ARRAYS

20180305840 ยท 2018-10-25

    Inventors

    Cpc classification

    International classification

    Abstract

    Protein arrays and their use to assay, in a parallel fashion, the protein products of highly homologous or related DNA coding sequences and described. By highly homologous or related it is meant those DNA coding sequences which share a common sequence and which differ only by one or more naturally occurring mutations such as single nucleotide polymorphisms, deletions or insertions, or those sequences which are considered to be haplotypes. Such highly homologous or related DNA coding sequences are generally naturally occurring variants of the same gene. Arrays according to the invention have two or more individual proteins deposited in a spatially defined pattern on a surface in a form whereby a property such as an activity or function of the proteins can be investigated or assayed in parallel by interrogation of the array.

    Claims

    1-4. (canceled)

    5. A method of simultaneously quantifying the relative properties of members of a set of protein moieties which are variants of a protein that differ in their amino acid sequences at one or more positions, the protein moieties of the set of protein moieties being encoded by naturally-occurring variants of a DNA sequence of interest that map to a common chromosomal locus; the method comprising the steps of: a) bringing a protein array comprising a surface on which the protein moieties of the set of protein moieties are deposited at spatially defined locations into contact with one or more test substances; and b) observing the interaction of said test substances with the protein moieties on the array; wherein the protein moieties of the set of protein moieties are immobilized on the surface by attachment to the surface through a common marker moiety appended to each of the protein moieties of the set of protein moieties; and wherein the surface has a surface coating that is capable of resisting non-specific protein absorption.

    6. The method of claim 5, wherein the protein moieties of the set of protein moieties are attached to the surface through the common marker moiety such that the protein moieties have their naturally occurring function and/or activity.

    7. The method of claim 5, wherein the common marker moiety appended to each of the protein moieties of the set of protein moieties is Biotin Carboxyl Carrier Protein (BCCP).

    8. The method of claim 5, wherein the protein moieties of the set of protein moieties are of human origin.

    9. The method of claim 5, wherein the variants of the DNA sequence of interest differ by one or more naturally-occurring mis-sense mutations, insertions or deletions.

    10. The method of claim 5, wherein the protein moieties of the set of protein moieties comprise proteins associated with a disease state, associated with drug metabolism or are uncharacterized.

    11. The method of claim 5, wherein the protein moieties of the set of protein moieties are enzymatically active.

    12. The method of claim 11, wherein the protein moieties of the set of protein moieties are drug metabolizing enzymes.

    13. The method of claim 5, wherein the protein moieties of the set of protein moieties are drug metabolising enzymes which are activated by contact with an accessory protein or by chemical treatment.

    14. The method of claim 5, wherein the protein moieties of the set of protein moieties comprise a wild type p53 and at least one allelic variant thereof.

    15. The method of claim 5, wherein the protein moieties of the set of protein moieties comprise a wild type p450 and at least one allelic variant thereof.

    16. The method of claim 5, wherein the surface is a flat surface.

    17. The method of claim 16, wherein the flat surface is selected from a glass slide, a polypropylene slide, a polystyrene slide, a membrane made of nitrocellulose, a membrane made of PVDF, a membrane made of nylon, and a membrane made of phosphocellulose.

    18. The method of claim 5, wherein the surface is coated or derivatized by chemical treatment.

    19. The method of claim 18, wherein the surface is coated with a porous or non-porous surface coating.

    20. A method of screening a set of protein moieties that differ in their amino acid sequences at one or more positions and are encoded by one or more naturally-occurring single nucleotide polymorphisms of a DNA sequence of interest for molecules that interact with one or more of the protein moieties comprising the steps of: a) bringing one or more test molecules into contact with a protein array which carries the set of protein moieties; and b) detecting an interaction between one or more test molecules and one or more protein moieties on the array; wherein protein moieties of the set of protein moieties are encoded by one or more naturally occurring single nucleotide polymorphisms of a DNA sequence of interest and differ in their amino acid sequences at one or more positions; wherein the protein array comprises a surface on which the protein moieties of the set of protein moieties are deposited at spatially defined locations, the protein moieties being immobilized on the surface by attachment to the surface through a common marker moiety appended to each of the protein moieties of the set of protein moieties such that the protein moieties have their naturally occurring function and/or activity; and wherein the surface has a surface coating that is capable of resisting non-specific protein absorption.

    21. The method of claim 20, wherein the protein moieties of the set of protein moieties are attached to the surface through the common marker moiety such that the protein moieties have their naturally occurring function and/or activity.

    22. The method of claim 20, wherein the common marker moiety appended to each of the protein moieties of the set of protein moieties is Biotin Carboxyl Carrier Protein (BCCP).

    23. The method of claim 20, wherein the protein moieties of the set of protein moieties are of human origin.

    24. The method of claim 20, wherein the variants of the DNA sequence of interest differ by one or more naturally-occurring mis-sense mutations, insertions or deletions.

    25. The method of claim 20, wherein the protein moieties of the set of protein moieties comprise proteins associated with a disease state, associated with drug metabolism or are uncharacterized.

    26. The method of claim 20, wherein the protein moieties of the set of protein moieties are enzymatically active.

    27. The method of claim 26, wherein the protein moieties of the set of protein moieties are drug metabolizing enzymes.

    28. The method of claim 20, wherein the protein moieties of the set of protein moieties are drug metabolising enzymes which are activated by contact with an accessory protein or by chemical treatment.

    29. The method of claim 20, wherein the protein moieties of the set of protein moieties comprise a wild type p53 and at least one allelic variant thereof.

    30. The method of claim 20, wherein the protein moieties of the set of protein moieties comprise a wild type p450 and at least one allelic variant thereof.

    31. The method of claim 20, wherein the surface is a flat surface.

    32. The method of claim 31, wherein the flat surface is selected from a glass slide, a polypropylene slide, a polystyrene slide, a membrane made of nitrocellulose, a membrane made of PVDF, a membrane made of nylon, and a membrane made of phosphocellulose.

    33. The method of claim 20, wherein the surface is coated or derivatized by chemical treatment.

    34. The method of claim 33, wherein the surface is coated with a porous or non-porous surface coating.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0072] FIG. 1 shows p53 mutant panel expression. E. coli cells containing plasmids encoding human wild type p53 or the indicated mutants were induced for 4 h at 30 C. Cells were lysed by the addition of lysozyme and Triton X100 and cleared lysates were analysed by Western blot. A band corresponding to full length his-tagged, biotinylated p53 runs at around 70 kDa.

    [0073] FIG. 2 shows a gel shift assay to demonstrate DNA binding function of E. coli expressed p53. 1 ul of cleared E. coli lysate containing wild type p53 (wt) or the indicated mutant was combined with 250 nM DIG-labelled DNA and 0.05 mg/ml polydI/dC competitor DNA. The ve control contained only DNA. Bound and free DNA was separated through a 6% gel (NOVEX), transferred to positively charged membrane (Roche) and DIG-labelled DNA detected using an anti-DIG HRP conjugated antibody (Roche). The DNA:p53 complex is indicated by an arrow.

    [0074] FIG. 3 shows microarray data for the p53 DNA binding assay. Lysates were arrayed in a 44 pattern onto streptavidin capture membrane as detailed in A) and probed with B) Cy3-labelled anti-histidine antibody or C) Cy3-labelled GADD45 DNA, prior to scanning in an Affymetrix 428 array scanner.

    [0075] FIG. 4 shows CKII phosphorylation of p53. 2 ul of E. coli lysate containing p53 wild type (wt) or the indicated mutant protein were incubated with or without casein kinase II in a buffer containing ATP for 30 min at 30 C. Reactions were Western blotted and phosphorylation at serine 392 detected using a phosphorylation specific antibody.

    [0076] FIG. 5 shows microarray data for the CKII phosphorylation assay. The p53 array was incubated with CKII and ATP for 1 h at 30 C and analysed for phosphorylation at serine 392. Phosphorylation was detected for all proteins on the array except for the truncation mutants Q136X, R196X, R209X, R213X, R306X and for the amino acid mutants L344P and S392A.

    [0077] FIG. 6 shows a solution phase MDM2 interaction assay. 10 ul of p53 containing lysate was incubated with 10 ul of MDM2 containing lysate and 20 ul anti-FLAG agarose in a total volume of 500 ul. After incubation for 1 h at room temperature the anti-FLAG agarose was collected by centrifugation, washed extensively and bound proteins analysed by Western blotting. P53 proteins were detected by Strep/HRP conjugate.

    [0078] FIG. 7 shows microarray data for MDM2 interaction. The p53 array was incubated with purified Cy3-labelled MDM2 protein for 1 h at room temperature and bound MDM2 protein detected using a DNA array scanner (Affymetrix). MDM2 protein bound to all members of the array apart from the W23A and W23G mutants.

    [0079] FIG. 8a shows replicate p53 microarrays incubated in the presence of .sup.33P labelled duplex DNA, corresponding to the sequence of the GADD45 promoter element, at varying concentrations and imaged using a phosphorimager so individual spots could be quantified.

    [0080] FIG. 8B shows DNA binding to wild-type p53 (high affinity), R273H (low affinity) and L344P (non-binder) predicting a wild-type affinity of 7 nM.

    [0081] FIG. 9A shows a plasmid map of pBJWI02.2 for expression of C-terminal BCCP hexa-histidine constructs.

    [0082] FIG. 9B shows the DNA sequence of pBJW102.2 (SEQ ID NO:52).

    [0083] FIG. 9C shows the cloning site of pBJW102.2 from start codon (SEQ ID NO:53). Human P450s, NADPH-cytochrome P450 reductase, and cytochrome b5 ORFs, and truncations thereof, were ligated to a DrallI/SmaI digested vector of pBJWI02.2.

    [0084] FIG. 10A shows a vector map of pJW45.

    [0085] FIG. 10B shows the sequence of the vector pJW45 (SEQ ID NO:54).

    [0086] FIG. 11A shows the DNA sequence of Human P450 3A4 open reading frame (SEQ ID NO:55).

    [0087] FIG. 11B shows the amino acid sequence of full length human P450 frame 3A4 (SEQ ID NO:56).

    [0088] FIG. 12A shows the DNA sequence of human P450 2C9 open reading frame (SEQ ID NO:57).

    [0089] FIG. 12B shows the amino acid sequence of full length human P450 2C9 (SEQ ID NO:58).

    [0090] FIG. 13A shows the DNA sequence of human P450 2D6 open reading frame (SEQ ID NO:59).

    [0091] FIG. 13B shows the amino acid sequence of full length human P450 2D6 (SEQ ID NO:60).

    [0092] FIG. 14 shows a western blot and coomassie-stained gel of purification of cytochrome P450 3A4 from E. coli. Samples from the purification of cytochrome P450 3A4 were run on SDS-PAGE, stained for protein using coomassie or Western blotted onto nitrocellulose membrane, probed with streptavidin-HRP conjugate and visualised using DAB stain:

    Lanes 1: Whole cells

    Lanes 2: Lysate

    [0093] Lanes 3: Lysed E. coli cells
    Lanes 4: Supernatant from E. coli cell wash
    Lanes 5: Pellet from E. coli cell wash
    Lanes 6: Supernatant after membrane solublisation
    Lanes 7: pellet after membrane solublisation
    Lanes 8: molecular weight markers: 175, 83, 62, 48, 32, 25, 16.5, 6.5 Kda.

    [0094] FIG. 15 shows the Coomassie stained gel of Ni-NTA column purification of cytochrome P450 3A4. Samples from all stages of column purification were run on SDS-PAGE:

    Lane 1: Markers 175, 83, 62, 48, 32, 25, 16.5, 6.5 KDa

    [0095] Lane 2: Supernatant from membrane solublisation

    Lane 3: Column Flow-Through

    [0096] Lane 4: Wash in buffer C
    Lane 5: Wash in buffer D
    Lanes 6&7: Washes in buffer D+50 mM Imidazole
    Lanes 8-12: Elution in buffer D+200 mM Imidazole.

    [0097] FIG. 16 shows the assay of activity for cytochrome P450 2D6 in a reconstitution assay using the substrate AMMC. Recombinant, tagged CYP2D6 was compared with a commercially available CYP2D6 in terms of ability to turnover AMMC after reconstitution in liposomes with NADPH-cytochrome P450 reductase.

    [0098] FIG. 17 shows the rates of resorufin formation from BzRes by cumene hydrogen peroxide activated cytochrome P450 3A4. Cytochrome P450 3A4 was assayed in solution with cumene hydrogen peroxide activation in the presence of increasing concentrations of BzRes up to 160 J.lM.

    [0099] FIG. 18 shows the equilibrium binding of [.sup.3H]ketoconazole to immobilised CYP3A4 and CYP2C9. In the case of CYP3A4 the data points are the meansstandard deviation, of 4 experiments. Non-specific binding was determined in the presence of 100 M ketoconazole (data not shown).

    [0100] FIG. 19 shows the chemical activation of tagged, immobilised P450 involving conversion of DBF to fluorescein by CHP activated P450 3A4 immobilised on a streptavidin surface.

    [0101] FIG. 20 shows the stability of agarose encapsulated microsomes. Microsomes containing cytochrome P450 2D6 plus NADPH-cytochrome P450 reductase and cytochrome b5 were diluted in agarose and allowed to set in 96 well plates. AMMC turnover was measured immediately and after two and seven days at 4 C.

    [0102] FIG. 21 shows the turnover of BzRes by cytochrome P450 3A4 isofonns. Cytochrome P450 3A4 isofonns WT, *1, *2, *3, *4, *5 & *15, (approximately 1 g) were incubated in the presence of BzRes (0-160 M) and cumene hydrogen peroxide (200 M) at room temperature in 200 mM KP04 buffer pH 7.4. Formation of resorufin was measured over time and rates were calculated from progress curves. Curves describing conventional Michaelis-Menton kinetics were fitted to the data.

    [0103] FIG. 22 shows the inhibition of cytochrome P450 3A4 isofonns by ketoconazole. Cytochrome P450 3A4 isofonns WT, *1, *2, *3, *4, *5 & *15, (approximately 1 g) were incubated in the presence of BzRes (50 M), Cumene hydrogen peroxide (200 M) and ketoconazole (0, 0.008, 0.04, 0.2, 1, 5 M) at room temperature in 200 mM KP04 buffer pH 7.4. Formation of resorufin was measured over time and rates were calculated from progress curves. ICso inhibition curves were fitted to the data.

    EXAMPLES

    Example I: Use of a Protein Array for Functional Analysis of Proteins Encoded by SNP-Containing Genesthe p53 Protein SNP Array

    [0104] Mutations in the tumour suppresser protein p53 have been associated with around 50% of cancers, and more than a thousand SNPs of this gene have been observed. Mutations of the p53 gene in tumour cells (somatic mutation), or in the genome of families with a predisposition to cancer (germline mutation), provide an association between a condition and genotype, but no molecular mechanism. To demonstrate the utility of protein arrays for functional characterisation of coding SNPs, the Inventors have arrayed wild type human p53 together with 46 germline mutations (SNPs). The biochemical activity of these proteins can then be compared rapidly and in parallel using small sample volumes of reagent or ligand. The arrayed proteins are shown to be functional for DNA binding, phosphorylated post-translationally on-chip by a known p53 kinase, and can interact with a known p53-interacting protein, MDM2. For many of these SNPs, this is the first functional characterisation of the effect of the mutation on p53 function, and illustrates the usefulness of protein microarrays in analysing biochemical activities in a massively parallel fashion.

    Materials and Methods for Construction of p53 SNP Array.

    [0105] Wild type p53 cDNA was amplified by PCR from a HeLa cell cDNA library using primers P53F (5 atg gag gag ccg cag tea gat cct ag 3; SEQ ID NO: 1) and P53R (5 gat cgc ggc cgc tea gtc agg ccc ttc tg 3; SEQ ID NO:2) and ligated into an E. coli expression vector downstream of sequence coding for a poly Histidine-tag and the BCCP domain from the E. coli AeeB gene. The ligation mix was transformed into chemically competent XLIBlue cells (Stratagene) according to the manufacturer's instructions. The p53 cDNA sequence was checked by sequencing and found to correspond to wild type p53 protein sequence as contained in the SWISS-PROT entry for p53 [Accession No. P04637].

    Construction of p53 Mutant Panel

    [0106] Mutants of p53 were made by using the plasmid containing the wild type p53 sequence as template in an inverse PCR reaction. Primers were designed such that the forward primer was 5 phosphorylated and started with the single nucleotide polymorphism (SNP) at the 5 end, followed by 20-24 nucleotides of p53 sequence. The reverse primer was designed to be complementary to the 20-24 nucleotides before the SNP. PCR was performed using Pwo polymerase which generated blunt ended products corresponding to the entire p53-containing vector. PCR products were gel purified, ligated to form circular plasmids and parental template DNA was digested with restriction endonuclease DpnI (New England Biolabs) to increase cloning efficiency. Ligated products were transformed into XLIBlue cells, and mutant p53 genes were verified by sequencing for the presence of the desired mutation and the absence of any secondary mutation introduced by PCR.

    Expression of p53 in E. coli

    [0107] Colonies of XLIBlue cells containing p53 plasmids were inoculated into 2 ml of LB medium containing ampicillin (70 micrograms/ml) in 48 well blocks (QIAGEN) and grown overnight at 37 C. in a shaking incubator. 40 l of overnight culture was used to inoculate another 2 ml of LB/ampicillin in 48 well blocks and grown at 37 C. until an optical density (600 nm) of 0.4 was reached. IPTG was then added to 50 M and induction continued at 30 C. for 4 hours. Cells were then harvested by centrifugation and cell pellets stored at 80 C. For preparation of protein, cell pellets were thawed at room temperature and 40 l of p53 buffer (25 mM HEPES pH 7.6, 50 mM KCl, 10% glycerol, 1 mM DTT, 1 mg/ml bovine serum albumin, 0.1% Triton X100) and 10 l of 4 mg/ml lysozyme were added and vortexed to resuspend the cell pellet. Lysis was aided by incubation on a rocker at room temperature for 30 min before cell debris was collected by centrifugation at 13000 rpm for 10 min at 4 C. The cleared supernatant of soluble protein was removed and used immediately or stored at 20 C.

    Western Blotting

    [0108] Soluble protein samples were boiled in SDS containing buffer for 5 min prior to loading on 4-20% Tris-Glycine gels (NOVEX) and run at 200 V for 45 min. Protein was transferred onto PVDF membrane (Hybond-P, Amersham) and probed for the presence of various epitopes using standard techniques. For detection of the histidinetag, membranes were blocked in 5% Marvel/PBST and anti-RGSHis antibody (QIAGEN) was used as the primary antibody at 1/1000 dilution. For detection of the biotin tag, membranes were blocked in Superblock/TBS (Pierce) and probed with Streptavidin-HRP conjugate (Amersham) at 1/2000 dilution in Superblock/TBS/0.1% Tween20. The secondary antibody for the RGSHis antibody was anti-mouse IgG (Fe specific) HRP conjugate (Sigma) used at 1/2000 dilution in Marvel/PBST. After extensive washing, bound HRP conjugates were detected using either ECLPlus (Amersham) and Hyperfilm ECL (Amersham) or by DAB staining (Pierce).

    DNA Gel Shift Assay

    [0109] DNA binding function of expressed p53 was assayed using a conventional gel shift assay. Oligos DIGGADD45A (5DIG-gta cag aac atg tct aag cat get ggg gac-3; SEQ ID N0:3) and GADD45B (gtc ccc age atg ctt aga cat gtt ctg tac 3; SEQ ID N0:4) were annealed together to give a final concentration of 25 I-lM dsDNA. Binding reactions were assembled containing I l of cleared lysate, 0.2 ul of annealed DIG-labelled GADD45 oligos and 1 l of polydI/dC competitor DNA (Sigma) in 20 l of p53 buffer. Reactions were incubated at room temperature for 30 min, chilled on ice and 5 l loaded onto a pre-run 6% polyacrylamide/TBE gel (NOVEX). Gels were run at 100 V at 4 DC for 90 min before being transferred onto positively charged nitrocellulose (Roche). Membranes were blocked in 0.4% Blocking Reagent (Roche) in Buffer 1 (100 mM maleic acid, 150 mM NaCl, pH 7.0) for 30 min and probed for presence of DIG-labelled DNA with anti-DIG Fab fragments conjugated to HRP (Roche). Bound HRP conjugates were detected using ECLPlus and Hyperfilm ECL (Amersham).

    p53 Phosphorylation Assay

    [0110] Phosphorylation of p53 was performed using purified casein kinase II (CKII, Sigma). This kinase has previously been shown to phosphorylate wild type p53 at serine 392. Phosphorylation reactions contained 2 l of p53 lysate, 10 mM MgCl.sub.2, 100 M ATP and 0.1 U of CKII in 20 l of p53 buffer. Reactions were incubated at 30 C. for 30 min, reaction products separated through 4-20% NOVEX gels and transferred onto PVDF membrane. Phosphorylation of p53 was detected using an antibody specific for phosphorylation of p53 at serine 392 (Cell Signalling Technology), used at 1/1000 dilution in Marvel/TBST. Secondary antibody was an anti-rabbit HRP conjugate (Cell Signalling Technology), used at 1/2000 dilution.

    MDM2 Interaction Assay

    [0111] The cDNA for the N-terminal portion of MDM2 (amino acids 17-127) was amplified from a cDNA library and cloned downstream of sequences coding for a His-tag and a FLAG-tag in an E. coli expression vector. Plasmids were checked by sequencing for correct MDM2 sequence and induction of E. coli cultures showed expression of a His and FLAG tagged soluble protein of the expected size. To test for interaction between MDM2 and the p53 mutant panel, binding reactions were assembled containing 10 l p53 containing lysate, 10 l MDM2 containing lysate, 20 l anti-FLAG agarose in 500 l phosphate buffered saline containing 300 mM NaCl, 0.1% Tween20 and 1% (w/v) bovine serum albumin. Reactions were incubated on a rocker at room temperature for 1 hour and FLAG bound complexes harvested by centrifugation at 5000 rpm for 2 min. After extensive washing in PBST, FLAG bound complexes were denatured in SDS sample buffer and Western blotted. Presence of biotinylated p53 was detected by Streptavidin/HRP conjugate.

    p53 Microarray Fabrication and Assays

    [0112] Cleared lysates of the p53 mutant panel were loaded onto a 384 well plate and printed onto SAM2 membrane (Promega, Madison, Wis., USA) using a custom built robot (K-Biosystems, UK) with a 16 pin microarraying head. Each lysate was spotted 4 Limes onto each array, and each spot was printed onto 3 times. After printing, arrays were wet in p53 buffer and blocked in 5% Marvel/p53 buffer for 30 min. After washing 35 min in p53 buffer, arrays were ready for assay.

    [0113] For DNA binding assay, 5 l of annealed Cy3-labelled GADD45 oligo was added to 500 l p53 buffer. The probe solution was washed over the array at room temperature for 30 min, and washed for 35 min in p53 buffer. Arrays were then dried and mounted onto glass slides for scanning in an Affymetrix 428 array scanner. Quantification of Cy3 scanned images was accomplished using ImaGene software.

    [0114] For the phosphorylation assay, 10 l CKII was incubated with the arrays in 320 l p53 buffer and 80 l Mg/ATP mix at 30 C. for 30 min. Arrays were then washed for 35 min in TBST and anti-phosphoserine 392 antibody added at 1/1000 dilution in Marvel/TBST for 1 h. After washing for 35 min in TBST, anti-rabbit secondary antibody was added at 1/2000 dilution for 1 h. Bound antibody was detected by ECLPlus and Hyperfilm.

    [0115] For the MDM2 interaction assay, 1 l of purified Cy3 labelled MDM2 protein was incubated with the arrays in 500 l PBS/300 mM NaCl/0.1% Tween20/1% BSA for 1 h at room temperature. After washing for 35 min in the same buffer, arrays were dried, mounted onto glass slides and analysed for Cy3 fluorescence as for the DNA binding assay.

    Results

    [0116] Expression of p53 in E. coli and Construction of Mutant Panel

    [0117] The full length p53 open reading frame was amplified from a Hela cell cDNA library by PCR and cloned downstream of the tac promoter in vector pQE80L into which the BCCP domain from the E. coli gene ACCB had already been cloned. The resultant p53 would then be His and biotin tagged at its N-terminus, and FIG. 1 shows Western blot analysis of soluble protein from induced E. coli cultures. There is a clear signal for His-tagged, biotinylated protein at around 66 kDa, and a band of the same size is detected by the p53 specific antibody pAb1801 (data not shown). The plasmid encoding this protein was fully sequenced and shown to be wild type p53 cDNA sequence. This plasmid was used as the template to construct the mutant panel, and FIG. 1 also shows analysis of the expression of a selection of those mutants, showing full length protein as expected for the single nucleotide polymorphisms, and truncated proteins where the mutation codes for a STOP codon. The mutants were also sequenced to confirm presence of the desired mutation and absence of any secondary mutations.

    [0118] Although the Inventors have used His and biotin tags in this example of a SNP array, other affinity tags (eg FLAG, myc, VSV) can be used to enable purification of the cloned proteins. Also an expression host other than E. coli can be used (eg. yeast, insect cells, mammalian cells) if required.

    [0119] Also, although this array was focussed on the naturally occurring germline SNPs of p53, other embodiments are not necessarily restricted to naturally occurring SNPs (synthetic mutants) or versions of the wild type protein which contain more than one SNP. Other embodiments can contain versions of the protein which are deleted from either or both ends (a nested-set). Such arrays would be useful in mapping protein:ligand interactions and delineating functional domains of unknown proteins.

    E. coli Expressed p53 is Functional for DNA Binding

    [0120] To demonstrate functionality of our p53, the Inventors performed electrophoretic mobility shift assays using a DNA oligo previously shown to be bound by p53. FIG. 2 shows an example result from these gel shift assays, showing DNA binding by wild type p53 as well as mutants R72P, P82L and R181C. The first 2 mutants would still be expected to bind DNA as these mutations are outside of the DNA binding domain of p53. Having demonstrated DNA binding using a conventional gel based assay, the Inventors then wanted to show the same function for p53 arrayed on a surface. FIG. 3C shows the result of binding Cy3-labelled DNA to the p53 mutant panel arrayed onto SAM2 membrane (Promega, Madison. Wis., USA). Although the Inventors have used SAM2 membrane in this example of a SNP array, other surfaces which can be used for arraying proteins onto include but are not restricted to glass, polypropylene, polystyrene, gold or silica slides, polypropylene or polystyrene multi-well plates, or other porous surfaces such as nitrocellulose, PVDF and nylon membranes. The SAM2 membrane specifically captures biotinylated molecules and so purifies the biotinylated p53 proteins from the mutant panel cell lysates. After washing unbound DNA from the array, bound DNA was visualised using an Affymetrix DNA array scanner. As can be seen from FIG. 3, the same mutants which bound DNA in the gel shift assay also bound the most DNA when arrayed on a surface. Indeed, for a DNA binding assay the microarray assay appeared to be more sensitive than the conventional gel shift assay. This is probably because in a gel shift assay the DNA:protein complex has to remain bound during gel electrophoresis, and weak complexes may dissociate during this step. Also the 3-dimensional matrix of the SAM2 membrane used may have a caging effect. The amount of p53 protein is equivalent on each spot, as shown by an identical microarray probed for His-tagged protein (FIG. 3B).

    Use of the p53 Array for Phosphorylation Studies

    [0121] To exemplify the study of the effect of SNPs on post-translational modifications, the Inventors chose to look at phosphorylation of the p53 array by casein kinase II. This enzyme has previously been shown to phosphorylate p53 at serine 392, and the Inventors made use of a commercially available anti-p53 phosphoserine 392 specific antibody to study this event. FIG. 4 shows Western blot analysis of kinase reactions on soluble protein preparations from p53 wild type and S392A clones. Lane 1 shows phosphorylation of wild type p53 by CKII, with a background signal when CKII is omitted from the reaction (lane 2). Lanes 3 and 4 show the corresponding results for S392A, which as expected only shows background signal for phosphorylation by CKII. This assay was then applied in a microarray format, which as can be seen from FIG. 5 shows phosphorylation for all of the mutant panel except the S392A mutant and those mutants which are truncated before residue 392.

    Use of the p53 Array to Study a Protein:Protein Interaction

    [0122] To exemplify the study of a protein:protein interaction on a SNP protein array, the interaction of MDM2 with the p53 protein array was investigated. FIG. 6 shows that FLAG-tagged MDM2 pulls down wild type p53 when bound to anti-FLAG agarose. However the W23A mutant is not pulled down by FLAG agarose bound MDM2, which would be expected as this residue has previously been shown to be critical for the p53/MDM2 interaction (Bottger, A., Bottger, V., Garcia-Echeverria, C., et al, J. Mol. Biol. (1997) 269: 744-756). This assay was then carried out in a microarray format, and FIG. 7 shows the result of this assay, with Cy3-labelled protein being detected at all spots apart from the W23A and W23G mutant spots.

    [0123] The Inventors have used a novel protein chip technology to characterise the effect of 46 germline mutations on human p53 protein function. The arrayed proteins can be detected by both a His-tagged antibody and also a p53 specific antibody. This array can be used to screen for mutation specific antibodies which could have implications for p53 status diagnosis.

    [0124] The Inventors were able to demonstrate functionality of the wild type protein by conventional gel based assays, and have achieved similar results performing the assays in a microarray format. Indeed, for a DNA binding assay the microarray assay appeared to be more sensitive than the conventional gel shift assay. These arrays can be stored at 20 C in 50% glycerol and have been shown to still be functional for DNA binding after 1 month (data not shown).

    [0125] The CKII phosphorylation assay results are as expected, with phosphorylation being detected for all proteins which contained the serine at residue 392. This analysis can obviously be extended to a screen for kinases that phosphorylate p53, or for instance for kinases that differentially phosphorylate some mutants and not others, which could themselves represent potential targets in cancer.

    [0126] The MDM2 interaction assay again shows the validity of the protein array format, with results for wild type and the p53 mutants mirroring those obtained using a more conventional pull down assay. These results also show that our protein arrays can be used to detect protein:protein interactions. Potentially these arrays can be used to obtain quantitative binding data (ie K.sub.D values) for protein:protein interactions in a high-throughput manner not possible using current methodology. The fact that the MDM2 protein was pulled out of a crude E. coli lysate onto the array bodes well for envisioned protein profiling experiments, where for instance cell extracts are prepared from different patients, labelled with different fluorophores and both hybridised to the same array to look for differences in amounts of protein interacting species.

    [0127] Indeed, in Example 2 below the applicant has gone on to demonstrate that these arrays can be used to obtain quantative data.

    Example 2 Quantitative DNA Binding on the p53 Protein Microarray

    Methods

    DNA-Binding Assays.

    [0128] Oligonucleotides with the GADD45 promoter element sequence (5-gta cag aac atg tct aag cat get ggg gac-3; SEQ ID NO:3 and 5-gtc ccc age atg ctt aga cat gtt ctg tac-3; SEQ ID NO:4) were radiolabelled with gamma .sup.33P-ATP (Amersham Biosciences, Buckinghamshire, UK) and T4 kinase (Invitrogen, Carlsbad, Calif.), annealed in p53 buffer and then purified using a Nucleotide Extraction column (Qiagen, Valencia, Calif.). The duplex oligos were quantified by UV spectrophotometry and a 2.5 fold dilution series made in p53 buffer. 500 l of each dilution were incubated with microarrays at room temperature for 30 min, then washed three times for 5 min in p53 buffer to remove unbound DNA. Microarrays were then exposed to a phosphorimager plate (Fuji, Japan) overnight prior to scanning. ImaGene software (BioDiscovery, Marina del Rey, Calif.) was used to quantify the scanned images. Replicate values for all mutants at each DNA concentration were fitted to simple hyperbolic concentration-response curves R=B.sub.max/((K.sub.d/L)+l), where R is the response in relative counts and L is the DNA concentration in nM.

    Results

    Binding of p53 to GADD45 Promoter Element DNA.

    [0129] Replicate p53 microarrays were incubated in the presence of .sup.33P labelled duplex DNA, corresponding to the sequence of the GADD45 promoter element, at varying concentrations (FIG. 8A). The microarrays were imaged using a phosphorimager and individual spots quantified. The data were normalised against a calibration curve to compensate for the non-linearity of this method of detection and backgrounds were subtracted. Replicate values for all mutants were plotted and analysed by non-linear regression analysis allowing calculation of both K.sub.d and B.sub.max values (Table 1).

    TABLE-US-00001 TABLE 1 DNA binding Mutation B.sub.max (% wild-type) K.sub.d (nM) MDM2 CKII Wild-type 100 (90-110) 7 (5-10) + + W23A 131 (119-144) 7 (5-10) + W23G 84 (74-94) 5 (3-9) + R72P 121 (110-132) 9 (7-13) + + P82L 70 (63-77) 7 (5-10) + + M133T ND + + Q136X No binding + C141Y ND + + P151S ND + + P152L 31 (23-38) 18 (9-37) + + G154V ND + + R175H ND + + E180K 31 (21-41) 12 (4-35) + + R181C 88 (81-95) 11 (8-13) + + R181H 48 (40-57) 11 (6-21) + + H193R 21 (16-26) 22 (11-42) + + R196X No binding + R209X No binding + R213X No binding + P219S 21 (14-30) 10 (3-33) + + Y220C ND + + S227T 101 (94-110) 7 (5-9) + + H233N 60 (52-68) 5 (3-8) + + H233D 70 (58-84) 7 (3-14) + + N235D 32 (25-40) 27 (15-49) + + N235S 46 (36-56) 9 (4-20) + + S241F 38 (30-47) 19 (10-37) + + G245C ND + + G245S 44 (38-51) 11 (7-18) + + G245D ND + + R248W 107 (95-120) 12 (8-17) + + R248Q 85 (77-95) 17 (12-23) + + I251M ND + + L252P 22 (12-32) 16 (4-63) + + T256I 32 (22-41) 14 (6-34) + + L257Q 26 (19-35) 17 (7-44) + + F258K ND + + L265P ND + + V272L ND + + R273C 70 (56-85) 20 (11-37) + + R273H 59 (40-79) 54 (27-106) + + P278L ND + + R280K 54 (40-70) 21 (9-46) + + E286A 32 (23-41) 22 (10-46) + + R306X No binding + R306P 90 (81-100) 7 (5-11) + + G325V 73 (67-79) 7 (5-10) + + R337C 88 (80-95) 6 (4-8) + + L344P No binding + S392A 121 (107-136) 10 (6-14) +

    [0130] FIG. 8B shows DNA binding to wild-type p53 (high affinity), R273H (low affinity) and L344P (non-binder) predicting a wild-type affinity of 7 nM.

    Discussion

    DNA Binding.

    [0131] Quantitative analysis of the DNA binding data obtained from the microarrays yielded both affinities (K.sub.d) and relative maximum binding values (B.sub.max) for wild-type and mutant p53. Protein function microarrays have not previously been used in this way and this data therefore demonstrate their usefulness in obtaining this quality and amount of data in a parallel fashion. The approach of normalising binding data for the amount of affinity-tagged protein in the spot provides a rapid means of analysing large data sets [Zhu, H. et al. Global analysis of protein activities using proteome chips. Science 293, 2101-2105 (2001).], however it takes into account neither the varying specific activity of the microarrayed protein nor whether the signal is recorded under saturating or sub-saturating conditions. The quantitative analysis carried out here allowed the functional classification of mutants into groups according to GADD45 DNA binding: those showing near wild-type affinity; those exhibiting reduced stability (low B.sub.max); those showing reduced affinity (higher K.sub.d); and those showing complete loss of activity (Table 1).

    [0132] Proteins with near wild-type affinity for DNA generally had mutations located outside of the DNA-binding domain and include R72P, P82L, R306P and G325V. R337C is known to affect the oligomerisation state of p53 but at the assay temperature used here it is thought to be largely tetrameric [Davison, T. S., Yin, P., Nie, E., Kay, C. & Arrowsmith, C. H. Characterisation of the oligomerisation defects of two p53 mutants found in families with Li-Fraumeni and Li-Fraumeni like syndrome. Oncogene 17, 651-656 (1998).], consistent with the affinity measured here. By contrast, total loss of binding was observed for mutations introducing premature stop codons (Q136X, R196X, R209X and R213X) and mutations that monomerise the protein (L344P [Lomax, M. E., Barnes, D. M., Hupp, T. R., Picksley, S. M. & Camplejohn, R. S. Characterisation of p53 oligomerisation domain mutations isolated from Li-Fraumeni and Li-Fraumeni like family members. Oncogene 17, 643-649 (1998).] and the tetramerisation domain deficient R306X) as expected.

    [0133] Within the DNA-binding domain, the applicant found that mutations generally reduced or abolished DNA binding with the notable exceptions of R181C/H, S227T and H233N/D; these are all solvent exposed positions, distant from the protein-DNA interface and exhibit wild-type binding. Mutations R248Q/W, R273C/H and R280K, present at the protein-DNA interface, exhibited low affinities with K.sub.d values 2-7 times higher than wild-type (Table 1) consistent with either loss of specific protein-DNA interactions or steric hindrance through sub-optimal packing of the mutated residue.

    [0134] Many of the remaining mutants fall into a group displaying considerably reduced specific activities, apparent from very low B.sub.max values, even when normalised according to the amount of protein present in the relevant spot. For some mutants, DNA binding was compromised to such a level that although binding was observed, it was not accurately quantifiable due to low signal to background ratios e.g. P151S and G245C. For others such as L252P, low signal intensities yielded measurable K.sub.d values, but with wide confidence limits.

    [0135] To further demonstrate the applicability of the invention to protein arrays comprising at least two protein moieties derived from naturally occurring variants of a DNA sequence of interest such as, for example, those encoding proteins from phase 1 or phase 2 drug metabolising enzymes (DME's) the invention is further exemplified with reference to a p450 array. Phase 1 DME's include the Cytochrome p450's and the Flavin mono oxygenases (FMO's) and the Phase 2 DME's, UDP-glycosyltransferase (UGTs), glutathione S transferases (GSTs), sulfotransferases (SULTs), N-acetyltransferases (NATs), drug binding nuclear receptors and drug transporter proteins.

    [0136] Preferably, the full complement, or a significant proportion of human DMEs are present on the arrays of the invention. Such an array can include (numbers in parenthesis currently described in the Swiss Prot database): all the human P450s (119), FMOs (5), UDP-glycosyltransferase (UGTs) (18), GSTs (20), sulfotransferases (SULTs) (6), N-acetyltransferases (NATs) (2), drug binding nuclear receptors (33) and drug transporter proteins (6). This protein list does not include those yet to be characterised from the human genome sequencing project, splice variants known to occur for the P450s that can switch substrate specificity or polymorphisms known to affect the function and substrate specificity of both the P450s and the phase 2 DMEs.

    [0137] For example it is known that there are large differences in the frequency of occurrence of various alleles in P450s 2C9, 2D6 and 3A4 between different ethnic groups (see Tables 2, 3 and 4). These alleles have the potential to affect enzyme kinetics, substrate specificity, regio-selectivity and, where multiple products are produced, product profiles. Arrays of proteins described in this disclosure allow a more detailed examination of these differences for a particular drug and will be useful in predicting potential problems and also in effectively planning the population used for clinical trials.

    TABLE-US-00002 TABLE 2 P450 2D6 Allele Frequency Allele Ethnic Study P450 Allele Mutation Frequency Group Group Reference 2D6 *1 W.T. 26.9% Chinese 113 (1) 36.4% German 589 (2) 36% Caucasian 195 (3) 33% European 1344 (4) 2D6 *2 R296C; 13.4% Chinese 113 (1) S486T 32.4% German 589 (2) 29% Caucasian 195 (3) 27.1% European 1344 (4) 2D6 *3 Frameshift 2% German 589 (2) 1% Caucasian 195 (3) 1.9% European 1344 (4) 2D6 *4 Splicing 20.7% German 589 (2) defect 20% Caucasian 195 (3) 16.6% European 1344 (4) 1.2% Ethiopian 115 (5) 2D6 *5 Deletion 4% Caucasian 195 (3) 6.9% European 1344 (4) 2D6 *6 Splicing 0.93% German 589 (2) defect 1.3% Caucasian 195 (3) 2D6 *7 H324P 0.08% German 589 (2) 0.3% Caucasian 195 (3) 0.1% European 1344 (4) 2D6 *9 K281del 2% Caucasian 195 (3) 2.7% European 1344 (4) 2D6 *10 P34S; 50.7% Chinese 113 (1) S486T 1.53% German 589 (2) 2% Caucasian 195 (3) 1.5% European 1344 (4) 8.6% Ethiopian 115 (5) 2D6 *12 G42R; 0% German 589 (2) R296C; 0.1% European 1344 (4) S486T 2D6 *14 P34S; 0.1% European 1344 (4) G169R; R296C; S486T 2D6 *17 T107I; 0% Caucasian 195 (3) R296C; 0.1% European 1344 (4) S486T 9% Ethiopian 115 (5) 34% African 388 (6)
    All other P450 allelic variants occur at a frequency of 0.1% or less (4).

    TABLE-US-00003 TABLE 3 P450 2C9 Allele Frequency Allele Fre- Ethnic Study P450 Allele Mutation quency Group Group Reference 2C9 *1 W.T. 62% Caucasian 52 (7) 2C9 *2 R144C 17% Caucasian 52 (7) 2C9 *3 I359L 19% Caucasian 52 (7) 2C9 *4 I359T x % Japanese X (8) 2C9 *5 D360E 0% Caucasians 140 (9) 3% African- 120 (9) Americans 2C9 *7 Y358C x % X Swiss Prot

    TABLE-US-00004 TABLE 4 P450 3A4 Allele Frequency Allele Ethnic Study P450 Allele Mutation Frequency Group Group Reference 3A4 *1 W.T. >80% X 3A4 *2 S222P 2.7% Caucasian X (10) 0% African x (10) 0% Chinese x (10) 3A4 *3 M445T 1% Chinese X (10) 0.47% European 213 (11) 4% Caucasian 72 (12) 3A4 *4 I118V 2.9% Chinese 102 (13) 3A4 *5 P218R 2% Chinese 102 (13) 3A4 *7 G56D 1.4% European 213 (11) 3A4 *8 R130Q 0.33% European 213 (11) 3A4 *9 V170I 0.24% European 213 (11) 3A4 *10 D174H 0.24% European 213 (11) 3A4 *11 T363M 0.34% European 213 (11) 3A4 *12 L373F 0.34% European 213 (11) 3A4 *13 P416L 0.34% European 213 (11) 3A4 *15 R162Q 4% African 72 (12) 3A4 *17 F189S 2% Caucasian 72 (12) 3A4 *18 L293P 2% Asian 72 (12) 3A4 *19 P467S 2% Asian 72 (12)

    REFERENCES

    [0138] 1. Johansson, I., Oscarson, M., Yue, Q. Y., Bertilsson, L., Sjoqvist, F. & Ingelman-Sundberg, M. (1994) Mol Pharmacol 46, 452-9. [0139] 2. Sachse, C., Brockmoller, J., Bauer, S. & Roots, I. (1997) Am J Hum Genet 60, 284-95. [0140] 3. Griese, E. U., Zanger, U. M., Brudermanns, U., Gaedigk, A., Mikus, G., Morike, K., Stuven, T. & Eichelbaum, M. (1998) Pharmacogenetics 8, 15-26. [0141] 4. Marez, D., Legrand, M., Sabbagh, N., Guidice, J. M., Spire, C., Lalitte, J. J., Meyer, U. A. & Broly, F. (1997) Pharmacogenetics 7, 193-202. [0142] 5. Aklillu, E., Persson, I., Bertilsson, L., Johansson, 1., Rodrigues, F. & Ingelman-Sundberg, M. (1996) J Pharmacol Exp Ther 278, 441-6. [0143] 6. Dandara, C., Masimirembwa, C. M., Magimba, A., Sayi, J., Kaaya, S., Sommers, D. K., Snyman, J. R. & Hasler, J. A. (2001) Eur J Clin Pharmacol 57, 11-7. [0144] 7. Aithal, G. P., Day, C. P., Kesteven, P. J. & Daly, A. K. (1999) Lancet 353, 717-9. [0145] 8. Imai, J., Ieiri, I., Mamiya, K., Miyahara, S., Furuumi, H., Nanba, E., Yamane, M., Fukumaki, Y., Ninomiya, H., Tashiro, N., Otsubo, K. & Higuchi, S. (2000) Pharmacogenetics 10, 85-9. [0146] 9. Dickmann, L. J., Rettie, A. E., Kneller, M. B., Kim, R. B., Wood, A. J., Stein, C. M., Wilkinson, G. R. & Schwarz, U. 1. (2001) Mol Pharmacol 60, 382-7. [0147] 10. Sata, F., Sapone, A., Elizondo, G., Stocker, P., Miller, V. P., Zhcng, W., Raunio, H., Crespi, C. L. & Gonzalez, F. J. (2000) Clin Pharmacol Ther 67, 48-56. [0148] 11. Eiselt, R., Domanski, T. L., Zibat, A., Mueller, R., Presecan-Siedel, E., Hustert, E., Zanger, U. M., Brockmoller, J., Klenk, H. P., Meyer, U. A., Khan, K. K., He, Y. A., Halpert, J. R. & Wojnowski, L. (2001) Pharmacogenetics 11, 447-58. [0149] 12. Dai, D., Tang, J., Rose, R., Hodgson, E., Bienstock, R. J., Mohrenweiser, H. W. & Goldstein, J. A. (2001) J Pharmacol Exp Ther 299, 825-31. [0150] 13. Hsieh, K. P., Lin, Y. Y., Cheng, C. L., Lai, M. L., Lin, M. S., Siest, J. P. & Huang, J. D. (2001) Drug Metab Dispos 29, 268-73.

    Example 3: Cloning of Wild-Type H. sapiens Cytochrome P450 Enzymes CYP2C9, CYP2D6 and CYP3A4

    [0151] The human cytochrome p450s have a conserved region at the N-terminus, this includes a hydrophobic region which faciliates lipid association, an acidic or stop transfer region, which stops the protein being fed further into the membrane, and a partially conserved proline repeat. Three versions of the p450s were produced with deletions up to these domains, the N-terminal deletions are shown below.

    TABLE-US-00005 Construct Version N-terminal Deletion T009-C23A4 Proline 34AA T009-C13A4 Stop Transfer 25 AA T009-C33A4 Hydrophobic peptide 13 AA T015-C22C9 Proline 28AA T015-C12C9 Stop Transfer 20AA T015-C32C9 Hydrophobic peptide OAA T017-Cl 2D6 Proline 29AA T017-C22D6 Stop Transfer 18 AA T017-C32D6 Hydrophobic peptide OAA

    [0152] The human CYP2D6 was amplified by PCR from a pool of brain, heart and liver eDNA libraries (Clontech) using specific forward and reverse primers (T017F and T017R). The PCR products were cloned into the pMD004 expression vector, in frame with the N-terminal His-BCCP tag and using the NotI restriction site present in the reverse primer. To convert the CYP2D6 for expression in the C-terminal tag vector pBJWI02.2 (FIGS. 9A&B), primers were used which incorporated an SfiI cloning site at the 5 end and removed the stop codon at the 3 to allow in frame fusion with the C terminal tag. The primers T017CR together with either T017CF1, T017CF2, or T017CF3 allowed the deletion of 29, 18 and 0 amino acids from the N-terminus of CYP2D6 respectively.

    [0153] Primer sequences are as follows:

    TABLE-US-00006 T017F: (SEQIDNO:5) 5-GCTGCACGCTACCCACCAGGCCCCCTG-3. T017R: (SEQIDNO:6) 5-TTGCGGCCGCTCTTCTACTAGCGGGGCACAGCACAAAGCTCATA G-3 T017CF1: (SEQIDNO:7) 5-TATTCTCACTGGCCATTACGGCCGCTGCACGCTACCCACCAGGC CCCCTG-3 T017CF2: (SEQIDNO:8) 5-TATTCTCACTGGCCATTACGGCCGTGGACCTGATGCACCGGCGC CAACGCTGGGCTGCACGCTACCCACCAGGCCCCCTG-3 T017CF3: (SEQIDNO:9) 5-TATTCTCACTGGCCATTACGGCCATGGCTCTAGAAGCACTGGTG CCCCTGGCCGTGATAGTGGCCATCTTCCTGCTCCTGGTGGACCTGAT GCACCGGCGCCAACGC-3 T017CR: (SEQIDNO:10) 5-GCGGGGCACAGCACAAAGCTCATAGGG-3

    [0154] PCR was performed in a 5 l volume containing 0.5 M of each primer, 125-250 M dNTPs, 5 ng of template DNA, lx reaction buffer, 1-5 units of polymerase (Pfu, Pwo, or Expand long template polymerase mix), PCR cycle=95 C. 5 minutes, 95 C. 30 seconds, 50-70 C. 30 seconds, 72 C. 4 minutes35 cycles, 72 C. 10 minutes, or in the case of Expand 68 C. was used for the extension step. PCR products were resolved by agarose gel electrophoresis, those products of the correct size were excised from the gel and subsequently purified using a gel extraction kit. Purified PCR products were then digested with either SfiI or NotI and ligated into the prepared vector backbone (FIG. 9C). Correct recombinant clones were determined by PCR screening of bacterial cultures, Western blotting and by DNA sequence analysis.

    [0155] CYP3A4 and CYP2C9 were cloned from cDNA libraries by a methodology similar to that of CYP2D6. Primer sequences to amplify CYP3A4 and CYP2C9 for cloning into the N-terminal vectors are as follows:

    TABLE-US-00007 2C9 T015F: (SEQIDNO:11) 5-CTCCCTCCTGGCCCCACTCCTCTCCCAA-3 T015R: (SEQIDNO:12) 5-TTTGCGGCCGCTCTTCTATCAGACAGGAATGAAGCACAGCCTGGT A-3 3A4 T009F: (SEQIDNO:13) 5-CTTGGAATTCCAGGGCCCACACCTCTG-3 T009R: (SEQIDNO:14) 5-TTTGCGGCCGCTCTTCTATCAGGCTCCACTTACGGTGCCATCCCT TGA-3

    [0156] Primers to convert the N-terminal clones for expression in the C-terminal tagging vector are as follows:

    TABLE-US-00008 3A4 T009CF1: (SEQIDNO:15) 5-TATTCTCACTGGCCATTACGGCCTATGGAACCCATTCACATGGACT TTTTAAGAAGCTTGGAATTCCAGGGCCCACACCTCTG-3 T009CF2: (SEQIDNO:16) 5-TATTCTCACTGGCCATTACGGCCCTTGGAATTCCAGGGCCCACACC TCTG-3 T009CF3: (SEQIDNO:17) 5-TTCTCACTGGCCATTACGGCCCCTCCTGGCTGTCAGCCTGGTGCTC CCTATCTATATGGAACCCATTCACATGGACTTTTTAGG-3 T009CR: (SEQIDNO:18) 5-GGCTCCACTTACGGTGCCATCCCTTGAC-3 2C9 T015CFI: (SEQIDNO:19) 5-TATTCTCACTGGCCATTACGGCCAGACAGAGCTCTGGGAGAGGAAA ACTCCCTCCTGGCCCCACTCCTCTCCCAG-3 T015CF2: (SEQIDNO:20) 5-TATTCTCACTGGCCATTACGGCCCTCCCTCCTGGCCCCACTCCTCT CCCAG-3 T015CR: (SEQIDNO:21) 5-GACAGGAATGAAGCACAGCTGGTAGAAGG-3

    [0157] The full length or Hydrophobic peptide (C3) version of 2C9 was produced by inverse PCR using the 2C9-stop transfer clone (C 1) as the template and the following primers:

    TABLE-US-00009 2C9-hydrophobic-peptide-F: (SEQIDNO:22) 5-CTCTCATGTTTGCTTCTCCTTTCACTCTGGAGACAGCGCTCTGGGA GAGGAAAACTC-3 2C9-hydrophobic-peptide-R: (SEQIDNO:23) 5-ACAGAGCACAAGGACCACAAGAGAATCGGCCGTAAGTGCCATAGTT AATTTCTC-3

    Example 4: Cloning of NADPH-Cytochrome P450 Reductase

    [0158] NADPH-cytochrome P450 reductase was amplified from fetal liver cDNA (Clontech), the PCR primers [NADPH reductase F1 5-GATCGACATATGGGAGACTCCCACGTGGACAC-3 (SEQ ID NO:24); NADPH reductase R1 5-CCGATAAGCTFATCAGCTCCACACGTCCAGGGAG-3] (SEQ ID NO:25) incorporated a Nde I site at 5 and a Hind III site at the 3 of the gene to allow cloning. The PCR product was cloned into the pJW45 expression vector (FIGS. 10A&B)) two stop codons were included on the reverse primer to ensure that the His-tag was not translated. Correct recombinant clones were determined by PCR screening of bacterial cultures, and by sequencing.

    Example 5: Cloning of Polymorphic Variants of H. sapiens Cytochrome P450s CYP2C9, CYP2D6 and CYP3A4

    [0159] Once the correct wild-type CYP450s (FIGS. 11, 12, & 13) were cloned and verified by sequence analysis the naturally occurring polymorphisms of 2C9, 2D6 and 3A4 shown in Table 5 were created by an inverse PCR approach (except for CYP2D6*10 which was amplified and cloned as a linear PCR product in the same way as the initial cloning of CYP2D6 described in Example 3). In each case, the forward inverse PCR primer contained a 1 bp mismatch at the 5 position to substitute the wild type nucleotide for the polymorphic nucleotide as observed in the different ethnic populations.

    TABLE-US-00010 TABLE 5 Polymorphic forms of P450 2C9, 2D6 and 3A4 cloned Cytochrome P450 polymorphism Encoded amino acid subsitutions CYP2C9*1 wild-type CYF2C9*2 R144C CYF2C9*3 I359L CYP2C9*4 I359T CYP2C9*5 D360E CYP2C9*7 Y358C CYP2D6*1 wild-type CYP2D6*2 R296C, S486T CYP2D6*9 K281del CYP2D6*10 P34S, S486T CYP2D6*17 T107I, R296C, S486T CYP3A4*1 wild-type CYP3A4*2 S222P CYP3A4*3 M445T CYP3A4*4 I118V CYP3A4*5 P218R CYP3A4*15 R162Q

    [0160] The following PCR primers were used.

    TABLE-US-00011 CYP2C9*2F: (SEQIDNO:26) 5-TGTGTTCAAGAGGAAGCCCGCTG-3 CYP2C9*2R: (SEQIDNO:27) 5-GTCCTCAATGCTGCTCTTCCCCATC-3 CYP2C9*3F: (SEQIDNO:28) 5-CTTGACCTTCTCCCCACCAGCCTG-3 CYP2C9*3R: (SEQIDNO:29) 5-GTATCTCTGGACCTCGTGCACCAC-3 CYP2C9*4F: (SEQIDNO:30) 5-CTGACCTTCTCCCCACCAGCCTG-3 CYP2C9*4R: (SEQIDNO:31) 5-TGTATCTCTGGACCTCGTGCAC-3 CYP2C9*5F: (SEQIDNO:32) 5-GCTTCTCCCCACCAGCCTGC-3 CYP2C9*5R: (SEQIDNO:33) 5-TCAATGTATCTCTGGACCTCGTGC-3 CYP2C9*7F: (SEQIDNO:34) 5-GCATTGACCTTCTCCCCACCAGC-3 CYP2C9*7R: (SEQIDNO:35) 5-CACCACGTGCTCCAGGTCTCTA-3 CYP2D6*10AF1: (SEQIDNO:36) 5-TATTCTCACTGGCCA1TACGGCCGTGGACCTGATGCACCGGCGCCA ACGCTGGGCTGCACGCTACTCACCAGGCCCCCTGC-3 CYP2D6*10AR1: (SEQIDNO:37) 5-GCGGGGCACAGCACAAAGCTCATAGGGGGATGGGCTCACCAGGAAA GCAAAG-3 CYP2D6*17F: (SEQIDNO:38) 5-TCCAGATCCTGGGTITCGGGC-3 CYP2D6*17R: (SEQIDNO:39) 5-TGATGGGCACAGGCGGGCGGTC-3 CYP2D6*9F: (SEQIDNO:40) 5-GCCAAGGGGAACCCTGAGAGC-3 CYP2D6*9R: (SEQIDNO:41) 5-CTCCATCTCTGCCAGGAAGGC-3 CYP3A4*2F: (SEQIDNO:42) 5-CCAATAACAGTCTTTCCATTCCTC-3 CYP3A4*2R: (SEQIDNO:43) 5-GAGAAAGAATGGATCCAAAAAATC-3 CYP3A4*3F: (SEQIDNO:44) 5-CGAGGTTTGCTCTCATGACCATG-3 CYP3A4*3R: (SEQIDNO:45) 5-TGCCAATGCAGTTTCTGGGTCCAC-3 CYP3A4*4F: (SEQIDNO:46) 5-GTCTCTATAGCTGAGGATGAAG-3 CYP3A4*4R: (SEQIDNO:47) 5-GGCACTTTTCATAAATCCCACTG-3 CYP3A4*5F: (SEQIDNO:48) 5-GATTCTTTCTCTCAATAACAGTC-3 CYP3A4*5R: (SEQIDNO:49) 5-GATCCAAAAAATCAAATCTTAAA-3 CYP3A4*15F: (SEQIDNO:50) 5-AGGAAGCAGAGACAGGCAAGC-3 CYP3A4*15R: (SEQIDNO:51) 5-GCCTCAGATTTCTCACCAACAC-3

    Example 6: Expression and Purification of P450 3A4

    [0161] E. coli XL-10 gold (Stratagene) was used as a host for expression cultures of P450 3A4. Starter cultures were grown overnight in LB media supplemented with 100 mg per litre ampicillin. 0.5 litre Terrific Broth media plus 100 mg per litre ampicillin and 1 mM thiamine and trace elements were inoculated with 1/100 dilution of the overnight starter cultures. The flasks were shaken at 37 C. until cell density OD.sub.600 was 0.4 then -Aminolevulinic acid (ALA) was added to the cells at 0.5 mM for 20 min at 30 C. The cells were supplemented with 50 M biotin then induced with optimum concentration of IPTG (30-100 M) then shaken overnight at 30 C.

    [0162] The E. coli cells from 0.5 litre cultures were divided into 50 ml aliquots, cells pelleted by centrifugation and cell pellets stored at 20 C. Cells from each pellet were lysed by resuspending in 5 ml buffer A (100 mM Tris buffer pH 8.0 containing 100 mM EDTA, 10 mM -mercaptoethanol, 10 stock of Protease inhibitor cocktail-Roche 1836170, 0.2 mg/ml Lysozyme). After 15 minutes incubation on ice 40 ml of ice-cold deionised water was added to each resuspended cell pellet and mixed. 20 mM Magnesium Chloride and 5 g/ml DNaseI were added. The cells were incubated for 30 min on ice with gentle shaking after which the lysed E. Coli cells were pelletted by centrifugation for 30 min at 4000 rpm. The cell pellets were washed by resuspending in 10 ml buffer B (100 mM Tris buffer pH 8.0 containing 10 mM -mercaptoethanol and a 10 stock of Protease inhibitor cocktail-Roche 1836170) followed by centrifugation at 4000 rpm. Membrane associated protein was then solubilised by the addition of 2 ml buffer C (50 mM potassium phosphate pH 7.4, 10 stock of Protease inhibitor cocktail-Roche 1836170, 10 mM -mercaptoethanol, 0.5 M NaCl and 0.3% (v/v) Igepal CA-630) and incubating on ice with gentle agitation for 30 minutes before centrifugation at 10,000 g for 15 min at 4 C. and the supernatant (FIG. 14) was then applied to Talon resin (Clontech).

    [0163] A 0.5 ml column of Ni-NTA agarose (Qiagen) was poured in disposable gravity columns and equilibrated with 5 column volumes of buffer C. Supernatant was applied to the column after which the column was successively washed with 4 column volumes of buffer C, 4 column volumes of buffer D (50 mM potassium phosphate pH 7.4, 10 stock of Protease inhibitor cocktail-Roche 1836170, 10 mM -mercaptoethanol, 0.5 M NaCl and 20% (v/v) Glycerol) and 4 column volumes of buffer D+50 mM Imidazole before elution in 4 column volumes of buffer D+200 mM Imidazole (FIG. 15). 0.5 ml fractions were collected and protein containing fractions were pooled aliquoted and stored at 80 C.

    Example 7: Determination of Heme Incorporation into P450s

    [0164] Purified P450s were diluted to a concentration of 0.2 mg/ml in 20 mM potassium phosphate (pH 7.4) in the presence and absence of 10 mM KCN and an absorbance scan measured from 600-260 nm. The percentage bound heme was calculated based on an extinction coefficient .sub.420 of 100 mM.sup.1cm.sup.1.

    Example 8: Reconstitution and Assay of Cytochrome P450 Enzymes into Liposomes with NADPH-Cytochrome P450 Reductase

    [0165] Liposomes are prepared by dissolving a 1:1:1 mixture of 1,2-dilauroyl-sn-glycero-3-phosphocholine, 1,2-dileoyl-sn-glycero-3-phosphocholine, 1,2-dilauroyl-sn-glycero-3-phosphoserine in chloroform, evaporating to dryness and subsequently resuspending in 20 mM potassium phosphate pH 7.4 at 10 mg/ml. 4 g of liposomes are added to a mixture of purified P450 2D6 (20 pmol), NADPH P450 reductase (40 pmol), cytochrome b5 (20 pmol) in a total volume of 10 l and preincubated for 10 minutes at 37 C.

    [0166] After reconstitution of cytochrome P450 enzymes into liposomes, the liposomes are diluted to 100 l in assay buffer in a black 96 well plate, containing HEPES/KOH (pH 7.4, 50 mM), NADP+(2.6 mM), glucose-6-phosphate (6.6 mM), MgCl.sub.2 (6.6 mM) and glucose-6-phosphate dehyrogenase (0.4 units/ml). Assay buffer also contains an appropriate fluorogenic substrate for the cytochrome P450 isoform to be assayed: for P450 2D6 AMMC, for P450 3A4 dibenzyl fluorescein (DBF) or resorufin benzyl ether (BzRes) can be used and for 2C9 dibenzyl fluorescein (DBF). The reactions are stopped by the addition of stopping solution (80% acetonitrile buffered with Tris) and products are read using the appropriate wavelength filter sets in a fluorescent plate reader (FIG. 16).

    [0167] P450s can also be activated chemically by, for example, the addition of 200 M cumene hydroperoxide in place of the both the co-enzymes and regeneration solution (FIG. 17).

    [0168] In addition fluorescently measured rates of turnover can be measured in the presence of inhibitors.

    Example 9: Detection of Drug Binding to Immobilised P450s CYP3A4

    [0169] Purified CYP3A4 (10 g/ml in 50 mM HEPES/0.01% CHAPS, pH 7.4) was placed in streptavidin immobiliser plates (Exiqon) (100 l per well) and shaken on ice for 1 hour. The wells were aspirated and washed twice with 50 mM HEPES/0.01% CHAPS. [.sup.3H]-ketoconazole binding to immobilised protein was determined directly by scintillation counting. Saturation experiments were performed using [.sup.3H]ketoconazole (5 Ci/mmol, American Radiochemicals Inc., St. Louis) in 50 mM HEPES pH 7.4, 0.01% CHAPS and 10% Superblock (Pierce) (FIG. 18). Six concentrations of ligand were used in the binding assay (25-1000 nM) in a final assay volume of 100 l. Specific binding was defined as that displaced by 100 M ketoconazole. Each measurement was made in duplicate. After incubation for 1 hour at room temperature, the contents of the wells were aspirated and the wells washed three times with 150 l ice cold assay buffer. 100 l MicroScint 20 (Packard) was added to each well and the plates counted in a Packard TopCount microplate scintillation counter (FIG. 18).

    Example 10: Chemical Activation of Tagged, Immobilised CYP3A4

    [0170] CYP3A4 was immobilised in streptavidin immobiliser plates as described in Example 9 and was then incubated with dibenzyl fluorescein and varying concentrations (0-300 M) of cumene hydrogen peroxide. End point assays demonstrated that the tagged, immobilised CYP3A4 was functional in a turn-over assay with chemical activation (FIG. 19).

    Example 11: Immobilisation of P450s Through Gel Encapsulation of Liposomes or Microsomes

    [0171] After reconstitution of cytochrome P450 enzymes together with NADPH-cytochrome P450 reductase in liposomes or microsomes, these can then be immobilised on to a surface by encapsulation within a gel matrix such as agarose, polyurethane or polyacrylamide.

    [0172] For example, low melting temperature (LMT) (1% w/v) agarose was dissolved in 200 mM potassium phosphate p1H 7.4. This was then cooled to 37 C. on a heating block. Microsomes containing cytochrome P450 3A4, cytochrome b5 and NADPH-cytochrome P450 reductase were then diluted into the LMT agarose such that 50 l of agarose contained 20, 40 and 20 pmol of P450 3A4, NADPH-cytochrome P450 reductase and cytochrome b5 respectively. 50 l of agarose-microsomes was then added to each well of a black 96 well microtitre plate and allowed to solidify at room temperature.

    [0173] To each well, 100 l of assay buffer was added and the assay was conducted as described previously (for example, Example 8) for conventional reconstitution assay. From the data generated a comparison of the fundamental kinetics of BzRes oxidation and ketoconazole inhibition was made (Table 6) which showed that the activity of the CYP3A4 was retained after gel-encapsulation.

    TABLE-US-00012 TABLE 6 Comparison of kinetic parameters for BZRes oxidation and inhibition by ketoconazole for cytochrome P450 3A4 microsomes in solution and encapsulated in agarose. Gel encapsulated Soluble BzRes Oxidation K.sub.M (M) 49 (18) 20 (5) V.sub.max (% of soluble) 50 (6) 100 (6) Ketoconazole inhibition IC50 (nM) 86 (12) 207 (54)

    [0174] For estimation of K.sub.M and V.sub.max for BzRes assays were performed in the presence of varying concentrations of BzRes up to 320 M. Ketoconazole inhibition was performed at 50 M BzRes with 7 three-fold dilutions of ketoconazole from 5 M. Values in parenthesis indicate standard errors derived from the curve fitting.

    [0175] The activity of the immobilised P450s was assessed over a period of 7 days (FIG. 20). Aliquots of the same protein preparation stored under identical conditions, except that they were not gel-encapsulated, were also assayed over the same period, which revealed that the gel encapsualtion confers significant stability to the P450 activity.

    Example 12: Quantitative Determination of Affect of 3A4 Polymorphisms on Activity

    [0176] Purified cytochrome P450 3A4 isoforms *1, *2, *3, *4, *5 & *15 (approx 1 g) were incubated in the presence of BzRes and cumene hydrogen peroxide (200 M) in the absence and presence of ketoconazole at room temperature in 200 mM KPO.sub.4 buffer pH 7.4 in a total volume of 100 l in a 96 well black microtitre plate. A minimum of duplicates were performed for each concentration of BzRes or ketoconazole. Resorufin formation of was measured over time by the increase in fluorescence (520 nm and 580 nm excitation and emission filters respectively) and initial rates were calculated from progress curves (FIG. 21).

    [0177] For estimation of K.sub.M.sup.app and V.sub.max.sup.app for BzRes, background rates were first subtracted from the initial rates and then were plotted against BzRes concentration and curves were fitted describing conventional Michaelis-Menton kinetics:


    V=V.sub.max/(1+(K.sub.M/S))

    where V and S are initial rate and substrate concentration respectively. V.sub.max values were then normalised for cytochrome P450 concentration and scaled to the wild-type enzyme (Table 7).

    [0178] For estimation of IC.sub.50 for ketoconazole, background rates were first subtracted from the initial rates which were then converted to a % of the uninhibited rate and plotted against ketoconazole concentration (FIG. 22). IC.sub.50 inhibition curves were fitted using the equation:


    V=100(1+(I/IC.sub.50))

    where V and I are initial rate and inhibitor concentration respectively. The data obtained are shown in Table 7:

    TABLE-US-00013 TABLE 7 Kinetic parameters for BzRes turnover and its inhibition by ketoconazole for cytochrome P450 3A4 isoforms. V.sub.max BzRes K.sub.M BzRes (M) IC.sub.50 ketoconazole (M) 3A4*WT 100 (34) 104 (25) 0.91 (0.45) 3A4*2 65 (9) 62 (4) 0.44 (0.11) 3A4*3 93 (24) 54 (13) 1.13 (0.16) 3A4*4 69 (22) 111 (18) 0.88 (0.22) 3A4*5 59 (16) 101 (11) 1.96 (0.96) 3A4*15 111 (23) 89 (11) 0.59 (0.20)

    [0179] The parameters were obtained from the fits of Michaelis-Menton and ICso inhibition curves to the data in FIGS. 21 & 22. Values in parenthesis are standard errors obtained from the curve fits.

    Example 13: Array-Based Assay of Immobilised CYP3A4 Polymorphisms

    [0180] Cytochrome P450 polymorphisms can be assayed in parallel using an array format to identify subtle differences in activity with specific small molecules. For example, purified cytochrome P450 3A4 isoforms *1, *2, *3, *4, *5 & *15 can be individually reconstituted in to liposomes with NADPH-cytochrome P450 reductase as described in Example 11. The resultant liposomes preparation can then be diluted into LMP agarose and immobilised into individual wells of a black 96 well microtitre plate as described in Example 11. The immobilised proteins can then be assayed as described in Example 11 by adding 100 l of assay buffer containing BzRes+/ketoconazole to each well.

    [0181] Chemical activation (as described in Example 12) can also be used in an array format. For example, purified cytochrome P450 3A4 isoforms *1, *2, *3, *4, *5 & *15 can be individually reconstituted in to liposomes without NADPH-cytochrome P450 reductase and the resultant liposomes can be immobilised via encapsulation in agarose as described in Example 11. The cytochrome P450 activity in each well can then be measured as described in Example 12 by 100 l of 200 mM KPO.sub.4 buffer pH 7.4 containing BzRes and cumene hydrogen peroxide (200 M), +/ ketoconazole, to each well.

    [0182] In summary, the Inventors have developed a novel protein array technology for massively parallel, high-throughout screening of SNPs for the biochemical activity of the encoded proteins. Its applicability was demonstrated through the analysis of various functions of wild type p53 and 46 SNP versions of p53 as well as with allelic variants of p450. The same surface and assay detection methodologies can now be applied to other more diverse arrays currently being developed. Due to the small size of the collection of proteins being studied here, the spot density of our arrays was relatively small, and each protein was spotted in quadruplicate. Using current robotic spotting capabilities it is possible to increase spot density to include over 10,000 proteins per array.

    INCORPORATION BY REFERENCE

    [0183] The entire disclosure of each of the aforementioned patent and scientific documents cited hereinabove is expressly incorporated by reference herein.

    EQUIVALENTS

    [0184] The invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting on the invention described herein. The scope of the invention is thus indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced by reference therein.