Isolation and characterization of a novel pythium omega 3 desaturase with specificity to all omega 6 fatty acids longer than 18 carbon chains

Abstract

The present invention relates to a polynucleotide encoding an omega 3 (?-3) desaturase from Pythium irregulare with specificity to long chain polyunsaturated omega 6 (?-6) fatty acids as well as a vector containing the polynucleotide, and a host cell containing the vector or the polynucleotide. Moreover, the present invention pertains to a polypeptide encoded by the polynucleotide, antibodies against the polypeptide as well as a method for the manufacture of the polypeptide. Further, encompassed by the present invention are transgenic non-human organisms. Finally, the present invention relates to methods for the manufacture of compounds and oil-fatty acid-, or lipid-containing compositions.

Claims

1. A method for the manufacture of a composition comprising a compound having a structure of the general formula I: ##STR00005## wherein R.sup.1=hydroxyl, coenzyme A (thioester), lysophosphatidylcholine, lysophosphatidylethanolamine, lysopho sphatidylglycerol, lysodipho sphatidylglycerol, lysopho sphatidylserine, lysophosphatidylinositol, sphingo base or a radical of the formula II: ##STR00006## R.sup.2=hydrogen, lysophosphatidylcholine, lysophosphatidylethanolamine, lysopho sphatidylglycerol, lysodipho sphatidylglycerol, lysopho sphatidylserine, lysophosphatidylinositol or saturated or unsaturated C.sub.2-C.sub.24-alkylcarbonyl, R.sup.3=hydrogen, saturated or unsaturated C.sub.2-C.sub.24-alkylcarbonyl, or R.sup.2 and R.sup.3 independently of each other are a radical of the formula Ia: ##STR00007## n=2, 3, 4, 5, 6, 7 or 9, m=2, 3, 4, 5 or 6 and p=0 or 3; and wherein said method comprises cultivating a host cell or a transgenic non-human organism comprising a polynucleotide comprising a heterologous nucleic acid sequence selected from the group consisting of: (i) the nucleic acid sequence of SEQ ID NO: 1 or 23; (ii) a nucleic acid sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 24; and (iii) a nucleic acid sequence encoding a polypeptide having omega-3 desaturase activity capable of converting omega-6 DPA into DHA, wherein said polypeptide has at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 2 or 24, under conditions which allow biosynthesis of said compound.

2. The method of claim 1, further comprising formulating the composition into an oil-, fatty acid-, or lipid-containing composition.

3. The method of claim 1, wherein said host cell or transgenic non-human organism additionally comprises at least one further enzyme being involved in the biosynthesis of fatty acids or lipids.

4. The method of claim 1, wherein said host cell is an animal cell, a plant cell or a microorganism cell.

5. The method of claim 1, wherein said transgenic non-human organism is an animal, a microorganism, or a plant.

6. The method of claim 1, wherein said nucleic acid sequence encodes a polypeptide having at least one polypeptide pattern selected from the group consisting of SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 37, 38, 39, 40, 41, 42, 43, 44, and 45.

7. The method of claim 2, wherein the oil-, fatty acid-, or lipid-containing composition comprises at least 0.5%, 1%, 2%, 3%, 4% or 5% of ?-3 eicostetraenic acid (ETA), eicosapentaenoic acid (EPA) and/or docosahexaenoic acid (DHA), based on the total fatty acid content of the host cell or transgenic non-human organism.

8. The method of claim 2, wherein said oil-, fatty acid-, or lipid-containing composition is further formulated as a pharmaceutical composition, a cosmetic composition, a foodstuff, a feedstuff, a fish feed or a dietary supply.

9. The method of claim 3, wherein said further enzyme is selected from the group consisting of: acyl-CoA dehydrogenase(s), acyl-ACP [=acyl carrier protein] desaturase(s), acyl-ACP thioesterase(s), fatty acid acyltransferase(s), acyl-CoA:lysophospholipid acyltransferase(s), fatty acid synthase(s), fatty acid hydroxylase(s), acetyl-coenzyme A carboxylase(s), acyl-coenzyme A oxidase(s), fatty acid desaturase(s), fatty acid acetylenase(s), lipoxygenase(s), triacylglycerol lipase(s), allenoxide synthase(s), hydroperoxide lyase(s) or fatty acid elongase(s), acyl-CoA:lysophospholipid acyltransferase, ?4-desaturase, ?5-desaturase, ?6-desaturase, ?8-desaturase, ?9-desaturase, ?12-desaturase, ?5-elongase, ?6-elongase and ?9-elongase.

10. The method of claim 5, wherein the plant is an oil crop.

11. The method of claim 5, further comprising at least one of the following steps: a) harvesting the plant or a plant part thereof from the field; b) disrupting the plant or plant part by comminuting, steaming or roasting; c) pressing or extracting the plant or plant part; d) cold-beating or cold-pressing of the plant or plant part, without applying heat by pressing to obtain the oils, fats, lipids and/or free fatty acids; e) pressing or extracting the plant or plant part with a solvent and subsequently removing the solvent; f) removing substances such as plant mucilages and suspended matter; g) desliming which is effected enzymatically or chemico-physically by addition of acid; h) removing free fatty acids by treatment with a base solution; i) washing resulting product thoroughly with water to remove alkali remaining in the product followed by drying; j) removing pigment remaining in the product by bleaching; k) deodorizing the product; or l) a combination of one or more of steps a) to k).

12. The method of claim 5, wherein the plant is an intact plant or a plant part.

13. The method of claim 9, wherein the oil crop is selected from the group consisting of oilseed rape, evening primrose, hemp, thistle, peanut, canola, linseed, soybean, safflower, sunflower, borage, maize, wheat, rye, oats, triticale, rice, barley, cotton, cassava, pepper, Tagetes, Solanaceae plants, potato, tobacco, eggplant, tomato, Vicia species, pea, alfalfa, bushy plants, coffee, cacao, tea, Salix species, trees, oil palm, coconut, perennial grasses and fodder crops.

14. The method of claim 12, wherein the plant part is selected from the group consisting of leaf, stem, seed, root, tubers, anthers, fibers, root hairs, stalks, embryos, calli, cotelydons, petioles, harvested material and plant tissue.

15. A method for the manufacture of polyunsaturated fatty acids in a plant, plant part or plant cell, comprising: a) transforming a plant, plant part or plant cell with a polynucleotide comprising a heterologous nucleic acid sequence selected from the group consisting of: (i) the nucleic acid sequence of SEQ ID NO: 1 or 23; (ii) a nucleic acid sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 24; and (iii) a nucleic acid sequence encoding a polypeptide having omega-3 desaturase activity capable of converting omega-6 DPA into DHA, wherein said polypeptide has at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 2 or 24; b) cultivating the plant, plant part or plant cell under conditions which allow biosynthesis of polyunsaturated fatty acids and harvesting said plant, plant part or plant cell; and c) isolating the polyunsaturated fatty acids from the plant, plant part or plant cell in form of an oil, lipid or free fatty acids.

16. A method for the manufacture of triacylglycerides in a plant, plant part or plant cell, comprising: a) transforming a plant, plant part or plant cell with a polynucleotide comprising a heterologous nucleic acid sequence selected from the group consisting of: (i) the nucleic acid sequence of SEQ ID NO: 1 or 23; (ii) a nucleic acid sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 24; and (iii) a nucleic acid sequence encoding a polypeptide having omega-3 desaturase activity capable of converting omega-6 DPA into DHA, wherein said polypeptide has at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 2 or 24; b) cultivating the plant, plant part or plant cell under conditions which allow biosynthesis of triacylglycerides and harvesting said plant, plant part or plant cell; and c) isolating the triacylglycerides from the plant, plant part or plant cell, wherein the triacylglycerides comprise polyunsaturated fatty acids.

17. The method of claim 15, further comprising formulating the polyunsaturated fatty acids in form of free fatty acids into an oil-, fatty acid-, or lipid-containing composition.

18. The method of claim 16, further comprising formulating the triacylglycerides into an oil-, fatty acid-, or lipid-containing composition.

19. The method of claim 15, wherein said nucleic acid sequence encodes a polypeptide having at least one polypeptide pattern selected from the group consisting of SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 37, 38, 39, 40, 41, 42, 43, 44, and 45.

20. The method of claim 16, wherein said nucleic acid sequence encodes a polypeptide having at least one polypeptide pattern selected from the group consisting of SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 37, 38, 39, 40, 41, 42, 43, 44, and 45.

21. The method of claim 17, wherein said oil-, fatty acid-, or lipid-containing composition is further formulated as a pharmaceutical composition, a cosmetic composition, a foodstuff, a feedstuff, a fish feed or a dietary supply.

22. The method of claim 18, wherein said oil-, fatty acid-, or lipid-containing composition is further formulated as a pharmaceutical composition, a cosmetic composition, a foodstuff, a feedstuff, a fish feed or a dietary supply.

Description

(1) The figures show:

(2) FIG. 1: The figure shows a comparison of the DNA sequences for the two ?-3 desaturase polynucleotides from Pythium irrgulare (SEQ ID NO: 1 and 23).

(3) FIG. 2: The figure shows an alignment of the deduced amino acids for the two ?-3 desaturase polynucleotides from Pythium irrgulare (SEQ ID NO: 2 and 24).

(4) FIG. 3: A comparison of the deduced amino acids for the ?-3 desaturase polypeptides from Pythium irrgulare (SEQ ID NO: 2), Phytophthora infestans (SEQ ID NO: 12) and Saprolegnia declina (SEQ ID NO: 31) is shown.

(5) FIG. 4: GC analysis of fatty acid methyl esters from the yeast transformant pYES2-O3 and the control pYES2 fed with GDLA.

(6) FIG. 5: GC analysis of fatty acid methyl esters from the yeast transformant pYES2-O3 and the control pYES2 fed with ARA.

(7) FIG. 6: GC analysis of fatty acid methyl esters from the yeast transformant pYES2-O3 and the control pYES2 fed with DPA (?-6).

(8) The following Examples shall merely illustrate the invention. They shall not be construed, whatsoever, to limit the scope of the invention.

Example 1: Isolation of Novel ?-3 Desaturase Polynucleotides from Pythium irregulare

(9) ?-3 desaturases are the enzymes which are able to convert ?-6 fatty acids into their corresponding ?-3 PUFAs. In order to isolate polynucleotides encoding said enzymes, Pythium irregulare strain 10951 was ordered from ATCC. It was grown in liquid media YETG at room temperature for 5 days with constant agitation at 250 rpm. Total RNA was isolated from the harvested mycelia using TRIzol reagent (Invitrogen). The cDNA was synthesized using the Superscript III first strand kit (Invitrogen). Two pairs of degenerate primers were designed based on the conserved domains of omega-3 desaturase genes. RT-PCR was conducted to amplify the ?-3 fragments using the Pythium cDNA as the template by

(10) TABLE-US-00001 (forwardprimer;SEQIDNO:46) TTYTGGGGNTTYTTYACNGT and (reverseprimer;SEQIDNO:47) CCYTTNACYTANGTCCACT.

(11) A 500 base-pair (bp) fragment was amplified and cloned into pCR4-TOPO vector (Invitrogen). A blast search from the sequence of the 500 bp fragment confirmed that it was an omega-3 desaturase gene from Pythium irregulare.

(12) Based on the sequence of the ?-3 desaturase fragment from Pythium irregulare, two pairs of race primers and one pair of nested PCR primers were designed

(13) TABLE-US-00002 SEQIDNO:48 (TCGCGCTCGCATGTGCTCAACTTCAG,RACE-F1,; SEQIDNO:49 TGGTGAC-CACGAGCATCGTGGCGAAG,RACE-R1,; SEQIDNO:50 TCCTCAC-GCCGTTCGAGTCCTGGAAG,RACE-F1,; SEQIDNO:51) ATGGTCGTGAA-GCCCAAGACGAAGGTC,RACE-R2,.

(14) A Marathon RACE cDNA library (BD Biosciences) was made using the messenger RNA isolated from total RNA from Pythium irregulare. PCR reactions for 3 and 5 races were applied to amplify a 800 bp and a 1000 bp fragments, respectively, from 3 and 5 RACE. These fragments were cloned into pCR4-TOPO vector (Invitrogen). Four positive clones from each race were sequenced and there are some variations among them. Therefore Pythium irregulare may have more than one ?-3 desaturase genes.

(15) The assembled ?-3 desaturase gene contains a 1092 bp of open reading frame. Based the assembled ?-3 desaturase gene, one pair of primers

(16) TABLE-US-00003 SEQIDNO:52 (TCCGCTCGCCATGGCGTCCAC,O3-Yes1, and SEQIDNO:53) TGACCGATCAC-TTAGCTGCAGCTTA,O3-Yes2,
was designed to amplify the full length of 03 genes (?-3 desaturase genes) from Pythium. The full length O3 from Pythium was cloned into yeast expression vector pYES2.1/V5-His-TOPO. Eight of full length clones were sequenced. Six of them are identical. This gene was designated as O3-Pythiym1. Two of other ones are identical, which was designated as O3-Pythgium2. Two genes are 99% identical (FIG. 1) and they only have one amino acid different (FIG. 2). The O3 desaturase protein from Pythium is 69% and 60% identical to ?-3 desaturase from P. infestans (WO 2005/083053) and ?-3 desaturase gene from Saprolegnia diclina (WO 2004/071467) (FIG. 3), respectively. It has low identities to delta-12 and delta-15 desaturase genes.

Example 2: Characterization of Novel ?-3 Desaturases from Pythium irregulare

(17) The plasmids containing the full length O3 genes in the yeast expression vector pYES2.1/V5-His-TOPO were transformed into yeast S. cerevisiae. The positive transformants were selected for uracil auxotrophy on DOB-U agar plates. To characterize the ?-3 desaturase enzyme activity, positive clones and the control (yeast with pYES2.1 vector) were cultured overnight in DOB-U liquid medium at 28? C. and then grown in induction medium (DOB-U+Gal+Raf) containing 100 ?M of various exogenously supplied fatty acid substrates at 16? C. for 4 days. The whole yeast cells expressing Pythium ?-3 genes were harvested by centrifugation and washed twice with distilled water. Then the yeast cells were directly transmethylated with methanolic HCl (3N) at 80? C. for 1 hour. The resultant methyl esters were extracted with hexane and analyzed by gas chromatography (GC). GC was carried out as described in WO 2005/083053.

(18) The expression results showed that ?-3 desaturase from Pythium is not able to desaturase the 18-carbon ?-6 fatty acids, such as LA and GLA. It desaturates the ?-6 fatty acids longer than 18-carbon chains, such as DGLA (FIG. 4), ARA (FIG. 5) and DPA (FIG. 6). However, it is more specific to ARA with over 40% conversion rate (Table 1).

(19) TABLE-US-00004 TABLE 1 Production of ?-3 fatty acids from exogenous ?-6 fatty acids in the yeast transformant (pYES2-O3) and the control yeast pYES2 Substrate Substrate (%) Product Product (%) Conversion (%) pYES2 LA 24.50 ALA 0 GLA 21.97 SDA 0 DGLA 15.79 ETA 0 ARA 6.45 EPA 0 DPA 8.26 DHA 0.03 pYES2-O3 LA 25.56 ALA 0 0 GLA 22.79 SDA 0 0 DGLA 17.78 ETA 1.90 9.65% ARA 7.19 EPA 4.95 40.77% DPA 9.52 DHA 0.20 2.01%

(20) In summary, two ?-3 desaturase isoforms were isolated from Pythium irregulare and both are able to introduce an ?-3 double bond into ?-6 fatty acids longer than 18 carbon chains supplied exogenously in yeast. Moreover, this is apparently the first ?-3 desaturase that is able to convert the ?-6 DPA into DHA.