WATERMELON PLANTS WITH CUCUMBER VEIN YELLOWING VIRUS (CVYV) RESISTANCE

Abstract

The application relates to the field of plant breeding, in particular watermelon breeding. Provided are CVYV resistant watermelon plants (and seeds from which these plants can be grown). Also provided is a QTL for CVYV resistance (cyv_3.1) and markers and methods for screening plants for the presence of the QTL.

Claims

1. A diploid cultivated watermelon plant of the species Citrullus lanatus ssp. vulgaris, or part thereof, comprising an introgression fragment from a wild watermelon plant on chromosome 3, whereby said introgression fragment comprises a CVYV-resistance conferring locus and whereby the introgression fragment comprises one or more of the following markers: a) a Guanine (G) at nucleotide 76 of SEQ ID NO: 2 (SNP_02) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2; b) a Cytosine (C) at nucleotide 76 of SEQ ID NO: 3 (SNP_03) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3; and/or c) a wild watermelon-genome-specific molecular marker within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP_02 or SNP_03.

2. The plant according to claim 1, wherein the introgression fragment is a fragment comprising the region starting at 2.50 Mb and ending at 12.80 Mb of chromosome 3, or a part thereof, wherein the part is at least 5 kb in size.

3. The plant according to claim 1, wherein the plant produces fruits comprising a degree brix of at least 7.0.

4. The plant according to claim 1, wherein said plant is homozygous for the introgression fragment and the plant is CVYV resistant and optionally ZYMV resistant.

5. A tetraploid watermelon plant made by doubling the chromosomes of the plant of claim 1.

6. The tetraploid watermelon plant according to claim 5, wherein the plant is an inbred line.

7. (canceled)

8. (canceled)

9. Seed from which a plant of claim 1 can be grown.

10. A vegetative propagation of a plant according to claim 1.

11. A cell or tissue culture of a plant of according to claim 1, wherein the cells or tissues comprise the introgression fragment.

12. The cell or tissue culture according to claim 11, comprising cells or protoplasts or plant tissue from a plant part, wherein the plant part is a scion, fruit, embryo, meristem, cotyledon, pollen, ovule, leaf, anther, root, root tip, pistil, flower, seed, a stem.

13. The plant part according to claim 1, wherein said part is a scion, fruit, pollen, ovule, stem, cotyledon, leaf, cell, embryo, meristem, anther, root, root tip, pistil, flower, or seed, and wherein the cells of said plant part comprise the introgression fragment.

14. A watermelon plant regenerated from the cell or tissue culture of claim 11.

15. A method for screening watermelon seeds, plants or plant parts or DNA from such seeds, plants or plant parts for the presence of one or more markers linked to CVYV resistance on chromosome 3, comprising determining the presence of: a) a Guanine (G) at nucleotide 76 of SEQ ID NO: 2 (SNP_02) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2; and/or b) a Cytosine (C) at nucleotide 76 of SEQ ID NO: 3 (SNP_03) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3; and/or c) a wild watermelon-genome-specific molecular marker within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP_02 or SNP_03.

16. A method for producing triploid hybrid watermelon seeds, wherein plants grown from such seeds are CVYV resistant, comprising: a) allowing pollination of flowers of the tetraploid plant according to claim 5 with pollen of a diploid plant, and b) harvesting seeds produced in the fruits of the tetraploid plant, wherein the diploid plant is a diploid cultivated watermelon plant of the species Citrullus lanatus ssp. Vulgaris comprising an introgression fragment from a wild watermelon plant on chromosome 3, whereby said introgression fragment comprises a CVYV-resistance conferring locus and whereby the introgression fragment comprises one or more of the following markers: i) a Guanine (G) at nucleotide 76 of SEQ ID NO: 2 (SNP_02) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2; ii) a Cytosine (C) at nucleotide 76 of SEQ ID NO: 3 (SNP_03) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3; and/or iii) a wild watermelon-genome-specific molecular marker within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP_02 or SNP_03.

17. (canceled)

18. A triploid watermelon seed made by the method of claim 16.

19. A triploid plant grown from the seed of claim 18.

20. A method for seedless triploid watermelon fruit production comprising: (a) interplanting triploid hybrid seeds according to claim 18 with diploid pollenizer plants, and optionally (b) harvesting the seedless watermelon fruits produced on the triploid plants of (a).

21. A method for seedless triploid watermelon fruit production comprising: (a) interplanting triploid hybrid plants according to claim 19 with diploid pollenizer plants, and optionally (b) harvesting the seedless watermelon fruits produced on the triploid plants of (a).

Description

DETAILED DESCRIPTION

[0065] The inventors found a recessive QTL on chromosome 3 of wild watermelon accessions, which comprises a CVYV resistance conferring locus. They found two different haplotypes linked to the resistance conferring QTL, haplotype A comprised nucleotides G-G-C at SNP_01, SNP_02 and SNP_03, respectively, and haplotype B comprised nucleotides A-G-C at SNP_01, SNP_02 and SNP_03, respectively.

[0066] Furthermore, SNP_02 and SNP_03 (the two common SNPs of both resistance haplotypes) were closely linked to the cyv_3.1 locus and were used to backcross the QTL cyv_3.1 into CVYV susceptible cultivated watermelon from two different wild watermelon accessions, thereby introducing CVYV-resistance into cultivated watermelon producing marketable fruits.

[0067] Seeds of two diploid inbred lines comprising cyv_3.1 in homozygous form have been deposited by Nunhems B.V. at the NCIMB under accession numbers NCIMB 42449 and NCIMB42450. These two lines comprise SNP_02 and SNP_03 in homozygous form and have SNP haplotype B. The fruits are seeded, red-fleshed fruits having a brix of 11.0 and are marketable fruits. The plants are CVYV resistant and ZYMV susceptible (and also lack the eIF4E marker of Ling et al., 2008 supra). One of the lines has fruits with a Crimson Sweet type rind (NCIMB 42449), the other one (NCIMB42450) has fruits with a Jubilee rind (as in Premium F1). Average fruit weight is 7 kg and 8 kg respectively. In addition, a number of cultivated inbred lines comprising the cyv_3.1 locus have been generated, which have average fruit weights ranging from about 2 kg to about 12 kg.

[0068] Seeds of another diploid elite inbred line comprising cyv_3.1 in homozygous form have been deposited by Nunhems B.V. at the NCIMB under accession number NCIMB 42666. This line comprise SNP_02 and SNP_03 in homozygous form and has SNP haplotype A. The fruits are seeded, red-fleshed fruits which are marketable.

TABLE-US-00001 TABLE1 SNPmarkerslinkedtocyv_3.1andSNPlocationonchromosome3ofthecultivated watermelongenomepublishedontheworldwidewebicugi.org/cgi-bin/ICuGI/index.cgiunder Watermelon:Genome,Watermelongenome(97103)-version1 cyv_3.1/cyv_3.1 watermelon Genomicsequence(5 to3 introgression cyv_3.1/cyv_3.1 variety direction)comprisingtheSNP SNP fromC.lanatus introgression without atnucleotide76ofthesequence, marker ssp. fromC.lanatus cyv_3.1 andphysicalSNPlocationon name mucosospermus ssp.lantus (WT/WT) cultivatedwatermelonchromosome3(*) SNP_01 GG AA GG GGGGCGAATAAAATAAAATA AATAAATTTGGTAGGGTTGG AGTGGAATAAAGGAGATTTT ATTTTATTTGGTTGA[A/G]* GAAACAAAAAGGGAAAAATT GGAATTAAGGGTTTAAGGAG GGAGAGGAATTAGGGTTTAG TTTAATCCCACCCTC (SEQIDNO:1) *Locatedatnucleotide7.586.752 SNP_02 GG GG AA TCAGTCATAGTATAGTGGAA TATTTGACTGCAGGTATAAG ACTCAACTTCAGAAAGATCC AGACCTTTTTTTTAA[A/G]* AGAGAGAGAGAGAGAGAGAG AGAGAGAACTAGAAACAACA ATTTCCACCAAAAGAATGAA AAGAGACTAAGACTC (SEQIDNO:2) *Locatedatnucleotide7.664.093 SNP_03 CC CC TT CGAGTTGGCTATTAGAGTTG ATCGTTGGAGATGATTGACT GAGTTAGTTGCTAGAGGTGG TCGTTGAGTTGGTTG[C/T]* CGAAGGTATTCGTCAGGGCT AGTTGCGAAGTTGGGCTTTG GAGAAGTGGAGATAGTCATT GTAGTTGATTGATGG (SEQIDNO:3) *Locatedatnucleotide7.693.225 Phenotype CVYVresistant CVYVresistant CVYV susceptible SNP Resistance Resistance haplotype HaplotypeA:G- HaplotypeB:A- G-CforSNP_01, G-Cfor SNP_02and SNP_01, SNP_03 SNP_02and SNP_03

[0069] Diploid Cultivated Watermelon Plants, Seeds and Plant Parts Comprising cyv_3.1

[0070] In one aspect of the invention (seed of) a diploid cultivated watermelon plant of the species Citrullus lanatus ssp. vulgaris is provided, wherein said plant comprises an introgression fragment from a wild watermelon plant on chromosome 3, whereby said introgression fragment comprises a CVYV-resistance conferring locus and is optionally detectable by (or comprises) a marker selected from the group consisting of: [0071] a) a Guanine (G) at nucleotide 76 of SEQ ID NO: 2 (SNP_02) or at nucleotide 76 of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2; and/or [0072] b) a Cytosine (C) at nucleotide 76 of SEQ ID NO: 3 (SNP_03) or at nucleotide 76 of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3; and/or (optionally) [0073] c) a wild watermelon-genome-specific molecular marker within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP_02 or SNP_03.

[0074] The above watermelon plant thus comprises an introgression fragment on chromosome 3 (comprising cyv_3.1), which is detectable by the resistance genotype of SNP_02 and/or SNP_03 and/or optionally another wild-watermelon genome specific marker within 5 Mb of SNP_02 or SNP_03. Although SNP_02 and SNP_03 are closely linked to the QTL, it is possible to generate introgression fragments which have lost SNP_02 and/or SNP_03, but retain the QTL and one or more different wild watermelon-genome-specific markers closely linked to cyv_3.1, as mentioned under c) above. The important contribution to the art is that the introgression fragment comprises the CVYV-resistance locus referred herein to as cyv_3.1. The plant need not be phenotypically CVYV resistant, as the CVYV-resistance locus may be in heterozygous form (only one recombinant chromosome 3 may be present). Thus the diploid genotype for SNP_02 may be either heterozygous GA (Guanine/Adenine) or homozygous GG (Guanine/Guanine) and the diploid genotype for SNP_03 may be either heterozygous CT (Cytosine/Thymine) or homozygous CC (Cytosine/Cytosine). In other words, a plant may be heterozygous for the introgression fragment (and the QTL), having only one Guanine (G) at nucleotide 76 of SEQ ID NO: 2 (SNP_02), or at a nucleotide corresponding to nucleotide 76 of SEQ ID NO: 2 in a variant sequence, i.e. in a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2, and only one Cytosine at nucleotide 76 of SEQ ID NO: 3 (SNP_03), or at a nucleotide corresponding to nucleotide 76 of SEQ ID NO: 3 in a variant sequence, i.e. in a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3; or it may be homozygous for the introgression fragment (and the QTL) having two Guanines at nucleotide 76 of SEQ ID NO: 2 (SNP_02) or at a nucleotide corresponding to nucleotide 76 of SEQ ID NO: 2 in a variant sequence, i.e. in a sequence of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2 and having two Cytosine (C) at nucleotide 76 of SEQ ID NO: 3 (SNP_03) or at a nucleotide corresponding to nucleotide 76 of SEQ ID NO: 3 in a variant sequence, i.e. in a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3. The same applies to the wild watermelon-genome-specific markers, linked to cyv_3.1, under c) above, i.e. this marker may be heterozygous or homozygous. The markers under c) can be identified by e.g. sequencing the region. These markers may be any markers which are linked to cyv_3.1 and which are polymorphic between the wild watermelon genomic DNA and the cultivated watermelon genomic DNA, such as SNP markers, insertions or deletions of one or more nucleotides (e.g. INDEL markers), AFLP markers, etc.

[0075] In one aspect the introgression fragment is in homozygous form, and the introgression fragment comprising the CVYV locus cyv_3.1 is in homozygous form, whereby the plant is CVYV resistant, as e.g. determinable in a CVYV resistance assay and/or a molecular marker assay. Thus in one aspect the SNP_02, SNP_03 and/or the wild watermelon-genome-specific marker are homozygous, i.e. SNP_02 and SNP_03 have the resistance genotype GG and CC, respectively, and the plant is CVYV resistant, e.g. when tested in a CVYV resistance assay and preferably also when grown in the field or tunnel under natural CVYV pressure.

[0076] As mentioned the wild watermelon-genome-specific markers may be any type of molecular marker present on the introgression fragment comprising cyv_3.1 and distinguishing the introgression fragment from the cultivated watermelon chromosome 3 region (WT genotype, lacking cyv_3.1), e.g. one or more SNP markers, CAPS markers, RFLP markers, AFLP markers, microsatellite markers, minisatellite markers, insertions or deletions of one or more nucleotides (e.g. INDELs), etc. Thus a wild watermelon-genome-specific molecular marker is a marker which is polymorphic or distinct between the wild watermelon genome introgression fragment comprising cyv_3.1 and the cultivated watermelon genome lacking the introgression fragment. Polymorphic SNP markers have already been provided herein, but other markers can be easily developed by the skilled person, e.g. by mapping or fine mapping or sequencing the region on chromosome 3 comprising the introgression fragment. For example the chromosome 3 region of plants deposited, comprising the introgression fragment in homozygous form, can be sequenced and compared to the same region of cultivated watermelon chromosome 3 in order to identify other wild watermelon-genome-specific molecular markers within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 2 kb, 1 kb or less of SNP_02 or of SNP_03, i.e. other wild watermelon-genome-specific markers linked to SNP_2 and/or SNP_03 and thus indicative of the introgression fragment comprising cyv_3.1.

[0077] Thus in one aspect said introgression fragment is detectable by (or comprises) a marker selected from the group consisting of: [0078] a) a diploid genotype GG (Guanine/Guanine) at nucleotide 76 of SEQ ID NO: 2 (SNP_02) or of a sequence comprising at least 90%, 91%, 92%/0, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2; and/or [0079] b) a diploid genotype CC (Cytosine/Cytosine) at nucleotide 76 of SEQ ID NO: 3 (SNP_03) or of a sequence comprising at least 90%, 91%, 920/0, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3; and/or [0080] c) a wild watermelon-genome-specific molecular marker within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP_02 or SNP_03 which marker is in homozygous form.

[0081] When referring herein to a SNP genotype at a specific position, e.g. at nucleotide 76 of SEQ ID NO: 2, or of a sequence comprising at least 90%/0, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the SEQ ID NO, this means that the SNP genotype is present in a variant sequence at a nucleotide corresponding to the same nucleotide (e.g. corresponding to nucleotide 76 of SEQ ID NO: 2) in the variant sequence, i.e. in a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%/0 sequence identity to the mentioned SEQ ID NO. It may for example be that the variant sequence is one or a few nucleotides shorter, but when one pairwise aligns the variant sequence with the mentioned SEQ ID NO, one can see which nucleotide of the variant sequence corresponds to the same nucleotide. In the variant sequence this may for example be nucleotide number 75 or 77 of that variant sequence which corresponds to nucleotide 76 of the mentioned sequence.

[0082] The above plant is, thus, also CVYV resistant in its phenotype, as determinable in a CVYV resistance assay as e.g. described in the Examples, or in the field or tunnel in areas where CVYV occurs naturally. It is understood that in a CVYV resistance assay a plurality of plants (e.g. at least 10, 11, 12, 13, 14, or more) of the line or variety are tested, preferably in several replicates (e.g. 2, 3, 4 or more), and optionally in several locations, and by including a plurality of plants of a susceptible control variety in the same assay. Seeds of the deposited lines can be included as a positive control. All current watermelon varieties are CVYV susceptible, so that any variety or parent line of any such variety can be used as susceptible control, for example the old diploid variety Sugar Baby may be used or Dumara (Nunhems) may be used.

[0083] In a specific embodiment of the invention (seed of) a diploid cultivated watermelon plant of the species Citrullus lanatus ssp. vulgaris is provided, wherein said plant comprises an introgression fragment from a wild watermelon plant on chromosome 3, whereby said introgression fragment comprises a CVYV-resistance conferring locus and is detectable by (or comprises): [0084] a) a Guanine (G) at nucleotide 76 of SEQ ID NO: 2 (SNP_02) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2; and/or [0085] b) a Cytosine (C) at nucleotide 76 of SEQ ID NO: 3 (SNP_03) or of a sequence comprising at least 90%/0, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3.

[0086] The plant comprises the CVYV resistance locus in homozygous or heterozygous form.

[0087] In one aspect the plant comprises the introgression fragment in homozygous form, i.e. the introgression fragment is detectable by (or comprises): [0088] a) a diploid genotype GG (Guanine/Guanine) for nucleotide 76 of SEQ ID NO: 2 (SNP_02) or of a sequence comprising at least 90%/0, 91%, 92%/0, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2; and/or [0089] b) a diploid genotype CC (Cytosine/Cytosine) at nucleotide 76 of SEQ ID NO: 3 (SNP_03) or of a sequence comprising at least 90%/0, 91%, 920/0, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3.

[0090] The above diploid plants may in one embodiment have SNP haplotype A or SNP-haplotype B. Thus, in one aspect the plants comprise SNP haplotype A having G-G-C for SNP_01-SNP_02 and SNP_03, respectively (e.g. in diploid form the SNP haplotype A is either GG-GG-CC in homozygous form, or GG-GA-CT in heterozygous form). In another aspect the plant comprises SNP haplotype B having A-G-C for SNP_01-SNP_02 and SNP_03, respectively (e.g. in diploid form the SNP haplotype A is either AA-GG-CC in homozygous form, or AG-GA-CT in heterozygous form). Thus, at nucleotide 76 of SEQ ID NO: 1 (SNP_01) or of a sequence comprising at least 90%/0, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:1, the SNP genotype may be either a Guanine or an Adenine. SNP_01 can distinguish the two different resistance haplotypes.

[0091] Any of the above described diploid watermelon plants may be of any type, i.e. the cyv_3.1 resistance locus may be introduced into any cultivated watermelon to produce lines or varieties comprising the CVYV locus. Cultivated watermelons produce diverse fruit sizes (e.g. very small, as described in WO2012069539, e.g. less than 0.9 kg or even equal to or less than 0.65 kg; personal-size of about 3-7 pounds, i.e. about 1.4 to 3.2 kg; icebox sizes of about 6-12 pounds, i.e. about 2.7 to 5.5 kg; and larger sizes of up to 35 pounds, i.e. about 15.9 kg), fruit flesh colors, and fruit shapes and with different rind colors. The cyv_3.1 locus may, therefore, be introduced into cultivated watermelon producing any fruit shape (e.g. elongate, oval, oval elongated, blocky, blocky elongated, spherical or round), fruit surface (e.g. furrow, smooth), flesh color (e.g. red, dark red, scarlet red, coral red, orange, salmon or pink, yellow, canary yellow or white), rind color (e.g. light green; dark green; green-striped with narrow, medium or wide stripes; grey types; with or without spotting; Golden yellow; Crimson type rind, Jubilee type rind; Allsweet type rind; black/dark green), rind thickness, rind toughness, rind pattern (e.g. striped, non-striped, netted), flesh structure/flesh firmness, lycopene and/or vitamin content, different sugar to acid ratios, very good fruit flavour, etc. by breeding. See Guner and Wehner 2004, Hort Science 39(6): 1175-1182, in particular pages 1180-1181 describing genes for fruit characteristics. Generally important breeding objectives are early maturity, high fruit yield, high internal fruit quality (good uniform color, high sugar, proper sugar:acid ratio, good flavour, high vitamin and lycopene content, firm flesh texture, non-fibrous flesh texture, freedom from defects such as hollow heart, rind necrosis, blossom-end rot or cross stitch and good rind characteristics and cracking-resistance).

[0092] The fruits produced by the diploid line or variety are preferably marketable fruits.

[0093] In one aspect the average brix is at least 6.0, 7.0, 8.0 or at least 9.0, preferably at least 10.0, more preferably at least 11.0 or more.

[0094] Fruit color may be any color, such as red, dark red, scarlet red, coral red, orange, salmon, pink, pinkish red, yellow, canary yellow or white. Preferably the fruit flesh color is uniform.

[0095] The diploid may be an inbred line or a diploid hybrid, produced by crossing two inbred lines. In one aspect both inbred parent lines are homozygous for the cyv_3.1, so that the hybrid is also homozygous.

[0096] The diploid plant may be an inbred line, a variety, a diploid F1 hybrid, an OP (open pollinated) variety, a pollenizer plant, (e.g. a dedicated pollenizer producing marketable fruits as described in WO2012069539), or any other cultivated diploid, including any clonally propagated plant. As the CVYV resistance phenotype is preferably phenotypically expressed, the introgression fragment is in one aspect homozygous in the diploid, as are the one or more of the markers linked to cyv_3.1.

[0097] The wild watermelon introgression fragment comprising cyv_3.1 may be of various sizes, e.g. about 15 Mb or less, about 10 Mb or less, about 9 Mb or less, about 8 Mb or less, about 7 Mb or less, about 6 Mb or less, about 5 Mb or less, about 4 Mb or less, about 3 Mb or less, about 2.5 Mb or 2 Mb or less, about 1 Mb (equals 1,000,000 base pairs) or less, or about 0.5 Mb (equals 500,000 base pairs) or less, such as about 200,000 bp (equals 200 kilo base pairs) or less, about 100,000 bp (100 kb) or less, about 50,000 bp (50 kb) or less, about 30,000 bp (30 kb) or less. Smaller introgression fragments are generally preferred, as negative traits may be located on the same fragment. Size of an introgression fragment can be reduced by meiotic recombination (e.g. by selfing the plant) and selecting recombinant progeny plants having a smaller introgression fragment but retaining cyv_3.1, using e.g. a phenotypic assay and/or a molecular marker assay as described herein. If SNP_01 and/or SNP_02 and/or SNP_03 are lost through recombination, but the plant retains the cyv_3.1 locus, phenotypic selection can be used to select a plant retaining cyv_3.1 and/or the introgression fragment can be detected using another method, e.g. sequencing the region of chromosome 3 where the QTL is found (e.g. the region between about 2.50 Mb and about 12.8 Mb of chromosome 3, see FIG. 1) or other wild watermelon-genome-specific markers linked to cyv_3.1. Such other wild watermelon genome specific markers can be developed using methods known to the skilled person, such as fine mapping, sequencing, etc.

[0098] In one aspect the introgression fragment of the invention (comprising cyv_3.1 or a variant thereof and wherein the introgression fragment is introgressed from a wild watermelon plant) is a fragment comprising (or spanning) the region starting at 2.50 Mb and ending at 12.80 Mb of chromosome 3 and comprises the cyv_3.1 locus or a variant thereof.

[0099] In another aspect the introgression fragment of the invention (comprising cyv_3.1 or a variant thereof and wherein the introgression fragment is introgressed from a wild watermelon plant) is a fragment comprising a smaller fragment (part) of the region starting at 2.50 Mb and ending at 12.80 Mb of chromosome 3, e.g. having a size of e.g. 9 Mb, 8 Mb, 7 Mb, 6 Mb, 5 Mb, 4 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 100 kb, 50 kb, 35 kb, 30 kb, 20 kb, or less (as described above) and comprising the cyv_3.1 locus or a variant thereof. In one aspect the part is at least 5 kb, 10 kb, 20 kb in size, or more.

[0100] In yet another aspect the introgression fragment of the invention (comprising cyv_3.1 or a variant thereof and wherein the introgression fragment is introgressed from a wild watermelon plant) consist of a smaller fragment (sub-fragment) of the region starting at 2.50 Mb and ending at 12.80 Mb of chromosome 3, e.g. having a size of e.g. 9 Mb, 8 Mb, 7 Mb, 6 Mb, 5 Mb, 4 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 100 kb, 50 kb, 35 kb, 30 kb, 20 kb, or less (as described above) and comprising the cyv_3.1 locus or a variant thereof. In one aspect the part is at least 5 kb, 10 kb, 20 kb in size, or more.

[0101] In yet a further aspect the introgression fragment of the invention (comprising cyv_3.1 or a variant thereof and wherein the introgression fragment is introgressed from a wild watermelon plant) comprises the region starting at starting at 7.50 Mb and ending at 7.75 Mb chromosome 3, or the region starting at 7.60 Mb and ending at 7.70 Mb, wherein the fragment comprises the cyv_3.1 locus or a variant thereof. In one aspect the part is at least 5 kb, 10 kb, 20 kb in size, or more.

[0102] Also seeds from which the plants of the invention can be grown are provided herein.

[0103] Likewise plant parts of the plants of the invention are encompassed herein, such as cells, roots, leaves, fruits, fruit parts, pollen, ovules, flowers, rootstocks, scions, cuttings, stems, DNA extracted from such parts or cells, etc. Such plant parts comprise in their genome at least one recombinant chromosome 3 comprising the introgression fragment, detectable by one or more markers as described. Likewise genomic DNA extracted from such cells or plant parts comprises in its genome at least one recombinant chromosome 3 comprising the introgression fragment, detectable by one or more markers as described.

[0104] The C. lanatus ssp. mucosospermus CVYV resistance source was a wild accession obtained from the US GRIN collection. It has small (about 13 cm?13 cm) white-fleshed fruits with a brix of about 3.0. The C. lanatus ssp. lanatus accession was also a wild accession obtained from the US GRIN collection. It had yellow bitter fruits of about 16 cm?24 cm, with a brix below 3.0.

[0105] The resistance cyv_3.1 was backcrossed from these two diploid wild accessions into CVYV susceptible watermelon elite lines, thereby generating diploid cultivated watermelon comprising cyv_3.1 and being resistant against CVYV, when the introgression fragment was present in homozygous form.

[0106] As mentioned above, seeds of two diploid inbred cultivated watermelon lines comprising cyv_3.1 in homozygous form have been deposited at the NCIMB under accession numbers NCIMB42449 and NCIMB42450. These two lines comprise SNP_02 and SNP_03 in homozygous form and have SNP haplotype B. The fruits are seeded, red-fleshed fruits having a brix of 11.0 and are thus marketable fruits. The plants are CVYV resistant but ZYMV susceptible (and also lack the eIF4E marker of Ling et al. 2008 supra). One of the lines has fruits with a Crimson sweet rind, the other one has fruits with a Jubilee rind. The cyv_3.1 can be transferred from these two lines into any other cultivated watermelon line or variety by traditional breeding, using either phenotypic selection or marker selection or both.

[0107] Also seeds of another diploid elite inbred line comprising cyv_3.1 in homozygous form have been deposited by Nunhems B.V. at the NCIMB under accession number NCIMB 42666. This line comprise SNP_02 and SNP_03 in homozygous form and has SNP haplotype A. The fruits are seeded, red-fleshed fruits which are marketable. The plants are CVYV resistant.

[0108] In one aspect the cyv_3.1 is obtainable from (can be obtained from/is as present in) seeds deposited under NCIMB42449 or NCIMB 42450 or NCIMB 42666, e.g. by crossing plants grown from such seeds (or progeny thereof) with another watermelon plant and selecting progeny comprising the introgression fragment. In one aspect the other watermelon plant is a cultivated watermelon which is lacks cyv_3.1.

[0109] Alternatively other wild accessions of C. lanatus ssp. mucosospermus or of C. lanatus ssp. lanatus may comprise cyv_3.1 (or a variant thereof) and may be used to introgress cyv_3.1 (or a variant thereof) into cultivated watermelon. To identify such other wild accessions one or more of the markers provided herein can be used, optionally in combination with CVYV resistance assays. For example, the seeds of the wild watermelon accession PI1189318, was found to comprise cyv_3.1, as shown in Example 6, when screening progeny of wild watermelon accessions of the US GRIN collection using the SNP markers provided herein. PI189318 produce hard white fleshed fruits, which are bitter and which have a very low brix (about 3.0). The cyv_3.1 locus can be introgressed from this, or other wild watermelon accessions, into cultivated watermelon as described herein, optionally using one or more of the SNP markers provided herein. Thus in one aspect the cultivated watermelon plant of the invention comprises an introgression fragment from e.g. PI1189318 or progeny thereof, or from other wild watermelons, whereby the introgression fragment comprises the cvy_3.1 resistance locus and is detectable by one or more markers linked to cvy_3.1 as described herein. The wild watermelons may be of SNP haplotype A or B. For example PI189318 has SNP haplotype A in homozygous form.

[0110] In one embodiment of the invention (seed of) a diploid cultivated watermelon plant of the species Citrullus lanatus ssp. vulgaris is provided, wherein said plant comprises an introgression fragment from a wild watermelon plant on chromosome 3, whereby said introgression fragment comprises a CVYV-resistance conferring locus, whereby said introgression fragment comprises: [0111] a) a Guanine (G) at nucleotide 7.664.093 of the cultivated watermelon genome chromosome 3 (SNP_02); and/or [0112] b) a Cytosine (C) at nucleotide 7.693.225 of the cultivated watermelon genome chromosome 3 (SNP_03); and/or optionally [0113] c) a wild watermelon-genome-specific molecular marker within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP_02 or SNP_03.

[0114] In another embodiment of the invention (seed of) a diploid cultivated watermelon plant of the species Citrullus lanatus ssp. vulgaris is provided, wherein said plant comprises an introgression fragment from a wild watermelon plant on chromosome 3, whereby said introgression fragment comprises a CVYV-resistance conferring locus and whereby said introgression fragment is detectable by (or comprises) a marker selected from the group consisting of: [0115] a) a Guanine (G) at nucleotide 76 of SEQ ID NO: 2 (SNP_02) or of a nucleic acid molecule which hybridizes under stringent conditions to SEQ ID NO: 2; and/or [0116] b) a Cytosine (C) at nucleotide 76 of SEQ ID NO: 3 (SNP_03) or of a nucleic acid molecule which hybridizes under stringent conditions to SEQ ID NO: 3; and/or optionally [0117] c) a wild watermelon-genome-specific molecular marker within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP_02 or SNP_03.

[0118] In a different embodiment of the invention (seed of) a diploid cultivated watermelon plant of the species Citrullus lanatus ssp. vulgaris is provided, wherein said plant comprises an introgression fragment from a wild watermelon plant on chromosome 3, whereby said introgression fragment comprises a CVYV-resistance conferring locus and whereby said introgression fragment is detectable by (or comprises) a marker selected from the group consisting of: [0119] a) a Guanine (G) at nucleotide 76 of SEQ ID NO: 2 (SNP_02) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2; and/or [0120] b) a Cytosine (C) at nucleotide 76 of SEQ ID NO: 3 (SNP_03) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3; and/or optionally [0121] c) a wild watermelon-genome-specific molecular marker within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP_02 or SNP_03.

[0122] In one aspect the introgression fragment, and the markers, are homozygous.

[0123] In one aspect, the plants of the invention lack a ZYMV resistance conferring locus on chromosome 3. However, CVYV resistance can also be combined with ZYMV resistance on chromosome 3 as described below.

[0124] Also plant parts, such as fruits or parts thereof, cells, leaves, flowers, etc. of the above plants are encompassed herein. As mentioned previously, fruits are marketable diploid fruits.

[0125] In one embodiment the cultivated watermelon plant or plant part comprising the CVYV-resistance conferring locus as found in seeds deposited under accession numbers NCIMB 42449 or NCIMB 42450 or NCIMB 42666 or as found in wild watermelon PI189318 or other wild watermelons. Thus in one aspect cyv_3.1 is obtainable by (can be obtained by) crossing a watermelon plant of which seeds were deposited under Accession number NCIMB42449 or NCIMB42450 or NCIMB42666, or progeny of any of these plants (e.g. obtained by selfing and/or crossing and which progeny retain the cyv_3.1), with another watermelon plant, e.g. a cultivated watermelon elite line or variety. In another aspect the cyv_3.1 gene is obtainable by introgressing the resistance from wild watermelons, such as PI189318 or other wild watermelons, into cultivated watermelon.

[0126] In another aspect the cultivated watermelon plant or plant part comprising the CVYV-resistance conferring introgression fragment as found in seeds deposited under accession numbers NCIMB 42449 or NCIMB 42450 or NCIMB 42666, or a shorter part thereof, which retains cyv_3.1. Thus in one aspect the introgression fragment comprising cyv_3.1 is obtainable by (can be obtained by) crossing a watermelon plant of which seeds were deposited under Accession number NCIMB42449 or NCIMB42450 or NCIMB42666, or progeny of any of these plants (e.g. obtained by selfing and/or crossing and which progeny retain the cyv_3.1), with another watermelon plant.

[0127] Thus, the CVYV resistance gene on chromosome 3 is in one aspect the gene as present in seeds deposited under Accession Number NCIMB42449 or NCIMB42450 or NCIMB42666, or progeny thereof, but it may equally be the resistance gene of another wild watermelon, especially a wild watermelon comprising one or more of the SNP markers, i.e. the resistance genotype of the SNP markers, linked to cyv_3.1. Examples are wild accessions such as PI189318 or others. In addition to marker analysis or as an alternative e.g. an allelism test can easily be carried out by the skilled person in order to determine whether such a CVYV resistance is indeed conferred by the same resistance gene, namely cyv_3.1. Likewise other methods or combinations of methods can be used, such as mapping, fine mapping, sequencing, genetic inheritance, and the like to confirm that the same gene, cyv_3.1, is responsible for the CVYV resistance phenotype.

[0128] Combining cyv_3.1 Conferring CVYV Resistance with ZYMV Resistance

[0129] The inventors found that cyv_3.1 is located on the same chromosome as the recessive zym gene, which confers resistance against ZYMV. Therefore cyv_3.1 can be combined with zym on chromosome 3 to provide a chromosome that comprises CVYV and ZYMV resistance-conferring loci in coupling phase.

[0130] ZYMV is a virus transmitted by aphids and can cause slight to severe fruit deformation and discoloration.

[0131] Sources for zym resistance are for example PI595203 as described by Ling et al. 2008 (supra). The inventors have converted the CAPS marker described by Ling et al. 2008 into a SNP marker referred to as SNP_04, see Table 2.

TABLE-US-00002 TABLE2 SNPmarkerintheeIF4EgenelinkedtoZYMVresistanceandSNPlocation onchromosome3ofthecultivatedwatermelongenomepublishedonthe worldwidewebicugi.org/cgi-bin/ICuGI/index.cgiunderWatermelon: Genome,Watermelongenome(97103)-version1 Watermelon Genomicsequence(5' to3' withzym/zym Watermelon direction)comprisingtheSNPat SNP introgression variety nucleotide70ofthesequence,and marker frome.g. without physicalSNPlocationonculti- name PI595203 zym/zym vatedwatermelonchromosome3(*) SNP_04 GG TT TGAAGTTCTACCTCCAAAAC TCCTCAACAGTAGAGAAGGT ATAGATCGGTCGGATAGACG CACCCCAGG[G/T]*GGCTT GCTTAGACTTGGCGGATGGG TTATCGAACCAAAAGGTCCA AGAGTGCTCAAGAGGGTGAG GCTGATGCACTATCGCCGCC GACAAATTGGACGAGTCAAG GTCGTCGTCTCCGACGATCT CTCCTTCCTCAAGTTCCTCA TCTTCATCACCGCCTCGTCC TCTAGGGTTTTGATTTGCAA TGGTATTAGAAAGATCTTCC GTGGATGTAGCTTTGATCGT CTCTTCGACTACCATTTTCC TTTCACTACTTGTGGAATTG AGCGT (SEQIDNO:4) *Locatedatnucleotide7.767.975 Phenotype ZYMVresistant ZYMV susceptible

[0132] The diploid watermelon plants of the invention described above may, thus, further comprise the zym gene on chromosome 3.

[0133] Thus, in one aspect a of the invention (seed of) a diploid cultivated watermelon plant of the species Citrullus lanatus ssp. vulgaris is provided, wherein said plant comprises an introgression fragment from a wild watermelon plant on chromosome 3 comprising a CVYV resistance conferring locus, whereby said introgression fragment is detectable by (or comprises) a marker selected from the group consisting of: [0134] a) a Guanine (G) at nucleotide 76 of SEQ ID NO: 2 (SNP_02) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2; and/or [0135] b) a Cytosine (C) at nucleotide 76 of SEQ ID NO: 3 (SNP_03) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3; and/or [0136] c) a wild watermelon-genome-specific molecular marker within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP_02 or SNP_03; and [0137] d) wherein the plant further comprises the zym gene on chromosome 3.

[0138] Optionally, the presence of (an introgression fragment comprising) the zym gene is by detecting a Guanine (G) at nucleotide 70 of SEQ ID NO: 4 (SNP_04) or of a sequence comprising at least 90%/0, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 4. However, SNP_04 is probably not very closely linked to zym, so that phenotypic selection or the development of a more closely linked marker may be preferred to ensure that zym is present.

[0139] The recombinant chromosome 3, thus, comprises the introgression fragment comprises the CVYV resistance locus cyv_3.1 and may further comprise (an introgression fragment comprising) the zym gene on the same chromosome. The plant need not be phenotypically CVYV resistant and ZYMV resistant, as the CVYV resistance locus and the zym gene may be in heterozygous form (only one recombinant chromosome 3 may be present). In one aspect, the plant is homozygous for the recombinant chromosome 3 and thus resistant against both CVYV and ZYMV.

[0140] Thus, in one aspect the introgression fragment comprising the CVYV resistance locus cyv_3.1 is in homozygous form, and the (introgression fragment comprising) zym gene is in homozygous form, whereby the plant is CVYV and ZYMV resistant. In one aspect the SNP_02 and/or SNP_03 and/or the wild watermelon genome specific marker(s) linked to cyv_3.1 are homozygous and zym is homozygous (zym/zym), and optionally SNP_04 (if present) is homozygous GG (Guanine/Guanine).

[0141] In a specific embodiment of the invention (seed of) a diploid cultivated watermelon plant of the species Citrullus lanatus ssp. vulgaris is provided, wherein said plant comprises an introgression fragment from a wild watermelon plant on chromosome 3 comprising a CVYV resistance conferring locus named cyv_3.1, whereby said introgression fragment is detectable by (or comprises): [0142] a) a Guanine (G) at nucleotide 76 of SEQ ID NO: 2 (SNP_02) or of a sequence comprising at least 90%, 91%, 92%/0, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2; and [0143] b) a Cytosine (C) at nucleotide 76 of SEQ ID NO: 3 (SNP_03) or of a sequence comprising at least 90%/0, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%/0 sequence identity to SEQ ID NO: 3; and [0144] c) wherein the chromosome 3 further comprises the zym gene.

[0145] In one aspect the plant comprises the introgression fragment on chromosome 3 in homozygous form, i.e. the introgression fragment is detectable by (or comprises): [0146] a) a diploid genotype GG (Guanine/Guanine) for nucleotide 76 of SEQ ID NO: 2 (SNP_02) or of a sequence comprising at least 90%/0, 91%, 920/0, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2; and [0147] b) a diploid genotype CC (Cytosine/Cytosine) at nucleotide 76 of SEQ ID NO: 3 (SNP_03) or of a sequence comprising at least 90%, 91%, 920/0, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3; and [0148] c) wherein the chromosome 3 further comprises the zym gene in homozygous form (zym/zym); and [0149] d) wherein the plant is CVYV and ZYMV resistant.

[0150] The above diploid plants may in one embodiment have CVYV SNP haplotype A or SNP-haplotype B combined with the zym gene. Thus, in one aspect the plants comprise SNP haplotype A having G-G-C for SNP_01 and SNP_02 and SNP_03, respectively (e.g. in diploid form the SNP haplotype A is either GG-GG-CC in homozygous form or GG-GA-CT in heterozygous form) and the zym gene linked on the same chromosome as cyv_3.1 (and optionally SNP_04 has the diploid genotype GT, heterozygous, or GG, homozygous). In another aspect the plant comprises SNP haplotype B having A-G-C for SNP_01 and SNP_02 and SNP_03, respectively (e.g. in diploid form the SNP haplotype A is either AA-GG-CC in homozygous form or AG-GA-CT in heterozygous form) and the zym gene linked on the same chromosome as cyv_3.1 (and optionally SNP_04 has the diploid genotype GT, heterozygous, or GG, homozygous). Thus, at nucleotide 76 of SEQ ID NO: 1 (SNP_01) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:1, the SNP genotype may be either a Guanine or an Adenine. SNP_01 can distinguish the two different CVYV resistance haplotypes, but either haplotype may be combined with the zym gene on the same chromosome 3.

[0151] A diploid CVYV and ZYMV resistant plant may, thus, comprise one of the following two genotypes:

TABLE-US-00003 SNP marker and gene on chromosome 3 Diploid SNP genotype Diploid SNP genotype SNP_01 GG AA SNP_02 GG GG SNP_03 CC CC gene zym/zym zym/zym Optionally SNP_04 GG GG

[0152] To combine the CVYV resistance locus cyv_3.1 with the zym gene, the skilled person will cross a plant of the invention, comprising cyv_3.1, with a plant comprising the zym gene and select a recombinant progeny plant comprising both the CVYV locus cyv_3.1 and the zym gene on one recombinant chromosome 3.

[0153] In one embodiment the cultivated watermelon plant or plant part comprising the CVYV-resistance conferring locus cyv_3.1 as found in seeds deposited under accession numbers NCIMB 42449 or NCIMB 42450 or NCIMB 42666 and further comprise the zym gene.

[0154] In one embodiment the cultivated watermelon plant or plant part comprising the introgression fragment (comprising cyv_3.1) as found in seeds deposited under accession numbers NCIMB 42449 or NCIMB 42450 or NCIMB 42666, or a smaller fragment thereof (which retains locus cyv_3.1) and further comprise the zym gene.

[0155] In one aspect the diploid watermelon plants (and seeds from which the plants can be grown) according to the invention are inbred lines, produced by selfing several times.

[0156] In another aspect the diploid watermelon plants (and seeds from which the plants can be grown) according to the invention are F1 hybrids produced by crossing two diploid inbred lines according to the invention and collecting the seeds from the cross.

[0157] Plants grown from the deposited seeds were also tested for CGMMV (Cucumber Green Mottle Virus) resistance, but were susceptible, indicating that cyv_3.1 does not confer CGMMV resistance.

[0158] Tetraploid Cultivated Watermelon Plants, and Plant Parts, Comprising cyv_3.1 (or a Variant Thereof)

[0159] Seedless triploid watermelon production involves using pollen from diploid male parent plants to fertilize flowers of tetraploid (2n=4x=44) maternal parent plants. Pollination of the tetraploid flowers with diploid pollen leads to F1 seeds which are triploid (Kihara, 1951, Proceedings of American Society for Horticultural Science 58: 217-230; Eigsti 1971, Hort Science 6: 1-2). The triploid hybrid plants, grown from these F1 seeds, are self-infertile as they produce sterile pollen due to chromosome imbalance (Fehr, 1987). The triploid hybrids, therefore, need to be pollinated by a diploid pollenizer to produce watermelon fruit. Triploid plants are, therefore, interplanted with pollenizer plants for fruit production. The seedless fruit produced after pollination on the triploid hybrid plant are often not truly seedless, but may contain some undeveloped, small, pale seeds, which are edible.

[0160] Thus, to produce such seedless triploid varieties, a tetraploid female parent line (preferably an inbred line) and a diploid male parent line (preferably an inbred line) are crossed. The seeds produced in the fruits of the tetraploid parent via cross pollination are triploid, having two chromosome sets from the tetraploid mother and one chromosome set from the diploid father. These seeds are harvested and sold as triploid varieties. The triploid plants grown from these seeds still need pollen to induce fruit set (provided by a pollenizer), but the fruits produced are seedless watermelon fruits.

[0161] In one aspect a tetraploid watermelon plant is provided comprising four recombinant chromosomes 3, i.e. each comprising the introgression fragment from a wild watermelon comprising cyv_3.1. Thus, the tetraploid plant comprises four copies of cyv_3.1. When it is crossed with a diploid male parent line comprising two copies of cyv_3.1, the resulting triploid seeds comprise three copies of cyv_3.1.

[0162] To make such a tetraploid plant, any of the CVYV-resistant diploid plants described above, which are homozygous for the introgression fragment, may be used as starting material to generate tetraploid plants. Chromosome doubling techniques known to the skilled person may be used to generate a tetraploid plant from such diploid plants. For example Noh et al. (2012) Hort. Environ. Biotechnol. 53(6):521-529, evaluated different methods of generating tetraploid watermelons. In all methods an antimitotic agent is used, such as colchicine, dinitoalanine, or oryzalin, in order to induce chromosome doubling. Optionally tissue culture may be used to generate tetraploid plants from plant parts. To verify that plants are tetraploid chromosome number can be confirmed. Ploidy can be easily determined by chromosome counting or flow cytometry or other known methods (Sari et al. 1999, Scientia Horticulturae 82: 265-277, incorporated herein by reference).

[0163] Thus, in one aspect of the invention (seed of) a CVYV-resistant tetraploid cultivated watermelon plant of the species Citrullus lanatus ssp. vulgaris is provided, wherein said plant comprises an introgression fragment from a wild watermelon plant on chromosome 3, whereby said introgression fragment confers CVYV-resistance due to the presence of the cyv_3.1 locus and whereby the recombinant chromosome 3 is present in four copies.

[0164] The introgression fragment is detectable by (or comprises) a marker selected from the group consisting of: [0165] a) a Guanine (G) at nucleotide 76 of SEQ ID NO: 2 (SNP_02) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2; and/or [0166] b) a Cytosine (C) at nucleotide 76 of SEQ ID NO: 3 (SNP_03) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3; and/or [0167] c) a wild watermelon-genome-specific molecular marker within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP_02 or SNP_03.

[0168] As mentioned, the tetraploid plant comprises four copies of said recombinant chromosome 3.

[0169] Thus, in one embodiment the tetraploid watermelon plant above comprises: [0170] a) a tetraploid genotype GGGG (Guanine/Guanine/Guanine/Guanine) for nucleotide 76 of SEQ ID NO: 2 (SNP_02) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2; and/or [0171] b) a tetraploid genotype CCCC (Cytosine/Cytosine/Cytosine/Cytosine) at nucleotide 76 of SEQ ID NO: 3 (SNP_03) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3; and/or [0172] c) a tetraploid genotype for the wild watermelon-genome-specific molecular marker within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP_02 or SNP_03.

[0173] Genotyping of tetraploid plants or plant parts (cells, leaves, DNA, etc.) can be done in the same way as for diploids, using for example a KASP-assay to distinguish SNP genotypes, e.g. plants or parts comprising GGGG for SNP_02 can be distinguished from plants or parts comprising GGGA, GGAA, GAAA or AAAA for SNP_02 in their genome.

[0174] As the tetraploid is made by doubling the chromosomes of a CVYV resistant diploid described further above, the aspects described for the diploid above apply to the tetraploid as well. For example, the tetraploid may also comprise the zym gene in coupling phase on the recombinant chromosome 3 and may thus comprise four copies of cyv_3.1 (or a variant thereof) and four copies of zym. Likewise haplotype A or haplotype B may be present in four copies.

[0175] So, from the above diploids the following tetraploids can be derived:

TABLE-US-00004 SNPmarkerandgene DiploidSNPgenotype.fwdarw. DiploidSNPgenotype.fwdarw. onchromosome3 tetraploidSNPgenotype tetraploidSNPgenotype SNP_01 GG.fwdarw. GGGG AA.fwdarw. AAAA SNP_02 GG.fwdarw. GGGG GG.fwdarw. GGGG SNP_03 CC.fwdarw. CCCC CC.fwdarw. CCCC Optionallyzymgene zym/zym.fwdarw. zym/zym.fwdarw. zym/zym/zym/zym zym/zym/zym/zym OptionallySNP_04 GG.fwdarw. GGGG GG.fwdarw. GGGG

[0176] The CVYV resistant tetraploid is preferably selfed a number of times, to produce an inbred teraploid, which can be used as female parent in the production of triploid seeds.

[0177] In one aspect the diploid, CVYV resistant plants of which seeds were deposited under accession numbers NCIMB 42449 and NCIMB 42450, or progeny thereof (e.g. comprising a smaller introgression fragment) are used to make tetraploids. These plants do not comprise the zym gene and are ZYMV susceptible.

[0178] In one aspect the diploid, CVYV resistant plants of which seeds were deposited under accession numbers NCIMB 42666, or progeny thereof (e.g. comprising a smaller introgression fragment) are used to make tetraploids.

[0179] In another aspect a cultivated watermelon plants comprising a cyv_3.1 gene from a different wild watermelon, such as from PI189318 or others, is used to make a tetraploid CVYV resistant plant.

[0180] Also, plants comprising both cyv_3.1 (or a variant) and the zym gene can be used to make tetraploids. The cyv_3. (or a variant thereof) can be easily combined with the zym gene, as e.g. found in PI595203, by traditional breeding techniques and selecting recombinants, optionally with the assistance of markers described herein, comprising both cyv_3.1 and zym on chromosome 3. PI595203 is available at the USDA, ARS, National Genetic Resources Program, Germplasm Resources Information Network(GRIN).

[0181] Therefore, in one aspect a tetraploid watermelon plant (and seed from which the plant can be grown) is provided herein, comprising the CVYV-resistance conferring locus as found in NCIMB 42449 or NCIMB 42450 or NCIMB42666 or in PI189318 or other wild watermelons and optionally comprising the zym gene.

[0182] In one aspect the tetraploid watermelon plants (and seeds from which the plants can be grown) according to the invention are inbred lines, produced by selfing several times. In one aspect the plants are suitable as parent lines for triploid seed production, described below.

[0183] Seeds from which such tetraploid plants can be grown are encompassed herein. Also plant parts of the tetraploid plants according to the invention are encompassed herein, such as cells, pollen, flowers, fruits, leaves, stems, etc. Fruits are preferably marketable fruits. The brix is preferably at least 6.0, 7.0, 8.0 or least 9.0, preferably at least 10.0, more preferably at least 11.0 or more. Fruit color may be any color, such as red, dark red, scarlet red, coral red, orange, salmon, pink, pinkish red, yellow, canary yellow or white. Preferably the fruit flesh color is uniform.

[0184] In one aspect the tetraploid plant of the invention is a vegetative propagation.

[0185] The tetraploid plants may be selfed one or more time, but they may also be crossed to another tetraploid watermelon plant. If that other tetraploid watermelon plant lacks cyv_3.1, the F1 produced by the cross contains only two copies of cyv_3.1. If such a plant is crossed again with a tetraploid plant lacking cyv_3.1, progeny with only one copy of cyv_3.1 can be generated. Similarly if such a plant is selfed, progeny with one or three copies of cyv_3.1 can be generated. Thus, a tetraploid watermelon comprising 3, 2 or only 1 copy of cyv_3.1 are also encompassed herein.

[0186] Triploid Cultivated Watermelon Plants, and Plant Parts, Comprising cyv_3.1 (or a Variant Thereof)

[0187] In one aspect the CVYV-resistant tetraploid plant described above is used as female parent and is pollinated with pollen of a CVYV-resistant diploid male parent (also as described above) and the seeds from the cross are harvested. These seeds are triploid, i.e. they comprise three copies of the cyv_3.1 locus of the invention. Plants grown from these seeds are CVYV resistant and produce seedless watermelon fruits (triploid fruits). Optionally plants are also ZYMV resistant, i.e. comprise the zym gene.

[0188] Thus all aspects described above for the diploids and tetraploid plants of the invention apply to the triploid seeds and plants grown from such seeds. So for example, in one aspect the cyv_3.1 locus is the cyv_3.1 locus as found in seeds deposited under NCIMB 42449 or NCIMB 42450 or NCIMB 42666. But it may also be the cyv_3.1 gene as found in wild watermelons, such as PI189318 or others. In another aspect the introgression fragment (comprising the cyv_3.1 locus) as found in seeds deposited under NCIMB 42449 or NCIMB 42450 or NCIMB 42666 is encompassed herein, or a smaller fragment thereof, which smaller fragment retains the cyv_3.1 locus. But also other variants of cyv_3.1 are encompassed herein, e.g. from other wild watermelon accessions.

[0189] Seeds from which triploid CVYV-resistant plants can be grown are an embodiment herein, as are plant parts grown from such seeds, as well as seedless watermelon fruits produced by these plants.

[0190] Triploid, seedless fruits are preferably marketable. Preferably they have an average brix of at least 6.0, 7.0, 8.0 or preferably at least 9.0, preferably at least 10.0, more preferably at least 11.0.

[0191] Fruits may be of any size, shape, color and rind pattern. Preferably fruit flesh color at maturity is uniform. In one aspect fruit flesh is red or dark red.

[0192] The average fruit weight of a triploid hybrid comprising cyv_3.1 (or a variant thereof) in three copies may be equal to or above 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 kg. In another embodiment average fruit weight of a triploid hybrid comprising cyv_3.1 (or a variant thereof) in three copies may be equal to or less than 5 kg, e.g. 4, 3, 2, 1.5 or 1 kg or even less.

[0193] Seedless fruits may be of any shape (e.g. elongate, oval, blocky, spherical or round), fruit surface (furrow, smooth), flesh color (red, dark red, scarlet red, coral red, orange, salmon, pink, pinkish red, yellow, canary yellow or white), rind color (e.g. light green; dark green; green-striped with narrow, medium or wide stripes; grey types; with or without spotting; Golden yellow), rind thickness, rind toughness, rind pattern (e.g. striped, non-striped, netted), flesh structure/flesh firmness, lycopene and/or vitamin content, different sugar to acid ratios, fruit flavour, etc.

[0194] Thus, the CVYV-resistance conferring cyv_3.1 locus (or variant) may be used to breed a range of seedless varieties, producing fruits of different shapes and sizes, etc. by traditional breeding. See Guner and Wehner 2004, Hort Science 39(6): 1175-1182, in particular pages 1180-1181 describing genes for fruit characteristics. Generally important breeding objectives are early maturity, high fruit yield, high internal fruit quality (good uniform color, high sugar, proper sugar:acid ratio, good flavor, high vitamin and lycopene content, firm flesh texture, non-fibrous flesh texture, freedom from defects such as hollow heart, rind necrosis, blossom-end rot or cross stitch and good rind characteristics and cracking-resistance).

[0195] In one aspect the triploid plant of the invention is a vegetative propagation.

[0196] Vegetative Propagations and Cell or Tissue Cultures

[0197] The above diploid plants, tetraploid plants or triploid plants can also be reproduced vegetatively (clonally) and such vegetatively propagated plants, or vegetative propagations are an embodiment of the invention. They can easily be distinguished from other watermelon plants by one or more (or all) of the markers linked to cyv_3.1 (or a variant thereof) and/or phenotypically.

[0198] Vegetative propagations can be made by different methods. For example one or more scions of a plant of the invention may be grafted onto a different rootstock, e.g. a biotic or abiotic stress tolerant rootstock.

[0199] Other methods include in vitro cell or tissue culture methods and regeneration of vegetative propagations from such cultures. Such cell or tissue cultures comprise or consist of various cells or tissues. In one aspect such a cell or tissue culture comprises or consists of vegetative cells or vegetative tissues.

[0200] In another aspect a cell or tissue culture comprises or consists of reproductive cells or tissues, such as anthers or ovules. Such cultures can be treated with chromosome doubling agents to make e.g. double haploid plants, or they can alternatively be used to make haploid plants (e.g. to make diploids from a tetraploid or to make haploids from a diploid).

[0201] An in vitro cell or tissue culture may, thus, comprise or consist of cells or protoplasts or plant tissue from a plant part selected from the group consisting of: fruit, embryo, meristem, cotyledon, pollen, ovule, leaf, anther, root, root tip, pistil, flower, seed, stem. Also parts of any of these are included, such as e.g. only the seed coat (maternal tissue).

[0202] Thus, in one aspect of the invention a cell culture or a tissue culture of cells of a plant comprising one, two, three or four copies of cyv_3.1 (or a variant), all as described above, is provided. As mentioned, a cell culture or a tissue culture comprises cells or protoplasts or plant tissue from a plant part of a plant comprising cyv_3.1 may be comprise or consist of cells or tissues selected from the group consisting of: embryo, meristem, cotyledon, pollen, leaf, anther, root, root tip, pistil, flower, seed, stem; or parts of any of these.

[0203] Also provided is a watermelon plant regenerated from such a cell culture or tissue culture, wherein the regenerated plant (or progeny thereof, e.g. obtained after selfing the regenerated plant) comprises the cyv_3.1 locus (or a variant thereof). Therefore, in one aspect the watermelon plant comprising cyv_3.1 (or a variant thereof) in one or more copies is a vegetatively propagated watermelon plant.

[0204] In a different aspect the cells and tissues of the invention (and optionally also the cell or tissue culture), comprising cyv_3.1 (or a variant thereof) in one or more copies, are non-propagating cells or tissues.

[0205] Methods and Uses of QTL cyv_3.1 (or a Variant) and/or of Markers Linked to cyv_3.1 (or to a Variant Thereof)

[0206] The recessive cyv_3.1 locus of the invention (or a variant thereof), i.e. the introgression fragment comprising the locus, can be transferred into, or introduced into, any other cultivated watermelon plant, by e.g. making crosses with plants of the invention, e.g. plants grown from the deposited seeds, or with vegetatively propagated plants of the invention, or by identifying wild watermelon plants comprising the cyv_3.1 (or a variant thereof) and introgressing cyv_3.1 (or a variant thereof) from such a wild accession into cultivated watermelon as described herein.

[0207] For example wild accessions of watermelon can be screened with one or more markers linked to the cyv_3.1 locus (e.g. SNP_02 and/or SNP_03 and/or one or more other markers linked to cyv_3.1) to identify putative wild accessions comprising cyv_3.1 or a variant thereof. Such accessions can optionally or alternatively also be screened phenotypically in a CVYV resistance assay and/or they can be crossed with cultivated watermelon plants and descendants of the cross can be screened for the CVYV resistance marker genotype and/or CVYV-resistance phenotype. The skilled person can, therefore, identify the QTL cyv_3.1 or a variant thereof in other wild watermelon accessions, transfer it into cultivated watermelon onto chromosome 3, e.g. by backcrossing 4, 5, 6, 7 or more times to cultivated watermelon lines to generate diploid watermelon plants of the invention. These can then be used to generate tetraploids and triploids as described herein.

[0208] Thus, the CVYV resistance conferred by cyv_3.1, or a variant thereof, can be crossed into different genetic backgrounds of cultivated watermelon by e.g. using seed deposited herein as a source of cyv_3.1, as described elsewhere herein, or by identifying the cyv_3.1 (or a variant thereof) in wild watermelon accessions and (back)crossing it into cultivated watermelon.

[0209] The cyv_3.1 (or a variant) can be introduced into other watermelon plants lacking cyv_3.1 (or a variant) using known breeding methods. Known breeding methods can be used alone or in combination, such as (but not limited to) recurrent selection, pedigree breeding, backcross breeding, inbred development, hybrid testing, marker assisted breeding, etc. Progeny are then selected which retain cyv_3.1 (or a variant) using one or more of the markers provided herein and/or CVYV resistance (when no dominant WT allele is present). Thus, selection of progeny plants having cyv_3.1 (or a variant) can be done by phenotypic selection of CVYV resistance in plants selfed one or more times and by discarding plants which are CVYV susceptible. For example, if progeny which segregate for CVYV resistance are inoculated or planted in a CVYV infested area, CVYV resistant plants can be easily identified.

[0210] Thus, in one aspect a method of generating a diploid cultivated watermelon of the species Citrullus lanatus ssp. vulgaris is provided, wherein said plant comprises an introgression fragment from a wild watermelon plant on chromosome 3, whereby said introgression fragment comprises a CVYV-resistance conferring locus, is provided, comprising the steps of: Crossing a wild watermelon plant comprising a CVYV resistance-conferring locus on chromosome 3 with a diploid cultivated watermelon plant and selecting progeny of said cross which comprise a genome of cultivated watermelon and an introgression fragment on chromosome 3 from the wild watermelon plant, whereby said introgression fragment comprises the CVYV resistance conferring locus.

[0211] The presence of the CVYV resistance conferring locus in the wild watermelon plant and/or in the progeny may be determined phenotypically using a CVYV resistance assay and/or on a molecular level, by detecting the presence of one or more of the markers described herein linked to cyv_3.1 (or a variant), e.g. one or more markers selected from the group consisting of: [0212] a) a Guanine (G) at nucleotide 76 of SEQ ID NO: 2 (SNP_02) or of a sequence comprising at least 900/o, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2; and/or [0213] b) a Cytosine (C) at nucleotide 76 of SEQ ID NO: 3 (SNP_03) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3; and/or (optionally) [0214] c) a wild watermelon-genome-specific molecular marker within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP_02 or SNP_03.

[0215] The introgression fragment can also be transferred to other diploid cultivated watermelon plants, e.g. to combine CVYV resistance with other traits. Thus, in another aspect a method of generating a diploid cultivated watermelon of the species Citrullus lanatus ssp. vulgaris is provided, wherein said plant comprises an introgression fragment from a wild watermelon plant on chromosome 3, whereby said introgression fragment comprises a CVYV-resistance conferring locus, is provided, comprising the steps of:

[0216] Crossing a diploid cultivated watermelon plant comprising a CVYV resistance-conferring locus on chromosome 3 (as described above) with another diploid cultivated watermelon plant, especially a plant lacking a CVYV resistance conferring locus on chromosome 3, and selecting progeny of said cross (e.g. F1, F2, F3 or further selfing progeny or backcross progeny) which comprise a genome of cultivated watermelon and an introgression fragment on chromosome 3 from the wild watermelon plant, whereby said introgression fragment comprises the CVYV resistance conferring locus. The progeny may also be a result of one or more backcrosses optionally combined with one or more selfings, e.g. BC1, BC1S1, BC1S2, BC2, BC2S1, BC3, etc. Again, the presence of the introgression fragment in the progeny may be determined using one or more of the markers described and/or CVYV resistance assays.

[0217] Also a screening method for selecting or identifying watermelon seeds, plants or plant parts or DNA from such seeds, plants or plant parts comprising in their genome an introgression fragment on chromosome 3 comprising a CVYV-resistance conferring locus is provided, said method comprises: Screening watermelon seeds, plants or plant parts (e.g. cells) or DNA from such seeds, plants or plant parts for the presence of one or more markers described herein linked to cyv_3.1 (or a variant), e.g. one or more markers selected from the group consisting of: [0218] a) a Guanine (G) at nucleotide 76 of SEQ ID NO: 2 (SNP_02) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2; and/or [0219] b) a Cytosine (C) at nucleotide 76 of SEQ ID NO: 3 (SNP_03) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3; and/or [0220] c) a wild watermelon-genome-specific molecular marker within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP_02 or SNP_03.

[0221] The watermelon seeds, plants or plant parts may be haploid, doubled-haploid, diploid, triploid or tetraploid. Obviously, screening for the presence of one or more markers may involve screening (detection) of several copies of the marker, e.g. four copies of Guanine (G) of SNP_02 in a tetraploid. Likewise, alternatively or in addition, the screening for the absence of the WT (susceptible) SNP genotype is encompassed herein. So, when referring to a diploid plant, plant part or DNA comprising a Guanine (G) at nucleotide 76 of SEQ ID NO: 2 (SNP_02) or in a sequence comprising at least 90%/0, 91%, 92%/0, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2, the marker assay alternatively or in addition may detect the presence or absence of Adenine (A) at nucleotide 76 of SEQ ID NO: 2 (SNP_02) or of a sequence comprising at least 90%/0, 91%, 920/0, 93%, 94%, 95%, 96%, 97%, 98%/0 or 99% sequence identity to SEQ ID NO: 2.

[0222] Optionally the method further comprises selecting one or more seeds, plants or plant parts comprising the introgression fragment in one copy (e.g. for haploids or diploids), in two copies (e.g. for diploids or doubled-haploids), in three copies (e.g. for triploids) or in four copies (e.g. for tetraploids).

[0223] The molecular markers described herein may be detected according to standard method. For example SNP markers can easily be detected using a KASP-assay (see www.kpbioscience.co.uk) or other SNP genotyping assays. For developing a KASP-assay, for example 70 base pairs upstream and 70 base pairs downstream of the SNP can be selected and two allele-specific forward primers and one allele specific reverse primer can be designed. See e.g. Allen et al. 2011, Plant Biotechnology J. 9, 1086-1099, especially p 097-1098 for KASP assay method.

[0224] Thus, in one aspect, the SNP markers and the presence/absence of the marker associated with cyv_3.1 is determined using a KASP assay, but equally other SNP genotyping assays can be used. For example, a TaqMan SNP genotyping assay, a High Resolution Melting (HRM) assay, SNP-genotyping arrays (e.g. Fluidigm, Illumina, etc.) or DNA sequencing may equally be used.

[0225] In a different aspect a method of generating a tetraploid cultivated watermelon of the species Citrullus lanatus ssp. vulgaris is provided, wherein said plant comprises an introgression fragment from a wild watermelon plant on chromosome 3, whereby said introgression fragment comprises a CVYV-resistance conferring locus, comprising the steps of:

[0226] Doubling the chromosomes of a diploid cultivated watermelon or part thereof, said diploid being CVYV resistant due to the presence of an introgression fragment on chromosome 3 comprising a CVYV-resistance conferring locus in homozygous form, as described elsewhere, and identifying (or selecting) a tetraploid plant or plant part and optionally regenerating a whole plant therefrom.

[0227] The tetraploid plant is optionally further selfed one or more times to produce an inbred tetraploid line, comprising four copies of cyv_3.1 or a variant thereof.

[0228] See e.g. http://cuke.hort.ncsu.edu/cucurbitlwmelon/seedless.html for doubling the chromosome by colchicine treatment and tetraploid identification.

[0229] Again, the presence of the cyv_3.1 or variant thereof can be determined by detecting one or more or all of the linked markers.

[0230] A method for generating a tetraploid inbred plant having CVYV resistance is provided, comprising the steps of: [0231] a) providing a diploid inbred line comprising an introgression fragment from a wild watermelon plant on chromosome 3, said introgression fragment comprising a CVYV resistance conferring locus, in homozygous form, and [0232] b) doubling the chromosomes of said inbred line or plant part of the line to generate a tetraploid line or tetraploid plant part and regenerating a tetraploid plant of the line, and [0233] c) selfing the tetraploid line for several generations.

[0234] In step a) the diploid plant may be any diploid plant of the invention as described above, e.g. it may be a plant derived from seed deposited under NCIMB 42449 or NCIMB 42450 or NCIMB 42666, or progeny of any of these, or may be a diploid plant into which cyv_3.1 from seed deposit NCIMB 42449 or NCIMB42450 or NCIMB 42666 has been transferred by crossing. The diploid may also be new diploid plant generated by introgression cyv_3.1 or a variant thereof from a wild CVYV resistant watermelon into cultivated watermelon. The introgression may for example be from PI189318 or other wild watermelon accessions.

[0235] In yet another aspect, a method for generating triploid hybrid watermelon plants of the species Citrullus lanatus ssp. vulgaris is provided, comprising:

[0236] Crossing a tetraploid female parent line comprising four copies of cyv_3.1 (or a variant thereof) with a diploid male parent line comprising two copies of cyv_3.1 (or a variant thereof) and collecting seeds produced on the female parent line. Optionally the harvested seeds may be dried.

[0237] Pollination of the tetraploid female line may be by hand or by insects (e.g. bees) in isolation blocks. To ensure pollination of the tetraploid female flowers with pollen from the male diploid, different methods can be used, such as collecting male flowers by hand and hand-pollinating female flowers, followed by covering the pollinated flower. Alternatively, all male (staminate) flowers that develop on the tetraploid plants may be removed to ensure pollination of the pistillate flowers on the tetraploid plants with diploid pollen. When the fruits on the tetraploid plants are mature, they are harvested and the triploid F1 hybrid seeds (resulting from cross-pollination) are collected. These may then be sorted (e.g. by size), dried, optionally treated, and packaged for sale. Thus packages or containers comprising or consisting of seeds obtained by the above method are an embodiment herein.

[0238] In one embodiment a method for producing seedless triploid fruits is provided, comprising: [0239] a) interplanting triploid hybrid watermelon plants comprising three copies of cyv_3.1 or a variant thereof and diploid pollenizer plants, [0240] b) allowing pollination of the female flowers on the triploid hybrid plants to occur, and, optionally, [0241] c) harvesting the fruits from the triploid hybrid plants.

[0242] Thus, for seedless fruit production, the triploid CVYV resistant hybrid according to the invention may be interplanted with a suitable diploid pollenizer, such as for example Jenny or Polimax may be used, or Super-pollenizers (SP-1, SP-2, SP-3, SP-4, SP-5), Sidekick, Escort-4, Companion or others. Optionally, the pollenizer may be a dual purpose pollenizer as described in WO2012/069539 A1. The diploid pollenizer should produce sufficient pollen at the right time of the day and for an appropriate period of time to induce fruit set in triploid hybrids. The pollenizer plants may be hybrid diploids (F1 diploids) or open pollinated (OP) pollenizers. Fruit are then harvested from the triploid plants of the invention.

[0243] The triploid plants may be grafted onto different rootstocks. The method is preferably carried out in the open field. Interplanting in one field may be either done by seeding or transplants of the pollenizer and triploids. Various interplanting methods can be used, as known in the art and various ratios of pollenizer: triploid hybrid may be used. One row of pollenizer plants may for example be present at least every 2, at least every 3 or at least every 4 rows of triploids, but other methods of interplanting may also be used. Pollination is usually done by bees, and bee hives can be provided to the fields unless sufficient wild bees are naturally present. Pollination can also be performed by manual or mechanical means. Harvest at maturity may be done by hand or mechanized.

[0244] The triploid fruits, containing three copies of cyv_3.1 (or a variant thereof), are seedless. The fruits may be harvested for fresh consumption or for processing. Containers comprising or consisting of a plurality of such fruits or fruit parts are a further embodiment of the invention. The harvested fruits can, thus, be sorted, packaged in containers etc. Containers comprising or consisting of triploid fruits preferably comprise or consist of marketable fruits, comprising three copies of cyv_3.1 (or a variant) in their genome. Also containers comprising fruit parts and food or feed products comprising fruit parts are encompassed herein.

Uses According to the Invention

[0245] The use of cyv_3.1 (or a variant thereof) for generating CVYV-resistant cultivated watermelon plants, producing marketable fruits, is one aspect of the invention. Likewise the use of any of the markers linked to cyv_3.1 (or a variant thereof) in identifying and/or selecting plants or plant parts or progeny comprising or retaining cyv_3.1 (or a variant thereof) is encompassed.

[0246] In one aspect also the use of a diploid or doubled-haploid plant according to the invention as a male or female parent is provided, whereby the plant is crossed with another watermelon plant or is allowed to self-fertilize to produce progeny.

[0247] In one aspect the use of a tetraploid plant according to the invention as a male or female parent is provided, whereby the plant is crossed with another watermelon plant (e.g. with a diploid male parent) or is allowed to self-fertilize to produce progeny. Especially the use of a tetraploid as a female parent in hybrid triploid watermelon seed production (i.e. F1 seed production) is encompassed.

[0248] In another aspect the use of triploid plant according to the invention in triploid seedless fruit production is provided.

[0249] Seeds and Plant Parts and Progeny

[0250] It is understood that it is also an object of the invention to provide seeds from which the diploid, triploid or tetraploid plants described herein can be grown. Also seedlings, scions and rootstocks, as well as cells and tissues of the diploid, doubled-haploid, triploid or tetraploid plants of the invention are encompassed herein. Such plant parts comprise cyv_3.1 (or a variant) according to the invention. A plant part of the plant may e.g. be selected from a scion, fruit, pollen, ovule, stem, cotyledon, leaf, cell, embryo, meristem, anther, root, root tip, pistil, flower, and/or seed.

[0251] Also progeny of any of the plants according to the invention are provided herein, such as seeds obtainable by crossing a plant comprising cyv_3.1 (or a variant) described herein with another watermelon plant and/or by selfing a plant according to the invention to produce F1 seeds, and further generation progeny (F2, F3, etc.). The presence of cyv_3.1 (or a variant) in the progeny can be determined by CVYV resistance assays and/or markers analysis.

[0252] Watermelon plants obtained (derived), or obtainable (derivable), from plants according to the invention (e.g. from plants comprising cyv_3.1 or a variant thereof) include plants obtained by breeding methods, such as selfing, crossing, backcrossing, recurrent selection, double haploid production, marker assisted selection, clonal propagations, transformants, etc., whereby the derived plants comprise at least one recombinant chromosome 3 comprising cyv_3.1 (or a variant) according to the invention.

[0253] In one aspect a watermelon plant is provided, of which a representative number of seeds has been deposited under accession number NCIMB 42449 or NCIMB 42450 or NCIMB 42666, or progeny of any such plants, e.g. obtained by crossing and/or selfing. In one aspect a watermelon seed is provided, of which a representative number of seeds has been deposited under accession number NCIMB 42449 or NCIMB 42450 or NCIMB 42666. Also pollen, an ovule, cells, tissues, vegetative propagations obtained from these plants, or from the progeny thereof, are provided. In one aspect progeny retain the cyv_3.1 of the plants of which seeds were deposited under NCIMB 42449 or NCIMB 42450 NCIMB 42666. In one aspect progeny retain the introgression fragment on chromosome 3 (comprising cyv_3.1) of the plants of which seeds were deposited under NCIMB 42449 or NCIMB 42450 NCIMB 42666, or a smaller fragment of the introgression fragment, whereby the smaller fragment retains the CVYV resistance conferring locus (cyv_3.1).

[0254] Fine-Mapping, Sequencing and Allelism Tests

[0255] The cyv_3.1 locus was found in the region between about 2.50 Mb and about 12.8 Mb of chromosome 3, see FIG. 1. Fine-mapping can be carried out using methods known in the art to determine the exact position of the locus. For example recombinant lines can be generated comprising smaller parts of the introgressed region and CVYV assays can then be used to determine which fragment still confers resistance against CVYV (and thus retains the locus). Alternatively the region can also be sequenced to identify candidate resistance genes. Using such methods or similar methods markers more closely linked to the cyv_3.1 locus (or variant) can be identified, e.g. wild watermelon-genome-specific molecular marker linked to cyv_3.1 (or a variant) can be identified, within a physical distance of 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP_02 or SNP_03.

[0256] Similarly, any CVYV resistant wild watermelon accessions, e.g. PI189318 or others, can be crossed with cultivated CVYV susceptible watermelon to generate a new mapping population and to determine whether the CVYV resistance is conferred by cyv_3.1 or a variant thereof, i.e. if a CVYV resistance QTL is mapped to the same region of chromosome 3, the wild accession clearly contains the cyv_3.1 locus or a variant thereof.

[0257] If two watermelon plants both have CVYV resistance and it is not clear if the resistance is caused by the same QTL, different methods can be used to verify whether the same locus (i.e. cyv_3.1 or a variant) is involved. As mentioned, marker tests and/or sequencing and/or QTL mapping or fine-mapping can be used to determine whether a resistance-conferring introgression fragment from a wild watermelon is present in the region of chromosome 3. Alternatively or in addition an allelism test can be carried out, i.e. the two plants can be crossed and segregation of the phenotype (CVYV resistance) in progeny plants can be analysed.

[0258] The following non-limiting Examples describe plants comprising cyv_3.1 according to the invention.

[0259] Unless stated otherwise in the Examples, methods for conventional watermelon breeding are used, such as e.g. described in Maynard 2001, WatermelonsCharacteristics, Production and Marketing, ASHS Press; Mohr H. C. Watermelon Breeding in Mark J. Bassett (editor) 1986 Breeding Vegetable Crops, AVI Publishing Company.

DEPOSIT INFORMATION

[0260] Nunhems B.V. has deposited seeds of a diploid cultivated watermelon line, comprising cyv_3.1 in homozygous form and producing fruits with a Crimson Sweet type rind under accession number NCIMB 42449 and seeds of a diploid cultivated watermelon line, comprising cyv_3.1 in homozygous form and producing fruits with a Jubilee type rind under accession number NCIMB 42450. The seeds were deposited by Nunhems B.V. on 18 Aug. 2015 at the NCIMB Ltd., Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, UK. Access to the deposits will be available during the pendency of this application to persons determined by the Commissioner of Patent and Trademarks to be entitled thereto upon request.

[0261] Nunhems B.V. has deposited seeds of a diploid cultivated watermelon elite line, comprising cyv_3.1 in homozygous form and producing red fleshed fruits under accession number NCIMB42666. The seeds were deposited by Nunhems B.V. on 26 Sep. 2016 at the NCIMB Ltd., Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, UK.

[0262] All seed deposits were made under the Budapest Treaty and making use of the Expert solution.

[0263] Subject to 37 C.F.R. ? 1.808(b), all restrictions imposed by the depositor on the availability to the public of one or more deposits will be irrevocably removed upon the granting of the patent by affording access to the deposits. The deposits will be maintained for a period of 30 years, or 5 years after the most recent request, or for the enforceable life of the patent whichever is longer, and will be replaced if it ever becomes nonviable during that period. Applicant does not waive any rights granted under this patent on this application or under the Plant Variety Protection Act (7 USC 2321 et seq.).

EXAMPLES

Example 1: CVYV ResistanceQTL Mapping

[0264] Two F2 mapping populations were generated from crosses between wild watermelon accession and a CVYV susceptible inbred proprietary line. The populations were genotyped with >3000 SNPs.

[0265] Phenotyping of F3 lines was performed using a CVYV assay in climate cells in Italy. The first true expanded leaf (15 to 20 days after sowing) was inoculated by hand, with a second inoculation 4-5 days after the first one. Control plants were inoculated with buffer only.

[0266] A total of 14 plants per genotype was inoculated with inoculum containing CVYV (Almeria type strain), in two replicates and including Sugar Baby as susceptible control. A randomized block design was used. CVYV was maintained in frozen infected leaf tissue. To prepare inoculum pre-multiplication of the virus was carried out on susceptible cucumber variety Sheila. Fresh, young, symptomatic leaves of variety Sheila were then used to prepare the inoculum (1 gram fresh leaf per 5 ml 0.03M phosphate buffer, with active carbon and diatomaceous earth were crushed with a pestle and mortar on a bed of ice).

[0267] Inoculated plants were incubated with 12-14 hours light, day temperature 25 degrees Celsius and night temperatures 18 degrees Celsius. Leaves were scored for CVYV symptoms at regular intervals (e.g. 20 days post inoculation (dpi), 35 dpi, 50 dpi, 65 dpi). The susceptible control, Sugar Baby, must be severely symptomatic after 30 dpi. Individual plants were scored in three classes: a) susceptible-presence of symptoms on the leaves, b) resistantno symptoms on the leaves, c) doubtful. At least 90% of the plants of a line had to be scored as resistant for the line to be considered resistant.

[0268] QTL mapping revealed a major QTL for CVYV resistance on chromosome 3 in both mapping populations, which was named cyv_3.1.

[0269] To better localize the QTL more SNP markers were identified in the confidence interval. Three markers closely linked to the QTL were identified, see Table 1 (supra), termed SNP_01, SNP_02 and SNP_03.

TABLE-US-00005 TABLE 3 SNP Chromosome Base position on chromosome 3 SNP_01 Chr_03 7,586,752 SNP_02 Chr_03 7,664,093 SNP_03 Chr_03 7,693,225

Example 2: Backcrossing of cyv_3.1 into Elite Lines

[0270] Using marker assisted backcrossing, cyv_3.1 was backcrossed (4 to 6 backcrosses) into several elite lines and seeds of two elite lines were deposited under accession numbers NCIMB 42449 and NCIMB 42450.

[0271] Plants of NCIMB 42449 and NCIMB 42450, and selfing progeny thereof, were evaluated (phenotyped) for resistance against CVYV in two consecutive years in climate cells in Murcia, in the same way as described in Example 1.

[0272] Results are shown in Table 4 below:

TABLE-US-00006 First Second evaluation evaluation Nr. of (% of plants (% of plants Plant line Repetition plants resistant) resistant) 2014 phenotyping: NCIMB42449 1 10 100 100 NCIMB42449 2 10 100 100 NCIMB42449 3 10 100 100 NCIMB42450 1 10 80 80 NCIMB42450 2 10 100 100 Susceptible line 1 10 0 0 Susceptible line 2 10 30 20 Susceptible line 1 10 40 0 Susceptible line 2 10 50 20 Susceptible line 3 10 40 10 Sugar Baby (control) Multiple 50 22 0 2015 phenotyping: Progeny of 1 14 100 100 NCIMB42449 Progeny of 2 13 100 100 NCIMB42449 Progeny of 3 14 100 100 NCIMB42449 Progeny of 4 15 100 100 NCIMB42449 Progeny of 1 15 100 100 NCIMB42450 Progeny of 2 15 100 100 NCIMB42450 Progeny of 3 14 100 100 NCIMB42450 Progeny of 4 14 100 100 NCIMB42450 Progeny of 5 14 100 100 NCIMB42450 Sugar Baby (control) Multiple 35 27 0

Example 3: Marker Validation

[0273] Validation of these markers over a collection of different watermelon material yielded the discovery of two haplotypes for CVYV resistance, whereby SNP_01 could distinguish the haplotypes. All commercial hybrids tested had the same genotype as Sugar Baby and were all CVYV susceptible.

TABLE-US-00007 TABLE 5 SNP_01 SNP_02 SNP_03 CVYV resistance Inbred line - GG GG CC Resistant NCIMB 42666 Inbred line - AA GG CC Resistant NCIMB 42449 Inbred line - AA GG CC Resistant NCIMB42450 SUGAR BABY GG AA TT Susceptible

Example 4: ZYMV Resistance is an Independent Locus on Chromosome 3

[0274] As from the literature it was known that ZYMV resistance is also located on chromosome 3, the inventors wanted to know if the CVYV resistant plants were also ZYMV resistant. They inoculated NCIMB 42449 and NCIMB 42450 with either the European or the US strain of ZYMV. They also re-analyzed the SNP marker data for the SNP published to be linked to the zym gene, referred to as SNP_04 herein.

TABLE-US-00008 TABLE 6 CVYV ZYMV SNP_01 SNP_02 SNP_03 SNP_04 resistance resistance Inbred line - GG GG CC GG Resistant Resistant not deposited Inbred line - AA GG CC TT Resistant Susceptible NCIMB 42449 Inbred line - AA GG CC TT Resistant Susceptible NCIMB42450 SUGAR BABY GG AA TT TT Susceptible Susceptible

[0275] The results showed that cyv_3.1 and zym are independent loci on chromosome 3 and that SNP_04 can be used to differentiate between ZYMV resistant and susceptible plants.

Example 5: Tetraploid Lines

[0276] NCIMB 42449 and NCIMB 42450 were both used to generate CVYV resistant tetraploid lines using colchicine treatment. For NCIMB 42449 five putative tetraploid lines were made, while for NCIMB 42450 ten putative tetraploid lines were made.

Example 6: Screening of Wild Watermelon Accessions

[0277] Progeny of wild, diploid, watermelon accessions originating e.g. from the US GRIN collection were screened for CVYV resistance and for their SNP genotype for SNP_01, SNP_02 and SNP_03.

[0278] One line, derived from PI189318 was found to have the following SNP genotype and the following resistance phenotype:

TABLE-US-00009 TABLE 7 SNP_01 SNP_02 SNP_03 CVYV resistance PI189318 GG GG CC Resistant

[0279] This wild watermelon can, therefore, be used to introgress cyv_3.1 into cultivated watermelon, e.g. by backcrossing.

[0280] Optionally an allelism test can be carried out, by crossing PI189318 with plants grown from seeds deposited herein to confirm that PI189318 contains the cyv_3.1 gene.