GENOME ENGINEERING THE HUMAN IMMUNOGLOBULIN LOCUS TO EXPRESS RECOMBINANT BINDING DOMAIN MOLECULES
20220364125 · 2022-11-17
Inventors
Cpc classification
C07K16/462
CHEMISTRY; METALLURGY
C12N2310/20
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
C12N2750/14143
CHEMISTRY; METALLURGY
C07K2317/569
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
C07K2317/14
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C07K2317/64
CHEMISTRY; METALLURGY
C07K2317/76
CHEMISTRY; METALLURGY
International classification
C12N15/90
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
Abstract
The disclosure describes a genome engineering strategy that allows for the production of secreted antibody fragments or non-immunoglobulin binding domains and the corresponding cell surface B cell receptor (BCR) from a human immunoglobulin (Ig) locus, and uses thereof.
Claims
1. A method for the production of antibody fragments or non-immunoglobulin binding domains from an immunoglobulin locus, comprising: introducing a targeted DNA break in an immunoglobulin locus using a genome editing system; and inserting a promoter-driven expression construct, that expresses an antigen-binding domain, into the genome edited immunoglobulin locus, wherein the promoter-driven expression construct produces an mRNA encoding an antibody fragment or non-immunoglobulin binding domain.
2. The method of claim 1, wherein the immunoglobulin locus is a human immunoglobulin locus.
3. The method of claim 1, wherein the immunoglobulin locus is selected from the IGHG1, IGHG2, IGHG3, IGHG4, IGHD, IGHE, IGHM, IGHA1, and IGHA2.
4. The method of claim 3, wherein the immunoglobulin locus is selected from the IGHG1, IGHG2, IGHG3, and IGHG4.
5. The method of claim 4, wherein the immunoglobulin locus is IGHG1.
6. The method of claim 1, wherein the genome editing system is selected from CRISPR/Cas9, CRISPR/Cpf1, Zinc finger nucleases (ZFN), and transcription activator-like effector nucleases (TALEN).
7. The method of claim 6, wherein the genome editing system is a CRISPR/Cas9 genome editing system.
8. The method of claim 7, wherein the spCas9 guide RNAs target a polynucleotide having the sequence of sg01, sg02, sg03, sg04, sg05, sg06, sg12, sg16, or sg17 presented in Table 2.
9. The method of claim 6, wherein the genome editing system is a CRISPR/Cpf1 genome editing system.
10. The method of claim 9, wherein the Cpf1 guide RNAs target a polynucleotide having the sequence of Cpf1-g1, Cpf1-g2, Cpf1-g3, or Cpf1-g4 presented in Table 3.
11. The method of claim 6, wherein the genome editing system comprises a guide RNA (gRNA) that targets a sequence as set forth in Table 2, 3, 4 or 6.
12. The method of claim 1, wherein the targeted DNA break (i) is in a constant region downstream of a CH1 exon, (ii) is between the CH1 exon and Hinge exon, (ii) is in an intron between CH2 and CH3 region, and/or (iv) is downstream of a CH2 exon, of the immunoglobulin locus.
13. The method of claim 1, wherein the promoter-driven expression construct is inserted into the genome edited immunoglobulin locus by homology-directed repair.
14. The method of claim 1, wherein the promoter-driven expression construct comprises a B cell specific promoter.
15. The method of claim 14, wherein the B cell specific promoter is an EEK promoter or an MH promoter.
16. The method of claim 1, wherein the promoter-driven expression construct produces an mRNA that further comprises an M1 and an M2 exons of an immunoglobulin locus.
17. A method to produce an engineered B cell or an engineered precursor B cell that expresses an antibody fragment or non-immunoglobulin binding domain, comprising: treating a B cell or a precursor B cell using the method of claim 1.
18. The method of claim 17, wherein the B cell or the precursor B cell is engineered ex vivo, in vitro or in vivo.
19. An engineered B cell or an engineered precursor B cell that expresses an antibody fragment or non-immunoglobulin binding domain made by the method of claim 17.
20. A cell line comprising the engineered B cell or an engineered precursor B cell of claim 19.
21. The cell line of claim 20, wherein the engineered precursor B cell comprises an embryonic stem cell, a hematopoietic stem cell or an induced pluripotent stem cell.
22. An antibody fragment or non-immunoglobulin binding domain isolated from the engineered B cell or an engineered precursor B cell of claim 19.
23. A method of treating a subject with a microbial or viral infection, comprising: obtaining isolated B cells or precursor B cells; treating the isolated B cells or precursor B cells with the method of claim 1 to produce engineered B cells or engineered precursor B cells that express an antibody fragment or non-immunoglobulin binding domain that recognize antigen(s) from the infectious microbe or virus; administering the engineered B cells or engineered precursor B cells to the subject.
24. The method of claim 23, wherein the isolated B cells or precursor B cells are autologous to the subject.
25. The method of claim 23, wherein the isolated B cells or precursor cells are allogeneic to the subject.
26. The method of claim 23, wherein the viral infection is HIV, Hepatitis, Herpes simplex, Ebola, Dengue, influenza, and coronavirus.
27. A method of treating a subject with cancer, comprising: obtaining isolated B cells or precursor B cells; treating the isolated B cells or precursor B cells with the method of claim 1 to produce engineered B cells or engineered precursor B cells that expresses antibody fragments or non-immunoglobulin binding domains that recognize antigen(s) from a cancer cell; administering the engineered B cells or engineered precursor B cells to the subject.
28. The method of claim 27, wherein the isolated B cells or precursor B cells are autologous to the subject.
29. The method of claim 27, wherein the isolated B cells or precursor cells are allogeneic to the subject.
30. The method of claim 27, wherein the subject has a cancer selected from non-Hodgkin's lymphoma, acute lymphoblastic leukemia, B-cell lymphoma, mantle cell lymphoma, multiple myeloma, acute myeloid leukemia, colorectal cancer, breast cancer, lung cancer, ovarian cancer, and renal cancer.
31. A method of treating a subject with an autoimmune disorder, comprising: obtaining isolated B cells or precursor B cells; treating the isolated B cells or precursor B cells with the method of claim 1 to produce engineered B cells or engineered precursor B cells that expresses antibody fragments or non-immunoglobulin binding domains that can bind to and prevent activation of cytokines or receptors associated with an autoimmune disorder, or prevent aggregations or plaques associated with an autoimmune disorder; administering the engineered B cells or engineered precursor B cells to the subject.
32. The method of claim 31, wherein the isolated B cells or precursor B cells are autologous to the subject.
33. The method of claim 31, wherein the isolated B cells or precursor cells are allogeneic to the subject.
34. The method of claim 31, wherein the subject has an autoimmune disorder selected from Alzheimer's disease, Celiac disease, Addison disease, Graves disease, dermatomyositis, multiple sclerosis, rheumatoid arthritis, psoriasis, and inflammatory bowel disease.
35. A polynucleotide comprising: an antigen recognition cassette comprising a promoter operably linked to a sequence encoding a binding domain and a splice donor site compatible with an immunoglobulin exon sequence splice acceptor.
36. The polynucleotide of claim 35, further comprising at least one homology arm at the 5′ and/or 3′ end of the antigen recognition cassette.
37. The polynucleotide of claim 35, wherein the polynucleotide is present in a vector.
38. The polynucleotide of claim 37, wherein the vector is a viral vector.
39. The polynucleotide of claim 38, wherein the vector is an adeno-associated virus (AAV).
40. The polynucleotide of claim 35, wherein the promoter is a promoter functional in a mammalian cell.
41. The polynucleotide of claim 40, wherein the mammalian cell is a mammalian B-cell or B-cell precursor.
42. The polynucleotide of claim 41, wherein the B-cell precursor is an induced pluripotent stem cell, a hematopoietic stem cell or an embryonic stem cell.
43. The polynucleotide of claim 35, wherein the promoter is a constitutive promoter.
44. The polynucleotide of claim 35, wherein the promoter is an inducible promoter.
45. The polynucleotide of claim 35, wherein the binding domain comprises an antibody fragment.
46. The polynucleotide of claim 35, wherein the binding domain is a non-immunoglobulin polypeptide binding domain.
47. The polynucleotide of claim 35, wherein the binding domain interacts with an antigen selected from the group consisting of glycoproteins; bacterial or viral antigens; CD3, CD5; CD19; CD123; CD22; CD30; CD171; CS1 (also referred to as CD2 subset 1, CRACC, SLAMF7, CD319, and 19A24); C-type lectin-like molecule-1 (CLL-1 or CLECL1); CD33; epidermal growth factor receptor variant III (EGFRviii); ganglioside G2 (GD2); ganglioside GD3 (aNeu5Ac(2-8)aNeu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer); TNF receptor family member B cell maturation (BCMA); Tn antigen ((Tn Ag) or (GalNAcα-Ser/Thr)); prostate-specific membrane antigen (PSMA); Receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms Like Tyrosine Kinase 3 (FLT3); Tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; a glycosylated CD43 epitope expressed on acute leukemia or lymphoma but not on hematopoietic progenitors; a glycosylated CD43 epitope expressed on non-hematopoietic cancers; Carcinoembryonic antigen (CEA); Epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); Interleukin-13 receptor subunit alpha-2 (IL-13Ra2 or CD213A2); Mesothelin; Interleukin 11 receptor alpha (IL-11Ra); prostate stem cell antigen (PSCA); Protease Serine 21 (Testisin or PRSS21); vascular endothelial growth factor receptor 2 (VEGFR2); Lewis(Y) antigen; CD24; Platelet-derived growth factor receptor beta (PDGFR-beta); Stage-specific embryonic antigen-4 (SSEA-4); CD20; Folate receptor alpha (FRa or FR1); Folate receptor beta (FRb); Receptor tyrosine-protein kinase ERBB2 (Her2/neu); Mucin 1, cell surface associated (MUC1); epidermal growth factor receptor (EGFR); neural cell adhesion molecule (NCAM); Prostase; prostatic acid phosphatase (PAP); elongation factor 2 mutated (ELF2M); Ephrin B2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor); carbonic anhydrase IX (CAlX); Proteasome (Prosome, Macropain) Subunit, Beta Type, 9 (LMP2); glycoprotein 100 (gp100); oncogene fusion protein consisting of breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl) (bcr-abl); tyrosinase; ephrin type-A receptor 2 (EphA2); sialyl Lewis adhesion molecule (sLe); ganglioside GM3 (aNeu5Ac(2-3)bDClalp(1-4)bDGlcp(1-1)Cer); transglutaminase 5 (TGS5); high molecular weight-melanoma associated antigen (HMWMAA); o-acetyl-GD2 ganglioside (OAcGD2); tumor endothelial marker 1 (TEM1/CD248); tumor endothelial marker 7-related (TEM7R); claudin 6 (CLDN6); thyroid stimulating hormone receptor (TSHR); G protein coupled receptor class C group 5, member D (GPRC5D); chromosome X open reading frame 61 (CXORF61); CD97; CD179a; anaplastic lymphoma kinase (ALK); Polysialic acid; placenta-specific 1 (PLAC1); hexasaccharide portion of globoH glycoceramide (GloboH); mammary gland differentiation antigen (NY-BR-1); uroplakin 2 (UPK2); Hepatitis A virus cellular receptor 1 (HAVCR1); adrenoceptor beta 3 (ADRB3); pannexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); lymphocyte antigen 6 complex, locus K 9 (LY6K); Olfactory receptor 51E2 (OR51E2); TCR Gamma Alternate Reading Frame Protein (TARP); Wilms tumor protein (WT1); Cancer/testis antigen 1 (NY-ES0-1); Cancer/testis antigen 2 (LAGE-la); Melanoma-associated antigen 1 (MAGE-A1); ETS translocation-variant gene 6, located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17); X Antigen Family, Member 1A (XAGEl); angiopoietin-binding cell surface receptor 2 (Tie 2); melanoma cancer testis antigen-1 (MAD-CT-1); melanoma cancer testis antigen-2 (MAD-CT-2); Fos-related antigen 1; tumor protein p53 (p53); p53 mutant; prostein; survivin; telomerase; prostate carcinoma tumor antigen-1 (PCT A-1 or Galectin 8), melanoma antigen recognized by T cells 1 (MelanA or MARTI); Rat sarcoma (Ras) mutant; human Telomerase reverse transcriptase (hTERT); sarcoma translocation breakpoints; melanoma inhibitor of apoptosis (ML-IAP); ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene); N-Acetyl glucosaminyl-transferase V (NA17); paired box protein Pax-3 (PAX3); Androgen receptor; Cyclin B1; v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog (MYCN); Ras Homolog Family Member C (RhoC); Tyrosinase-related protein 2 (TRP-2); Cytochrome P450 1B 1 (CYP1B 1); CCCTC-Binding Factor (Zinc Finger Protein)-Like (BORIS or Brother of the Regulator of Imprinted Sites); Squamous Cell Carcinoma Antigen Recognized By T Cells 3 (SART3); Paired box protein Pax-5 (PAX5); proacrosin binding protein sp32 (OY-TESl); lymphocyte-specific protein tyrosine kinase (LCK); A kinase anchor protein 4 (AKAP-4); synovial sarcoma, X breakpoint 2 (SSX2); Receptor for Advanced Glycation End products (RAGE-1); renal ubiquitous 1 (RU1); renal ubiquitous 2 (RU2); legumain; human papilloma virus E6 (HPV E6); human papilloma virus E7 (HPV E7); intestinal carboxyl esterase; heat shock protein 70-2 mutated (mut hsp70-2); CD79a; CD79b; CD72; Leukocyte-associated immunoglobulin-like receptor 1 (LAIRl); Fc fragment of IgA receptor (FCAR or CD89); Leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLECi2A); bone marrow stromal cell antigen 2 (BST2); EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2); lymphocyte antigen 75 (LY75); Glypican-3 (GPC3); Fc receptor-like 5 (FCRL5); and immunoglobulin lambda-like polypeptide 1 (IGLLl); MPL; c-MYC epitope Tag; CD34; LAMP1; TROP2; GFRalpha4; CDH17; CDH6; NYBR1; CDH19; CD200R; Slea (CA19.9); Sialyl Lewis Antigen); Fucosyl-GM1; PTK7; gpNMB; CDH1-CD324; DLL3; CD276/B7H3; IL11Ra; IL13Ra2; CD179b-IGLl1; TCRgamma-delta; NKG2D; CD32 (FCGR2A); CD16 (FGCR3A), Tn ag; Timl-/HVCR1; CSF2RA (GM-CSFR-alpha); TGFbetaR2; Lews Ag; TCR-beta1 chain; TCR-beta2 chain; TCR-gamma chain; TCR-delta chain; FITC; Leutenizing hormone receptor (LHR); Follicle stimulating hormone receptor (FSHR); Gonadotropin Hormone receptor (CGHR or GR); CCR4; GD3; SLAMF6; SLAMF4; HIV1 envelope glycoprotein; HTLV1-Tax; CMV pp65; EBV-EBNA3c; KSHV K8.1; KSHV-gH; influenza A hemagglutinin (HA); GAD; PDL1; Guanylyl cyclase C (GCC); auto antibody to desmoglein 3 (Dsg3); auto antibody to desmoglein 1 (Dsg1); HLA; HLA-A; HLA-A2; HLA-B; HLA-C; HLA-DP; HLA-DM; HLA-DOA; HLA-DOB; HLA-DQ; HLA-DR; HLA-G; IgE; CD99; Ras G12V; Tissue Factor 1 (TF1); AFP; GPRC5D; Claudin18.2 (CLD18A2 or CLDN18A.2); P-glycoprotein; STEAP1; Liv1; Nectin-4; Cripto; gpA33; BST1/CD157; low conductance chloride channel; and the antigen recognized by TNT antibody.
48. The polynucleotide of claim 35, wherein the immunoglobulin exon sequence splice acceptor is downstream of the CH1 exon.
49. A recombinant B cell or B cell precursor comprising a heterologous promoter linked to a binding domain coding sequence and a splice donor engineered into an immunoglobulin locus of the B cell or B cell precursor.
50. The recombinant B cell or B cell precursor of claim 49, wherein the heterologous promoter is a promoter functional in a mammalian cell.
51. The recombinant B cell or B cell precursor of claim 49, wherein the B-cell precursor is an induced pluripotent stem cell, a hematopoietic stem cell or an embryonic stem cell.
52. The recombinant B cell or B cell precursor of claim 49, wherein the promoter is a constitutive promoter.
53. The recombinant B cell or B cell precursor of claim 49, wherein the promoter is an inducible promoter.
54. The recombinant B cell or B cell precursor of claim 49, wherein the binding domain coding sequence encodes an antibody fragment.
55. The recombinant B cell or B cell precursor of claim 49, wherein the binding domain coding sequence encodes a non-immunoglobulin polypeptide binding domain.
56. The recombinant B cell or B cell precursor of claim 49, wherein the binding domain interacts with an antigen selected from the group consisting of glycoproteins; bacterial or viral antigens; CD3, CD5; CD19; CD123; CD22; CD30; CD171; CS1 (also referred to as CD2 subset 1, CRACC, SLAMF7, CD319, and 19A24); C-type lectin-like molecule-1 (CLL-1 or CLECL1); CD33; epidermal growth factor receptor variant III (EGFRviii); ganglioside G2 (GD2); ganglioside GD3 (aNeu5Ac(2-8)aNeu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer); TNF receptor family member B cell maturation (BCMA); Tn antigen ((Tn Ag) or (GalNAcα-Ser/Thr)); prostate-specific membrane antigen (PSMA); Receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms Like Tyrosine Kinase 3 (FLT3); Tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; a glycosylated CD43 epitope expressed on acute leukemia or lymphoma but not on hematopoietic progenitors; a glycosylated CD43 epitope expressed on non-hematopoietic cancers; Carcinoembryonic antigen (CEA); Epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); Interleukin-13 receptor subunit alpha-2 (IL-13Ra2 or CD213A2); Mesothelin; Interleukin 11 receptor alpha (IL-11Ra); prostate stem cell antigen (PSCA); Protease Serine 21 (Testisin or PRSS21); vascular endothelial growth factor receptor 2 (VEGFR2); Lewis(Y) antigen; CD24; Platelet-derived growth factor receptor beta (PDGFR-beta); Stage-specific embryonic antigen-4 (SSEA-4); CD20; Folate receptor alpha (FRa or FR1); Folate receptor beta (FRb); Receptor tyrosine-protein kinase ERBB2 (Her2/neu); Mucin 1, cell surface associated (MUC1); epidermal growth factor receptor (EGFR); neural cell adhesion molecule (NCAM); Prostase; prostatic acid phosphatase (PAP); elongation factor 2 mutated (ELF2M); Ephrin B2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor); carbonic anhydrase IX (CAlX); Proteasome (Prosome, Macropain) Subunit, Beta Type, 9 (LMP2); glycoprotein 100 (gp100); oncogene fusion protein consisting of breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl) (bcr-abl); tyrosinase; ephrin type-A receptor 2 (EphA2); sialyl Lewis adhesion molecule (sLe); ganglioside GM3 (aNeu5Ac(2-3)bDClalp(1-4)bDGlcp(1-1)Cer); transglutaminase 5 (TGS5); high molecular weight-melanoma associated antigen (HMWMAA); o-acetyl-GD2 ganglioside (OAcGD2); tumor endothelial marker 1 (TEM1/CD248); tumor endothelial marker 7-related (TEM7R); claudin 6 (CLDN6); thyroid stimulating hormone receptor (TSHR); G protein coupled receptor class C group 5, member D (GPRC5D); chromosome X open reading frame 61 (CXORF61); CD97; CD179a; anaplastic lymphoma kinase (ALK); Polysialic acid; placenta-specific 1 (PLAC1); hexasaccharide portion of globoH glycoceramide (GloboH); mammary gland differentiation antigen (NY-BR-1); uroplakin 2 (UPK2); Hepatitis A virus cellular receptor 1 (HAVCR1); adrenoceptor beta 3 (ADRB3); pannexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); lymphocyte antigen 6 complex, locus K 9 (LY6K); Olfactory receptor 51E2 (OR51E2); TCR Gamma Alternate Reading Frame Protein (TARP); Wilms tumor protein (WT1); Cancer/testis antigen 1 (NY-ES0-1); Cancer/testis antigen 2 (LAGE-la); Melanoma-associated antigen 1 (MAGE-A1); ETS translocation-variant gene 6, located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17); X Antigen Family, Member 1A (XAGEl); angiopoietin-binding cell surface receptor 2 (Tie 2); melanoma cancer testis antigen-1 (MAD-CT-1); melanoma cancer testis antigen-2 (MAD-CT-2); Fos-related antigen 1; tumor protein p53 (p53); p53 mutant; prostein; survivin; telomerase; prostate carcinoma tumor antigen-1 (PCT A-1 or Galectin 8), melanoma antigen recognized by T cells 1 (MelanA or MARTI); Rat sarcoma (Ras) mutant; human Telomerase reverse transcriptase (hTERT); sarcoma translocation breakpoints; melanoma inhibitor of apoptosis (ML-IAP); ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene); N-Acetyl glucosaminyl-transferase V (NA17); paired box protein Pax-3 (PAX3); Androgen receptor; Cyclin B1; v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog (MYCN); Ras Homolog Family Member C (RhoC); Tyrosinase-related protein 2 (TRP-2); Cytochrome P450 1B 1 (CYP1B 1); CCCTC-Binding Factor (Zinc Finger Protein)-Like (BORIS or Brother of the Regulator of Imprinted Sites); Squamous Cell Carcinoma Antigen Recognized By T Cells 3 (SART3); Paired box protein Pax-5 (PAX5); proacrosin binding protein sp32 (OY-TESl); lymphocyte-specific protein tyrosine kinase (LCK); A kinase anchor protein 4 (AKAP-4); synovial sarcoma, X breakpoint 2 (SSX2); Receptor for Advanced Glycation End products (RAGE-1); renal ubiquitous 1 (RU1); renal ubiquitous 2 (RU2); legumain; human papilloma virus E6 (HPV E6); human papilloma virus E7 (HPV E7); intestinal carboxyl esterase; heat shock protein 70-2 mutated (mut hsp70-2); CD79a; CD79b; CD72; Leukocyte-associated immunoglobulin-like receptor 1 (LAIRl); Fc fragment of IgA receptor (FCAR or CD89); Leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2); lymphocyte antigen 75 (LY75); Glypican-3 (GPC3); Fc receptor-like 5 (FCRL5); and immunoglobulin lambda-like polypeptide 1 (IGLLl); MPL; c-MYC epitope Tag; CD34; LAMP1; TROP2; GFRalpha4; CDH17; CDH6; NYBR1; CDH19; CD200R; Slea (CA19.9); Sialyl Lewis Antigen); Fucosyl-GM1; PTK7; gpNMB; CDH1-CD324; DLL3; CD276/B7H3; IL11Ra; IL13Ra2; CD179b-IGLl1; TCRgamma-delta; NKG2D; CD32 (FCGR2A); CD16 (FGCR3A), Tn ag; Timl-/HVCR1; CSF2RA (GM-CSFR-alpha); TGFbetaR2; Lews Ag; TCR-beta1 chain; TCR-beta2 chain; TCR-gamma chain; TCR-delta chain; FITC; Leutenizing hormone receptor (LHR); Follicle stimulating hormone receptor (FSHR); Gonadotropin Hormone receptor (CGHR or GR); CCR4; GD3; SLAMF6; SLAMF4; HIV1 envelope glycoprotein; HTLV1-Tax; CMV pp65; EBV-EBNA3c; KSHV K8.1; KSHV-gH; influenza A hemagglutinin (HA); GAD; PDL1; Guanylyl cyclase C (GCC); auto antibody to desmoglein 3 (Dsg3); auto antibody to desmoglein 1 (Dsg1); HLA; HLA-A; HLA-A2; HLA-B; HLA-C; HLA-DP; HLA-DM; HLA-DOA; HLA-DOB; HLA-DQ; HLA-DR; HLA-G; IgE; CD99; Ras G12V; Tissue Factor 1 (TF1); AFP; GPRC5D; Claudin18.2 (CLD18A2 or CLDN18A.2); P-glycoprotein; STEAP1; Liv1; Nectin-4; Cripto; gpA33; BST1/CD157; low conductance chloride channel; and the antigen recognized by TNT antibody.
Description
DESCRIPTION OF DRAWINGS
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
DETAILED DESCRIPTION
[0055] As used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “an immune cell” includes a plurality of such immune cells and reference to “the single chain antibody” includes reference to single chain antibodies and equivalents thereof known to those skilled in the art, and so forth.
[0056] Also, the use of “or” means “and/or” unless stated otherwise. Similarly, “comprise,” “comprises,” “comprising” “include,” “includes,” and “including” are interchangeable and not intended to be limiting.
[0057] It is to be further understood that where descriptions of various embodiments use the term “comprising,” those skilled in the art would understand that in some specific instances, an embodiment can be alternatively described using language “consisting essentially of” or “consisting of.”
[0058] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Allen et al., Remington: The Science and Practice of Pharmacy 22.sup.nd ed., Pharmaceutical Press (Sep. 15, 2012); Hornyak et al., Introduction to Nanoscience and Nanotechnology, CRC Press (2008); Singleton and Sainsbury, Dictionary of Microbiology and Molecular Biology 3.sup.rd ed., revised ed., J. Wiley & Sons (New York, N.Y. 2006); Smith, March's Advanced Organic Chemistry Reactions, Mechanisms and Structure 7.sup.th ed., J. Wiley & Sons (New York, N.Y. 2013); Singleton, Dictionary of DNA and Genome Technology 3.sup.rd ed., Wiley-Blackwell (Nov. 28, 2012); and Green and Sambrook, Molecular Cloning: A Laboratory Manual 4th ed., Cold Spring Harbor Laboratory Press (Cold Spring Harbor, N.Y. 2012), provide one skilled in the art with a general guide to many of the terms used in the present application. For references on how to prepare antibodies, see Greenfield, Antibodies A Laboratory Manual 2.sup.nd ed., Cold Spring Harbor Press (Cold Spring Harbor N.Y., 2013); Köhler and Milstein, Derivation of specific antibody-producing tissue culture and tumor lines by cell fusion, Eur. J. Immunol. 1976 July, 6(7):511-9; Queen and Selick, Humanized immunoglobulins, U.S. Pat. No. 5,585,089 (1996 December); and Riechmann et al., Reshaping human antibodies for therapy, Nature 1988 Mar. 24, 332(6162):323-7. All headings and subheading provided herein are solely for ease of reading and should not be construed to limit the invention. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and specific examples are illustrative only and not intended to be limiting. All publications mentioned herein are incorporated herein by reference in full for the purpose of describing and disclosing the methodologies, which might be used in connection with the description herein. Moreover, with respect to any term that is presented in one or more publications that is similar to, or identical with, a term that has been expressly defined in this disclosure, the definition of the term as expressly provided in this disclosure will control in all respects.
[0059] It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention, which is defined solely by the claims.
[0060] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term “about.” The term “about” when used to describe the present invention, in connection with percentages means±1%.
[0061] The term “adeno-associated virus” or “AAV” as used herein refers to a member of the class of viruses associated with this name and belonging to the genus dependoparvovirus, family Parvoviridae. Multiple serotypes of this virus are known to be suitable for gene delivery; all known serotypes can infect cells from various tissue types. At least 11, sequentially numbered, are disclosed in the prior art. Non-limiting exemplary serotypes useful for the purposes disclosed herein include any of the 11 serotypes, e.g., AAV2 and AAV6. The term “lentivirus” as used herein refers to a member of the class of viruses associated with this name and belonging to the genus lentivirus, family Retroviridae. While some lentiviruses are known to cause diseases, other lentivirus are known to be suitable for gene delivery. See, e.g., Tomás et al. (2013) Biochemistry, Genetics and Molecular Biology: “Gene Therapy—Tools and Potential Applications,” ISBN 978-953-51-1014-9, DOI: 10.5772/52534.
[0062] The term “antibody” is used herein in the broadest sense and encompasses various antibody structures including, but not limited to, monoclonal antibodies, polyclonal antibodies, monospecific antibodies (e.g., antibodies consisting of a single heavy chain sequence and a single light chain sequence, including multimers of such pairings), multispecific antibodies (e.g., bispecific antibodies) and antibody fragments so long as they exhibit the desired antigen-binding activity. The “class” of an antibody refers to the type of constant domain or constant region possessed by its heavy chain. There are five major classes of antibodies: IgA, IgD, IgE, IgG and IgM, and several of these can be further divided into subclasses (isotypes), e.g., IgG.sub.1, IgG.sub.2, IgG.sub.3, IgG.sub.4, IgA.sub.1, and IgA.sub.2. The heavy chain constant domains that correspond to the different classes of immunoglobulins are called a, δ, ε, γ, and μ, respectively. The light chain of an antibody can be assigned to one of two types, called kappa (κ) and lambda (λ), based on the amino acid sequence of its constant domain.
[0063] The term “antibody fragment” refers to at least one portion of an antibody, that retains the ability to specifically interact with (e.g., by binding, steric hindrance, stabilizing/destabilizing, spatial distribution) an epitope of an antigen. Examples of antibody fragments include, but are not limited to, Fab, Fab′, Fab′h, Fv fragments, scFv antibody fragments, disulfide-linked Fvs (sdFv), a Fd fragment consisting of the VH and CH1 domains, linear antibodies, single domain antibodies such as sdAb (either vL or vH), camelid vHH domains, multi-specific antibodies formed from antibody fragments such as a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region, and an isolated CDR or other epitope binding fragments of an antibody. An antigen binding fragment can also be incorporated into single domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g., Hollinger and Hudson, Nature Biotechnology 23:1126-1136, 2005). Antigen binding fragments can also be grafted into scaffolds based on polypeptides such as a fibronectin type III (Fn3) (see U.S. Pat. No. 6,703,199, which describes fibronectin polypeptide mini bodies).
[0064] The term “antibody heavy chain,” refers to the larger of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations, and which normally determines the class to which the antibody belongs.
[0065] The term “antibody light chain,” refers to the smaller of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations. Kappa (κ) and lambda (λ) light chains refer to the two major antibody light chain isotypes.
[0066] The term “antigen” or “Ag” refers to a molecule that provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both. The skilled artisan will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an “antigen” as that term is used herein. Furthermore, one skilled in the art will understand that an antigen need not be encoded solely by a full-length nucleotide sequence of a gene. It is readily apparent that the disclosure includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to encode polypeptides that elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a “gene” at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample, or might be macromolecule besides a polypeptide. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a fluid with other biological components.
[0067] Non-limiting examples of target antigens include: antigens associated with infectious agents including, but are not limited to proteins, glycoproteins (e.g., surface or coat proteins of bacteria or viruses), mixtures of proteins (e.g., bacterial cell lysate), other detectable compounds associated with an infectious agent or particles (e.g., virus-like particles or viral coat proteins, bacterial surface antigens, etc.); CD3, CD5, CD19; CD123; CD22; CD30; CD171; CS1 (also referred to as CD2 subset 1, CRACC, SLAMF7, CD319, and 19A24); C-type lectin-like molecule-1 (CLL-1 or CLECL1); CD33; epidermal growth factor receptor variant III (EGFRviii); ganglioside G2 (GD2); ganglioside GD3 (aNeu5Ac(2-8)aNeu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer); TNF receptor family member B cell maturation (BCMA); Tn antigen ((Tn Ag) or (GalNAcα-Ser/Thr)); prostate-specific membrane antigen (PSMA); Receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms Like Tyrosine Kinase 3 (FLT3); Tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; a glycosylated CD43 epitope expressed on acute leukemia or lymphoma but not on hematopoietic progenitors, a glycosylated CD43 epitope expressed on non-hematopoietic cancers, Carcinoembryonic antigen (CEA); Epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); Interleukin-13 receptor subunit alpha-2 (IL-13Ra2 or CD213A2); Mesothelin; Interleukin 11 receptor alpha (IL-11Ra); prostate stem cell antigen (PSCA); Protease Serine 21 (Testisin or PRSS21); vascular endothelial growth factor receptor 2 (VEGFR2); Lewis(Y) antigen; CD24; Platelet-derived growth factor receptor beta (PDGFR-beta); Stage-specific embryonic antigen-4 (SSEA-4); CD20; Folate receptor alpha (FRa or FR1); Folate receptor beta (FRb); Receptor tyrosine-protein kinase ERBB2 (Her2/neu); Mucin 1, cell surface associated (MUC1); epidermal growth factor receptor (EGFR); neural cell adhesion molecule (NCAM); Prostase; prostatic acid phosphatase (PAP); elongation factor 2 mutated (ELF2M); Ephrin B2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAlX); Proteasome (Prosome, Macropain) Subunit, Beta Type, 9 (LMP2); glycoprotein 100 (gp100); oncogene fusion protein consisting of breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl) (bcr-abl); tyrosinase; ephrin type-A receptor 2 (EphA2); sialyl Lewis adhesion molecule (sLe); ganglioside GM3 (aNeu5Ac(2-3)bDClalp(1-4)bDGlcp(1-1)Cer); transglutaminase 5 (TGS5); high molecular weight-melanoma associated antigen (HMWMAA); o-acetyl-GD2 ganglioside (OAcGD2); tumor endothelial marker 1 (TEM1/CD248); tumor endothelial marker 7-related (TEM7R); claudin 6 (CLDN6); thyroid stimulating hormone receptor (TSHR); G protein coupled receptor class C group 5, member D (GPRC5D); chromosome X open reading frame 61 (CXORF61); CD97; CD179a; anaplastic lymphoma kinase (ALK); Polysialic acid; placenta-specific 1 (PLAC1); hexasaccharide portion of globoH glycoceramide (GloboH); mammary gland differentiation antigen (NY-BR-1); uroplakin 2 (UPK2); Hepatitis A virus cellular receptor 1 (HAVCR1); adrenoceptor beta 3 (ADRB3); pannexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); lymphocyte antigen 6 complex, locus K 9 (LY6K); Olfactory receptor 51E2 (OR51E2); TCR Gamma Alternate Reading Frame Protein (TARP); Wilms tumor protein (WT1); Cancer/testis antigen 1 (NY-ES0-1); Cancer/testis antigen 2 (LAGE-la); Melanoma-associated antigen 1 (MAGE-A1); ETS translocation-variant gene 6, located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17); X Antigen Family, Member 1A (XAGEl); angiopoietin-binding cell surface receptor 2 (Tie 2); melanoma cancer testis antigen-1 (MAD-CT-1); melanoma cancer testis antigen-2 (MAD-CT-2); Fos-related antigen 1; tumor protein p53 (p53); p.sup.53 mutant; prostein; survivin; telomerase; prostate carcinoma tumor antigen-1 (PCT A-1 or Galectin 8), melanoma antigen recognized by T cells 1 (MelanA or MARTI); Rat sarcoma (Ras) mutant; human Telomerase reverse transcriptase (hTERT); sarcoma translocation breakpoints; melanoma inhibitor of apoptosis (ML-IAP); ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene); N-Acetyl glucosaminyl-transferase V (NA17); paired box protein Pax-3 (PAX3); Androgen receptor; Cyclin B1; v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog (MYCN); Ras Homolog Family Member C (RhoC); Tyrosinase-related protein 2 (TRP-2); Cytochrome P450 1B 1 (CYP1B 1); CCCTC-Binding Factor (Zinc Finger Protein)-Like (BORIS or Brother of the Regulator of lmprinted Sites), Squamous Cell Carcinoma Antigen Recognized By T Cells 3 (SART3); Paired box protein Pax-5 (PAX5); proacrosin binding protein sp32 (OY-TESl); lymphocyte-specific protein tyrosine kinase (LCK); A kinase anchor protein 4 (AKAP-4); synovial sarcoma, X breakpoint 2 (SSX2); Receptor for Advanced Glycation End products (RAGE-1); renal ubiquitous 1 (RU1); renal ubiquitous 2 (RU2); legumain; human papilloma virus E6 (HPV E6); human papilloma virus E7 (HPV E7); intestinal carboxyl esterase; heat shock protein 70-2 mutated (mut hsp70-2); CD79a; CD79b; CD72; Leukocyte-associated immunoglobulin-like receptor 1 (LAIRl); Fc fragment of IgA receptor (FCAR or CD89); Leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2); lymphocyte antigen 75 (LY75); Glypican-3 (GPC3); Fc receptor-like 5 (FCRL5); and immunoglobulin lambda-like polypeptide 1 (IGLLl), MPL, Biotin, c-MYC epitope Tag, CD34, LAMP1 TROP2, GFRalpha4, CDH17, CDH6, NYBR1, CDH19, CD200R, Slea (CA19.9; Sialyl Lewis Antigen); Fucosyl-GM1, PTK7, gpNMB, CDH1-CD324, DLL3, CD276/B7H3, IL11Ra, IL13Ra2, CD179b-IGLl1, TCRgamma-delta, NKG2D, CD32 (FCGR2A), Tn ag, Timl-/HVCR1, CSF2RA (GM-CSFR-alpha), TGFbetaR2, Lews Ag, TCR-beta1 chain, TCR-beta2 chain, TCR-gamma chain, TCR-delta chain, FITC, Leutenizing hormone receptor (LHR), Follicle stimulating hormone receptor (FSHR), Gonadotropin Hormone receptor (CGHR or GR), CCR4, GD3, SLAMF6, SLAMF4, HIV1 envelope glycoprotein, HTLV1-Tax, CMV pp65, EBV-EBNA3c, KSHV K8.1, KSHV-gH, influenza A hemagglutinin (HA), GAD, PDL1, Guanylyl cyclase C (GCC), auto antibody to desmoglein 3 (Dsg3), auto antibody to desmoglein 1 (Dsg1), HLA, HLA-A, HLA-A2, HLA-B, HLA-C, HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, HLA-DR, HLA-G, IgE, CD99, Ras G12V, Tissue Factor 1 (TF1), AFP, GPRC5D, Claudin18.2 (CLD18A2 or CLDN18A.2)), P-glycoprotein, STEAP1, Liv1, Nectin-4, Cripto, gpA33, BST1/CD157, low conductance chloride channel, and the antigen recognized by TNT antibody. In a particular embodiment, the first VHH fragment has specificity to a tumor antigen. In a particular embodiment, the tumor antigen is selected from CEA, EGFR, Her2, EpCAM, CD20, CD30, CD33, CD47, CD52, CD133, CEA, gpA33, Mucins, TAG-72, CIX, PSMA, folate-binding protein, GD2, GD3, GM2, VEGF, VEGFR, Integrin, o/β3, α5β1, ERBB2, ERBB3, MET, IGF1 R, EPHA3, TRAILR1, TRAILR2, RANKL, FAP and Tenascin.
[0068] As used herein “affinity” is meant to describe a measure of binding strength. Affinity, in some instances, depends on the closeness of stereochemical fit between a binding agent and its target (e.g., between an antibody and antigen including epitopes specific for the binding domain), on the size of the area of contact between them, and on the distribution of charged and hydrophobic groups. Affinity generally refers to the “ability” of the binding agent to bind its target. There are numerous ways used in the art to measure “affinity”. For example, methods for calculating the affinity of an antibody for an antigen are known in the art, including use of binding experiments to calculate affinity. Binding affinity may be determined using various techniques known in the art, for example, surface plasmon resonance, bio-layer interferometry, dual polarization interferometry, static light scattering, dynamic light scattering, isothermal titration calorimetry, ELISA, analytical ultracentrifugation, and flow cytometry. An exemplary method for determining binding affinity employs surface plasmon resonance. Surface plasmon resonance is an optical phenomenon that allows for the analysis of real-time biospecific interactions by detection of alterations in protein concentrations within a biosensor matrix, for example using the BIAcore system (Pharmacia Biosensor AB, Uppsala, Sweden and Piscataway, N.J.).
[0069] As used herein an “antigen recognition cassette” comprises a polynucleotide encoding a binding domain that binds to a desired target (e.g., an antigen) linked to a splice donor sequence and driven by a regulatory element such as a promoter.
[0070] As used herein, the term “binding domain” refers to a domain or portion of a larger molecule that has a binding specificity for a second molecule and binds to that second molecule with an affinity higher than a non-specific domain. Binding domains are present in antibody and antibody fragments as well as on certain receptors and other molecules (e.g., non-immunoglobulin binding scaffolds). Typically a molecule that has a binding domain is a protein, e.g., an immunoglobulin chain or fragment thereof, comprising at least one domain, e.g., immunoglobulin variable domain sequence that can bind to a target with affinity higher than a non-specific domain. The term encompasses antibodies and antibody fragments. In another embodiment, an antibody molecule is a multispecific antibody molecule, e.g., it comprises a plurality of immunoglobulin variable domain sequences (a plurality of binding domains), wherein a first immunoglobulin variable domain sequence of the plurality has binding specificity for a first epitope and a second immunoglobulin variable domain sequence of the plurality has binding specificity for a second epitope. In another embodiment, a multispecific antibody molecule is a bispecific antibody molecule. A bispecific antibody has specificity for two antigens. A bispecific antibody molecule is characterized by a first immunoglobulin variable domain sequence which has binding specificity for a first epitope and a second immunoglobulin variable domain sequence that has binding specificity for a second epitope.
[0071] “Cancer” and “cancerous” refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include, but are not limited to B-cell lymphomas (Hodgkin's lymphomas and/or non-Hodgkins lymphomas), T cell lymphomas, myeloma, myelodysplastic syndrome, skin cancer, brain tumor, breast cancer, colon cancer, rectal cancer, esophageal cancer, anal cancer, cancer of unknown primary site, endocrine cancer, testicular cancer, lung cancer, hepatocellular cancer, gastric cancer, pancreatic cancer, cervical cancer, ovarian cancer, liver cancer, bladder cancer, cancer of the urinary tract, cancer of reproductive organs thyroid cancer, renal cancer, carcinoma, melanoma, head and neck cancer, brain cancer (e.g., glioblastoma multiforme), prostate cancer, including but not limited to androgen-dependent prostate cancer and androgen-independent prostate cancer, and leukemia. Other cancer and cell proliferative disorders will be readily recognized in the art. The terms “tumor” and “cancer” are used interchangeably herein, e.g., both terms encompass solid and liquid, e.g., diffuse or circulating, tumors. As used herein, the term “cancer” or “tumor” includes premalignant, as well as malignant cancers and tumors.
[0072] The term “Cas9” refers to a CRISPR-associated, RNA-guided endonuclease such as Streptococcus pyogenes Cas9 (spCas9) and orthologs and biological equivalents thereof. Biological equivalents of Cas9 include but are not limited to C2c1 from Alicyclobacillus acideterrestris and Cpf1 (which performs cutting functions analogous to Cas9) from various bacterial species including Acidaminococcus spp. and Francisella novicida U112. Cas9 may refer to an endonuclease that causes double stranded breaks in DNA, a nickase variant such as a RuvC or HNH mutant that causes a single stranded break in DNA, as well as other variations such as deadCas-9 or dCas9, which lack endonuclease activity. Cas9 may also refer to “split-Cas9” in which CAs9 is split into two halves—C-Cas9 and N-Cas9—and fused with a two intein moieties. See, e.g., U.S. Pat. No. 9,074,199 B1; Zetsche et al. (2015) Nat Biotechnol. 33(2):139-42; Wright et al. (2015) PNAS 112(10) 2984-89. Non-limiting examples of commercially available sources of SpCas9 comprising plasmids can be found under the following AddGene reference numbers: [0073] 42230: PX330; SpCas9 and single guide RNA [0074] 48138: PX458; SpCas9-2A-EGFP and single guide RNA [0075] 62988: PX459; SpCas9-2A-Puro and single guide RNA [0076] 48873: PX460; SpCas9n (D10A nickase) and single guide RNA [0077] 48140: PX461; SpCas9n-2A-EGFP (D10A nickase) and single guide RNA [0078] 62987: PX462; SpCas9n-2A-Puro (D10A nickase) and single guide RNA [0079] 48137: PX165; SpCas9
[0080] As used herein, the term “complementary” when used in reference to a polynucleotide is intended to mean a polynucleotide that includes a nucleotide sequence capable of selectively annealing to an identifying region of a target polynucleotide under certain conditions. As used herein, the term “substantially complementary” and grammatical equivalents is intended to mean a polynucleotide that includes a nucleotide sequence capable of specifically annealing to an identifying region of a target polynucleotide under certain conditions. Annealing refers to the nucleotide base-pairing interaction of one nucleic acid with another nucleic acid that results in the formation of a duplex, triplex, or other higher-ordered structure. The primary interaction is typically nucleotide base specific, e.g., A:T, A:U, and G:C, by Watson-Crick and Hoogsteen-type hydrogen bonding. In certain embodiments, base-stacking and hydrophobic interactions can also contribute to duplex stability. Conditions under which a polynucleotide anneals to complementary or substantially complementary regions of target nucleic acids are well known in the art, e.g., as described in Nucleic Acid Hybridization, A Practical Approach, Hames and Higgins, eds., IRL Press, Washington, D.C. (1985) and Wetmur and Davidson, Mol. Biol. 31:349 (1968). Annealing conditions will depend upon the particular application, and can be routinely determined by persons skilled in the art, without undue experimentation.
[0081] As used herein, the term “CRISPR” refers to Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR). CRISPR may also refer to a technique or system of sequence-specific genetic manipulation relying on the CRISPR pathway. A CRISPR recombinant expression system can be programmed to cleave a target polynucleotide using a CRISPR endonuclease and a guide RNA. A CRISPR system can be used to cause double stranded or single stranded breaks in a target polynucleotide. A CRISPR system can also be used to recruit proteins or label a target polynucleotide. In some aspects, CRISPR-mediated gene editing utilizes the pathways of nonhomologous end-joining (NHEJ) or homologous recombination to perform the edits. These applications of CRISPR technology are known and widely practiced in the art. See, e.g., U.S. Pat. No. 8,697,359 and Hsu et al. (2014) Cell 156(6): 1262-1278. When utilized for genome editing, the system includes Cas9 (a protein able to modify DNA utilizing crRNA as its guide), CRISPR RNA (crRNA, contains the RNA used by Cas9 to guide it to the correct section of host DNA along with a region that binds to tracrRNA (generally in a hairpin loop form) forming an active complex with Cas9), and trans-activating crRNA (tracrRNA, binds to crRNA and forms an active complex with Cas9). In addition to expression of the Cas9 nuclease, the CRISPR-Cas9 system uses an RNA molecule to recruit and direct the nuclease activity to target polynucleotide sequence of interest. These guide RNAs (gRNAs) take one of two forms: (i) a synthetic or expressed trans-activating CRISPR RNA (tracrRNA) plus a CRISPR RNA (crRNA) designed to cleave the gene target site of interest and (ii) a synthetic or expressed single guide RNA (sgRNA) that consists of both the crRNA and tracrRNA as a single construct. The crRNA and the tracrRNA form a complex which acts as the guide RNA for the Cas9 enzyme. The scaffolding ability of tracrRNA along with crRNA specificity can be combined into a single synthetic gRNA which simplifies guiding of gene alterations to a one component system which can increase efficiencies.
[0082] The term “encode” as it is applied to nucleic acid sequences refers to a polynucleotide which is said to “encode” a polypeptide if, in its native state or when manipulated by methods well known to those skilled in the art, can be transcribed and/or translated to produce the mRNA for the polypeptide and/or a fragment thereof. The antisense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom.
[0083] The terms “equivalent” or “biological equivalent” are used interchangeably when referring to a particular molecule, biological, or cellular material and intend those having minimal homology while still maintaining desired structure or functionality.
[0084] As used herein, the term “expression” refers to the process by which polynucleotides are transcribed into mRNA and/or the process by which the transcribed mRNA is subsequently being translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. The expression level of a gene may be determined by measuring the amount of mRNA or protein in a cell or tissue sample; further, the expression level of multiple genes can be determined to establish an expression profile for a particular sample.
[0085] The term “expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
[0086] As used herein, the term “functional” may be used to modify any molecule, biological, or cellular material to intend that it accomplishes a particular, specified effect.
[0087] The term “gRNA” or “guide RNA” as used herein refers to the guide RNA sequences used to target specific genes for correction employing the CRISPR technique. Techniques of designing gRNAs and donor therapeutic polynucleotides for target specificity are well known in the art. For example, Doench, J., et al. Nature biotechnology 2014; 32(12):1262-7, Mohr, S. et al. (2016) FEBS Journal 283: 3232-38, and Graham, D., et al. Genome Biol. 2015; 16: 260. gRNA comprises or alternatively consists essentially of, or yet further consists of a fusion polynucleotide comprising CRISPR RNA (crRNA) and trans-activating CRIPSPR RNA (tracrRNA); or a polynucleotide comprising CRISPR RNA (crRNA) and trans-activating CRIPSPR RNA (tracrRNA). In some aspects, a gRNA is synthetic (Kelley, M. et al. (2016) J of Biotechnology 233 (2016) 74-83). The terms “guide RNA” and “gRNA” refer to any nucleic acid that promotes the specific association (or “targeting”) of an RNA-guided nuclease such as a Cas9 to a target sequence such as a genomic or episomal sequence in a cell. gRNAs can be unimolecular (comprising a single RNA molecule, and referred to alternatively as chimeric) or modular (comprising more than one, and typically two, separate RNA molecules, such as a crRNA and a tracrRNA, which are usually associated with one another, for instance by duplexing). CRISPR/Cas9 strategies can employ a vector to transfect the mammalian cell. The guide RNA (gRNA) can be designed for each application as this is the sequence that Cas9 uses to identify and directly bind to the target DNA in a cell. Multiple crRNAs and the tracrRNA can be packaged together to form a single-guide RNA (sgRNA). The sgRNA can be joined together with the Cas9 gene and made into a vector in order to be transfected into cells. The disclosure provides gRNAs comprising SEQ ID Nos: 15-33, wherein T is replaced with U.
[0088] “Homology” or “identity” or “similarity” refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An “unrelated” or “non-homologous” sequence shares less than 40% identity, or alternatively less than 25% identity, with one of the sequences of the present invention.
[0089] The term “lentivirus” refers to a genus of the Retroviridae family. Lentiviruses are unique among the retroviruses in being able to infect non-dividing cells; they can deliver a significant amount of genetic information into the DNA of the host cell, so they are one of the most efficient methods of a gene delivery vector. HIV, SIV, and FIV are all examples of lentiviruses.
[0090] The term “lentiviral vector” refers to a vector derived from at least a portion of a lentivirus genome, including especially a self-inactivating lentiviral vector as provided in Milone et al., Mol. Ther. 17(8): 1453-1464 (2009). Other examples of lentivirus vectors that may be used in the clinic, include but are not limited to, e.g., the LENTIVECTOR® gene delivery technology from Oxford BioMedica, the LENTIMAX™ vector system from Lentigen and the like. Nonclinical types of lentiviral vectors are also available and would be known to one skilled in the art.
[0091] “Mammal” as used herein refers to any member of the class Mammalia, including, without limitation, humans and nonhuman primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs, and the like. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be included within the scope of this term.
[0092] The term “non-immune binding scaffolds” or “non-immune synthetic binding molecules” refer to molecules that have antigen binding domains, but differ in structure to that of an antibody and can be generated either from nucleic acids, as in the case of aptamers, or from non-immunoglobulin protein scaffolds/peptide aptamers, into which hypervariable loops are inserted to form the antigen binding domain. Constraining the hypervariable binding loop at both ends within the protein scaffold improves the binding affinity and specificity of the non-immunoglobulin binding domains to levels comparable to or exceeding that of a natural antibody. One advantage of these molecules compared to use of the typical antibody structure is that they have a smaller size.
[0093] As used herein, the term “operably linked” refers to the relationship between a first reference nucleotide sequence (e.g., a gene or coding sequence) and a second nucleotide sequence (e.g., a regulatory element) that allows the second nucleotide sequence to affect one or more properties associated with the first reference nucleotide sequence (e.g., a transcription rate). In the context of the disclosure, a regulatory element is operably linked to a coding sequence (e.g., a binding domain coding sequence) when the regulatory element is positioned within a vector such that it exerts an effect (e.g., a promotive or tissue-selective effect) on transcription of the coding sequence.
[0094] The term “ortholog” is used in reference of another gene or protein and intends a homolog of said gene or protein that evolved from the same ancestral source. Orthologs may or may not retain the same function as the gene or protein to which they are orthologous. Non-limiting examples of Cas9 orthologs include S. aureus Cas9 (“saCas9”), S. thermophiles Cas9, L. pneumophilia Cas9, N. lactamica Cas9, N. meningitides Cas9, B. longum Cas9, A. muciniphila Cas9, and O. laneus Cas9.
[0095] The term “polynucleotide”, “nucleic acid”, or “recombinant nucleic acid” refers to polymers of nucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA).
[0096] The term “promoter” as used herein refers to any sequence that regulates the expression of a coding sequence, such as a gene. Promoters may be constitutive, inducible, repressible, or tissue-specific, for example. A “promoter” is a control sequence that is a region of a polynucleotide sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind such as RNA polymerase and other transcription factors. Non-limiting exemplary promoters include CMV promoter and U6 promoter. Generally, promoter elements are located 5′ of the translation start site of a coding sequence or gene. However, in certain embodiments, a promoter element may be located within an intron sequence, or 3′ of the coding sequence. In some embodiments, a promoter useful for a genetic engineering is derived from a native gene of the target protein (e.g., a Factor VIII promoter). In some embodiments, a promoter is specific for expression in a particular cell or tissue of the target organism (e.g., a liver-specific promoter). In yet other embodiments, one of a plurality of well characterized promoter elements is used. Non-limiting examples of well-characterized promoter elements include the CMV early promoter, the R-actin promoter, and the methyl CpG binding protein 2 (MeCP2) promoter. In some embodiments, the promoter is a constitutive promoter, which drives substantially constant expression of an operably linked coding sequence. In other embodiments, the promoter is an inducible promoter, which drives expression of an operably linked coding sequence in response to a particular stimulus (e.g., exposure to a particular treatment or agent). For a review of designing promoters for AAV-mediated gene therapy, see Gray et al. (Human Gene Therapy 22:1143-53 (2011)), the contents of which are expressly incorporated by reference in their entirety for all purposes.
[0097] The term “protein”, “peptide” and “polypeptide” are used interchangeably and in their broadest sense to refer to a compound of two or more subunits of amino acids, amino acid analogs or peptidomimetics. The subunits may be linked by peptide bonds. In another aspect, the subunit may be linked by other bonds, e.g., ester, ether, etc. A protein or peptide must contain at least two amino acids and no limitation is placed on the maximum number of amino acids which may comprise a protein's or peptide's sequence. As used herein the term “amino acid” refers to either natural and/or unnatural or synthetic amino acids, including glycine and both the D and L optical isomers, amino acid analogs and peptidomimetics.
[0098] As used herein, the term “regulatory elements” refers to nucleotide sequences, such as promoters, enhancers, terminators, polyadenylation sequences, IRESs, introns, etc., that provide for the expression of a coding sequence in a cell.
[0099] The term “scFv” refers to a protein comprising at least one antibody fragment comprising a variable region of a light chain and at least one antibody fragment comprising a variable region of a heavy chain, wherein the light and heavy chain variable regions are contiguously linked, e.g., via a synthetic linker, e.g., a short flexible polypeptide linker, and capable of being expressed as a single chain polypeptide, and wherein the scFv retains the specificity of the intact antibody from which it is derived. Unless specified, as used herein an scFv may have the VL and VH variable regions in either order, e.g., with respect to the N-terminal and C-terminal ends of the polypeptide, the scFv may comprise VL-linker-VH or may comprise VH-linker-VL.
[0100] The term “subject” is intended to include living organisms that can be modified by the methods and compositions of the disclosure.
[0101] “TALEN” refers to an enzyme that can cleave specific sequences in a DNA molecule. TALENs are restriction enzymes that can be engineered to cut specific sequences of DNA. TALEN systems operate on a similar principle as ZFNs. TALENs are generated by combining a transcription activator-like effectors DNA-binding domain with a DNA cleavage domain. Transcription activator-like effectors (TALEs) are composed of 33-34 amino acid repeating motifs with two variable positions that have a strong recognition for specific nucleotides. By assembling arrays of these TALEs, the TALE DNA-binding domain can be engineered to bind desired DNA sequence, and thereby guide the nuclease to cut at specific locations in genome (Boch et al., Nature Biotechnology; 29(2):135-6 (2011)).
[0102] The term “therapeutic effect” refers to a biological effect which can be manifested by various means, including but not limited to, e.g., decrease in tumor volume, a decrease in the number of cancer cells, a decrease in the number of metastases, an increase in life expectancy, decrease in cancer cell proliferation, decrease in cancer cell survival, decrease in the titer of the infectious agent, a decrease in colony counts of the infectious agent, amelioration of various physiological symptoms associated with a disease condition.
[0103] “Treatment” and “treating,” as used herein refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) the targeted pathologic condition, prevent the pathologic condition, pursue or obtain beneficial results, or lower the chances of the individual developing the condition even if the treatment is ultimately unsuccessful. Those in need of treatment include those already with the condition as well as those prone to have the condition or those in whom the condition is to be prevented.
[0104] As used herein, “zinc-finger nucleases” or “ZFNs” refer to artificial restriction enzymes generated by fusing a zinc finger DNA-binding domain to a DNA-cleavage domain. Zinc finger domains can be engineered to target specific desired DNA sequences and this enables zinc-finger nucleases to target unique sequences within complex genomes. By taking advantage of endogenous DNA repair machinery, these reagents can be used to precisely alter the genomes of higher organisms.
[0105] Antibodies are naturally generated in developing B cells through a complex process involving recombination and mutagenesis of common starting sequences present in the immunoglobulin locus (Ig) locus. This process results in a vast repertoire of antibodies with different specificities, poised to respond to antigens present, for example, on foreign infectious agents. Once created by this process, a specific antibody variant will be displayed on the surface of a B cell in the form of a B cell receptor (BCR). Engagement of the BCR with a corresponding antigen leads to activation of that specific B cell, resulting in expansion, maturation and the secretion of its specific antibody. The antibody repertoire in the body is thus available for the selection and amplification of extremely specific responses. Additionally, B cell responses evolve over time, and generate antibody-secreting descendants that are capable of surviving and producing antibodies for decades, as well as memory responses that can be recalled upon antigen re-encounter.
[0106] Antibodies are naturally generated in developing B cells through a complex process involving recombination and mutagenesis of common starting sequences present in the immunoglobulin locus (Ig) locus. This process results in a vast repertoire of antibodies with different specificities, poised to respond to antigens present, for example, on foreign infectious agents. Once created by this process, a specific antibody variant will be displayed on the surface of a B cell in the form of a B cell receptor (BCR). Engagement of the BCR with a corresponding antigen leads to activation of that specific B cell, resulting in expansion, maturation and the secretion of its specific antibody. The antibody repertoire in the body is thus available for the selection and amplification of extremely specific responses. Additionally, B cell responses evolve over time, and generate antibody-secreting descendants that are capable of surviving and producing antibodies for decades, as well as memory responses that can be recalled upon antigen re-encounter.
[0107] In addition to this natural process that selects antibodies that recognize a specific antigen, “pre-formed” antibodies with desirable properties can be used as recombinant protein drugs, for example to treat cancer, infectious diseases, and autoimmune diseases. This approach can provide passive immunization, as well as allowing the use of antibodies with properties that may not efficiently form in nature. An example of the latter case are the so-called ‘broadly neutralizing’ antibodies (bnAbs) directed against the human immunodeficiency virus (HIV). bnAbs are rare antibodies that can inhibit many different strains of HIV but are often highly evolved and do not form easily during natural infections or in response to vaccinations. However, their ability to broadly recognize many different strains of HIV means that they are desirable for use as both a prevention strategy and a therapy.
[0108] In addition to the delivery of recombinant antibody proteins, antibody therapies are also being developed based on gene therapy approaches. Here, the desired antibody gene can be delivered as a self-contained expression cassette using, for example, AAV vectors. The engineered cells then produce and secrete the therapeutic antibody.
[0109] By inserting an antigen recognition cassette at the natural Ig locus, two important and highly desirable features of the immune response are preserved: (1) the ability to respond to the presence of an antigen, resulting in continuous production of the antibody without the need for constant re-infusions of expensive recombinant antibodies and (2) the ability for the antibody to mutate through defined cellular processes and potentially evolve alongside the disease, to further prevent the development of resistance to the therapy (see
[0110] Provided herein is an innovative genome engineering strategy that provides for the production of antibody fragments (e.g., single chain, single domain antibodies and the like) and non-immunoglobulin binding molecules from a specific locus (e.g., human Ig locus) of an immune cell (e.g., human B cell) or B cell precursors (e.g., hematopoietic stem cells, induced stem cells, embryonic stem cells and the like). The genome engineering techniques, methods and compositions described herein can be performed on autologous cells to a subject in need of treatment as well as allogeneic cells. The method can be performed ex vivo or in vivo.
[0111] For example, the disclosure shows that sdAbs can be generated from engineered B cells. sdAbs can be recombinantly produced and are a unique type of antibody produced by camelids that are of a much simpler design than standard human antibodies. sdAbs comprise only the equivalent of a heavy chain rather than the normal combination of heavy and light chains (e.g., see
[0112] sdAbs do not contain the CH1 domain of the heavy chain. In addition to being required for H chain+L chain pairing, the CH1 domain also regulates antibody secretion, adopting a disordered structure that prevents secretion of free H chain unless it is paired with an L chain. Thus, sdAbs are incompatible with the CH1 exon and cannot be produced by using the strategies described above.
[0113] In a particular embodiment, an antigen-binding VHH domain is inserted into an Ig constant region gene downstream of the CH1 exon, with gene expression driven by an internal promoter (see
[0114] In addition, the use of antibody fragments (e.g., sdAbs, scFv etc.) and non-immunoglobulin binding domain of the disclosure could support the creation of multiplex antibody-like constructs that simultaneously recognize different antigen targets (e.g., see
[0115] In a particular embodiment, genome editing technologies (e.g., CRISPR/Cas9) are used to introduce an antigen recognition cassette into an immunoglobulin (Ig) locus within an immune cell (e.g., a B cell, or a B cell precursor for example a hematopoietic stem cell (HSC) or induced pluripotent stem cell). The approaches described herein have the added advantage that a natural antibody producing cell type (e.g., a B cell) can be used as to produce the antibody fragments (e.g., sdAbs, scFv etc.) and non-immunoglobulin binding domain of the disclosure. Additionally, by editing the natural Ig locus, two important and highly desirable features of the immune response are preserved: (1) the potential for ongoing evolution of the antibody alongside the disease, to enhance the affinity of the antibody for its antigen and to further prevent the development of resistance to the therapy; and (2) the ability to respond to antigen, resulting in continuous production of the antibodies without the need for constant reinfusions of expensive recombinant antibodies. These properties are currently not possible when secreting an antibody from a non-natural cell, such as muscle cell, and when the antibody is expressed from a non-Ig locus.
[0116] In a certain embodiment, single domain antibodies (sdAbs) are produced by the genome editing strategies presented herein. sdAbs are a unique type of antibody produced by camels/llamas that are of a much simpler design than standard antibodies, comprising only one protein chain rather than the normal combination of heavy and light chains.
[0117] As described in the studies presented herein, guide RNAs were designed to introduce a DNA break into the human IgG1 locus at a specific site, but which had no detectable off-target activity at homologous IgG sequences (e.g., see
[0118] Accordingly, the genome engineering strategies described herein can be used to produce recombinant Ig antibody fragments (e.g., sdAbs, scFv etc.) and non-immunoglobulin binding domain expressed from a human Ig locus. Further, both secreted antibody fragments (e.g., sdAbs) and B cell receptors (BCRs) can be produced using the genome engineering strategies disclosed herein. One advantage of the genome engineering strategies of the disclosure is that ‘engineered’ B cells can be produced, which can continually produce desired antibody fragments (e.g., sdAbs, scFv etc.) and non-immunoglobulin binding domains in vivo. In contrast, current antibody therapies are administered as recombinant proteins that must be isolated from cells or microorganisms. To produce the recombinant proteins at scale requires use of expensive reactor systems which must provide a sterile environment to propagate cells, and further the recombinant proteins have to be isolated from the cells at a high purity, requiring the use of expensive purification equipment. It is not overly surprising that some of these recombinant protein therapies cost upwards of $100,000/dose. As a protein, these therapies have a limited half-life, requiring frequent re-administration if prolonged activity of the treatment is required.
[0119] The approach of engineering H+L chain antibodies within the Ig constant region domains has the advantage that monoclonal antibodies can be produced with defined Ig isotypes, thereby controlling functionalities. For instance, IgG1 or IgG3 editing could produce antibodies with desired effector functions such as ADCC, IgG4 editing could minimize such effector functions to generate primarily binding antibodies, and IgA editing could enhance functionality at mucosal surfaces such as the gut or lungs. This approach also bypasses the need to force class-switching in cells after editing, either ex vivo through cytokine treatments or in vivo through vaccine/adjuvant design or route of administration, both of which are relatively poorly understood in human B cells. Editing with a defined isotype would also be expected to improve the lot-to-lot consistency of a cell therapy and be advantageous from a clinical manufacturing perspective.
[0120] Modifications of the H+L design to minimize erroneous cross-pairing (e.g., CrossMab) also provides advantages of safety and reduces complexity of editing. In this embodiment, additional modification or knockout of the endogenous H and/or L chain loci are not required. Because the CrossMab design uses replacement of the CH1 domain, this method uses gene insertion downstream of the CH1 exon and is possible using the editing approach described for the native Ig locus, e.g., by inserting into constant regions downstream of the CH1 exon.
[0121] Co-expression of an endogenous and engineered antibody could also present additional functional opportunities. For instance, by editing antigen-specific B cells, it would be possible to have dual-functional B cells able to target either 2 different antigens, or 2 different targets on the same antigen. The former could provide opportunities to, for example, compensate for immunodeficiencies by expressing natural pathogen-specific antibodies alongside the therapeutic antibody. The latter could be useful in the case of mutagenic viral infections such as HIV or SARS-CoV-2, by targeting multiple epitopes to prevent escape mutagenesis from the therapy.
[0122] In a further embodiment, these approaches could be combined with the previously detailed modifications of the Fc stalk to enhance or modulate antibody effector functions, such as ADCC, or half-life, and the like.
[0123] Antigen-specific B cells following antigen encounter can survive for decades in vivo, remaining primed for expansion upon antigen re-encounter as well as continuing to produce protective antibodies from long-lived plasma cells. Accordingly, using the genome engineering strategies of the disclosure can provide for an ‘engineered’ B-cell with a synthetic immunoglobulin locus, but which retains normal functionality and effector functions, and further provides a prolonged therapeutic or prophylactic benefit which could last for the lifetime of the patient. As the ‘engineered’ B cells would be antigen specific, the therapy should be capable of self-tuning, boosting itself as needed without complex monitoring of patients or medical interventions needed to maintain activity within a therapeutic window. Moreover, B cells can naturally evolve antibody specificity over time through a process known as affinity maturation. By performing the genome engineering strategies of the disclosure at the endogenous immunoglobulin locus, it is expected that ‘engineered’ B cells will also be capable of applying these natural processes to the synthetic gene introduced through gene editing. Further, ‘engineered’ B cells can travel to relevant sites of infection or disease in the body to secrete functional antibodies. As such, ‘engineered’ B cells can access sites normally protected from parts of the immune system (such as B cell follicles in HIV infection); can achieve therapeutic efficacy at much lower doses than systemic delivery of recombinant proteins; avoid potential side effects (e.g., systemic immunosuppression in autoimmunity) or off-target effects (e.g., damaging or killing healthy cells throughout the body with anti-cancer antibodies whose target might be weakly expressed on other cells).
[0124] The genome engineering strategies described herein can be used to produce antibody fragments (e.g., sdAbs) and non-immunoglobulin binding domains from a human Ig locus. A normal human antibody is generated from two separate genes, a heavy and a light chain, which must then associate within the cell after protein synthesis prior to secretion. Thus, replicating full specificity of an antibody within a B cell would require introduction of both of these sequences into a cell. Since the heavy and light chains are located on different chromosomes, engineering fully natural antibody specificity would require editing at both of these loci. Performing sequential manipulations of the two loci would greatly increase the cost and complexity of the procedure. Some investigators have begun to explore gene editing of the immunoglobulin locus using synthetic transgenic constructs that express both the heavy and light chain from a single site in the genome. These rely on endogenous enhancer activity to drive a minimal antibody promoter element, as well as a 2A ribosome skipping motif to get protein translation of both the light chain and the heavy chain. These motifs are rarely 100% effective, and having weak activity could result in single chain antibodies with greatly reduced functionality or even introduce toxicity to the producer cell.
[0125] In contrast, the engineered antibody fragments (e.g., sdAbs, scFv etc.) and non-immunoglobulin binding domains of the disclosure contain all of their specificity within a single sequence, and do not require engineering at multiple loci. Furthermore, the nature of antibody fragments (e.g., single domain antibodies) and non-immunoglobulin binding domains allows editing at an alternative site in the IgH locus, with desirable properties (more consistent homology than other strategies). Further, the genome editing strategies to produce such antibody fragments (e.g., sdAbs, scFv etc.) and non-immunoglobulin binding domains described herein avoid safety issues seen with other genome editing procedures at the immunoglobulin locus. For example, investigators have recently began to show that, with gene editing tools based on double-stranded break generation, performing simultaneous manipulations at 2 or more locations can greatly increase genotoxic risks of DNA rearrangements such as inversions or translocations that could lead to cell death, dysfunction, or generation of cells that could be more likely to become cancerous in the future.
[0126] The genome editing strategies of the disclosure can be used to produce, for example, sdAbs, which contain multiple antigen recognition domains. Single domain antibodies are particularly amenable for engineering of constructs containing multiple antigen recognition domains. This approach has been previously demonstrated for recombinant proteins with single domain antibodies against influenza. Combining multiple recognition domains in a sdAb can increase sdAb efficacy in a variety of ways, including, but not limited to, increasing sdAb avidity so that it is more likely to bind to the target; making the sdAb more resistant to mutations by the infectious agent or tumor to avoid immune detection; providing for multiple effector functions, including but not limited to engagement of NK cell-mediated killing with an anti-CD16 domain, or recruiting T cell effector functions through an anti-CD3 domain.
[0127] The antibody fragments (e.g., sdAbs, scFv etc.) and non-immunoglobulin binding domains of the disclosure have reduced immunoreactivity than other protein-based therapies. Recombinant antibodies, even when fully humanized, come with the risk of anti-drug antibodies developing that are directed against the idiotype, and that can both prevent therapeutic efficacy and lead to adverse reactions. Current strategies to achieve long-term expression of antibodies against infectious diseases such as HIV through gene therapy (AAV vectors delivering antibody genes to muscle cells) have been hampered by extremely high rates of host antibodies directed against the therapeutic antibody. This is likely due to the known immunogenic nature of muscle-directed gene transfer with adeno-associated viral vectors that has been employed in non-human primates and in humans for this approach. Within the host, anti-idiotypic antibodies do not frequently prevent antibody function, suggesting that B cells have intrinsic tolerogenic mechanisms to prevent these deleterious immune reactivities. Additionally, a number of studies have used retroviral-based gene transfer in murine B cells to express proteins or peptides fused to antibody sequences and shown that these modified cells can induce active immune tolerance to the foreign protein by serving as tolerogenic antigen-presenting cells. It is postulated herein, that similar mechanisms will function for the ‘engineered’ B cells of the disclosure, allowing long-term production of therapeutic single domain antibodies without adverse immune reactions by the host.
[0128] In a particular embodiment, antibody fragments (e.g., sdAbs, scFv etc.) and non-immunoglobulin binding domains made by a method the disclosure can be used to treat a disease cause by an infectious agent by binding to antigens associated with the infectious agent. In a further embodiment, the infectious agent is a virus, a bacterium, a fungus, a parasitic helminth, or a parasitic protozoan. Examples of viruses include, but are not limited to those in the following virus families: Retroviridae (for example, human immunodeficiency virus (HIV), human T-cell leukemia viruses; Picornaviridae (for example, poliovirus, hepatitis A virus, enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses, foot-and-mouth disease virus); Caliciviridae (such as strains that cause gastroenteritis, including Norwalk virus); Togaviridae (for example, alphaviruses (including chikungunya virus, equine encephalitis viruses, Simliki Forest virus, Sindbis virus, Ross River virus, rubella viruses); Flaviridae (for example, hepatitis C virus, equine non-primate hepaci virus (NPHV), dengue viruses, yellow fever viruses, West Nile virus, Zika virus, St. Louis encephalitis virus, Japanese encephalitis virus, Powassan virus and other encephalitis viruses); Coronaviridae (for example, coronaviruses, severe acute respiratory syndrome (SARS) virus, Middle East respiratory syndrome (MERS) virus; Rhabdoviridae (for example, vesicular stomatitis viruses, rabies viruses); Filoviridae (for example, Ebola virus, Marburg virus); Paramyxoviridae (for example, parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (for example, influenza viruses); Bunyaviridae (for example, Hantaan viruses, Sin Nombre virus, Rift Valley fever virus, bunya viruses, phleboviruses and Nairo viruses); Arenaviridae (such as Lassa fever virus and other hemorrhagic fever viruses, Machupo virus, Junin virus); Reoviridae (e.g., reoviruses, orbiviurses, rotaviruses); Birnaviridae; Hepadnaviridae (hepatitis B virus); Parvoviridae (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses, BK-virus); Adenoviridae (adenoviruses); Herpesviridae (herpes simplex virus (HSV)-1 and HSV-2; cytomegalovirus; Epstein-Barr virus; varicella zoster virus; Kaposi's sarcoma herpesvirus (KSHV); and other herpes viruses, including HSV-6); Poxviridae (variola viruses, vaccinia viruses, pox viruses); and Iridoviridae (such as African swine fever virus); Astroviridae; and unclassified viruses (for example, the etiological agents of spongiform encephalopathies, the agent of delta hepatitis (thought to be a defective satellite of hepatitis B virus). In some examples, the viral pathogen is HIV, HCV, EBV, HTLV-1, KSHV, or Ebola virus.
[0129] Examples of bacterial pathogens include, but are not limited to: Helicobacter pylori, Escherichia coli, Vibrio cholerae, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (such as. M. tuberculosis, M. avium, M. intracellular, M. kansaii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringers, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides sp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidium, Treponema pertenue, Leptospira, Bordetella pertussis, Shigella flexnerii, Shigella dysenteriae and Actinomyces israelii.
[0130] Examples of fungal pathogens include, but are not limited to: Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis and Candida albicans.
[0131] Other pathogens (such as parasitic pathogens) include, but are not limited to: Plasmodium falciparum, Plasmodium vivax, Trypanosoma cruzi and Toxoplasma gondii. (Plasmodium species), amoebiasis (Entamoeba species), giardiasis (Giardia lamblia), toxoplasmosis (Toxoplasma gondii), cryptosporidiosis (Cryptosporidium species), trichomoniasis (Trichomonas vaginalis), Chagas disease (Trypanosoma cruzi), Leishmaniasis (Leishmania species), sleeping sickness (Trypanosoma brucei), amoebic dysentery (Entamoeba histolytica), acanthamoeba eeratitis (Acanthamoeba species), and primary amoebic meningoencephalitis (Naegleria fowleri)
[0132] Examples of helminth pathogens include Strongyloides stercoralis (causes strongyloidiasis); Onchocerca volvulus (causes river blindness/Robles disease); Loa (filarial nematode that causes Loa filariasis); and Wuchereria bancrofti (roundworm that causes lymphatic filariasis).
[0133] Antigens and antigenic epitopes associated with the various microbial and viral agents above are known. Moreover, antibody binding domains and scFv sequences targeting a vast number of biological targets are known in the art (see, e.g., WO2018/102795, which is incorporated herein by reference).
[0134] In one non-limiting example, sdAbs of the disclosure can be used to treat an HIV infection by binding to antigens associated with the Env protein from HIV. Similarly, antibodies developed against spike proteins of SARS-Cov2 can be used as a molecule from which recombinant binding domains can be obtained, cloned and used in an antigen recognition cassette of the disclosure. Such cassettes can then be used in the engineering of B cells for administering to a subject to allow for long term persistent response to SARS-Cov2 infection.
[0135] In another embodiment, antibody fragments (e.g., sdAbs, scFv etc.) and non-immunoglobulin binding domains made by a method the disclosure can be used to treat a subject with a cancer by binding to antigens associated with the cancer. Examples of cancer antigens can be found throughout herein. Examples of cancers that can be treated by sdAbs of the disclosure include, but are not limited to, non-Hodgkin's lymphoma, acute lymphoblastic leukemia, B-cell lymphoma, mantle cell lymphoma, multiple myeloma, acute myeloid leukemia, colorectal cancer, breast cancer, lung cancer, ovarian cancer, and renal cancer.
[0136] In another embodiment, sdAbs or other antibody fragments made by a method the disclosure can be used to treat a subject with an autoimmune disorder by binding to and preventing activation of cytokines or receptors associated with an autoimmune disorder, or prevent aggregations or plaques associated with an autoimmune disorder. Examples of autoimmune disorders that can be treated by the compositions and methods of the disclosure include, but are not limited to, Alzheimer's disease, Celiac disease, Addison disease, Graves disease, dermatomyositis, multiple sclerosis, rheumatoid arthritis, psoriasis, and inflammatory bowel disease.
[0137] The disclosure provides an antigen recognition cassette comprising the general structure: --(promoter)-(binding domain)-(splice donor)--. The promoter can be any promoter that can function to elicit expression of an operably linked coding sequence. Various promoters are known in the art. As mentioned above, the promoter can be tissue specific, constitutive, or inducible. The binding domain comprises a nucleic acid sequence encoding a binding domain polypeptide. As described above, the binding domain polypeptide can be an antibody fragment, a receptor domain, an artificial polypeptide having affinity for a particular antigen or cognate. In some embodiments, the cassette can comprise the hinge and CH2 coding sequences of an Ig locus. The splice donor domain comprises a nucleic acid sequence that can interact with a splice acceptor domain. An exemplary antigen recognition cassette is provided in
[0138] In some embodiments, the antigen recognition cassette is flanked by homology regions that have sequence homology to a site for insertion. In certain embodiments, the homology region has homology to an Ig region of a mammalian cell's genome. In some embodiments, that homology region is 25-750 bp long (e.g., 25, 50, 100, 200, 250, 300, 350, 400, 450, 500, 750 bp or longer). In some instances the homology region can be 500-1000 bp long. In certain embodiments, the homology region is 5′ to the promoter of the antigen recognition cassette and 3′ to the splice donor domain of the antigen recognition cassette. In other embodiments, the homology arms can be of different lengths. An exemplary construct is provided in
[0139] In still another embodiment, the disclosure provides a construct comprising an antigen recognition cassette with homology arms. In some embodiment, the construct is present in an AAV backbone. In one embodiment, the homology arms of a recognition cassette construct are flanked by ITRs of an AAV vector. An exemplary vector construct is provided in
[0140] As will be readily apparent the polynucleotide constructs of the disclosure are modular in design comprising a promoter module, a binding domain module, a splice donor module, a homology module, and/or a vector module. One of skill in the art will readily recognize that the modules can be varied without undue experimentation. For example, the promoter module can be any number of different promoter types/sequences as are well known in the art. Moreover, the binding domain module can be any number of binding domain module sequences (see, e.g., WO2018/102795 at Table 5, listing VL, VH, VHH and other binding domains and CDRs and related sequences, which are incorporated herein by reference). The Homology module (Homology arms) can be any sequence that is designed to have homology to the site where the cassette is to be inserted. Typically, the homology arms will have homology to an Ig locus in a mammalian cell.
[0141] In one embodiment, the disclosure provides an ex vivo method of generating engineered B cells. The method comprises isolating B cells from a subject, contacting the isolated B cells with a vector comprising an antigen recognition cassette of the disclosure such that the antigen recognition cassette integrates into the B cell genome in an Ig locus, and culturing the cells. The cultured cells may be “banked” or stored for administration to a patient or subject to be treated. The patient of subject may be autologous with the cells or allogeneic. Methods of isolating B cells are known. For example, B-cells can be isolated by two main approaches: 1) Negative selection—in which B-cells remain “untouched” in their native state; this is advantageous as it is likely that B-cells remain functionally unaltered by this process or 2) Positive selection—in which B-cells are labelled and actively removed from the sample by FACS, MACS, RosetteSep or antibody panning. One or more isolation techniques may be utilized in order to provide an isolated B cell population with sufficient purity, viability and yield.
[0142] In another embodiment, the disclosure provides an ex vivo method of generating engineered precursor B cells. The method comprises isolating precursor B cells including, but not limited to, embryonic stem cells, hematopoietic cells or parenchymal cells that are induced to become stem cells, from a subject, contacting the isolated precursor B cells with a vector comprising an antigen recognition cassette of the disclosure such that the antigen recognition cassette integrates into the precursor B cell genome in an Ig locus, and culturing the cells. The cultured cells may be “banked” or stored for administration to a patient or subject to be treated. The patient of subject may be autologous with the cells or allogeneic.
[0143] The following examples are intended to illustrate but not limit the disclosure. While they are typical of those that might be used, other procedures known to those skilled in the art may alternatively be used.
EXAMPLES
[0144] HIV-specific bn-sdAbs neutralize HIV. Camelid VHH domains previously reported to have broadly neutralizing activity against HIV (described in Table 1) were fused to the Hinge-CH2-CH3 domains of human IgG1 to create sdAbs.
TABLE-US-00001 TABLE 1 Summary of previously described VHH domains and sdAbs with anti-HIV activity Published % neutralization median Epitope on sdAb of HIV strains IC50 HIV Env VHH Origin tested (μg/mL) Format protein 9 Dromedary 48% (10/21) 0.18 VHH-Fc CD4bs/CD4i 28 Dromedary 62% (13/21) 0.277 VHH-Fc CD4bs/CD4i A6 Dromedary 76% (16/21) 0.224 VHH-Fc CD4bs/ CD4i/V2 J3 Llama 98% (57/58) 0.93 VHH CD4bs A14 Llama 74% (45/61) 0.53 VHH CD4bs B9 Llama 77% (47/61) 0.85 VHH CD4bs 3E3 Llama 76% (58/71) 0.82 VHH CD4bs CD4bs - CD4 binding site; CD4i - CD4-induced epitopes; V2 - the V2 apex
[0145] The antibodies were produced in 293T cells by calcium phosphate transfection of plasmids containing the sdAb sequences downstream of a CMV promoter, and the presence of HIV binding antibodies secreted into the culture supernatants was confirmed using an ELISA for binding to the HIV Env gp120 subunit. Antibody-containing supernatants were incubated with 2 different strains of HIV (R5-tropic JR-CSF and X4-tropic NL4-3), and HIV neutralization capabilities were determined using the GHOST cell assay as described in Cecilia et al., (Neutralization profiles of primary human immunodeficiency virus type 1 isolates in the context of coreceptor usage. J Virol 72: 6988-6996 (1998)). All sdAbs were inhibitory against both strains of HIV tested (see
[0146] Activity of spCas9 gRNAs at on- and off-target IgG genes. The activity of 10 spCas9 gRNAs (described in Table 2) and 4 Cpf1 gRNAs (described in Table 3) targeting an intron between the hinge and CH2 exons of IgG1 were assessed at the on-target IGHG1 gene, 4 major off-target regions (IGHG2, IGHG3, IGHG4, and IGHGP). As well, spCas9 gRNAs targeting the IGHG1 intron preceding the CH3 exon were assessed for on- and off-target activity (Table 4). These off-target loci comprise 3 genes and a pseudogene that are all >96% homologous to IGHG1 and thus have a high possibility of off-target activity.
TABLE-US-00002 TABLE 2 Summary of on and off-target cutting efficiency of tested spCas9 guide RNAs targeting the human IGHG1 intron preceding the Hinge exon. Off- Genomic Cutting target sequence effi- (IGG) targeted ciency, cutting Guide by gRNA (5′-3′)* ICE detected identity (SEQ ID NO:) (%) by ICE sg01 AGGCTAGGTGCCCCTAACCC (15) 70 +/− sg02 TAGCCGGGATGCGTCCAGGC (16) 40 + sg03 TGCATAGCCGGGATGCGTCC (17) 86 +++ sg04 CTCCGGGTGAAGAGGCAGAC (18) 47 − sg05 TCCGGGTGAAGAGGCAGACG (19) 51 − sg06 ACCCAGGCCCTGCACACAAA (20) 72 − sg12 GATTGGGAGTTACTGGAATC (21) 46 +/− sg16 GCAGAGGCCTCCGGGTGAAG (22) 20 − sg17 GCCCCGTCTGCCTCTTCACC (23) 32 − sgCOR2 CCGTCTGCCTCTTCACCCGG (24) 93 + IGG: IGHG2, IGHG3, IGHG4, or IGHGP *Shown are: the genomic sequences. As an example and for clarification, the sg01 gRNA would include the RNA sequence 5′AGGCUAGGUGCCCCUAACCC 3′
TABLE-US-00003 TABLE 3 Summary of on and off-target cutting efficiency tested Cpf1 guide RNAs targeting the human IGHG1 intron preceding the Hinge exon. Off- target Genomic (IGG) sequence by Cutting cutting, targeted effi- measur- Guide gRNA (5′-3′) ciency, able identity (SEQ ID NO:) ICE (%) by ICE Cpf1-gl TCCCCAGGCTCTGGGCAGGCA (25) 0 NA Cpf1-g2 CCCCAGGCTCTGGGCAGGCAC (26) 0 NA Cpf1-g3 CCCAGGCTCTGGGCAGGCACA (27) 70 — Cpf1-g4 TGTGCAGGGCCTGGGTTAGGG (28) 2 NA
TABLE-US-00004 TABLE 4 Summary of on and off-target indel generation for indicated spCas9 guide RNAs targeting the human IGHG1 intron preceding the CH3 exon. Off-target Sequence targeted indel (IGG) by gRNA effi- indels Guide gRNA (5′-3′) ciency, detected identity (SEQ ID NO:) ICE (%) by ICE CH3-g1 ATGTGGCCCTCGCACCCCAC (29) 41 − CH3-g2 AAGCCAAAGGTGGGACCCGT (30) 23 − CH3-g3 AGCCAAAGGTGGGACCCGTG (31) 56 +/− CH3-g4 GTGGGACCCGTGGGGTGCGA (32) 0 − CH3-g5 CATGTGGCCCTCGCACCCCA (33) 70 +
[0147] Briefly, gRNAs were synthesized in vitro, complexed with recombinant spCas9 protein, and nucleofected into K562 cells. After 5 days, genomic DNA was isolated, and PCR and Sanger sequencing analyses were performed for all 5 loci. The presence of DNA double-stranded breaks (DSBs) was inferred by observing indels, which were quantified by ICE as described in Hsiau et al., (Inference of CRISPR Edits from Sanger Trace Data. bioRxiv: 251082 (2019)). On-target DSBs were generated by all guides, though the total detectable activity varied. Three spCas9 guides (sg02, sg03, and sgCOR2) exhibited significant off-target activity at one or more of the homologous IgG genes, implying lack of suitability for this application, whereas the other 7 targeting the same intron showed little to no off-target cutting as detected by this assay (limit of detection ˜2%) (see
[0148] Genome editing at the IGHG1 locus using spCas9 RNPs and matched plasmid homology donors. K562 cells were nucleofected with spCas9 RNPs containing the indicated guide RNAs, in combination with a series of matched plasmid homology donors with different lengths of homology arms, as indicated. A unique series of homology donors were paired with each guide, since the exact DNA break site and thus preferred location for gene insertion is different for each gRNA. After 3 weeks, stable GFP expression, indicating site-specific genome editing, was measured by flow cytometry. The gRNA used was the most important source of variation in the final GFP levels; all homology arm designs for sg05 were superior to other gRNA/homology donor pairs (see
[0149] Genome editing at the IGHG1 locus using spCas9 and AAV6 homology donors. Homology donor cassettes were packaged into AAV6 vectors using standard methods to produce AAV vectors (triple transfection and iodixanol gradient centrifugation) (see
[0150] Genome editing at the IGHG1 locus produces HIV-specific bn-sdAbs in Raji cells and Ramos cells. Raji cells and Ramos cells (human B cell lines) were nucleofected with RNPs comprising spCas9 and gRNA sg05, together with matched plasmid homology donors, designed to insert expression cassettes for either PGK-GFP-pA, or the bn-sdAbs A6 or J3 (Table 1) plus a splice donor (sd). Expression of bn-sdAbs is driven by the B cell-specific EEK promoter. A 10-fold increase in stable GFP expression after 2 weeks was observed in Raji cells receiving donor plasmids plus sg05 RNPs compared to donor plasmid only, consistent with site-specific gene insertion stimulated by the targeted DSB (see
[0151] Increased stable GFP expression after 2 weeks was observed in Ramos cells receiving the GFP plasmid donor and Cas9 RNPs, consistent with site-specific gene insertion (see
[0152] After enrichment, bn-sdAb but not GFP edited cells secrete human IgG. Engineered Raji and Ramos cells were FACS sorted for surface human IgG1 (A6 and J3 edited cells) or for GFP (GFP edited cells) and expanded in culture (see
[0153] Using similar methodology, additional antigen recognition cassettes were inserted at the CH1-Hinge intron. The IGHG1 locus was edited by inserting various alternate protein domains that bind to HIV gp120. PGT121 is a human anti-HIV bnAb and scFv cassettes were generated in both the heavy chain-light chain (HL) and light chain-heavy chain (LH) orientations using standard (G.sub.4S).sub.3 linkers. CD4-mD1.22 is an engineered variant of domain 1 of CD4 that can bind to and neutralize HIV, but does not bind to MHC class II molecules. Raji cells were genome edited using spCas9 RNPs comprising sg05 (Table 2), and corresponding plasmid homology donors, by nucleofection. Cell surface expression of the expected resulting single-chain constructs was detected by flow cytometry to detect IgG expression and binding to recombinant gp120 (
[0154] Anti-HIV activity of antibodies produced by engineered B cell lines. Supernatants from engineered, enriched Raji and Ramos cells were diluted and mixed with 2 different strains of HIV (R5-tropic JR-CSF and X4-tropic NL4-3), and HIV neutralization capability was assayed using the GHOST cell assay. Supernatants from transiently transfected 293T cells receiving expression plasmids for the same bn-sdAbs were included as a positive control.
[0155] Quantification of anti-HIV activity of bn-sdAbs produced by transfection and genome editing. TZM-bl cells were used to assay the activity of A6- and J3-containing supernatants from transfected 293T cells or gene edited Raji or Ramos cells against 2 strains of HIV (JR-CSF or NL4-3). The relative efficiency of each antibody against either strain of HIV was conserved regardless of whether it was produced in 293T cells by transfection or from genome edited B cells (see
TABLE-US-00005 TABLE 5 Antibody neutralization efficiency from supernatants of 293T cells transiently transfected with an sdAb expression cassette and engineered human B cell lines. A6, IC50 (ng/mL) J3, IC50 (ng/mL) Cell type/treatment JR-CSF NL4-3 JR-CSF NL4-3 293T/transfection 436.8 45.3 8274 113.5 Raji/genome editing 265.7 67.8 >8000 367.9 Ramos/genome editing 487.7 63.7 >7800 125.0
[0156] Genome editing and in vitro differentiation of primary human B cells. Genome editing was performed at the CCR5 locus in primary human B cells using site-specific zinc finger nucleases (ZFN) or spCas9/gRNA targeting the CCR5 locus, combined with matched AAV6 CCR5-GFP homology donors (see
[0157] Different insertion sites can produce antibody-like molecules using the methods and compositions of the disclosure.
[0158] Also demonstrated is editing at the intron upstream of CH3 in IGHG1 using spCas9 complexed with guide RNAs (gRNAs) (
[0159] Moreover, the data shows evidence of somatic hypermutation.
[0160] Further,
[0161] Experiments were also performed to look at in vitro differentiation, and secretion of functional anti-HIV antibodies from primary human B cells engineered by insertion of the EEK/VHH-J3/splice donor cassette upstream of the hinge exon of IGHG1. B cells were transduced with AAV6 homology donors followed by electroporation with spCas9 RNPs containing sg05 (Table 2). Surface expression of VHH-J3 sdAb in untouched and genome edited cells after 8 days was measured by flow cytometry (
[0162] Editing at an alternate location in IgG1, in the intron between CH2 and CH3. This approach is described above and with reference to
[0163] The disclosure describes how the homology donor cassette is optimized to achieve the desired edits.
[0164] Specifically, as already disclosed above, it is useful to reduce homology between the Hinge-CH2 sequences in the cassette to be inserted and the endogenous Hinge and CH2 domain sequences. Retaining such homology was hypothesized to present alternate or competing stretches of sequence homology between the donor and the endogenous Ig locus, beyond the ‘homology arms’ in the constructs that are designed to direct the desired insertion events. To do this, six different codon wobbled sequences were constructed. Design ‘v6’ was chosen as it also resulted in the highest levels of antibody expression when examined as the final anticipated sequence of the recombinant protein (
[0165] The splice donor was also optimized to support expression of an sdAb after editing, since the original sequence did not support expression after site-specific insertion (
[0166] In
[0167]
[0168]
[0169] Table 6 shows the sequence of the IgG4-end series of gRNAs that can be used.
TABLE-US-00006 TABLE 6 Sequence of IgG4-end guide RNAs, targeting the 3′end of the CH3 exon in IgG4 Off- target indel (IGG) Sequence SEQ effi- indels Guide targeted by gRNA ID ciency, detected Identity (5′-3′) NO: ICE (%) by ICE IgG4end- TCTCTGGGTAAATGAGTGCC 37 8.5 — g1 IgG4end- AAGAGCCTCTCCCTGTCTCT 38 12.5 — g2 IgG4end- CGTGGACAAGAGCAGGTGGC 39 16.3 — g3 IgG4end- GACAAGAGCAGGTGGCAGGA 40 32.3 — g4 IgG4end- GGACAAGAGCAGGTGGCAGG 41 24.0 — g5
[0170] Editing to create full length (H plus L chain) antibodies, including CrossMab designs.
[0171] The H chain editing strategies described herein support the insertion of antigen-binding domains derived from cassettes comprising a complete Light chain plus a partial Heavy chain. In a specific modification, the constructs use a CrossMab design, wherein the positions of the CL and CH1 domains are reversed and are present on the alternate antibody chains (
[0172]
[0173]
[0174]
[0175] It will be understood that various modifications may be made without departing from the spirit and scope of this disclosure. Accordingly, other embodiments are within the scope of the following claims.