Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure

10113165 ยท 2018-10-30

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to oligonucleotides for inducing skipping of exon 53 of the dystrophin gene. The invention also relates to methods of inducing exon 53 skipping using the oligonucleotides.

Claims

1. A method for inducing the skipping of exon 53 of the human dystrophin pre-mRNA in a subject with Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD), or a cell derived from the subject, said method comprising providing to said subject or said cell, an antisense oligonucleotide of 18 nucleotides consisting of the base sequence of the sequence CUGUUGCCUCCGGUUCUG (SEQ ID NO: 29), wherein said oligonucleotide induces exon 53 skipping in the human dystrophin pre-mRNA in the subject or a cell derived from the subject, said oligonucleotide comprising a modification selected from the group consisting of: 2-O-methyl, 2-O-methylphosphorothioate, a morpholine ring, a phosphorodiamidate linkage, a peptide nucleic acid and a locked nucleic acid.

2. A method for treating Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD) in a subject by inducing the skipping of exon 53 of the human dystrophin pre-mRNA, said method comprising providing to the subject an antisense oligonucleotide of 18 nucleotides consisting of the base sequence of the sequence CUGUUGCCUCCGGUUCUG (SEQ ID NO: 29), wherein said oligonucleotide induces exon 53 skipping in the human dystrophin pre-mRNA of the subject, said oligonucleotide comprising a modification selected from the group consisting of: 2-O-methyl, 2-O-methylphosphorothioate, a morpholine ring, a phosphorodiamidate linkage, a peptide nucleic acid and a locked nucleic acid.

3. The method of claim 1, wherein the cell is a muscle cell.

4. The method of claim 1, wherein each internucleoside linkage of the oligonucleotide is a phosphorothioate linkage.

5. The method of claim 4, wherein the oligonucleotide is a 2-O-methyl phosphorothioate oligonucleotide.

6. The method of claim 1, wherein the oligonucleotide comprises a phosphorodiamidate internucleoside linkage.

7. The method of claim 6, wherein each internucleoside linkage of the oligonucleotide is a phosphorodiamidate internucleoside linkage.

8. The method of claim 7, wherein the oligonucleotide is a morpholino phosphorodiamidate oligonucleotide.

9. The method of claim 1, wherein the bases of said oligonucleotide consist of DNA bases or RNA bases.

10. The method of claim 1, wherein the oligonucleotide induces exon 53 skipping in the human dystrophin pre-mRNA and dystrophin expression in the muscle cell upon transfection of human muscle cells with at least 100 nM of said oligonucleotide and incubation for at least 16 hours.

11. The method of claim 10, wherein exon 53 skipping is detected by RT-PCR and/or sequence analysis.

12. The method of claim 10, wherein dystrophin expression in the muscle cell is detected by immunohistochemical and/or western blot analysis.

13. The method of claim 1, said oligonucleotide consisting of RNA.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1A-1F show RT-PCR and sequence analysis of dystrophin mRNA fragments of the AON-treated DMD patient myotube cultures (patient DL 515.2 (1A); patient DL363.2 (1B); patient 50685.1 (1C); patient DL 589.2 (1D); patient 53914.1 (1E); patient 50423.1 (1F)), focusing on the regions encompassing the exons targeted for skipping. Shorter novel transcripts were observed when compared to the untransfected myotube cultures (NT). Sequence analysis confirmed the precise skipping of the targeted exons. An alternatively spliced product, detected for patient 50685.1 (1C) was sequenced and found to be derived from activation of a cryptic splice site in exon 51. Shorter fragments, detected in untransfected myotube cultures from DL 363.2 (1B), DL 589.2 (1D) and 53914,1 (1E), were sequenced and found to be the result of the spontaneous skipping of exons 44, 50 and 53, respectively. Note that in some analyses, additional fragments, slightly shorter than the wild-type products, were present. This was due to heteroduplex formation. 100 bp: size marker, -RT-PCR: negative control.

(2) FIGS. 2A-2F illustrate immuno-histochemical analysis of the AON-treated myotube cultures from the six different DMD patients (patient DL 515.2 (2A); patient DL363.2 (2B); patient 50685.1 (2C); patient DL 589.2 (2D); patient 53914.1 (2E); patient 50423.1 (2F)). Cells were stained for myosin to identify fully differentiated myotubes (not shown). Monoclonal antibodies MANDYS 1 (middle panel) and Dys2 (right panel) were used to detect dystrophin one to four days post-transfection. No dystrophin signals could be detected in untreated cells stained with MANDYS 1 (left panel) nor Dys2 (not shown), whereas clear, mainly cytoplasmic dystrophin signals could be detected for each patient upon the induced exon skipping. In patients DL 363.2 (2B), DL 589.2 (2D) and 53914.1 (2E), dystrophin membrane signals could be observed. Note that membrane signals were more often found for Dys2, which recognizes the full-length dystrophin. MANDYS 1 recognizes an internal part of dystrophin and is more prone to generate cytoplasmic signals, since it also detects dystrophin in the first stages of synthesis. Magnification 63.

(3) FIGS. 3A-3F are Western blot analyses of the AON-treated myotube cultures from six different patients (patient DL 515.2 (3A); patient DL363.2 (3B); patient 53914.1 (3C); patient 50685.1 (3D); patient DL 589.2(3E); patient 50423.1 (3F)). Monoclonal antibody DY4 was used to detect dystrophin. Protein extracts isolated from human control myotube cultures (HC) were used as a positive control (3C and 3F). To avoid over-exposure, this sample was 1 to 10 diluted. To demonstrate equal loading of protein samples, blots were additionally stained with an antibody against myosin. No, or, as a result of spontaneous exon skipping, very low (3E and 3C) levels of dystrophin were detected in non-transfected Myotube cultures (NT). Clear dystrophin signals were observed in AON-treated myotube cultures for each of the patients. For 50685.1 and DL 363.2, a time-course experiment was performed. Dystrophin could be detected 16 hours post-transfection and was found at increasing levels at 24 hours and 48 hours post-transfection for 50685.1 (3D). For DL 363.2, dystrophin could be detected in increasing levels up to seven days post-transfection (3B). For patients DL 515.2 (3A), DL 363.2 (3B) and DL 589.2 (3E), the detected dystrophin was significantly shorter than the control dystrophin. This is due to the size of the deletions in these patients.

(4) FIGS. 4A-4B show immuno-histochemical analysis of four DGC proteins from treated myotube cultures from patient DL 363.2. Cells were stained for myosin to identify sufficiently differentiated myotubes (not shown). Monoclonal antibodies NCL-a-SARC, NCL-b-SARC, NCL-g-SARC and NCL-b-DG were used to detect -sarcoglycan, -sarcoglycan, -sarcoglycan and -dystroglycan, respectively. These proteins were detected in reduced percentages C40%) in untreated myotubes, and were mainly located in the cytoplasm (4A). Following AON treatment, however, -sarcoglycan was detected in 70%, -sarcoglycan was detected in 90%, -sarcoglycan was detected in 90% and -dystroglycan was detected in 80% of the myotubes, and the proteins were mostly membrane-bound (4B), Magnification 63.

(5) FIGS. 5A-5I are RT-PCR analyses of human dystrophin mRNA in the regions encompassing the exons targeted for skipping. Exon skipping was assessed using AONs directed to exon 2 (5A and 5B), exon 29 (5C), exon 40, 41 or 42 (5D), exon 43, 44 or 45 (5E), exon 46 (5F), exon 47, 48, 49 or 50 (5G), exon 51 (5H) and exon 53 (5I). Shorter novel transcript fragments were observed following transfection with the different AONs when compared to non-transfected myotube cultures (NT). Sequence analysis (not shown) confirmed the skipping of the targeted exons, as indicated by the labels adjacent to the images. Alternatively spliced products, detected in the regions around exon 2 (b), exon 29 (c), and exon 51 (h), were sequenced and found to be derived from either co-skipping of adjacent exons or usage of a cryptic splice site. No specific (RT-) PCR products were obtained. In some analyses, additional fragments, lightly shorter than the wild-type products, were present. This was due to heteroduplex formation.

(6) FIG. 6 illustrates double-exon skipping in DMD patient DL90.3 carrying a nonsense mutation in the out-of-frame exon 43. RT-PCR analysis of dystrophin mRNA fragments of AON-treated myotubes from this patient showed a shorter, novel transcript not present in untransfected myotubes (NT). Sequence analysis confirmed the precise skipping of the targeted exons 43 and 44. Besides this double-skip, we also detected a single-exon 44 skip. Note that the additional fragment, slightly shorter than the wild-type product, is due to heteroduplex formation. 100 bp: size marker, -RT-PCR: negative control.

(7) FIGS. 7A-7D illustrate double- and multi-exon skipping in human control myotubes (KM 109), DMD) (7A) patient DL 470.2 (7B), carrying a deletion of exons 46 to 50, and DMD patient 50685,1, carrying a deletion of exons 48 to 50 (7C). FIG. 7D is RT-PCR analysis of dystrophin mRNA fragments in the myotube cultures treated with either a mixture of h45A0N5 and h51A0N2 (mix) or with a U-linked combination of AONs (U: h45AON5 linked to h51AON2 by ten uracil nucleotides). In all samples treated with either the mix of AONs or the U-linker AON, a shorter transcript fragment was detected that contained exon 44 spliced to exon 52, and that was not present in untreated myotubes (NT). This novel, in-frame transcript arose from double-exon skipping inpatient AL 470.2 (the targeted exons 45 and 51 are directly flanking the deletion), but from multi-exon skipping in both the human control and patient 50685.1. In the treated patient myotube cultures, additional shorter fragments were observed due to single-exon 45 and single-exon 51 skipping. Note that in some lanes, other fragments, slightly shorter than the wild-type products, were present. This was due to heteroduplex formation. 100 bp: size marker, RT-PCR: negative control. FIG. 7D shows that all fragments were quantified using the DNA 7500 LABCHIP and the BIOANALYZER (Agilent). The percentage of double- or multi-exon 45 to 51 skipping was determined by the ratio of this fragment to the total of transcript fragments. The U-combined AON seems less efficient in AL 470.2, but more efficient in KM 109 and 50685.1, when compared to the mixture of AONs.

DETAILED DESCRIPTION

Examples

Example 1

(8) Results

(9) This study includes six DMD patients affected by different mutations (Table 1). Patient DL 515.2 carries an exon 45-50 deletion; hence exon 51 skipping would be frame correcting. Patient DL 363.2 has a deletion of exon 45-54; the reading frame for this patient would be corrected by an exon 44 skip. For patient 50685.1, who is affected by an exon 48-50 deletion, reading frame correction requires an exon 51 skip. Patient DL 5892 has an exon 51-55 deletion; the reading frame would be corrected by an exon 50 skip. Patient 53914.1 carries a single-exon 52 deletion. Notably, in this case, both the skipping of exon 51 or exon 53 would be frame correcting. Finally, patient 50423.1 has a deletion of a single base pair in exon 49, at position 7389 on cDNA level, resulting in a frame-shift and a premature stop codon in exon 49. Since exon 49 is an in-frame exon, skipping of this exon would correct the reading frame for this patient.

(10) We have previously identified AONs with which the skipping of the mentioned target exons 44, 49, 50, 51 and 53 can be induced at concentrations of 1 M (23). In subsequent dose-response experiments, however, we have obtained substantial skipping efficiencies with lower concentrations of 500 nM or 200 nM, and even 100 nM for most AONs (data not shown). This had the extra advantageous effect of lower doses of PEI required for transfection, which significantly reduced the levels of cytotoxicity as found in our earlier transfection experiments. Myotube cultures from the six DMD patients were transfected with the relevant AONs. On average, 70% to 90% of cells showed specific nuclear uptake of fluorescent AONs. RNA was isolated 24 hours post-transfection and analyzed by RT-PCR (FIGS. 1A-1F). In all patients, the targeted exons were skipped at high efficiencies, and precisely at the exon boundaries, as confirmed by sequence analysis of the novel shorter transcripts (FIGS. 1A-1F). For patient 50685.1, an additional transcript fragment was found (FIG. 1C). Sequence analysis showed that this was generated by the activation of a cryptic splice site in exon 51. This was previously also observed in human control cells treated with the same AON (23). Remarkably, low levels of spontaneous exon skipping were observed in untreated cells derived from patients DL 363.2 (exon 44 skip), DL 589.2 (exon 50 skip), and 53914.1 (exon 53 skip). RT-PCR analysis on several larger areas of the DMD gene transcript did not reveal additional, unexpected, aberrant splicing patterns induced by the AON-treatment.

(11) The resulting in-frame transcripts should restore dystrophin synthesis. Indeed, immuno-histochemical analysis of transfected myotube cultures detected dystrophin in the majority of myotubes for each patient (FIGS. 2A-2F). The therapeutic efficiency was determined by double staining, using antibodies against myosin, to identify sufficiently differentiated myotubes and dystrophin. On average, 75% to 80% of myosin-positive myotubes showed dystrophin expression. We observed clear membrane-bound dystrophin for patients DL 363.2, DL 589.2 and 53914.1 two days post-transfection (FIGS. 2B, 2D, and 2E). The presence of dystrophin was confirmed for each patient by Western blot analysis (FIGS. 3A-3F). For patients 50685.1 and DL 363.2, we performed time course experiments, which indicated that dystrophin can be detected as soon as 16 hours post-transfection (FIG. 3D) and at increasing levels up to seven days post-transfection (FIG. 3B). The dystrophin proteins from patients DL515.2, DL 363.2 and DL 589.2 are significantly shorter than the human control, which is due to the size of the deletion.

(12) For one patient, DL 363.2, we also assessed whether the induction of the dystrophin synthesis resulted in the restoration of the DGC (FIGS. 4A-4B). Prior to AON treatment, we found reduced, mainly cytoplasmatic alpha, beta, gamma sarcoglycan and beta-dystroglycan signals (30%, 30%, 40% and 80%, respectively) (FIG. 4A). Following AON transfection, increased levels of mainly membrane-bound alpha-, beta- and gamma-sarcoglycans and beta-dystroglycan were detected in 70%, 90%, 90% and 80% of the treated myotube cultures, respectively (FIG. 4B).

(13) Discussion

(14) The reading frame correction strategy for DMD patients is aimed at antisense-induced, targeted exon skipping. This would convert a severe DMD phenotype into a mostly milder BMD phenotype. We determined the broad applicability in six patients, carrying five different deletions and a point mutation in an exon 49 (Table I). Following AON treatment, we show for each patient the precise skipping of the targeted exon on the RNA level, and a dystrophin protein in 75% to 80% of the treated myotubes. In particular, we here report, for the first time, the application of a single AON treatment (i.e., the induced skipping of exon 51) to correct the reading frame for several different deletions.

(15) Interestingly, the levels of exon skipping observed in the DMD patient cells are significantly higher than those previously obtained in human control cells (23). Typically, the novel skip transcript is the major product. This can be explained by the action of the nonsense-mediated decay (NMD) process (25, 32), In control cells, the skip of an out-of-frame exon results in an out-of-frame transcript, which will be susceptible to NMD. In patient cells, the skip of a target exon results in an in-frame transcript that would be resistant to NMD and thus more stable than the out-of-frame transcript originally present.

(16) For three of the patients (DL 363.2, DL 589.2 and 53914.1), we detected low levels of spontaneous skipping of exons 44, 50 and 53 in untreated cells. This phenomenon has previously also been described for so-called revertant muscle fibers (33-35). These dystrophin-positive fibers are present in low amounts (2% to 10%) in DMD muscles and are considered to be the result of secondary somatic mutations and/or alternative splicing that restore the reading frame, The existence of revertant fibers has been suggested to correlate with the severity of the disease (36, 37)

(17) Restoration of the dystrophin synthesis could be detected as soon as 16 hours post-transfection. At two days post-transfection, dystrophin was detected at the membrane, indicating that these novel BMD-like proteins are likely in part functional. Furthermore, we show that restoration of the dystrophin synthesis appears to re-establish the formation of the dystrophin-glycoprotein complex.

(18) In patients DL 363.2 and DL 589.2, the targeted exon skipping enlarged the deletions to span exons 44-54 and 50-55, respectively. So far, these deletions have not been reported in DMD or BMD patients. This means that they either do not exist or generate a very mild phenotype not diagnosed as BMD. Considering both the large variety of BMD mutations and the markedly lower incidence of BMD observed, we consider the last explanation more plausible than the first. The out-of-frame deletions from patients DL 515.1, 50685.1 and 50423.1 were converted into in-frame deletions as observed in BMD patients carrying deletions of exon 45-51, exon 48-51 and exon 49 (30, 38-40); noteworthy, the exon 48-51 deletion has even been described in an asymptomatic person (40). On the other hand, however, there are also DMD patients carrying such deletions (38, 41-43). Since most of these theoretical in-frame deletions have been detected on the DNA level only, we hypothesize that the dystrophin deficiency in these DMD patients may be caused by additional aberrant splicing patterns on the RNA level, resulting in an out-of-frame transcript.

(19) It is feasible to correct over 75% of the mutations reported in the Leiden DMD-mutation database (30). Our results indicate that antisense-induced reading frame correction will be a promising therapeutic approach for many DMD patients carrying different deletions and point mutations. Towards the establishment of clinical trials, we are currently investigating and optimizing delivery methods in muscle tissue of mice in vivo.

(20) Material and Methods

(21) AONs and Primers

(22) The AONs applied (Table 1) were previously described (23). They contain a 5 fluorescein group (6-FAM), a full-length phosphorothioate backbone and 2-O-methyl modified ribose molecules (Eurogentec, BE). To avoid interference with the fluorescent signals of the secondary antibodies, unlabelled AONs were used for immuno-histochemical analyses. Primers for RT-PCR analysis (sequences available upon request) were synthesized by Eurogentec (BE) or by Isogen Bioscience BV (NL).

(23) Myogenic Cell Cultures and AON Transfections

(24) Primary human myoblasts from patients DL 515.2 (deletion exon 45-50), DL 363.2 (deletion exon 45-54), 50685.1 (deletion exon 48-50), DL 589.2 (deletion exon 51-55) and 53914.1 (deletion exon 52) were isolated from a muscle biopsy and cultured as described (44). Cultures were seeded in collagen pre-coated flasks and plates (Vitrogen 100, Cohesion). Myotubes were obtained from confluent myoblast cultures, following 7 to 14 days of serum deprivation. They were subsequently transfected using polyethylenimine (PEI) for three hours in low-serum medium, according to the manufacturer's instructions (ExGen500; MBI Fermentas), and with 3.5 l applied per g of transfected AON. For RT-PCR analysis, concentrations of 500 nM AON were used. At this concentration, the highest skipping levels can be obtained, albeit with moderate levels of cell death. Because more viable myotubes are required for immunohistochernical and western blot analysis, concentrations of 200 nM were applied.

(25) For patient 50423.1, who carries a point mutation in exon 49, only fibroblasts were available. Following infection (MOI 50-100) with an adenoviral vector containing the MyoD gene (Ad50MyoD), the fibroblasts were forced into myogenesis according to protocols described previously (45-47). Two hours post-infection, the medium was replaced by low-serum medium, and cells were incubated for eight to ten days until myotubes were formed. Transfection conditions were identical to those described above.

(26) RNA Isolation and RT-PCR Analysis

(27) At 24 hours post-transfection, total RNA was isolated from the myotube cultures (RNA-Bee RNA isolation solvent, Campro Scientific, NL). 300 ng of total RNA was used for RT-PCR analysis using C. therm polymerase (Roche Diagnostics, NL) in a 20 l. reaction at 60 C. for 30 minutes, primed with different DMD gene-specific reverse primers (Table 1). Primary PCRs were performed by 20 cycles of 94 C. (40 seconds), 60 C. (40 seconds) and 72 C. (60 seconds). One l of these reactions was then reamplified in nested PCRs by 32 cycles of 94 C. (40 seconds), 60 C. (40 seconds) and 72 C. (60 seconds). PCR products were analyzed on 1.5% or 2% agarose gels. Noteworthy, no evidence for a significant preference for the amplification of shorter fragments was obtained in PCR analyses on a defined series of mixtures of known quantities of the normal and shorter transcript fragments (data not shown).

(28) Sequence Analysis

(29) RT-PCR products were isolated from agarose gels using the QIAQUICK Gel Extraction Kit (Qiagen). Direct DNA sequencing was carried out by the Leiden Genorne Technology Center (LGTC) using the BigDye Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosysterns) and analyzed on an ABI 3700 Sequencer (PE Applied Biosystems).

(30) Protein Isolation and Western Blot Analysis

(31) Protein extracts were isolated from treated myotube cultures (25 crn.sup.2 flasks), using 150 l of treatment buffer (75 mM Tris-HCl pH 6.8, 15% SDS, 5% B-mercaptoethanol, 2% glycerol, 0.001% bromophenol blue), at two to four days post-transfection, depending on the survival rate of the myotubes. For the time course experiments, protein extracts were isolated 4 hours, 8 hours, 16 hours, 24 hours and 48 hours post-transfection (for patient 50685.1) or at 2 days, 4 days and 7 days post-transfection (for patient DL 3632).

(32) Polyacrylamide gel electrophoresis and Western blotting were performed as described by Anderson et al., with some minor adjustments (48). Briefly, samples (75 l) were run overnight at 4 C. on a 4% to 7% polyacrylamide gradient gel. Gels were blotted to nitrocellulose for five to six hours at 4 C. Blots were blocked for one hour with 5% non-fat dried milk in TBST buffer (10 mM Tris-HCl, 0.15 M NaCl, 0.5% Tween 20, pH 8), followed by an overnight incubation with NCL-DYS2 (which recognizes dystrophin) diluted 1:50, HRP-conjugated anti-mouse (Santa Cruz) diluted 1:10,000 was used as a secondary antibody. Immuno-reactive bands were visualized using Lumi-Lightplus Western Blotting Substrate and scanned with a Lumi-Imager (Roche Diagnostics, NL).

(33) Immunohistochemical Analysis

(34) Treated myotube cultures were fixed in 20 C. methanol at one to four days post-transfection, depending of the survival rate of the myotubes. Prior to reaction with the different antibodies, the oncells were incubated for one hour in a blocking solution containing 5% horse serum (Gibco BRL) and 0.05% Tween-20 (Sigma) in PBS (Gibco BRL). All antibodies used were diluted in this blocking solution. The following antibodies were applied: desmin polyclonal antibody (ICN Biomedicals) diluted 1:100, myosin monoclonal antibody diluted 1:100 (MF20; Developmental Studies Hybridoma Bank, University of Iowa), myosin polyclonal antibody L53 diluted 1:100 (a gift from Dr. M. van den Hoff, AMC, NL), MANDYS 1 (a gift from Dr. G, Morris, North East Wales Institute, UK) diluted 1:10 and NCL-DYS2 (Novacastra Laboratories Ltd) diluted 1:10 to detect dystrophin, NCL-a-SARC (Novacastra Laboratories Ltd) diluted 1:75, NCL-b-SARC (Novacastra Laboratories Ltd) diluted 1:50, NCL-g-SARC (Novacastra Laboratories Ltd) diluted 1:50 and NCL-b-DG (Novacastra Laboratories Ltd) diluted 1:50 to detect -sarcoglycan, -sarcoglycan, -sarcoglycan and -dystroglycan, respectively. After one hour incubation, slides were rinsed and incubated for one hour with the secondary antibodies Alexa Fluor 594 goat anti-rabbit conjugate diluted 1:1000 or Alexa Fluor 488 goat anti-mouse conjugate diluted 1:250 (Molecular Probes Inc). The slides were analyzed using a Leica confocal microscope equipped with epifluorescence optics. Digital images were captured using a CCD camera (Photometrics).

Example 2

Materials and Methods

(35) AONs and Primers

(36) A series of AONs (two per exon, see Table 2) was designed to bind to exon-internal target sequences showing a relatively high purine-content and, preferably, an open secondary pre-mRNA structure (at 37 C.), as predicted by the RNA mfold version 3.1 server [22]. The AONs varied in length between 15 and 24 bp, with G/C contents between 26 and 67%. They were synthesized with the following chemical modifications: a 51-fluorescein group (6-FAM), a full-length phosphorothioate backbone and 21-0-methyl-modified ribose molecules (Eurogentec, BE). The primers used for reverse transcription-polymerase chain reaction (RT-PCR) analysis (Table 3) were synthesized by Eurogentec (BE) or by Isogen Bioscience BV (NL).

(37) In Vitro Experiments

(38) Primary human myoblasts were isolated from a muscle biopsy from a non-affected individual (KM108) by enzymatic dissociation. Briefly, the tissue was homogenized in a solution containing 5 mg/ml collagenase type VIII (Sigma), 5 mg/ml bovine albumin fraction V (Sigma), 1% trypsin (Gibco BRL) in PBS (Gibco BRL). Following serial incubation steps of 15 minutes at 37 C., suspensions containing the dissociated cells were added to, and pooled in, an equal volume of proliferation medium (Nut.Mix F-10 (HAM) with GlutaMax-1, Gibco BRL) supplemented with 20% fetal bovine serum (Gibco BRL) and 1% penicillin/streptomycin solution (Gibco BRL), After centrifugation, the cells were plated and further cultured in proliferation medium, using flasks that were pre-coated with purified bovine dermal collagen (Vitrogen 100; Cohesion).

(39) The myogenic cell content of the culture, as determined by the percentage of desmin-positive cells in an immunohistochemical assay, was improved to 58% by repetitive pre-plating [23]. Myotubes were obtained from confluent myoblast cultures following 7 to 14 days of incubation in low-serum medium (DMEM (Gibco BRL), supplemented with 2% GlutaMax-1, 1% glucose, 2% fetal bovine serum and 1% penicillin/streptomycin solution). For transfection of the myotube cultures, we used polyethylenimine (PEI; Ex. Gen 500) according to the manufacturer's instructions (MBI Ferrnentas). The cultures were transfected for three hours in low-serum medium with 1 mM of each AON linked to PEI at a ratio-equivalent of 3.5.

(40) RNA isolation and RT-PCR analysis at 24 hours post-transfection, total RNA was isolated from the myotube cultures using RNAzol B according to the manufacturer's instructions (Campro Scientific, NL). One microgram of RNA was then used for RT-PCR analysis using C. therm polymerase (Roche Diagnostics) in a 20 l reaction at 60 C. for 30 minutes, primed with different DMD gene-specific reverse (RT) primers (Table 3). Primary PCRs were carried out with outer primer sets (see Table 3), for 20 cycles of 94 C. (40 seconds), 60 C. (40 seconds), and 72 C. (90 seconds). One microliter of this reaction was then reamplified in nested PCRs using the appropriate primer combinations (Table 3) for 32 cycles of 94 C. (40 seconds), 60 C. (40 seconds), and 72 C. (60 seconds). PCR products were analyzed on 1.5 or 2% agarose gels.

(41) Sequence analysis RT-PCR products were isolated from agarose gels using the QIAQUICK Gel Extraction kit (Qiagen). Direct DNA sequencing was carried out by the Leiden Genome Technology Center (LGTC) using the BIGDYE Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems), and analyzed on an ABI 3700 Sequencer (PE Applied Biosystems).

(42) Results

(43) In Vitro Exon Skipping

(44) AONs were empirically analyzed for the induction of exon skipping following transfection into human control myotube cultures, using the cationic polymer polyethylenimine (PEI). As determined by the nuclear uptake of the fluorescent AONs, average transfection efficiencies of 60-80% were obtained. At 24 hours post-transfection, transcripts were analyzed by RT-PCR using different primer combinations encompassing the targeted exons (Table 3). Of the 30 AONs tested, a total of 21(70%) reproducibly generated shorter transcript fragments with sizes corresponding to the specific skipping of the targeted exons (FIG. 5A-1 and Table 2). In fact, as confirmed by sequence analysis of the shorter transcripts (data not shown), we could induce the specific skipping of 13 out of the 15 exons targeted (five out of the seven in-frame exons, and eight out of the eight out-of-frame exons). No skipping of exons 47 and 48 was detected (FIGS. 5E and G).

(45) In the specific transcript regions that were screened in these experiments, we, observed in the non-transfected control myotubes, alternative splicing patterns around exons 2 and 29 (FIGS. 5B and C). The alternative products were sequenced and found to be due to the skipping of exons 2-7 (in-frame), exons 3-7 (out-of-frame), exons 28-29 (in-frame), and exons 27-29 (in-frame). This genuinely occurring exon skipping was also detected previously in human skeletal muscle [24, 25]. Remarkably, the level of the alternative splicing was significantly enhanced by the AON treatment of the transfected myotube cultures. Also noteworthy is the observation that h2AON1 not only induced exon 2 skipping in the normal transcript, but also in one of the alternative transcripts consisting of exons 1 and 2 spliced to exon 8 (FIG. 5B).

(46) The majority of AONs induced the precise skipping of the targeted exons, using the original splice sites of the adjacent exons. However, in response to h51AON2, an in-frame cryptic splice site was used in exon 51 (FIG. 5H). The level of this alternatively spliced product was variable in serial transfection experiments. Finally, in some of the transfection experiments, additional aberrant splicing fragments were detected due to the co-skipping of adjacent exons. Their incidence, however, was inconsistent, and at very low levels.

References to Example 2 (Numbering in this Part Refers Strictly to Numbering Used in Example 2)

(47) [1] Hoffman E. P., R H, Brown Jr., and L. M. Kunkel. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell 1987, 51:919-928. [2] Monaco A. P., C. J. Bertelson, S. Liechti-Gallati, H. Moser, and L. M. Kunkel. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genotmics 1988, 2:90-95. [3] Koenig M., A. H. Beggs, and M. Moyer, et al. The molecular basis for Duchenne versus Becker muscular dystrophy: correlation of severity with type of deletion. Am, J. Hum. Genet, 1989, 45:498-506. [4] Zubrzycka-Gaam E. E.; D. E. Bulman, and G. Karpati, et al. The Duchenne muscular dystrophy gene product is localized in sarcolemma of human skeletal muscle. Nature 1988, 333:466-469. [5] Yoshida M. and E. Ozawa, Glycoprotein complex anchoring dystrophin to sarcolemma. J. Biochem, (Tokyo) 1990, 108:748-752. [6] Ervasti J. M. and K. P. Campbell. Membrane organization of the dystrophin-glycoprotein complex. Cell 1991, 66:1121-1131. [7] Koenig M., A. P. Monaco and LM. Kunkel. The complete sequence of dystrophin predicts a rod-shaped cytoskeletal protein. Cell 1988, 53:219-226. [8] van Deutekom J. C., S. S. Floyd and D. K. Booth, et al. Implications of maturation for viral gene delivery to skeletal muscle. Neuromuscul. Disord. 1998, 8:135-148. [9] Mayeda A., Y. Hayase, H. Inoue, E. Ohtsuka and Y. Ohshima. Surveying cis-acting sequences of pre-mRNA by adding antisense 20-O-methyl oligoribonucleotides to a splicing reaction. J. Biochern. (Tokyo) 1990, 108:399-405. [10] Galderisi U., A. Cascino and A. Giordano. Antisense oligonucleotides as therapeutic agents, J. Cell. Physic!. 1999, 181:251-257. [11] Baker 13. F. and B. P. Monia. Novel mechanisms for antisense-mediated regulation of gene expression. Biochim. Biophys. Acta 1999, 1489:348. [12] Kole R. and R Sazani. Antisense effects in the cell nucleus: modification of splicing. Curr. Opin, Mol, Ther. 2001, 3:229-234. [13] Sicinski P., Y. Geng, A. S. Ryder-Cook, E. A. Barnard, M. G. Daxlison and P. J. Barnard. The molecular basis of muscular dystrophy in the mdx mouse: a point mutation. Science 1989, 244:15784580. [14] Dunckley M. G., M. Manoharan, P. Villiet, L C. Eperon and G. Dickson. Modification of splicing in the dystrophin gene in cultured Mdx muscle cells by antisense oligoribonucleotides. Hum, Mal. Genet. 1998, 7:1083-1090. [15] Mann C. J., K. Honeyman and Al. Cheng, et al. Antisense-induced exon skipping and synthesis of dystrophin in the mdx mouse. Proc. Natl, Acad. Sci. U.S.A. 2001, 98:42-47. [16] Wilton S. D., F. Lloyd and K. Carville, et al. Specific removal of the nonsense mutation from the mdx dystrophin mRNA using anti-sense oligonucleotides. Neuromuscul. Disord, 1999, 9:330-338. [17] Takeshima Y., H. Wada, M. Yagi, et al. Oligonucleotides against a splicing enhancer sequence led to dystrophin production in muscle cells from a Duchenne muscular dystrophy patient, Brain Dev. 2001, 23:788-790. [18] Pramono Z. A., Y. Takeshima, H. Alimsardjono, A. Ishii, S. Takeda and M. Matsuo. Induction of exon skipping of the dystrophin transcript in lymphoblastoid cells by transfecting an antisense oligodeoxynucleotide complementary to an exon recognition sequence. Biochem. Biophys. Res. Commun, 1996, 226:445-449. [19] Watakabe A., K. Tanaka and Y. Shimura. The role of exon sequences in splice site selection. Genes Dev. 1993, 7:407-418. [20] Tanaka K., A. Watakabe and Y. Shimura. Polypurine sequences within a downstream exon function as a splicing enhancer. Mol. Cell. Biol. 1994, 14:1347-1354. [21] van Deutekom J. C., M. Bremmar-Bout, A. A. Janson, et al. Antisense-induced exon skipping restores dystrophin expression in DMD patient-derived muscle cells. Hum. Mol. Genet. 2001, 10:1547-1554. [22] Mathews D E., J. Sabina, M. Zuker and D. H. Turner. Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. A. J. Mol. Biol. 1999, 288:911-940. [23] Richter C. and D. Yaffe. The in vitro cultivation and differentiation capacities of myogenic cell lines. Dev. Biol. 1970, 23:1-22. [24] Surono A., Y. Takeshima, T. Wibawa, Z. A. Pramono and M. Mafsuo. Six novel transcripts that remove a huge intron ranging from 250 to 800 kb are produced by alternative splicing of the 50 region of the dystrophin gene in human skeletal muscle. Biochem. Biophys. Res. Commun. 1997, 239:895-899. [25] Shiga N., Y. Takeshima, H. Sakamoto, et al. Disruption of the splicing enhancer sequence within exon 27 of the dystrophin gene by a nonsense mutation induces partial skipping of the exon and is responsible for Becker muscular dystrophy. J. Clin. Invest. 1997, 100:2204-2210. [26] Wells D. S., KB. Wells, E A. Asante, et al. Expression of human full-length and minidystrophin in transgenic mdx mice: implications for gene therapy of Duchenne muscular dystrophy. Hum. Mol. Genet. 1995, 4:1945-1250. [27] Sironi M., U. Pozzoli, R, Cagliani, G. P. Comi, A. Barden and N. Bresolin. Analysis of splicing parameters in the dystrophin gene: relevance for physiological and pathogenetic splicing mechanisms. Hum. Genet, 2001, 109:73-84. A. Aartsma-Rus et al., Neuromuscular Disorders 12 (2002) 871-S77.

Example 3

Results

(48) Double-Exon Skipping in Two DMD Patients

(49) This study includes two DMD patients affected by different frame disrupting mutations in the DMD gene that require the skip of two exons for correction of the reading frame (Table 5). Patient DL 90.3 carries a nonsense mutation in exon 43. Considering that this single exon is out-of-frame, the skipping of exon 43 would remove the nonsense mutation but not restore the reading frame.

(50) Since the combination with exon 44 is in-frame, in this patient, we aimed at double-exon skipping, targeting both these exons. Patient DL 470.2 is affected by a deletion of exons 46 to 50. Frame restoration would require a double-exon skipping of both exons flanking the deletion. Myotube cultures from both patients were transfected with a mixture of exon 43- and 44-specific AONs (DL90.3) or exon 45- and 51-specific AONs (DL470.2). The individual AONs (Table 5) were previously highly effective in single-exon skipping. Transfection efficiencies were typically over 80%, as indicated by the number of cells with specific nuclear uptake of the fluorescent AONs. RT-PCR analysis at 24 to 48 hours post-transfection, indeed demonstrated the feasibility of specific double-exon skipping in both samples (FIGS. 6 and 7A-C). This was confirmed by sequence analysis (data not shown). Additional shorter transcript fragments were obtained due to single-exon skipping: in patient DL90.3, exon 44 skipping (FIG. 6), and in patient DL470.2, exon 51 skipping (FIG. 7B).

(51) Multi-Exon Skipping

(52) The splicing of exon 44 directly to exon 52 (as induced in DL470.2) generates an in-frame transcript. We hypothesized that by inducing the skipping of the entire stretch of exons in between, i.e., multi-exon skipping, we would induce a BMD-like deletion (45-51) that covers and restores several known, smaller, DMD mutations. This would further enlarge the group of DMD patients that would benefit from one type of frame correction. The feasibility of multi-exon skipping was first shown in human control myotubes that were treated with a mixture of the exon 45- and 51-specific AONs (FIG. 7A; KM 109). We then applied it to myotubes from a third DMD patient carrying an exon 48-50 deletion (50685.1). By the AON-induced skipping of the (remaining) stretch of exons in between and including exons 45 and 51, we obtained the anticipated smaller in-frame transcript with exon 44 spliced to exon 52 (FIG. 7C).

(53) Double- and Multi-Exon Skipping Using a U-Linked AON Combination

(54) The skipping of more than one exon from one pre-mRNA molecule requires that both AONs are present in the same nucleus, targeting the same molecule. To enlarge this chance, we here studied the feasibility of one combined AON carrying both AONs specific for exons 45 and 51 (h45A0N5 and h51A0N2) linked by ten uracil nucleotides (Table 5). Following transfection of this U-linker AON into myotubes from human control and the DMD patients DL470.2 and 50685.1, RT-PCR analysis demonstrated its efficacy to generate the anticipated in-frame transcript with exon 44 spliced to exon 52 (FIGS. 7B-7C). This multi-exon skipping occurred specifically and precisely at the exon boundaries as confirmed by sequence analysis (data not shown). In contrast to patient DL 470.2, the U-linker AON was a slightly more efficient than the mixture of AONs in the human control and in patient 50685.1.

(55) Materials and Methods

(56) AONs and Primers

(57) AONs (Table 5) targeting exons 43, 44 and 51 were previously described (Aartsma-Rus, 2002). AONs targeting exon 45 were newly designed (sequences upon request). All AONs contain a 5 fluorescein group (6-FAM), a full-length phosphorothioate backbone and 2-O-methyl modified ribose molecules (Eurogentec, BE). To avoid interference with the fluorescent signals of the secondary antibodies, unlabelled AONs were used for immuno-histochemical analyses. Primers for RT-PCR analysis (Table 5, sequences available upon request) were synthesized by Eurogentec (BE).

(58) RNA Isolation and RT-PCR Analysis

(59) At 24 to 48 hours post-transfection, total RNA was isolated from the myotube cultures (RNA-Bee RNA isolation solvent, Campro Scientific, NL). 300 ng of total RNA were used for RT-PCR analysis using C. therm. polymerase (Roche Diagnostics, NL) in a 20 reaction at 60 C. for 30 minutes, primed with different DMD gene-specific reverse primers (Table 5). Primary PCRs were performed by 20 cycles of 94 C. (40 seconds), 60 C. (40 seconds) and 72 C. (60 seconds). One l of these reactions was then re-amplified in nested PCRs by 32 cycles of 94 C. (40 seconds), 60 C. (40 seconds) and 72 C. (60 seconds), PCR products were analyzed on 1.5% or 2% agarose gels. For quantification of the transcript products, nested PCRs were performed using 24 cycles. PCR products were analyzed using the DNA 7500 LabChip Kit and the Agilent 2100 Bioanalyzer (Agilent Technologies, NL).

(60) Sequence Analysis

(61) RT-PCR products were isolated from agarose gels using the QIAquick Gel Extraction Kit (Qiagen). Direct DNA sequencing was carried out by the Leiden Genome Technology Center (LGTC) using the BigDye Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems) and analyzed on an ABI 3700 Sequencer (PE Applied Biosystems).

Example 4

Expression Vectors Encoding a Transcript Comprising an Oligonucleotide of the Invention

(62) Due to the defined turnover rate of both the dystrophin pre-mRNA and the AONs, our DMD frame-correction therapy would require repetitive administrations of AONs. In addition, relatively high levels of antisense RNA will be necessary within the nucleus, where transcription and splicing of the dystrophin pre-mRNA occur. Therefore, we have set up a vector system in which specific AON sequences are incorporated into a modified gene. In this example, this embodiment is described for U7 small nuclear RNA (U7snRNA). U7snRNA is the RNA component of the U7 ribonucleoprotein particle (U7snRNP) that is involved in the processing of the 3 end of histone pre-mRNAs. Inherent to its function, U7snRNA is efficiently transported back from the cytoplasm to the nucleus in which it gets subsequently incorporated into very stable U7snRNP complexes. A similar approach was successfully applied in AON-based gene therapy studies on B-thalassemia (53, 54). In these studies, different plasmids were engineered containing a modified U7snRNA gene from which the natural antisense sequence directed to the histone pre-rnRNA was replaced with antisense sequences targeted to different B-thalassemia-associated aberrant splicing sites in the B-globin gene. Following transfection of these plasmids, correct splicing and expression of the full-length B-globin protein could be restored with an efficiency of up to 65% in cultured cells expressing the different mutant B-globin genes,

(63) Various U7snRNA gene constructs were engineered as described in reference 53 with the modification that the B-globin sequences were exactly replaced by the antisense sequences derived from the different AONs. In this Example, the sequences were replaced by the antisense sequences of m46AON4, 6, 9, or 11 that were effective in inducing the skipping of mouse exon 46. A sense construct was included as negative control (m46SON6). Following construct validation by sequencing, the plasmids were tested in vitro by transfection into cultured C2Cl2 mouse myoblasts. The U7snRNA-m46AON6 construct was most efficient.

(64) To enhance delivery of the AON-U7snRNA gene constructs, we have cloned them into recombinant adeno-associated viral (rAAV) vectors. AAV is a single-stranded DNA parvovirus that is non-pathogenic and shows a helper-dependent life cycle. In contrast to other viruses (adenovirus, retrovirus, and herpes simplex virus), rAAV vectors have demonstrated to be very efficient in transducing mature skeletal muscle. Because application of rAAV in classical DMD gene addition studies has been hindered by its restricted packaging limits (<5 kb), we applied rAAV for the efficient delivery of the much smaller U7snRNA antisense constructs (<600 bp) to mature murine skeletal muscle. The rAAV-U7-AON vectors also contain the gene for green fluorescence protein (GFF-cDNA), which allows analysis of transduction efficiencies in muscle post-injection. High titer virus productions were effective in inducing exon skipping.

References (to the General Part, Excluding Example 2)

(65) 1. Hoffman E. P, R. H. Brown Jr., and L. M. Kunkel (1987) Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell 51:919-928. 2. Hoffman E. P, K. H. Fischbeck, R. H. Brown, M. Johnson, R. Medori, J. D. Loike, J. B. Harris, R. Waterston, M. Brooke, L. Specht, et al. (1988) Characterization of dystrophin in muscle-biopsy specimens from patients with Duchenne's or Becker's muscular dystrophy. N Engl. J. Med. 318:1363-1368. 3. Den Dunnen J. T., P. M. Grootscholten, E. Bakker, L. A. Blonden, H. B. Ginjaar, Wapenaar, H. M. van Paassen, C. van Broeckhoven, P. L. Pearson, and G. J. van ommen (1989) Topography of the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions and 13 duplications. Am. J. Hum. Genet. 45:835-847. 4. Koenig M., A. H. Beggs, M. Moyer, S. Scherpf, K. Heindrich, T. Bettecken, G. Meng, C. R. Muller, M. Lindlof, H. Kaariainen, et al, (1989) The molecular basis for Duchenne versus Becker muscular dystrophy: correlation of severity with type of deletion. Am. J. Hum. Genet. 45:498-506. 5. Tuffery-Giraud S., S. Chambert, J. Demaille, and M. Claustres (1999) Point mutations in the dystrophin gene: evidence for frequent use of cryptic splice sites as a result of splicing defects. Hum. Mutat. 14:359-368. 6. Prior T. W., C. Bartolo, D. K. Pearl, AC, Papp, P J. Snyder, M. S. Sedra, A. H. Burghes, and J R. Mendell (1995) Spectrum of small mutations in the dystrophin coding region. Am. J. Hum. Genet. 57:22-33. 7. Moser H. (1984) Duchenne muscular dystrophy: pathogenetic aspects and genetic prevention. Hum. Genet. 66:17-40. 8. Emery A. B. (2002) The muscular dystrophies. Lancet 359:687-695. 9. Yoshida M. and E. Ozawa (1990) Glycoprotein complex anchoring dystrophin to sarcolemma. J. Biochem. (Tokyo), 108:748-752. 10. Ervasti J. M. and K. P. Campbell (1991) Membrane organization of the dystrophin-glycoprotein complex. Cell 66:1121-1131. 11. Di Blasi C., L. Moran. di, R. Barresi, F. Blasevich, F. Comelio, and M. Mora (1996) Dystrophin-associated protein abnormalities in dystrophin-deficient muscle fibers from symptomatic and asymptomatic Duchenne/Becker muscular dystrophy carriers. Acta Neuropathol. (Berl), 92:369-377. 12. Ervasti J. M., K. Ohlendieck, S. D. Kahl, M. G. Gayer, and K. P. Campbell (1990) Deficiency of a glycoprotein component of the dystrophin complex in dystrophic muscle. Nature 345:315-319. 13. Matsumura K, All. Burghes, M. Mora, F. M. Tome, L. Morandi, F. Cornell.sup., F. Leturcq, M. Jeanpierre, J. C. Kaplan, P. Reinert, et al. (1994) Immunohistochemical analysis of dystrophin-associated proteins in Becker/Duchenne muscular dystrophy with huge in-frame deletions in the NH2-terminal and rod domains of dystrophin J. Clin. Invest. 93:99-105. 14. Monaco A R, C. J. Bertelson, S. Liechti-Gallati, H. Moser, L. M. Kunkel (1988) An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics 2:90-95. 15. Clemens P. R. and PI Duncan (2001) Progress in gene therapy for Duchenne muscular dystrophy. Curr. Neurol. Neurosci, Rep. 1:89-96. 16. Khan M. A. (1993) Corticosteroid therapy in Duchenne muscular dystrophy. J. Neurol. Sci, 120:8-14. 17. De Angelis F. G., O, Sthandier, B. Berarducci, S. Toso, G. Galluzzi, E. Ricci, G. COSSII and I. Bozzoni (2002) Chimeric snRNA molecules carrying antisense sequences against the splice junctions of exon 51 of the dystrophin pre-mRNA induce exon skipping and restoration of a dystrophin synthesis in Delta 48-50 DMD cells. Proc. Natl. Acad. Sci. USA 99:9456-94.61. 18. Mann C. J., K. Honeyman, A. J. Cheng, T. Ly, F. Lloyd, S. Fletcher, J. E. Morgan, T. A. Partridge and S D. Wilton (2001) Antisense-induced exon skipping and synthesis of dystrophin in the mdx mouse. Proc. Natl. Acad. Sci. USA, 98:42-47. 19. van Deutekom J. C., M. Bremmer-Bout, A. A. Janson, I. B., Ginjaar, F. Baas, J. T. den Dunnen and G. J. van Ommen (2001) Antisense-induced exon skipping restores dystrophin expression in DMD patient-derived muscle cells. Hum. Mol. Genet. 10:1547-1554. 20. Wilton S. D., F. Lloyd, K. Carville, S. Fletcher, K. Honeyman, S. Agrawal and R. Kole (1999) Specific removal of the nonsense mutation from the mdx dystrophin mRNA using antisense oligonucleotides. Neuromuscul. Disord. 9:330-338. 21. Dunckley M. G., M. Manoharan, P. Villiet, I. C. Eperon and G. Dickson (1998) Modification of splicing in the dystrophin gene in cultured Mdx muscle cells by antisense oligoribonucleotides. Hum. Mol. Genet. 7:1083-1090. 22. Takeshima Y., H. Wada, M. Yagi, Y. Ishikawa, R. Minami, H. Nakamura and M. Matsu (2001) Oligonucleotides against a splicing enhancer sequence led to dystrophin production in muscle cells from a Duchenne muscular dystrophy patient. Brain Dev, 23:788-790. 23. Aartsma-Rus A., M. Bremmer-Bout, A. Janson, J. den Dunnen G, van Ommen and J. van Deutekom (2002) Targeted exon skipping as a potential gene correction therapy for Duchenne muscular dystrophy. Neuromuscul. Disord. 12, S71. 24. Shiga N., Y. Takeshima, H. Sakamoto, K. Inoue, Y. Yokota, M. Yokoyama and M. Matsuo (1997) Disruption of the splicing enhancer sequence within exon 27 of the dystrophin gene by a nonsense mutation induces partial skipping of the exon and is responsible for Becker muscular dystrophy. J. Clin. Invest. 100:2204-2210. 25. Cartegni L. S. L. Chew and A. R. Krainer (2002) Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat. Rev. Genet. 3:285-298, 26. Schaal T. D. and T. Mafflatis (1999) Multiple distinct splicing enhancers in the protein-coding sequences of a constitutively spliced pre-mRNA. Mol. Cell. Blot 19:261-273. 27. Takeshima Y., H. Nishio, H. Saka.moto, H. Nakamura and M. Matsuo (1995) Modulation of in vitro splicing of the upstream intron by modifying an intra-exon sequence which is deleted from the dystrophin gene in dystrophin Kobe. J. Main Invest. 95:515-520. 28. Pramono Z. A., Y. Takeshima, H. Alimsardjono, A. Ishii, S. Takeda, and M. Matsu (1996) Induction of exon skipping of the dystrophin transcript in lymphoblastoid cells by transfecting an antisense oligodeoxynueleotide complementary to an exon recognition sequence. Biochem. Biophys. Res. Commun. 226:445-449. 29. Koenig M., A. P. Monaco and L. M. Kunkel (1988) The complete sequence of dystrophin predicts a rod-shaped eytoskeletal protein. Cell 53:219-226. 30. Den Dunnen J. (1996) The Leiden Muscular Dystrophy pages; http://www.dmd.nl. 31. Mann C J. K. Honeyman, G. McCloroy, S. Fletcher and S. D. Wilton (2002) Improved antisense oligonucleotide-induced exon skipping in the mdx mouse model of muscular dystrophy. J. Gene Med. 4:644-654. 32. Kerr T. P., C. A. Sewry, S. A. Robb and R. G. Roberts (2001) Long mutant dystrophins and variable phenotypes: evasion of nonsense-mediated decay? Hum. Genet. 109:402-407. 33. Klein C. J. D. D. Coovert, D. E. Bulman, P. N. Ray, J. R. Mendell and A. H. Burghes (1992) Somatic reversion/suppression in Duchenne muscular dystrophy (DMD): evidence supporting a frame-restoring mechanism in rare dystrophin-positive fibers. Am. J. Hum. Genet. 50; 950-959.

(66) 34. Sherratt T. G., T. Vulliamy, V. Dubowitz, C A. Sewry and P. N. Strong (1993) Exon skipping and translation in patients with frameshift deletions in the dystrophin gene. Am. J. Hum. Genet. 53:1007-1015. 35. Lu Q. L., G. E. Morris, S. D. Wilton, T. Ly, O. V. Artem'yeva, P. Strong and T. A. Partridge (2000) Massive idiosyncratic exon skipping corrects the nonsense mutation in dystrophic mouse muscle and produces functional revertant fibers by clonal expansion. J. Cell Biol. 148:985-996. 36. Nicholson L. V., M. A. Johnson, K. M. Bushby and D. Gardner-Medwin (1993) Functional significance of dystrophin-positive fibers in Duchenne muscular dystrophy. Arch. Dis. Child 68:632-636, 37. Vainzof M., M. R. Passos-Bueno, R. I. Takata, C. Pavanelio Rde and M. Zatz (1993) Intrafamilial variability in dystrophin abundance correlated with difference in the severity of the phenotype. J. Neurol, Sci. 119:38-42. 38. Singh V., S. Shina, S. Mishra, L. S. Chaturvedi, S. Pradhan, R. D. Mittal and B. Mittal (1997) Proportion and pattern of dystrophin gene deletions in north Indian Duchenne and Becker muscular dystrophy patients. Hum. Genet. 99:206-208. 39. Melacini P., M. Fanin, G. A. Daniell, G. Fasoli, C. Villanova, C. Angelini, L. Vitiello, M. Miorelli, G. F. Buja, M. L. Mostaccitrolo, et al, (1993) Cardiac involvement in Becker muscular dystrophy. J Am, Coll. Cardiol, 22:1927-1934. 40. Melis M. A., M. Cau, F. Muntoni, A. Mateddu, R. Galanello, L. Boccone, F. Deidda, D. Loi and A. Cao (1998) Elevation of serum creatine kinase as the only manifestation of an intragenic deletion of the dystrophin gene in three unrelated families. Europ. J. Paediatr, Neurol. 2:255-261. 41. Onengut, S., G. N. Kavaslar, E. Battaloglu, P. Serdaroglu, F. Deymeer, C. Ozdernir, F. Calafell and A. Tolun (2000) Deletion pattern in the dystrophin gene in Turks and a comparison with Europeans and Indians. Ann. Hum. Genet. 64:33-40. 42. Rosenberg C., L. Navajas, D. F. Vagenas, E. Bakker, M. Vainzof, M. R. Passos-Bueno, Rd, Takata, G. J. Van Ommen, M. Zatz and J. T. Den Dunnen (1998) Clinical diagnosis of heterozygous dystrophin gene deletions by fluorescence in situ hybridization. Neuromuscul. Disord. 8:447-452. 43. Sertic J., N. Barisic, M. Sostarko, Z. Brzovic and A. Stavljenic-Rukavina (1997) Deletion screening of the Ducherme/Becker muscular dystrophy gene in Croatian population, Coll. Anthropol. 21:151456. 44. Rando T. A. and H. M. Blau (1994) Primary mouse myoblast purification, characterization, and transplantation for cell-mediated gene therapy. J. Cell Biol. 125:1275-1287. 45. Murry C E., M. A. Kay, T. Bartosek, S D. Hauschka and S. M, Schwartz (1996) Muscle differentiation during repair of myocardial necrosis in rats via gene transfer with MyoD. J. Clin, Invest. 98:2209-2217. 46. Roest P A., A. C. van der Tuljn, H. B. Ginjaar; R C. Hoeben, F. B. Hoger-Vorst, E. Bakker, J. T. den Dunnen and G. J. van Ommen (1996) Application of in vitro Myo-differentiation of non-muscle cells to enhance gene expression and facilitate analysis of muscle proteins. Neuromuscul. Disord. 6:195-202. 47. Havenga M. J., A. A. Lemckert, O. J. Ophorst, M. van Meijer, W. T. Germeraad, J. Grimbergen, M. A. van Den Doel, R. Vogels, J. van Deutekom and A. A. Janson, et al. (2002) Exploiting the natural diversity in adenovirus tropism for therapy and prevention of disease. J. Virol. 76:4612-4620. 48. Anderson L. V. and K. Davison (1999) Multiplex Western blotting system for the analysis of muscular dystrophy proteins. Am. J. Pathol. 154:1017-1022. 49. Neugebauer K M et al., J. Cell. Biol. 129:899-908 (1995). 50. Tacke R. and J. L. Manley, Proc. Soc. Exp. Biol. Med. 220:59-63 (1999). 51. Graveley B. R. et al., Curr Biol. 9:R6-7 (1999). 52. Misteli T et al., Nature 387:523-527 (1997). 53. Gorman L, Suter D, Emerick V, et al. Stable alteration of pre mRNA splicing patterns by modified U7 small nuclear RNAs. Proc. Natl. Acad. Sci. USA 1998, 4929-4934. 54. Suter D, Tomasini R, Reber U, et al. Double target antisense U7 snRNAs promote efficient skipping of an aberrant exon in three human beta thalassemic mutations. Hum. Mol. Genet. 1999, 8:2415-2423.

(67) TABLE-US-00001 TABLE 1 Overview of the patients, the AONs and the primer sets used in this study Targeted Primary PCR Nested PCR Patients Mutations exons AONs.sup.a RT-primers.sup.b sets.sup.b sets.sup.b DL 515.2 Deletion exon 45-50 Exon 51 h51AON1 h53r h4lf-h53r h42f-h52r DL 363.2 Deletion exon 45-54 Exon 44 h44AON1 h55r2 h42f4-h55r2 h44f-h55r 50685.1 Deletion exon 48-50 Exon 51 h51AON1 h53r h46f-h53r h47f-h52r DL 589.2 Deletion exon 51-55 Exon 50 h50AON1 h58r h47f-h58r h49f-h57r 53914.1 Deletion exon 52 Exon 51 h51AON1 h55r h49f-h55r h50f-h54r Exon 53 h53AON1 50423.1 Point mutation exon 49 Exon 49 h49AON1 h52r h46f-h52r h47f-h5lr .sup.aAON sequences were published previously (23). .sup.bPrimer sequences available upon request.

(68) TABLE-US-00002 TABLE2 CharacteristicsoftheAONsusedtostudythetargetedskippingof15differentDMDexons.sup.a SEQIDNO: Name Antisensesequence(5-3) Length(bp) G/C% U/C% Exonskip Transcript 1 h2AON1 cccauuuugugaauguuuucuuuu 24 29 75 + OF 2 h2AON2 uugugcauuuacccauuuugug 22 36 68 OF 3 h29AON1 Uauccucugaaugucgcauc 20 45 65 + IF 4 h29AON2 gguuauccucugaaugucgc 20 50 60 + IF 5 h40AON1 Gagccuuuuuucuucuuug 19 37 79 + IF 6 h40AON2 Uccuuucgucucugggcuc 19 58 79 + IF 7 h41AON1 Cuccucuuucuucuucugc 19 47 95 + IF 8 h41AON2 Cuucgaaacugagcaaauuu 20 35 50 + IF 9 h42AON1 cuugugagacaugagug 17 47 41 + IF 10 h42AON2 cagagacuccucuugcuu 18 50 67 + IF 11 h43AON1 ugcugcugucuucuugcu 18 50 78 OF 12 h43AON2 Uuguuaacuuuuucccauu 19 26 79 + OF 13 h44AON1 cgccgccauuucucaacag 19 58 63 + OF 14 h44AON2 uuuguauuuagcauguuccc 20 35 70 + OF 15 h45AON1 gcugaauuauuucuucccc 19 42 74 OF 16 h45AON5 gcccaaugccauccugg 17 65 58 + OF 17 h46AON4b cugcuuccuccaacc 15 60 80 + OF 18 h46AON8b gcuuuucuuuuaguugcugc 20 40 75 + OF 19 h47AON1 ucuugcucuucugggcuu 18 50 78 IF 20 h47AON2 cuugagcuuauuuucaaguuu 21 29 67 IF 21 h48AON1 uuucuccuuguuucuc 16 38 94 IF 22 h48AON2 ccauaaauuuccaacugauuc 21 33 62 IF 23 h49AON1 Cuuccacauccgguuguuu 19 47 74 + IF 24 h49AON2 Guggcugguuuuuccuugu 19 47 68 + IF 25 h50AON1 cucagagcucagaucuu 17 47 59 + OF 26 h50AON2 ggcugcuuugcccuc 15 67 73 OF 27 h51AON1 Ucaaggaagauggcauuucu 20 40 45 + OF 28 h51AON2 ccucugugauuuuauaacuugau 23 30 65 + OF 29 h53AON1 cuguugccuccgguucug 18 61 72 + OF 30 h53AON2 uuggcucuggccuguccu 18 61 72 OF .sup.aTwo AONs were tested per exon. Their different lengths and G/C contents (%) did not correlate to their effectivity in exon skipping (1, induced skipping, 2, no skipping). The AONs were directed to purine (A/G) -rich sequences as indicated by their (antisense) U/C content (%). Skipping of the target exons resulted in either an in-frame (IF) or an out-of-frame (OF) transcript. b van. Deutekom et al., 2001 [21].

(69) TABLE-US-00003 TABLE 3 Primer sets used for the RT-PCR analyses to detect the skipping of the targeted exons.sup.a Primary PCR Nested PCR primer Target exon RT-primer primer set set 2 h4r h1f1-h4r h1f2-h3r 2 h9r h1f1-h9r h1f2-h8r 29 h31r h25f-h31r h26f-h30r 40 h44r h38f-h44r h39f-h43r 41 h44r h38f-h44r h39f-h43r 42 h44r h38f-h44r h39f-h43r 43 h47r h41f-h47r h42f-h46r 44 h47r h41f-h47r h42f-h46r 45 h47r h41f-h47r h42f-h46r 46 h48r h44f-h48r h45f-h47r 47 h52r h44f-h52r h46f-h51r 48 h52r h44f-h52r h46f-h51r 49 h52r h44f-h52r h46f-h51r 50 h52r h44f-h52r h46f-h51r 51 h53r h47f-h53r h49f-h52r 53 h55r h50f-h55r h51f-h54r .sup.aPrimer sequences are available upon request

(70) TABLE-US-00004 TABLE 4 Overview and frequency of the DMD-causing mutations in the Leiden DMD (LDMD) Database, theoretically correctable by skipping one of the 12 exons successfully targeted in this study Therapeutic for DMD-mutations: Deletions No. of nonsense (exons) % of deletions Duplications % of duplications mutations in Skippable exon (exons) in LDMD Database (exons) in LDMD Database LDMD Database 2 3-7, 3-19, 3-21 2.9 2 9.0 29 5 40 1 41 4 42 0 43 44, 44-47, 44-49, 3.7 43 3.0 44-51 44 5-43, 14-43, 19-43, 7.8 44 3.0 30-43, 35-43, 36-43, 40-43, 42-43, 45, 45-54 46 21-45, 45, 47-54, 5.6 47-56 49 1 50 51, 51-53, 51-55 5.2 50 3.0 51 45-50, 47-50, 48-50, 17.5 51 1.5 49-50, 50, 52, 52-63 53 10-52, 45-52, 46-52, 7.5 47-52, 48-52, 49-52, 50-52, 52

(71) TABLE-US-00005 TABLE 5 Overview of the patients, the AONs and the primer sets used in Example 3 Targeted Primary PCR Nested PCR Patients Mutations exons AONs RT-primers.sup.b primer sets.sup.b primer sets.sup.b DL 90.3 Nonsense mutation exon 43 Exon43 h43AON2.sup.a h48r h4lf-h48r h42f-h47r Exon 44 h44AON1.sup.a DL470.2 Deletion exon 46-50 Exon 45 h45AON5 h53r h42f-h53r h43-h52r Exon 51 h51AON2.sup.a Exon 45 U-linker h53r h42f-h53r h43f-h52r Exon 51 AON.sup.c .sup.aSeparate AON sequences were published previously (Aartsma-Rus, 2002). .sup.bPrimer sequences available upon request .sup.cU linker AON consists of h45AON5 linked to h51AON2 by ten uracils.