodiments, the PGI2 analogue is treprostinil sodium.
[0372] In some embodiments, the one or more FAO activators comprises (or is) a compound of Formula (V):
##STR00007##
or a salt, solvate, tautomer, or stereoisomer thereof.
[0373] PGD2 is a prostaglandin that binds to the receptor PTGDR (DP1), as well as CRTH2 (DP2). In some embodiments, the one or more FAO activators comprises (or is) a compound of Formula VI):
##STR00008##
or a salt, solvate, tautomer, or stereoisomer thereof.
[0374] In some embodiments, the one or more FAO activators comprises an analogue of PGD2. In some embodiments, the analogue of PDG2 is a compound of Formula (VII):
##STR00009##
or a salt, solvate, tautomer, or stereoisomer thereof, wherein each of R.sub.1 and R.sub.2 is selected from the group consisting of halo, hydroxy, unsubstituted and substituted alkyl.
[0375] In some embodiments, the one or more FAO activators is a combination of rosiglitazone and PGI2. In some embodiments, the one or more FAO activators is a combination of rosiglitazone and treprostinil. In some embodiments, the one or more FAO activators is a combination of rosiglitazone and PGD2.
[0376] In some embodiments, the one or more FAO activators is a combination of pirinixic acid (WY-14643) and PGI2. In some embodiments, the one or more FAO activators is a combination of pirinixic acid (WY-14643) and PGD2. In some embodiments, the one or more FAO activators is a combination of pirinixic acid (WY-14643) and treprostinil.
V. Kits and Articles of Manufacture
[0377] The present application further provides kits, formulations, unit dosages, and articles of manufacture for use in any one of the methods of muscle regeneration in vitro or in vivo, and methods of treatment described herein.
[0378] In some embodiments, there is provided a kit for promoting myogenesis and/or inducing differentiation and/or maturation of a tissuegenic cell (e.g., myogenic cell such as myoblast or myocyte), comprising one or more FAO activators such as a PPARγ agonist (e.g., rosiglitazone) and/or PGI2 or analogue thereof (e.g., treprostinil). In some embodiments, the kit is useful for in vitro cell culture. In some embodiments, the kit is useful for ex vivo culture of tissuegenic cells (e.g., myogenic cells). In some embodiments, the kit is useful for in vivo application.
[0379] In some embodiments, there is provided a kit for treating a muscle disease or condition (e.g., muscle injury or muscle degeneration) in an individual, comprising a pharmaceutical composition comprising one or more FAO activators such as a PPARγ agonist (e.g., rosiglitazone) and/or PGI2 or analogue thereof (e.g., treprostinil). In some embodiments, the kit further comprises tissuegenic cells (e.g., myogenic cells, such as myoblasts and/or myocytes).
[0380] The kit may contain additional components, such as containers, reagents, culturing media, buffers, and the like to facilitate execution of any embodiment of the methods. For example, in some embodiments, the kit further comprises a cell collection and storage apparatus, which can be used to collect an individual's tissuegenic cells (e.g., myogenic cells, such as myoblasts). In some embodiments, the kit further comprises culturing mediator containers (e.g., petri dishes and plates) for proliferation and/or differentiation of tissuegenic cells (e.g., myogenic cells). In some embodiments, the kit further comprises immunostaining or histology reagents for assessing biomarkers of the tissuegenic cells (e.g., myogenic cells).
[0381] The kits of the present application are in suitable packaging. Suitable packaging include, but is not limited to, vials, bottles, jars, flexible packaging (e.g., Mylar or plastic bags), and the like. Kits may optionally provide additional components such as interpretative information. The present application thus also provides articles of manufacture, which include vials (such as sealed vials), bottles, jars, flexible packaging, and the like.
[0382] The kits may also comprise instructions relating to the use of the one or more FAO activators in any one of the methods described herein. In some embodiments, the kit further comprises an instructional manual, such as a manual describing a protocol according to any one of the methods of muscle regeneration, or methods of treatment described herein. The instructions may also include information on dosage, dosing schedule, and routes of administration of the one or more FAO activators or tissuegenic cells (e.g., myogenic cells) using the kit for the intended treatment.
[0383] Also provided are unit dosage forms comprising the one or more FAO activators and formulations described herein. These unit dosage forms can be stored in a suitable packaging in single or multiple unit dosages and may also be further sterilized and sealed. In some embodiments, the composition (such as pharmaceutical composition) is contained in a single-use vial, such as a single-use sealed vial. In some embodiments, the composition (such as pharmaceutical composition) is contained in a multi-use vial. In some embodiments, the composition (such as pharmaceutical composition) is contained in bulk in a container.
EXAMPLES
[0384] The examples below are intended to be purely exemplary of the present application and should therefore not be considered to limit the invention in any way. The following examples and detailed description are offered by way of illustration and not by way of limitation.
Example 1: an Early Transient Burst of PPAR-Driven Fatty Acid Oxidation Enhances Tissue Regeneration
[0385] By carefully mapping metabolomic profiles during the earliest phases of primary human myoblast differentiation, we uncovered a transient burst in mitochondrial fatty acid oxidation (FAO) and redox stress during the transition from proliferative primary myoblasts into non-proliferative myocytes. In addition, we document that this burst of FAO is specific to the early stages of differentiation, and it is associated with a transient increase in mitochondrial oxygen consumption, without significant changes in mitochondrial biogenesis or membrane potential. Mechanistically, the early burst of mitochondrial FAO is regulated by the transient rise of MyoD, PPARγ and PPARα to promote the early cellular differentiation program in human myocytes. We found that the PPARγ-FAO axis is pro-myogenic only in the early stages of differentiation, but anti-myogenic in the later stages of differentiation. In vivo, we found that early transient treatment with the anti-diabetic PPARγ agonist rosiglitazone can enhance mouse skeletal muscle regeneration by transiently increasing FAO flux, with important implications for our understanding of how exercise and nutrition can be regulated to influence muscle regeneration and degeneration.
Materials and Methods
[0386] Gene Expression Omnibus database mining
[0387] We mined transcriptomic data on human myoblast differentiation (GSE55034) in the Gene Expression Omnibus (GEO) database and analyzed them using the R Bioconductor package.
Metabolomics and Lipidomics Analyses
[0388] Liquid chromatography-tandem mass spectrometry (LC-MS/MS) metabolomics and lipidomics analyses were performed according to previously published protocols (Chong et al., 2012).
MALDI-MS Imaging Analysis
[0389] All MSI experiments were performance using an MALDI-FT-ICR instrument (solariX 9.4T, Bruker Daltonics) equipped with a smartbeam laser (Bruker Daltonics) in the mass range of m/z 100-1000 in positive ion mode at a frequency of 1000 Hz, using 200 laser shots and a spatial resolution of 100 μm. All data were processed using the FlexImaging 3.0 software (Bruker Daltonics).
Cell Culture and Drug Treatment
[0390] Primary human skeletal muscle (HSKM) progenitors (Gibco) were cultured on gelatin solution (0.1%, Merck-Millipore)-coated plate and incubated in a humidified atmosphere (5% CO.sub.2 and 37° C.) with growth medium composed of DMEM/F-12 (Gibco) supplemented with fetal bovine serum (FBS) (20%, GE Healthcare), L-glutamine (1%, Gibco) and penicillin-streptomycin (1%, Gibco). Confluent HSKM progenitors were induced to differentiate by replacing growth media with differentiation medium, comprising of DMEM/F-12, KnockOut Serum Replacement (2%, Gibco), L-glutamine (1%, Gibco) and penicillin-streptomycin (1%, Gibco). For drug treatments (all from Cayman Chemical), cells were incubated with etomoxir (10 uM), rosiglitazone (10 M), GW6471 (0.1 M), GSK3787 (1 uM), PGI2 (10 ng/ml), treprostinil (1 nM), and GW9662 (0.1 μM). MitoTracker Red (200 nM, Thermo Fisher) and JC1 (2 uM, Thermo Fisher) staining were performed according to manufacturer's instructions and stained cells were imaged with a Zeiss fluorescence microscope.
Transfection of HSKM Progenitors Using Polyethylenimine
[0391] HSKM progenitors were seeded onto gelatin-coated plates and cultured in growth media. One day after seeding, a mixture of polyethylenimine (PEI)/RNA was used to transfect the HSKM cells. To prepare the mixtures, PEI together with the following RNAs were mixed with serum-free DMEM, hsa-let-7 miRCURY LNA microRNA Power Family Inhibitor (YFI0450006, Qiagen), a combination of mirVana miRNA mimic hsa-let-7a-5p (4464066, Assay ID: MC10050, Thermo Fisher) and mirVana miRNA mimic hsa-let-7b-5p (4464066, Assay ID: MCi 1050, Thermo Fisher), MYOD1 siRNA (4392420, siRNA ID: s9231, Thermo Fisher), MLYCD siRNA TriFECTa DsiRNA Kit (Design ID: hs.Ri.MLYCD.13, IDT) or Cy5-conjugated scramble RNAi control. The PEI/RNA transfection mixtures were incubated at room temperature for 20 mins before being added to the HSKM cells. The transfection media was replaced with growth media after 24 hours.
Quantitative PCR
[0392] RNA was extracted using TRIzol (Thermo Fisher) and reverse transcribed to cDNA with Superscript III (Thermo Fisher) according to manufacturer's instructions. The synthesized cDNA was diluted 5× in H2O before performing qPCR with KAPA SYBR FAST (Merck) on ABI Prism 7900HT (Applied Biosystems) real-time PCR system according to manufacturers' instructions. Primer sequences are provided in Table 1.
TABLE-US-00001 TABLE 1 SEQ SEQ Human ID ID Gene Forward 5′ to 3′ NO Reverse 5′ to 3′ NO GAPDH TGGTATCGTGGAAGGACTCA 1 TTCAGCTCAGGGATGACCTT 12 MYOD1 CGGCATGATGGACTACAGCG 2 CAGGCAGTCTAGGCTCGAC 13 MYOG GGGGAAAACTACCTGCCTGTC 3 AGGCGCTCGATGTACTGGAT 14 MYHC TTCATTGGGGTCTTGGACAT 4 AACGTCCACTCAATGCCTTC 15 MYH3 ATTGCTTCGTGGTGGACTCAA 5 GGCCATGTCTTCGATCCTGTC 16 MYH7 TGCCACATCTTGATCTGCTC 6 CTCGGCTTCAAGGAAAATTG 17 MYH8 TAAACACACCTGCCTGATGC 7 TCAGCTTTAACAGGAAAATAAACG 18 SkActA CGACATCAGGAAGGACCTGTATGCC 8 GGCCTCGTCGTACTCCTGCTTGG 19 PPARA TCGGCGAGGATAGTTCTGGAAG 9 GACCACAGGATAAGTCACCGAG 20 PPARD GGCTTCCACTACGGTGTTCATG 10 CTGGCACTTGTTGCGGTTCTTC 21 PPARG AGCCTGCGAAAGCCTTTTGGTG 11 GGCTTCACATTCAGCAAACCTGG 22
miRNA Quantitative PCR
[0393] After HSKM progenitors were induced to differentiate, HSKM cells were harvested every 12 hourly for 84 hours. Cold TRIzol (Thermo Fisher) reagent was added onto the HSKM cells and the cell lysate stored at −30 C, until all the samples were available for RNA isolation. The isolated RNA samples were reverse transcribed and amplified by miScript RT Kit (Qiagen) according to manufacturer's instructions. miRNA quantitative PCR was performed using the miScript SYBR Green PCR kit (Qiagen) on ABI Prism 7900HT (Applied Biosystems) real-time PCR system according to manufacturers' instructions. The following miScript Primer Assays (Qiagen) were used, Hs_let-7a_2 (MS00031220), Hs_let-7b_1 (MS00003122), Hs_let-7e_3 (MS00031227) and Hs_let-7g_2 (MS00008337).
Mitochondrial DNA Copy Number Measurement
[0394] After HSKM progenitors were induced to differentiate, HSKM cells were harvested every 12 hourly for 84 hours. Genomic DNA was isolated from HSKM cells using the DNeasy Blood & Tissue Kit (Qiagen) according to manufacturer's instructions. Briefly, HSKM cells were washed with phosphate buffered saline (PBS) (Thermo Fisher), trypsinized (0.25%, Thermo Fisher) at 37° C. for 3 min and centrifuged at 1300 rpm for 3 min. The harvested cell pellets were subsequently stored at −80° C., until all the samples were available for DNA isolation. For mitochondrial DNA copy number measurement, qPCR-based mitochondrial quantification was performed using KAPA SYBR FAST (Merck) on ABI Prism 7900HT (Applied Biosystems) real-time PCR system according to manufacturers' instructions. Primer sequences are provided in Table 2.
TABLE-US-00002 TABLE 2 SEQ SEQ Human ID ID gene Forward 5′ to 3′ NO Reverse 5′ to 3′ NO B2M CACTGAAAAAGATGAGTATGCC 23 AACATTCCCTGACAATCCC 29 ND1 ACGCCATAAAACTCTTCACCAAAG 24 GGGTTCATAGTAGAAGAGCGATGG 30 ND4 ACCTTGGCTATCATCACCCGAT 25 AGTGCGATGAGTAGGGGAAGG 31 ND5 AGTTACAATCGGCATCAACCAA 26 CCCGGAGCACATAAATAGTATGG 32 ND6 TGGGGTTAGCGATGGAGGTAGG 27 AATAGGATCCTCCCGAATCAAC 33 Mito CACTTTCCACACAGACATCA 28 TGGTTAGGCTGGTGTTAGGG 34
Oxygen Consumption Analyses
[0395] HSKM progenitors were seeded onto Seahorse XF96 Cell Culture Microplate (Agilent), pre-coated with gelatin (0.1%, Merck-Millipore), in growth media at 10,000 cells per well. 2 days after seeding, HSKM progenitors were induced to differentiate by replacing growth media with differentiation medium. Before performing the Seahorse XF cell Mito Stress Test assay, cell culture media were replaced with assay media (Seahorse XF DMEM Medium, pH 7.4, 2 mM pyruvate, 2 mM glutamine) (Agilent) and incubated in a CO.sub.2-free incubator at 37° C. for 1 hour to equilibrate temperature and pH for each well. During the assay, Oligomycin (2 uM, Agilent), FCCP (0.5 uM, Agilent), and a mixture of Antimycin A and Rotenone (0.5 uM, Agilent), were injected sequentially and measurements were taken according to manufacturer's instructions. The data was analyzed using WAVE software.
Western Blot
[0396] Protein was extracted with RIPA buffer (Thermo Fisher) supplemented with protease inhibitor cocktails I and II (Merck) and phosphatase inhibitor cocktail set III (Merck). Protein was quantified with Pierce BCA protein assay kit (Thermo Fisher) and analyzed with Sunrise Tecan plate reader. After SDS-PAGE and electro-transfer onto PVDF membranes (GE Healthcare), western blot was performed with the following primary antibodies, MyoD (1:50, sc-760, Santa Cruz Biotechnology), MyoG (1:200, sc-576, Santa Cruz Biotechnology), myosin heavy chain MHC eFluor 660 (1:20, 50-6503-82, Thermo Fisher), α-Actinin (Sarcomeric) (1:500, A7811, Merck), PPARA (1:1000, CST), PPARD (1:1000, CST), PPARG (1:1000, 2443S, CST), H3K9ac (1:1000, CST), and GAPDH (1:1000, sc-25778, Santa Cruz Biotechnology). Subsequently, blots were stained with secondary antibody anti-rabbit IgG HRP conjugate (1:2500, W401B, Promega) and anti-mouse IgG HRP conjugate (1:2500, W402B, Promega). Protein levels were detected using ECL prime western blotting detection reagent kit (GE Healthcare).
Immunofluorescence
[0397] Cells were washed with PBS (Thermo Fisher) and fixed with paraformaldehyde (PFA) (4%, Electron Microscopy Sciences) at room temperature for 10 mins. Cells were stained with primary antibody myosin heavy chain eFluor 660 (1:20, 50-6503-82, Thermo Fisher) at 4 C overnight. DAPI (Merck) was used as a nuclear counterstain according to manufacturer's recommendations. Stained cells were imaged with a Zeiss fluorescence microscope.
Muscle Cryo-Injury
[0398] Eight week old NOD scid gamma (NSG) or C57BL/6 mice were anaesthetized with a mixture of ketamine and xylazine (120 mg/kg and 8 mg/kg respectively) via intraperitoneal injection. After successful anesthetization, the skin over the tibialis anterior (TA) or gastrocnemius or quadriceps muscle was disinfected by wiping with 70% ethanol and a 3 mm incision was made over the TA muscle. A dry-ice-chilled 4-mm metal probe was directly applied onto the exposed skeletal muscle for three cycles of five seconds to induce cryo-injury. Thereafter, the incision was immediately sutured using a surgical suture stapler. Upon recovery under heat lamps for a period of 2 hours, the mice were randomly allocated to each treatment groups. All the drugs (rosiglitazone (20 mg/kg), etomoxir (20 mg/kg), GW0742 (1 mg/kg), GSK3787 (5 mg/kg), fenofibrate (30 mg/kg), WY-14643 (30 mg/kg), PGI2 (3.2 mM), PGF1a (3.2 mM), PGD2 (3.2 mM), PGG1 (3.2 mM), treprostinil (1 mM), HGF (4 ng/uL) and DMSO vehicle (all Cayman Chemical) were intramuscularly injected into the TA muscle using an insulin syringe (BD). At the end of the experiment, muscular strength was measured using the grip strength meter (Bioseb). Seven days to twenty-seven days after cryo-injury, the TA muscles were biopsied or harvested for histology and western blot. For the histology samples, TA muscles were incubated in 4% PFA solution overnight and embedded in paraffin. Samples were serially sectioned until depleted and haemotoxylin and eosin (H&E) staining was performed on every 12th 5 um-thick tissue section. After microscopy imaging, the area of the cryo-injured myofibers was quantified using ImageJ. For western blot samples, TA muscles were snap-frozen in liquid nitrogen and homogenized in RIPA buffer (Thermo Fisher) supplemented with protease inhibitor cocktails I and II (Merck) and phosphatase inhibitor cocktail set III (Merck) using TissueLyser II (Qiagen).
Intramuscular Injection of GFP-Positive HSKM Cells
[0399] Lentiviral eGFP expression vector pLenti CMV GFP Blast (659-1) (Addgene #17445) was packaged into lentiviral particles. To obtain GFP-positive HSKM progenitors, cells were then transduced with the viral particles and selected with growth media containing blasticidin (25 ug/ml, InvivoGen) for 5-7 days. Cryo-injury was carried out on eight-week-old NSG mice as mentioned above and subsequently mice were randomly allocated into 2 groups for HSKM transplantation, rosiglitazone-treated GFP-positive HSKM and DMSO-treated GFP-positive HSKM. GFP-positive HSKM were treated with growth media containing rosiglitazone or DMSO control for 24 hr and trypsinized for cell transplantation. 2 million HSKM cells were resuspended in 100 ul of growth media containing Matrigel hESC-Qualified Matrix (1:1, Corning). Using a 23-gauge needle, the cell suspension was injected into the TA muscle. 7 days after cryo-injury, the TA muscles were harvested in 4% PFA overnight and embedded in paraffin.
Immunohistochemistry
[0400] Tibialis anterior (TA) tissue samples embedded in paraffin were sectioned using a microtome and transferred onto Leica Microsystems Plus Slides. Some tissues were flash frozen for cryosectioning. Paraffin-embedded sections were deparaffinized in xylene (Merck) for 2 washes (10 mins) and then transferred sequentially into 100% EtOH (Merck), 100% EtOH, 95% EtOH and 70% EtOH (2 mins) at room temperature. The sections were then rehydrated in deionized water (3 mins). Antigen retrieval was carried out using the 2100 Retriever in sodium citrate buffer (Merck, pH 6.2, 30 mins). Slides were then cooled in cold PBS (15 mins) and blocked in blocking buffer at room temperature (30 mins). Primary antibody staining was conducted in blocking buffer at 4° C. overnight with the following antibodies, GFP (1:500, sc-9996, Santa Cruz), Pax7 (5 ug/ml, 042349, DSHB), MyoD (5 ug/ml, sc-377460, Santa Cruz), Ki67 (1:100, 14-5698-82, Thermo Fisher), embryonic MHC (Myh3; 1:100, sc-53091, Santa Cruz), PDGFRa (5 ug/mL, AF1062, R&D), F4/80 (1:100, ab6640, Abcam), PPARG (1:1000, 2443S, CST), and myosin heavy chain eFluor 660 (1:20, 50-6503-82, eBioscience). After the slides were washed thrice in PBS (10 mins) and counterstained with DAPI, secondary antibody staining for GFP was conducted in blocking buffer at room temperature (1 hr) with goat anti-mouse IgG secondary antibody, Alexa Fluor 488 (1:500, A11001, Thermo Fisher).
Results
Metabolomic Analysis of Early Primary Human Myoblast Differentiation
[0401] To globally survey the metabolic changes that are induced during the earliest stages of myoblast differentiation, we performed LC-MS/MS metabolomics profiling of primary human myoblasts and myocytes. Primary human myoblasts were subjected to serum withdrawal conditions for 48 hours to halt proliferation and induce cellular differentiation to generate primary human myocytes. Serum withdrawal induced critical changes in the metabolome of primary human myoblasts as they underwent a phase transition to differentiate into non-proliferative myocytes (
[0402] Redox-related metabolites increased contemporaneously with the increase in FAO intermediates, including oxidized glutathione, glutathione, and NADH (
[0403] To examine if the increased FAO in early myogenic differentiation is supported by transcriptional or post-transcriptional changes, we mined transcriptomic data on primary human myoblast differentiation in the GEO database (GSE55034). We found that a variety of lipid metabolism and FAO-related genes were indeed upregulated transiently on day 2 after the initiation of primary human myoblast differentiation. These include the upstream transcriptional master regulators of lipid metabolism, the nuclear hormone receptors PPARA, PPARG, RXRB, RXRG, NCOA1, NCOA2; the upstream fatty acid transporters FABP3, FABP4, CD36, SCARB1, FATP1-6; and a variety of lipases including LPL (
Mitochondrial Metabolism During Early Differentiation of Human Myoblasts
[0404] To test whether mitochondrial oxidation is indeed functionally increased in the early phases of myoblast differentiation, we stained the proliferative primary human myoblasts and non-proliferative myocytes with Mitotracker Red and JC1 dyes, to examine their mitochondrial volume and membrane potential. We found that just 48 hours after serum withdrawal, human myocytes manifested a significant increase in mitochondrial volume (
[0405] To examine if the early increase in mitochondrial volume translated to an increase in activity, we turned to the Seahorse Analyzer to measure basal and maximal O.sub.2 consumption rates and assess the mitochondrial ETC flux and ATP synthesis rates in response to mitochondrial enzyme perturbations. Our analyses revealed that both the basal and maximal O.sub.2 consumption rates initially dropped at 12 h of serum withdrawal, but rose quickly over time as differentiation progressed (
MyoD and PPARs Regulate the Transient Burst in FAO
[0406] To dissect the mechanistic basis for the transient increase in mitochondrial FAO during the early stages of cellular differentiation, we performed RNA profiling for a variety of myogenic and differentiation regulators over a time-course in myogenic differentiation. Our results showed that most myogenic regulators either monotonically increased or decreased after serum withdrawal, thus eliminating them as candidates for driving the transient increase in mitochondrial FAO (
[0407] Another class of metabolic regulators are the let-7 miRNAs (Zhu et al., 2011; Shyh-Chang et al., 2013; Jun-Hao et al., 2016), which are known to accumulate with differentiation across multiple cell-types in general. In particular, the let-7 miRNAs are also known to regulate insulin signalling in muscle cells and upregulate mitochondrial FAO by suppressing PI3K-mTOR signalling. During primary human myoblast differentiation, we found that let-7e miRNA did show a transient increase between 12-24 h of myoblast differentiation (
[0408] Finally, we turned to the master regulators of FAO, the Peroxisome Proliferator Activated Receptors (PPARs). Our profiling of the human myoblast differentiation time-course revealed that PPARγ mRNA underwent a transient increase from 0-36 h of myogenesis, declining back to near-basal levels by 84 h (
Controlling Myoblast Differentiation by Perturbing FAO at Different Times
[0409] To test the importance of mitochondrial FAO in myoblast differentiation, we applied the mitochondrial CPT1-specific inhibitor etomoxir at low concentrations which avoid their off-target effects on CoA metabolism, during different time-windows of myoblast differentiation. We found that mitochondrial FAO inhibition severely compromised myocyte survival at 0-24 h and 24-48 h of myoblast differentiation (
[0410] When the remaining adherent myocytes were assayed for changes in myocyte differentiation by Western blot, we found that mitochondrial FAO inhibition at different time-windows led to different profiles of myogenic markers (
[0411] When we performed Seahorse analysis on the O.sub.2 consumption rates of human myocytes in response to mitochondrial FAO inhibition, we found that only the early 0-12 h and 12-24 h time-windows of etomoxir treatment could decrease O.sub.2 consumption rates (
[0412] Having established the importance of the transient rise in PPARγ to mitochondrial FAO, and the importance of mitochondrial FAO to early myoblast differentiation, it was of interest to test if the anti-diabetic PPARγ agonists could enhance early myoblast differentiation. We tested the well-known thiazolidinedione Avandia, or rosiglitazone, during early human myoblast differentiation at low density. Our tests showed that rosiglitazone treatment at the 0-24 h time-window uniquely upregulated the mRNA levels of myogenin (MYOG), adult type I myosin heavy chain (MYH7) and perinatal myosin heavy chain (MYH8), whereas other time-windows of treatment had no significant effects at the end of 96 h (
Enhancing Skeletal Muscle Regeneration In Vivo Via PPARγ-FAO
[0413] To test the utility of these in vitro findings in an in vivo context, we injected a bolus of the PPARγ agonist rosiglitazone directly into the cryoinjured skeletal muscles of mice at different time-points (
[0414] To assess if these findings are clinically relevant to human myoblast transplant therapies (MTT; Chua et al., 2019), and to test if the effects of rosiglitazone on myoblasts are cell-autonomous, we pre-treated GFP+ human myoblasts under serum withdrawal conditions with either DMSO or rosiglitazone for the 0-24 h time-window, then orthotopically injected the human myoblasts into the TA muscle of immunodeficient NSG mice 24 h after cryoinjury (
[0415] To confirm that these in vivo effects were dependent on the PPARγ-FAO axis, we tested rosiglitazone treatment against rosiglitazone+etomoxir treatment, relative to the DMSO control. Our results showed that the rosiglitazone-induced MYOG and MHC protein expression was abrogated by co-treatment with etomoxir (
[0416] To confirm that these findings were relevant to the regenerative defects often observed in aging skeletal muscles, we first checked if muscle stem cells are aberrant in the skeletal muscles of geriatric 2-year-old mice, which are equivalent to 60-year-old humans in biological terms. Immunostaining revealed that Pax7+ muscle stem cells were actually increased in aged mouse muscles (
Functional Assay of Prostaglandins in Tissue Regeneration
[0417] To test if other lipid mediators such as prostaglandins do exert significant functions in skeletal muscle regeneration, we injected a single bolus of the youth-associated prostaglandin PGI2 at 0 h post-injury into the TA muscle. Assessment of the regenerative index of eMHC+ nuclei revealed that PGI2 significantly promoted muscle regeneration, but only by day 6 (
Novel Role of PGI2 in Regulating PPARG and Activating Stem Cells into Committed Progenitors
[0418] While GPCR-driven cAMP production is often thought to be the downstream mechanism of PGI2 signalling (Narumiya et al., 1999, DOI: 10.1152/physrev.1999.79.4.1193), the results show that cAMP was significantly decreased after PGI2 injection (***P<0.001,
Novel Synergy Between PGI2 and PPARG in Promoting Tissue Regeneration
[0419] Time-course analysis of skeletal muscle regeneration confirmed that a single bolus injection of PGI2 at 0 h post-injury significantly increased the numbers of MyoG+Ki67+ committed myoblasts in the early phase of muscle regeneration (days 2-4;
PGI2-PPARG signalling Promotes Stem Cell Activation and Suppresses Tissue Fibrosis
[0420] Besides promoting muscle stem cells to activate and enter an intermediate state of committed myoblasts in early myogenesis, PGI2 signalling also promotes the proliferative capacity of myoblasts. Using pure primary human myoblasts, we found that long-term PGI2 treatment can significantly increase the proliferation rate of both early-passage (
[0421] Furthermore, we found that 2 days after intra-peritoneal injection of a single bolus of the PGI2 analogue treprostinil, the fraction of Pax7+Ki67+ proliferative muscle stem cells, the total pool of Pax7+ muscle stem cells, and the total pool of Ki67+ proliferative cells in the gastrocnemius muscle were all significantly increased (P<0.05), even without injury (
[0422] Treprostinil could also increase the total pool of Ki67+ progenitor cells in the endoderm-derived liver tissue, even without damage stimuli or injury (
[0423] In addition daily injection of PGI2, the PGI2 analogue treprostinil, or the PPARG agonist rosiglitazone, into aged and sarcopenic 2-year-old mice, led to a significant reversal of aging-induced fibrosis in multiple non-skeletal muscle tissues, including the liver (
[0424] Immunofluorescence of multiple tissues further revealed that the PGI2 analogue treprostinil, or the PPARG agonist rosiglitazone could all suppress PDGFRA+ Ki67+ fibrotic precursor numbers in multiple non-skeletal muscle tissues, including the liver (
[0425] Thus, drugs that modulate the PGI2-PPARG-FAO-H3K9ac axis could be useful for promoting general tissue regeneration and reversing fibrosis in multiple degenerative diseases, where tissue degeneration is occurring with or even without overt damage. Such degenerative diseases could include sarcopenia, cachexia, disuse atrophy, inflammatory myopathies, muscular dystrophies, cardiomyopathies, skin wrinkling, intractable cutaneous ulcers, skin wounds, bullosis, alopecia, keloids, dermatitis, macular degeneration, colitis, liver steatosis, steatohepatitis, liver fibrosis, cirrhosis, pancreatitis, type 2 diabetes (T2D), lipodystrophies, chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, acute respiratory distress syndrome (ARDS), rheumatoid arthritis, osteoarthritis, osteoporosis, neurodegenerative diseases, cerebral infarction, myocardial infarction, pulmonary infarction, bone fracture, gastric ulcers, enteritis, chronic kidney disease, renal fibrosis, or any other genetically determined, environmentally determined or idiopathic disease processes causing loss or atrophy of tissue/organ/body part structure and function. Overall, our results suggest that the prostaglandin (PGI2)-PPAR-FAO-H3 acetylation pathway could be a general mechanism to mimick the effects of exercise and injury stimuli, to activate tissuegenic stem cells and drive regeneration in tissues derived from all three germ layers, including endoderm, mesoderm and neuroectoderm, and in both skeletal muscles and non-skeletal muscle tissues.
PGI2 Signalling Promotes Wound-Less Regeneration in Synergy with PPARG
[0426] Hepatocyte growth factor (HGF) has been previously shown to activate muscle stem cell proliferation (Tatsumi et al., 1998, DOI: 10.1006/dbio.1997.8803). To test if HGF synergizes with PGI2, we injected PGI2 with or without HGF into the gastrocnemius muscle. Our results showed that PGI2 combined with HGF failed to increase, while HGF alone and treprostinil (TP) alone could increase proliferative myoblasts (
[0427] PPARD has been shown to be a target of PGI2 in vascular cells (He et al., 2008, DOI: 10.1161/CIRCRESAHA.108.176057; Li et al., 2011, DOI: 10.1165/rcmb.2010-04280C). PPARD agonists have also been previously shown to be exercise mimetic drugs (Narkar et al., 2008; DOI: 10.1016/j.cell.2008.06.051). Our results showed that 2 days after injection into the gastrocnemius muscle, the PGI2 analogue (TP) alone significantly increased while the PPARD agonist GW0742 surprisingly decreased Pax7+ Ki67+ proliferative muscle stem cells (
[0428] To definitively test if PPARD plays a role in muscle regeneration, we injected a single bolus of the PPARD agonist GW0742 or the PPARD inhibitor GSK3787 into the injured TA muscle. The results showed that GW0742 can significantly decrease muscle regeneration (
[0429] PPARA has also been shown to be a direct binding target of PGI2 (Forman et al., 1997, DOI: 10.1073/pnas.94.9.4312), and fenofibrate is a specific agonist of PPARA, while WY-14643 is an agonist of both PPARA and PPARG (EC50=0.63 and 32 uM respectively). Our results showed that the PGI2 analogue (TP) alone and WY-14643 alone significantly increased proliferative myoblasts (
Discussion
[0430] Fatty acid oxidation is emerging as an important metabolic pathway that regulates cell fate. Downstream effects of FAO include bioenergetics-associated signalling via the AMP/ATP ratio, the NAD+/NADH ratio, redox stress signalling via mtROS, and, as shown here, the regulation of protein acetylation via acetyl-CoA (Shyh-Chang and Ng, 2017). Previous studies had shown that low levels of FAO are required for maintaining quiescent muscle stem cells (MuSCs), hematopoietic stem cells (HSCs), and intestinal stem cells (ISCs; Ryall et al. 2015; Pala and Tajbakhsh et al., JCS 2018; Ito et al., 2012; Mihaylova et al., 2018.) Conversely, we had previously shown that excessive mitochondrial FAO can induce excessive mtROS and p38 MAPK signalling to cause tissue atrophy during cachexia (Fukawa et al., 2016). After stem cells are activated to proliferate and then differentiate, it is known that the mitochondrial oxidative capacity would rise by the end of terminal differentiation (Remels et al., 2010; Wagatsuma and Sakuma 2013). However the intermediate changes, i.e. the oxidative kinetics, the upstream regulators, the precise nutrient source, and most importantly the cause vs. effect role of nutrient oxidation during each stage of tissuegenesis, had all remained unclear.
[0431] Here we found that FAO is surprisingly dynamic during tissuegenic differentiation. Under normal circumstances, mitochondrial oxidation drops during the first 24 h of myoblast differentiation, followed by a transient burst of FAO that is specifically required only for the early differentiation (24-48 h) into non-proliferative myocytes. Mechanistically, this early burst of FAO is driven by PPARγ. Subsequently, PPARγ-driven FAO is downregulated in the middle phases of differentiation into resting myotubes. Our findings complete the picture depicted by a recent study (Yucel et al., 2019), which only showed that mitochondrial oxidation transiently drops in the first 24 h of myogenic differentiation, possibly due to mitophagy (Sin et al., 2016). Our findings imply there are 2 waves of mitochondrial oxidation during cellular differentiation, and that the first wave driven by the PPARγ-FAO axis can be finely controlled to regulate stem cell fate and tissue regeneration, especially since the PPARγ-FAO axis represents an eminently druggable pathway at nearly every step. The second wave of increased mitochondrial oxidation is likely driven by PPARα (
[0432] The PPAR nuclear hormone receptors are well-known master regulators of lipid metabolism. Traditionally, PPARα is thought to be an activator of FAO in the liver, PPARβ/δ is a ubiquitous regulator of FAO in many tissues, whereas PPARγ is an activator of lipogenesis in various lipid-metabolizing tissues (Manickham and Wahli 2017). While generally true, several studies have begun to show that PPARγ could also upregulate FAO in other tissues (Benton et al., 2008; Sikder et al., 2018).
[0433] In fact, previous studies with PPARγ knockout and inhibition had led to conflicting conclusions on the role of PPARγ or lack thereof in skeletal muscle development and muscle insulin sensitivity (Hunter et al., 2001; Hevener et al., 2003; Norris et al., 2003; Singh et al., 2007; Dammone et al., Int J Mol Sci. 2018). Consistent with our findings with 0-96 h perturbation of PPARγ, muscle-specific PPARγ.sup.KO mice revealed no overt phenotype in skeletal muscle development (Hevener et al., 2003; Norris et al., 2003), but myocyte triglyceride content was increased ˜50% (Hevener et al., 2003), suggesting that PPARγ promotes lipid catabolism in myocytes. Furthermore constitutive PPARγ.sup.KO was found to increase the mitotic activity of primary mouse myoblasts in vitro, suggesting that PPARγ is necessary to block the proliferative state in myoblasts (Dammone et al., 2018). And while some studies showed that PPARγ activation is anti-myogenic (Hunter et al., 2001; Singh et al., 2007), others suggested that PPARγ inhibition is also anti-myogenic (Singh et al., 2007). Here our time-window experiments have clarified these conflicting findings by showing that excessive inhibition of any PPAR subtype can lead to compensatory responses, and that PPARγ-FAO is only pro-myogenic in early myoblast differentiation, becoming anti-myogenic in late myogenesis.
[0434] Yet another confounding factor is the difference between the immortalized C2C12 cell-line and primary muscle cells (Dressel et al., 2003; Hu et al., 2012). Our bioinformatics analyses showed that immortalized C2C12 already start with high levels of PPARγ initially, only downregulating PPARγ upon myogenic differentiation. In contrast to immortalized C2C12, primary myoblasts only transiently upregulate PPARγ during early differentiation, with important implications for our interpretations of immortalized C2C12 data. Regardless, previous studies had shown that the PPARs can regulate MyoD, and cooperate with MyoD to transactivate some myogenesis genes, including mitochondrial UCP3 (Hunter et al., 2001; Solanes et al., 2003). Furthermore it has been shown that MyoD can also cooperate with non-canonical NF-KB RelB to induce the transcription of PGC10 and a variety of oxidative genes, including FAO genes, in multi-nucleated myotubes (Shintaku et al., 2017). Consistent with these findings, the MyoD-RelB-PGC10 transcriptional network could be how MyoD promotes maximal OCR in myocytes, by upregulating the downstream mitochondrial oxidation machinery needed for maximal OCR. In contrast, PPARγ induction of the upstream fatty acid metabolism enzymes could feed mitochondrial FAO and upregulate the basal rates of OCR in primary human myocytes.
REFERENCES
[0435] Anchelin, M., et al. (2011). PLoS One 6, e16955. [0436] Baker, D. J., et al. (2011). Nature 479, 232-236. [0437] Balzer, E., et al. (2010). Development 137, 891-900. [0438] Bar-Nur, O., et al. (2018). Stem Cell Reports 10(5), 1501-1521. [0439] Beausejour, C. M., et al. (2003). EMBO J. 22, 4212-4222. [0440] Bernet, J. D., et al. (2014). Nat. Med. 20, 265-271. [0441] Bigot, A., et al. (2008). Biol. Cell 100, 189-199. [0442] Blau, H. M., et al. (1983). Proc. Natl. Acad. Sci. U.S.A 80, 4856-4860. [0443] Blau, H. M., Cosgrove, B. D., and Ho, A. T. V (2015). Nat. Med. 21, 854-862. [0444] Borchin, B., Chen, J., and Barberi, T. (2013) Stem Cell Rep. 1(6), 620-631. [0445] Brack, A. S., and Rando, T. A. (2012). Cell Stem Cell 10, 504-514. [0446] Briske-Anderson, et al. (1997). Proc. Soc. Exp. Biol. Med. 214, 248-257. [0447] Buckingham, M., and Relaix, F. (2015). Cell Dev. Biol. 44, 115-125. [0448] Capel, A. J., et al. (2019). Front. Bioeng. Biotechnol., 7, 20. [0449] De Cecco, et al. (2019). Nature 566, 73-78. [0450] Chandel, N. S., et al. (1998). Proc. Natl. Acad. Sci. U.S.A 95, 11715-11720. [0451] Chandel, N. S., et al. (2000). J. Biol. Chem. 275, 25130-25138. [0452] Chang, J., et al. (2016). Nat. Med. 22, 78-83. [0453] Cheung, T. H., and Rando, T. A. (2013). Nat. Rev. Mol. Cell Biol. 14, 329-340. [0454] Choi, Y., et al. (2019). Biomaterials 206: 160-169. [0455] Christy, B., et al. (2015). p53 and rapamycin are additive. Oncotarget 6. [0456] Chua, M.-W. J., et al. (2019). Assessment of different strategies for scalable production and proliferation of human myoblasts. Cell Prolif doi: 10.1111/cpr.12602. [0457] Chung, C. Y., et al. (1999). Biochem. Biophys. Res. Commun. 265, 246-251. [0458] Coletti, D., et al. (2002). EMBO J. 21, 631-642. [0459] Conboy, I. M., and Rando, T. A. (2002). Dev. Cell 3, 397-409. [0460] Conboy, M. J., et al., (2010). Protocols for Adult Stem Cells, Methods in Molecular Biology™ (Methods and Protocols), vol 621. Humana Press. [0461] Copley, M. R., et al. (2013). Nat. Cell Biol. 15, 916-925. [0462] Cosgrove, B. D., et al. (2014). Nat. Med. 20, 255-264. [0463] Darabi, R., et al. (2008) Nat. Med. 14, 134-143. [0464] Darwin, C., Darwin, F., and Darwin, F. (1887). The life and letters of Charles Darwin, including an autobiographical chapter. Edited by his son, Francis Darwin. (London, John Murray,). [0465] Decary, S., Mouly, V., and Butler-Browne, G. S. (1996). Hum. Gene Ther. 7, 1347-1350. [0466] Decary, S., et al. (1997). Hum. Gene Ther. 8, 1429-1438. [0467] Demaria, M., et al. (2014). Dev. Cell 31, 722-733. [0468] Deuchar, E. (1976). J. Embryol. Exp. Morphol. 35, 345-354. [0469] Drummond, M. J., et al. (2011). Physiol. Genomics 43, 595-603. [0470] Elsaeidi, F., et al. (2018). J. Neurosci. 38, 2246-2261. [0471] Emerling, B. M., et al. (2005). Mol. Cell. Biol. 25, 4853-4862. [0472] Emerling, B. M., et al. (2008). Proc. Natl. Acad. Sci. 105, 2622-2627. [0473] Engleka, K. A., et al. (2005). Dev. Biol. 280, 396-406. [0474] Esquenet, M., et al. (1997). J. Steroid Biochem. Mol. Biol. 62, 391-399. [0475] Farr, J. N., et al. (2017). Nat. Med. 23, 1072-1079. [0476] Flamini, V., et al. (2018). Stem Cell Reports 10, 970-983. [0477] Fukawa, T., et al. (2016). Nat. Med. 22, 666-671. [0478] Garcia-Prat, L., et al. (2016). Autophagy 12, 612-613. [0479] Groskreutz, D. J., et al. (1994). J. Biol. Chem. 269(8), 6241-5. [0480] Grounds, M. D. (2014). Bioarchitecture 4, 81-87. [0481] Gussoni, E., Blau, H. M., and Kunkel, L. M. (1997). Nat. Med. 3, 970-977. [0482] Gutscher, M., et al. (2008). Nat. Methods 5, 553-559. [0483] Hanson, G. T., et al. (2004). J. Biol. Chem. 279, 13044-13053. [0484] Hinds, S. et al. (2011). Biomaterials, 32(14), 3575-3583. [0485] Huang, Y. (2012). Wiley Interdiscip. Rev. RNA 3, 483-494. [0486] Hutcheson, D. A., et al. (2009). Genes Dev. 23, 997-1013. [0487] Jeon, O. H., et al. (2017). Nat. Med. 23, 775-781. [0488] Kastenhuber, E. R., and Lowe, S. W. (2017). Cell 170, 1062-1078. [0489] Khodabukus, A. and Baar, K. (2009). Tissue Engineering Part C: Methods 15(3). [0490] Kudlow, B. A., et al. (2008). Mol. Biol. Cell 19, 5238-5248. [0491] L'honore, A., et al. (2014). Dev. Cell 29, 392-405. [0492] L'honore, A., et al. (2018). Elife 7. [0493] Lau, A., et al. (2019). J. Clin. Invest. 129, 4-11. [0494] Le, M. T. N., et al. (2011). PLoS Genet. 7, e1002242. [0495] Lee, S. J., et al. (2012). Proc. Natl. Acad. Sci. 109, E2353-E2360. [0496] Li T. et al. (2018). Nano Research 11(10), 5240-5257. [0497] Li, Z., et al. (2012). Dev. Cell 23, 1176-1188. [0498] Liu, N., et al. (2017). Nat. Cell Biol. 19, 202-213. [0499] Ma, X., et al. (2014). Nat. Commun. 5, 5212. [0500] Majmundar, A. J., et al. (2010). Mol. Cell 40, 294-309. [0501] Malhotra, J. D., and Kaufman, R. J. (2007). Antioxid. Redox Signal. 9, 2277-2294. [0502] Mendell, J. R. (1995). Ann. Neurol. 37, 3-4. [0503] Miwa, S., and Brand, M. D. (2003). Biochem. Soc. Trans. 31, 1300-1301. [0504] Mullarky, E., and Cantley, L. C. (2015). Diverting Glycolysis to Combat Oxidative Stress. [0505] Nakada, Y., et al. (2017). Nature 541, 222-227. [0506] O'Driscoll, L., et al. (2006). J. Endocrinol. 191, 665-676. [0507] Pajcini, K. V, et al. (2010). Stem Cell 7, 198-213. [0508] Park, T. J., et al. (2017). Science. 356, 307-311. [0509] Pearson, R. D. (1984). Acta Biotheor. 33, 51-59. [0510] Poletto, M., et al. (2017). Nucleic Acids Res. 45, 10042-10055. [0511] Porrello, E. R., et al. (2011). Science. 331, 1078-1080. [0512] Price, F. D., v et al. (2014). Nat. Med. 20, 1174-1181. [0513] Pronsato, L., et al. (2013a). Biocell 37, 1-9. [0514] Pronsato, L., Boland, R., and Milanesi, L. (2013b). Arch. Biochem. Biophys. 530, 13-22. [0515] Quintana, E., et al. (2008). Nature 456, 593-598. [0516] Robinton, D. A., et al. (2019). Dev. Cell 48, 396-405.e3. [0517] Rodier, F., Campisi, J., and Bhaumik, D. (2007). Nucleic Acids Res. 35, 7475-7484. [0518] Ron, D., and Walter, P. (2007). Nat. Rev. Mol. Cell Biol. 8, 519-529. [0519] Rowe, R. G., et al. (2016). J. Exp. Med. 213, 1497-1512. [0520] Ryall, J. G., et al. (2015). Cell Stem Cell 16, 171-183. [0521] Sadek, H. A., et al. (2014). Stem Cell Reports 3, 1. [0522] Schienda, J., et al. (2006). Proc. Natl. Acad. Sci. 103, 945-950. [0523] Schwarzkopf, M., et al. (2006). Genes Dev. 20, 3440-3452. [0524] Semenza, G. L., et al. (1994). J. Biol. Chem. 269, 23757-23763. [0525] Sena, L. A., and Chandel, N. S. (2012). Mol. Cell 48, 158-167. [0526] Shah, M. V., Namigai, E. K. O., and Suzuki, Y. (2011). Mech. Dev. 128, 342-358. [0527] Sharples, A. P., et al. (2011). J. Cell. Biochem. 112, 3773-3785. [0528] Shelton, M., et al. (2016). Methods 101, 73-84. [0529] Shinoda, G., et al. (2013). Stem Cells 31, 1563-1573. [0530] Shyh-Chang, N., and Daley, G. Q. (2013). Cell Stem Cell 12, 395-406. [0531] Shyh-Chang, N., et al. (2013a). Cell 155, 778-792. [0532] Shyh-Chang, N., Daley, G. Q., and Cantley, L. C. (2013b). Development 140, 2535-2547. [0533] Skuk, D., et al. (2010). Mol. Ther. 18, 1689-1697. [0534] Smith-Bolton, R. K., et al. (2009). Dev. Cell 16, 797-809. [0535] Sousa-Victor, P., et al. (2014). Nature 506, 316. [0536] Stockley, T. L., et al. (2000). J. Lab. Clin. Med. 135(6): 484-92. [0537] Takashima, Y., et al. (2016). Hepatology 64, 245-260. [0538] Testa, S., et al. (2018). Materials today Communications 15: 120-123. [0539] Tierney, M. T., et al. (2014). Nat. Med. 20, 1182-1186. [0540] Tierney, M. T., et al. (2016). Cell Rep. 14, 1940-1952. [0541] Urbach, A., et al. (2014). Genes Dev. 28, 971-982. [0542] Van Raamsdonk, J. M., et al. (2002). J. Lab. Clin. Med. 139(1), 35-42. [0543] Xipell, E., et al. (2016). Neuro. Oncol. 18, 1109-1119. [0544] Xu, M., et al. (2018). Nat. Med. 24, 1246-1256. [0545] Yang, M., et al. (2015). Development 142, 1616-1627. [0546] Yao, K., et al. (2016). Cell Rep. 17, 165-178. [0547] Yermalovich, A. V., et al. (2019). Nat. Commun. 10, 168. [0548] Yin, H., Price, F., and Rudnicki, M. A. (2013). Physiol. Rev. 93, 23-67. [0549] Yuan, J., et al. (2012). Science. 335, 1195-1200. [0550] Yun, J., and Finkel, T. (2014). Cell Metab. 19, 757-766. [0551] Zhang, J., et al. (2016). Cell Stem Cell 19, 66-80. [0552] Zhu, H., et al. (2011). Cell 147, 81-94.