Method and agents for producing N-acetylneuraminic acid (NeuNAc)

Abstract

The invention relates to an isolated nucleic acid molecule comprising at least one promoter that is active in fungal cells of the trichoderma species, wherein a nucleic acid sequence encoding an N-acetylglucosamine-2-epimerase and/or an N-acetylneuraminic acid synthase is operatively bound to each promoter. The at least one promoter that is active in fungal cells is a constitutive promoter.

Claims

1. A method for producing N-acetylneuraminic acid (NeuNAc), comprising cultivating a fungal cell in the presence of an N-acetyl-D-glucosamine source, wherein the fungal cell is of the genus Trichoderma and comprises a) a nucleic acid molecule or b) a set of two nucleic acid molecules, wherein the nucleic acid molecule of a) and each of the nucleic acid molecules of the set b) comprise at least one constitutive promoter that is active in the genus Trichoderma, and wherein the nucleic acid molecule of a) further comprises a nucleic acid sequence encoding an N-acetylglucosamine 2-epimerase and an NeuNAc synthase operatively linked to one or more of said at least one promoter, or the set of two nucleic acid molecules of b) comprises a nucleic acid molecule encoding the N-acetylglucosamine 2-epimerase and a nucleic acid molecule encoding the NeuNAc synthase, each of said molecules comprising at least one promoter that is active in fungal cells of the genus Trichoderma operably linked to the sequence encoding N-acetylglucosamine 2-epimerase or N-acetylneuraminic acid synthase, wherein the N-acetylglucosamine 2-epimerase is SEQ ID NO:1.

2. The method according to claim 1, wherein the N-acetyl-D-glucosamine source is chitin.

3. The method according to claim 1, wherein the fungal cell is of the species Trichoderma reesei.

4. The method according to claim 1, wherein said at least one promoter is selected from the group consisting of a promoter of a glycolytic gene, a promoter of translational elongation factor EF-1 alpha (tef1a), a promoter of actin (act), a promoter of Subunit IV of cytochrome c oxidase (cox4), a promoter of 1,6-beta-D-glucanase gene (neg1) and a promoter of secretion-associated RAS-related protein (sar1).

5. The method according to claim 4, wherein said at least one promoter is a promoter of the glycolytic gene, wherein the gene is selected from the group consisting of pyruvate kinase (pki), glyceraldehyde-3-phosphate dehydrogenase (gpd) and zwischenferment (zwf1).

6. The method according to claim 2, wherein the chitin is colloidal.

7. The method according to claim 2, wherein the chitin is crab-shell chitin.

8. The method according to claim 1, wherein said nucleic acid sequence encoding an NeuNAc synthase is SEQ ID NO:2.

9. The method according to claim 1, wherein said nucleic acid molecule of a) encoding an N-acetylglucosamine 2-epimerase and an NeuNAc synthase or the set of nucleic acid molecules of b) encoding the N-acetylglucosamine 2-epimerase and the N-acetylneuraminic acid synthase is codon-optimized for expression in the fungal cell.

10. A method for producing N-acetylneuraminic acid (NeuNAc), comprising cultivating a fungal cell in the presence of an N-acetyl-D-glucosamine source, wherein the fungal cell is of the genus Trichoderma and comprises a) a nucleic acid molecule or b) a set of two nucleic acid molecules, wherein the nucleic acid molecule of a) and each of the nucleic acid molecules of the set b) comprise at least one constitutive promoter that is active in the genus Trichoderma, and wherein the nucleic acid molecule of a) further comprises a nucleic acid sequence encoding an N-acetylglucosamine 2-epimerase and an NeuNAc synthase operatively linked to one or more of said at least one promoter, or the set of two nucleic acid molecules of b) comprises a nucleic acid molecule encoding the N-acetylglucosamine 2-epimerase and a nucleic acid molecule encoding the NeuNAc synthase, each of said molecules comprising at least one promoter that is active in fungal cells of the genus Trichoderma operably linked to the sequence encoding N-acetylglucosamine 2-epimerase or N-acetylneuraminic acid synthase, wherein the NeuNAc synthase is SEQ ID NO:2.

11. The method according to claim 10, wherein the N-acetyl-D-glucosamine source is chitin.

12. The method according to claim 10, wherein the fungal cell is of the species Trichoderma reesei.

13. The method according to claim 10, wherein said at least one promoter is selected from the group consisting of a promoter of a glycolytic gene, a promoter of translational elongation factor EF-1 alpha (tef1a), a promoter of actin (act), a promoter of Subunit IV of cytochrome c oxidase (cox4), a promoter of 1,6-beta-D-glucanase gene (neg1) and a promoter of secretion-associated RAS-related protein (sar1).

14. The method according to claim 13, wherein said at least one promoter is a promoter of the glycolytic gene, wherein the gene is selected from the group consisting of pyruvate kinase (pki), glyceraldehyde-3-phosphate dehydrogenase (gpd) and zwischenferment (zwf1).

15. The method according to claim 11, wherein the chitin is colloidal.

16. The method according to claim 11, wherein the chitin is crab-shell chitin.

17. The method according to claim 10, wherein said nucleic acid sequence encoding an N-acetylglucosamine 2-epimerase is SEQ ID NO:1.

18. The method according to claim 10, wherein said nucleic acid molecule of a) encoding an N-acetylglucosamine 2-epimerase and an NeuNAc synthase or the set of nucleic acid molecules of b) encoding the N-acetylglucosamine 2-epimerase and the N-acetylneuraminic acid synthase is codon-optimized for expression in the fungal cell.

Description

DESCRIPTION OF DRAWINGS

(1) The present invention is illustrated in more detail in conjunction with the following Figures and Examples, without being limited thereto.

(2) FIG. 1 shows an overview of possible metabolic reaction pathways, from the polymer chitin as a starting substance to the formation of NeuNAc. Metabolic intermediate products are shown in rectangles and arrows represent enzyme-catalyzed reactions. Next to the arrow, the corresponding EC number of the enzymatic reaction is indicated. A circled plus denotes an enzymatic reaction which could be assigned to a gene in the genome of Trichoderma reesei. A circled minus indicates that no annotated gene could be found in the currently published genome.

(3) FIGS. 2a and 2b show the formation of NeuNAc in an in vitro reaction with heterologously expressed T. reesei protein in the transgenic strain PEC/PSC1 using the substrates GlcNAc, ATP and PEP.

(4) (a) The extracted ion chromatograms (EIC) of an HPLC-MS analysis with a mass of 222,098 atomic mass units (amu) are shown. This mass corresponds to the mass of the [GlcNAc+H]+ ion and to that of the [ManNAc+H]+ ion. The retention times (RT) of GlcNAc (12.988 rpm) and ManNAc (12.288 min) were determined using pure standards of both substances and are indicated by a vertical line in the chromatogram. (1) Chromatogram of the in vitro enzymatic reaction with GST fusion proteins of GlcNAc 2-epimerase and NeuNAc synthase, which were expressed in E. coli. (2) Chromatogram of the enzymatic reaction with the cell-free extract of the transgenic strain PEC/PSC1. (3) Chromatogram of the reaction with the cell-free extract of the parent strain QM9414 as a negative control.

(5) (b) Illustrated are the EICs at a mass of 310.1134 amu, which corresponds to the mass of the [NeuNAc+H]+ ion and can be detected at a retention time of 8.345 min. The chromatograms (1), (2) and (3) were obtained with the same samples as described in section (a), wherein chromatogram (2) is amplified 10-fold and chromatogram (3) is amplified 1,000-fold in relation to chromatogram (1). (ad 1) includes the mass spectrum pertaining to chromatogram (1) at a retention time of 8.345 min. (ad 2) shows the mass spectrum of chromatogram (2) at a retention time of 8.348 min.

(6) FIGS. 3a and 3b show the in vivo production of NeuNAc in the transgenic T. reesei strain PEC/PSC1 after cultivation on GlcNAc for 66 h.

(7) (a) Illustrated are the EICs of the HPLC-MS analysis with a mass of 222.097 amu (the [GlcNAc+H]+ ion and the [ManNAc+H]+ ion). The retention time (RT) of GlcNAc (12.988 min) and ManNAc (12.288 min) was determined using pure standards of both substances and is indicated by a vertical line in the chromatogram. (1) Chromatogram of the in vitro enzymatic reaction with GST fusion proteins of GlcNAc 2-epimerase and NeuNAc synthase, which were expressed in E. coli. (2) Chromatogram of the cell-free extract of the transgenic strain PEC/PSC1 (3) Chromatogram of the cell-free extract of the parent strain QM9414 as a negative control.

(8) (b) Illustrated are the EICs with a mass of 310.1134 amu, which corresponds to the mass of the [NeuNAc+H]+ ion and can be detected at a retention time of 8.345 min. The chromatograms (1), (2) and (3) were obtained with the same samples as described in section (a), wherein chromatogram (2) is amplified 100-fold and chromatogram (3) is amplified 1,000-fold in relation to chromatogram (1). (ad 1) includes the mass spectrum pertaining to chromatogram (1) at a retention time of 8.345 min. (ad 2) shows the mass spectrum of chromatogram (2) at a retention time of 8.348 min.

EXAMPLE

Materials and Methods

Strains and Culture Conditions

(9) Trichoderma reesei (Hypocrea jecorina) QM9414 (ATCC 26921) was used as the parent strain in this example and was cultured on malt extract agar.

(10) Mycelia for the in vitro enzymatic reactions were obtained from cultures of the strains set up in 1,000 mL Erlenmeyer flasks with 200 mL of 3% (w/v) malt extract. The flasks were inoculated with 10^8 conidia per liter and the cultivation was carried out at 30 C. and 250 rpm for 40 h. The cultivation of T. reesei on colloidal chitin was performed in 1,000 mL Erlenmeyer flasks each containing 200 ml of Mandels-Andreotti medium including 1% (w/v) colloidal chitin and 0.1% (w/v) bacto peptone. The inoculation was performed with 10^8 conidia per liter and the incubation was carried out at 30 C. and 250 rpm for 90 h.

(11) For the in vivo production of NeuNAc, the corresponding T. reesei strains were directly cultured in 250 mL of Mandels-Andreotti medium containing 1% (w/v) GlcNAc at 30 C. and 250 rpm for 66 h (inoculation with 10^8 spores/liter).

(12) Synthetic Genes and Plasmid Construction

(13) The synthetic gene tbage was generated based on the protein sequence of Anabaena sp. CH1 GlcNAc 2-epimerase (GenBank: ABG57042) by translating the protein sequence into a DNA sequence using the software GeneOptimizer (Geneart, Germany). In this process, the DNA sequence was optimized with respect to the codon usage of T. reesei (Table 1):

(14) TABLE-US-00004 >tbage (SEQIDNO:3) tctagaatgggcaagaacctccaggccctggcccagctctacaagaacgc cctcctcaacgacgtcctgcccttctgggagaaccacagcctcgacagcg agggcggctacttcacctgcctcgaccgccagggcaaggtctacgacacc gacaagttcatctggctccagaaccgccaggtctggaccttcagcatgct ctgcaaccagctggagaagcgcgagaactggctcaagatcgcccgcaacg gcgccaagttcctcgcccagcacggccgcgacgacgagggcaactggtac tttgccctgacccgcggcggcgagcctctggtccagccctacaacatctt cagcgactgcttcgccgccatggccttcagccagtacgccctcgccagcg gcgaggagtgggccaaggacgtcgccatgcaggcctacaacaacgtcctc cgccgcaaggacaaccccaagggcaagtacaccaagacctaccccggcac ccgccccatgaaggccctggctgtccccatgatcctcgccaacctcaccc tggagatggagtggctcctcccccaggagaccctggagaacgtcctcgcc gccaccgtccaggaggtcatgggcgacttcctcgaccaggagcagggcct catgtacgagaacgtcgcccccgacggcagccacatcgactgcttcgagg gccgcctcatcaaccccggccacggcatcgaggccatgtggttcatcatg gacatcgcccgccgcaagaacgacagcaagaccatcaaccaggccgtcga cgtcgtcctca-acatcctcaacttcgcctgggacaacgagtacggcggc ctctactacttcatggacgccgccggccaccccccccagcagctggagtg ggaccagaagctctggtgggtccacctggagagcctcgtcgccctcgcca tgggctaccgcctcaccggccgcgacgcctgctgggcctggtatcagaag atgcacgactacagctggcagcacttcgccgaccctgagtacggcgagtg gttcggctacctcaaccgccgaggcgaggtcctcctcaacctcaagggcg gcaagtggaagggctgcttccacgtcccccgcgccatgtacctctgctgg cagcagttcgaggccctcaqctaatqcat

(15) In an analogous manner, the synthetic gene tneub was generated which is based on the protein sequence of the NeuNAc synthase from Campylobacter jejuni NCTC11168 and whose DNA sequence was also adapted to the codon usage of T. reesei:

(16) TABLE-US-00005 >tneub (SEQIDNO:4) tctagaatgcagatcaagatcgacaagctcaccatcagccagaagaaccc cctcatcatccccgagatcggcatcaaccacaacggcagcctggagatcg ccaagctcatggtcgacgccgccaagcgagccggcgccaagatcatcaag caccagacccacatcgtcgaggacgagatgagccaggaggccaagaacgt catccccggcaacgccaacatcagcatctacgagatcatggagcagtgcg ccctcaactacaaggacgagctggccctcaaggagtacgtcgagaagcag ggcctcgtctacctcagcacccccttcagccgcgccgccgccaaccgcct ggaggacatgggcgtcagcgcctacaagatcggcagcggcgagtgcaaca actaccccctgatcaagcacatcgcccagttcaagaagcccatgatcatc agcaccggcatgaacagcatcgagagcatcaagcccaccgtcaagatcct ccgcgactacgagatccccttcgtcctcctgcacaccaccaacctctacc ccacccccagccacctcgtccgcctccaggccatgctggagctgtacaag gagttcaactgcctctacggcctcagcgaccacacgacgaacaacctcgc ctgcatcggcgccatcgccctcggcgccagcgtcctggagcgccacttca ccgacaccatggaccgcaagggccccgacatcgtctgcagcatggacgag agcaccctcaaggacctcatcaaccagacccaggagatggtcctcctccg cggcgacaacaacaagaaccccctgaaggaggagcaggtcaccatcgact tcgccttcgccagcgtcgtcagcatcaaggacatcaagaagggcgagatc ctcagcatggacaacatctgggtcaagcgccccagcaagggcggcatcag cgccaaggacttcgaggccatcctcggcaagcgcgccaagaaggacatca agaacaacatccagctcacctggqacqacttcgaqtaatqcat

(17) For the construction of the plasmids pMS-PEC and pMS-PSC, the synthetic genes tbage and tneub were cut from their production plasmid using XbaI/NsiI restriction digestion and were inserted into the plasmid pRLM.sub.ex30 (Mach, R. L. et al., 1994, Curr. Genet. 25:567-70), wherein the hph gene located between the XbaI and the NsiI restriction site was replaced by tbage and tneub, respectively.

(18) For the construction of pGEX-epi and pGEX-syn, the plasmid pGEX4T-2 (GE Healthcare, UK) was digested with EcoRI and XhoI. A double-stranded DNA consisting of the oligomeric nucleotides GEXfw and GEXrev (Table 1) was inserted into the open pGEX4T-2, whereby the plasmid pGEX-MS was obtained and the new restriction sites XbaI and NsiI were generated. tbage tneub were introduced into pGEX-MS via the restriction sites XbaI/NsiI, which resulted in the formation of the plasmids pGEX-epi and pGEX-syn.

(19) TABLE-US-00006 TABLE2 Nucleotidesequencesoftheoligomersused Name Sequence(5.fwdarw.3) Usage NANASfw GTGGTGTGCAGGAGGACGAA qPCRtneub (SEQIDNO:5) NANASrev CAAGCACATCGCCCAGTTCAAG qPCRtneub (SEQIDNO:6) ManEfw GCGATCTTGAGCCAGTTCTC qPCRtbage (SEQIDNO:7) ManErev GCTACTTCACCTGCCTCGAC qPCRtbage (SEQIDNO:8) GEX-MSfw AATTCCTTCTAGAGATATGCATC construction (SEQIDNO:9) ofpGEX-MS GEX-MSrev TCGAGATGCATATCTCTAGAAGG construction (SEQIDNO:10) ofpGEX-MS pkifwR CTGCGACACTCAGAACATGTACGT qPCRpkicDNA (SEQIDNO:11) pkifwD GCTCTGCTTGGAACCTGATTGA qPCRpkiDNA (SEQIDNO:12) pkirev GGTCTGGTCGTCCTTGATGCT qPCRpki (SEQIDNO:13) sar1fw TGGATCGTCAACTGGTTCTACGA qPCRsari (SEQIDNO:14) sar1rev GCATGTGTAGCAACGTGGTCTTT qPCRsari (SEQIDNO:15)

(20) Protoplast Transformation of T. reesei

(21) The protoplast transformation of T. reesei was carried out as mentioned in a previous article (Gruber, F. et al., 1990. Curr. Genet. 18, 71-6). A total amount of 10 g of DNA was used per transformation. In a co-transformation, pMS-PEC (4 g) and pMS-PSC (4 g) were transformed together with the plasmid pHylox2 (2 g) which mediates a resistance to hygromycin B. Recombinant strains were selected for hygromycin B resistance.

(22) RNA Analysis

(23) RNA extraction, reverse transcription and qPCR were performed as described in a previous article. Oligomer nucleotide sequences which were employed as primers are given in Table 1. Sari was used as a reference gene for the normalization of the RT-qPCR. The primers ManEfw and ManErev were used for the gene tbage in the qPCR at an optimal elongation temperature of 64 C. and with 2 mM MgCl.sub.2. The primers NANAfw and NANArev were used for the gene tneub in the qPCR at an optimal elongation temperature of 64 C. For the pki gene, the primers pkifwR and pkirev were used in the qPCR at an optimal elongation temperature of 64 C. Data analysis was carried out using REST 2008.

(24) DNA Analysis

(25) Genomic DNA was isolated from the fungal mycelium, as described in a previous article. The hybridization and detection was carried out according to standard operating procedures using the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche, Switzerland). The qPCR of genomic DNA was performed using about 50 ng of genomic template DNA. The same primers as in the RNA analysis were used for the genes tbage and tneub. pki served as a reference gene and was amplified with the primers pkifwD and pkirev at an elongation temperature of 64 C.

(26) Glutathione S-Transferase (GST) Fusion Proteins

(27) GST fusion proteins of GlcNAc 2-epimerase (GST: epi) and NeuNAc synthase (GST: syn) were produced by expression of the plasmids pGEX-epi and pGEX-syn in E. coli BL21 (DE3) cells. According to the standard operating protocol, the fusion proteins were purified with the aid of GSTrapFF columns having a column volume of 1 mL (GE Healthcare).

(28) Enzymatic Reaction with Cell-Free Extracts

(29) Harvested mycelia were first ground in liquid nitrogen to give a fine powder and then immediately resuspended in a 0.1 M bicine buffer (pH 8) containing protease inhibitors (2 M of leupeptin, 1 M of pepstatin A, 10 M of PMSF) (0.3 g of mycelial powder/1 mL of buffer). The suspension was further lysed using an ultrasonic probe Sonifier 250 Cell Disruptor (Branson, U.S.) (settings: power 40%, duty cycle 50%, 20 s action, 40 s pause, 10 cycles) and insoluble components were separated by centrifugation (10 min, 13,000g, 4 C.). The whole supernatant was used in the enzymatic reaction. The enzymatic reaction was carried out in a similar manner as described by Vann et al. (Vann, W. F., et al., 1997, Glycobiology 7:697-701). The reaction for detecting the activity of GlcNAc 2-epimerase involves 10 mM GlcNAc, 0.2 mM ATP, 100 mM bicine buffer (pH 8) and 10-40 L of cell-free extract in a total volume of 100 L. The reaction for detecting the activity of NeuNAc synthase involves 10 mM ManNAc, 10 mM PEP, 12.5 mM MnCl.sub.2, 100 mM bicine buffer (pH 8) and 10-40 L of cell-free extract in a total volume of 100 L. The combined reaction for detecting the activity of both GlcNAc 2-epimerase and NeuNAc synthase involves 10 mM GlcNAc, 10 mM PEP, 12.5 mM MnCl.sub.2, 100 mM bicine buffer (pH 8) and 40 L of cell-free extract in a total volume of 100 L. All reactions were incubated for 60 min at 37 C., heat-inactivated for 10 min at 85 C. and then analyzed by HPLC. 5 L (1 g/L) each of the GST-fusion proteins GST:epi and GST:syn were used a positive control in the enzymatic reaction instead of using cell-free extracts.

(30) Chitinase Enzymatic Reaction

(31) In this reaction, the release of GlcNAc from the polymer chitin is measured. Chitin was employed both as raw chitin from crab shells and as colloidal chitin in a 30 mM phosphate buffer (pH 4.7). 5, 10 or 50 L of the culture supernatant were measured in a total volume of 1.5 mL. The reaction was incubated for 20 h at 37 C. and then heat-inactivated for 10 min at 90 C. The formation of GlcNAc was measured in the HPLC.

(32) NeuNAc Detection in Cell-Free Extracts

(33) Harvested mycelium of T. reesei was ground in liquid nitrogen to give a fine powder and resuspended in bidistilled water (0.3 g of mycelial powder/1 ml of water). The suspension was further lysed with an ultrasonic probe Sonifier 250 Cell Disruptor (Branson, U.S.) (settings: Power 40%, duty cycle 50%, 20 s action, 40 s pause, 10 cycles) and insoluble components were separated by centrifugation (10 min, 13,000g, 4 C.). The supernatant was filtered through a 0.45 m filter and analyzed by HPLC-MS.

(34) HPLC-MS Analysis

(35) The formation of NeuNAc and ManNAc in the enzymatic reaction as well as in the cell-free extract was measured in a HPLC-MS (IT-TOF-MS) (Shimadzu, Japan) using a Rezex RHM monosaccharide H.sup.+ column (8%, 3007.8 mm) (Phenomenex, USA). The mobile phase consisted of water containing 0.1% (v/v) of trifluoroacetic acid and the flow was set to 0.6 mL/min. The column temperature was 80 C. and 10 L of sample were loaded onto the column. Detection was performed in the ESI.sup.+ mode and a scanning range of 60 to 600 amu was covered.

(36) Results

(37) In Silico Analysis of a NeuNAc Biosynthesis Pathway in T. reesei

(38) At present, there is no evidence in the literature that NeuNAc can be produced naturally in Trichoderma reesei. Therefore, the known metabolic reactions leading to the production of NeuNAc were verified in silico and it was checked whether they also occur in T. reesei. FIG. 1 illustrates the presently known enzyme-catalyzed processes which lead to the formation of NeuNAc using the biopolymer chitin as a starting substance. Present in Trichoderma are enzymes which are required for catabolizing chitin. The first step from chitin to the monomer GlcNAc is catalyzed by chitinases (3.2.1.14). Furthermore, the activity of a hexokinase (EC 2.7.1.1), a GlcNAc 6-phosphate deacetylase (EC 3.5.1.25) and a glucosamine-6-phosphate deaminase (EC 3.5.99.6) is required to catabolize chitin, so that fructose-6-phosphate may eventually enter the glycolytic pathway. At least one potential enzyme in each case can be found in the annotated genome of T. reesei (Table 3). Furthermore, genes can be found that are responsible for the biosynthesis of chitin, including a phosphoacetylglucosamine mutase (EC 5.4.2.3), an UDP-N-GlcNAc diphosphorylase (EC 2.7.7.23) and a plurality of chitin synthases (EC 2.4.1.16). However, no genes are annotated in the genome of T. reesei that are responsible for the synthesis of ManNAc (EC 5.1.3.8 in bacteria, EC 5.1.3.4 in mammals) or for the synthesis of NeuNAc (EC 2.5.1.6. in bacteria, EC 2.7.1.60, EC 2.5.1.57, EC 3.1.3.29 in mammals).

(39) TABLE-US-00007 TABLE 3 Candidate genes for the metabolic reactions of chitin and GlcNAc which are annotated in the genome of T. reesei. EC number Name Protein identity EC 3.2.1.14 Chitinase 2735, 43873, 53949, 62645, 62704, 66041, 68347, 72339, 80833, 81598, 104401, 110317, 119859, 123354, 124043 EC 2.7.1.1 Hexokinase 56129, 73665, 79677 EC 3.5.1.25 GlcNAc-6-phosphate 79671 deacetylase EC 3.5.99.6 Glucosamine-6-phosphate 49898 deaminase EC 5.4.2.3 Phosphoacetylglucosamine 80994 mutase EC 2.7.7.23 UDP-N-GlcNAc 79568 diphosphorylase EC 2.4.1.16 Chitin synthase 51492, 55341, 58188, 71563, 112271, 122172

(40) A Gene Cluster for the Catabolic Conversion of GlcNAc in Trichoderma reesei

(41) During the in silico analysis of the degradation pathways for GlcNAc, three candidate genes (estExt_GeneWisePlus. C_140427, est-tExt_GeneWisePlus.C_140421, estExt_Genewise1.C_140432) could be found which encode a hexokinase, a GlcNAc-6-phosphate deacetylase and glucosamine-6-phosphate deaminase and are all located in close proximity to one another in the genome of T. reesei (location in the genome on scaffold 14: 714385-729984). Similar clusters are also present in other filamentous fungi, such as Neurospora crassa or Aspergillus nidulans, which is indicative of a conserved cluster for the catabolism of GlcNAc.

(42) The hexokinase (Protein ID 79677) that is annotated in the genome of T. reesei can therefore be further specified as GlcNAc kinase (EC 2.7.1.59), analogous to the annotation and characterization in Candida albicans (39). Furthermore, the gene (estExt_GeneWisePlus.C_140419), which is located adjacent to the GlcNAc-6-phosphate deacetylase (estExt_GeneWisePlus.C_140421), may also pertain to the cluster as a homologue of this gene in Neurospora crassa is annotated as -N-acetylglucosaminidase (N. crassa OR74A (NC10): Supercontig. 6: 560844-564980) is annotated.

(43) Construction of Expression Vectors

(44) A two-enzyme strategy was chosen for the production of NeuNAc in Trichoderma, wherein the first enzymatic step is catalyzed by a GlcNAc 2-epimerase (EC 5.1.3.8) and the second by a NeuNAc synthase (EC 2.5.1.99). The protein sequence of the GlcNAc 2-epimerase from Anabaena sp. CH1 (GenBank: ABG57042) and, for the NeuNAc synthase, the protein sequence of Campylobacter jejuni NCTC11168 (Cj1141) were selected as candidates. The protein sequences were translated into DNA sequences by means of the software GeneOptimizer (Geneart) and the codon usage was adapted to that of T. reesei (Table 1). The resulting synthetic genes were designated as tbage and tneub.

(45) The coding sequences were inserted into the plasmid pRLMex30, wherein the coding sequence for the hph gene was substituted in this plasmid. Thus, both genes were under the control of the constitutive pki promoter and the cbh2 terminator (plasmid pMS-PEC with tbage and plasmid pMS-PSC with tneub).

(46) In order to be able to also express both genes under an inducible system, the pki promoter was replaced by the xyn1 promoter (plasmid pMS-XEX with tbage and plasmid pMS-XSC with tneub).

(47) TABLE-US-00008 TABLE 4 Comparison of an inducible promoter system (xyn1) and a constitutive promoter system (pki) Genomic DNA Transcript formation Enzymatic activity Strain Promoter Epimerase Synthase Epimerase Synthase Epimerase Synthase XEX5 xyn1 + n.d. + n.d. n.d. XEX11 xyn1 + n.d. + n.d. n.d. XSC3 xyn1 n.d. + n.d. + n.d. XSC13 xyn1 n.d. + n.d. + n.d. PEC11 pki + n.d. + n.d. + n.d. PEC15 pki + n.d. + n.d. + n.d. PEC17 pki + n.d. + n.d. + n.d. PSC15 pki n.d. + n.d. + n.d. + PSC16 pki n.d. + n.d. + n.d. + PSC17 pki n.d. + n.d. + n.d. XEX/XSC1 xyn1 + + + + XEX/XSC5 xyn1 + + + + PEC/PSC1 pki + + + + + + PEC/PSC10 pki + + + + + (n.d. = not determined, + present, absent)

(48) To produce Trichoderma reesei strains that are capable of producing NeuNAc, the parent strain QM9414 was transformed with various combinations of the plasmids pMS-PEC, pMS-PSC, pMS-XEX as well as pMS-XSC and pMS-Hylox2 (including the selection marker hph between two loxP sequences). The plasmids containing the genes tbage and tneub were transformed both individually and in a combination of tneub/tbage.

(49) Selected transformants were examined with respect to integration of the transformed DNA in the genome as well as transcript formation and enzymatic activity of GlcNAc 2-epimerase and NeuNAc synthase. The results are shown in Table 4. It can be seen that while there was a detectable transcript formation with the xyn1 promoter, no enzymatic activity of the two heterologously expressed enzymes could be detected. Work was therefore continued exclusively with those strains in which expression occurred under the control of the pki promoter.

(50) The two strains PEC/PSC1 and PEC/PSC10 were further examined with respect to their genomic copy number ratio of tbage and tneub. Table 5 shows the results of this investigation.

(51) TABLE-US-00009 TABLE 5 Comparison of gene transcription and gene copy number between two transgenic strains of T. reesei Transcript ratio Copy ratio PEC/PSC1/PEC/PSC10 PEC/PSC1/PEC/PSC10 Designation of gene Median [95% CI] median [95% CI] tbage 2.021 [1.589-2.836] 1.810 [1.376-2.585] tneub 0.479 [0.385-0.622] 0.400 [0.320-0.492]

(52) The strain PEC/PSC1 exhibits a transcription of the tbage gene that is approximately 2-fold higher than that of the strain PEC/PSC10. In contrast, the strain PEC/PSC10 exhibits an about 2-fold higher transcription of the gene family tneub than the strain PEC/PSC1. These difference in transcription levels can be explained by the different copy numbers of the two genes in the genome of both strains. The ratio of the copy number in both strains was measured by qPCR of genomic DNA, wherein the gene encoding the pyruvate kinase (pki) was used as reference gene. The copying conditions in both strains equaled the transcription ratios, which leads to the fact that the different transcription ratios can be explained with the copy number ratio and each copy of the gene is apparently transcribed with the same efficiency (Table 5).

(53) Heterologous Protein Expression of GlcNAc 2-Epimerase and NeuNAc Synthase in Trichoderma reesei

(54) After the cultivation of the Trichoderma reesei strain, the cell-free extract was tested for the presence of GlcNAc 2-epimerase and NeuNAc synthase. The conversion of the substrates PEP and GlcNAc to form ManNAc and NeuNAc was measured subsequently to the addition of the cell-free enzyme-containing extract. The conversion reaction was analyzed by HPLC-MS and the corresponding chromatograms are shown in FIGS. 2a and 2b. In this conversion reaction, GST fusion proteins of GlcNAc 2-epimerase (tbage) and NeuNAc synthase (tneub), which are produced by expression in E. coli, were used as a positive control.

(55) The formation of ManNAc and NeuNAc shows indicates that the two synthetic genes tbage and tneub are functionally expressed in Trichoderma (FIG. 2a2 and FIG. 2b2). Also, the positive control with the GST fusion proteins shows the formation of ManNAc and NeuNAc (FIG. 2a1 and FIG. 2b1). Neither ManNAc nor NeuNAc are formed in the enzymatic reaction when an extract of the original strain QM9414 is used. This result shows that no significant GlcNAc 2-epimerase activity is present in the parent strain. Furthermore, it was also exclusively tested for NeuNAc synthase activity in strain QM9414, wherein ManNAc and PEP were used as a substrate in the enzymatic reaction. Neither in this case any activity in the parent strain could be observed, which suggests that there is neither NeuNAc synthase activity nor GlcNAc 2-epimerase activity in natural isolates of Trichoderma reesei.

(56) Growth of Trichoderma reesei on Colloidal Chitin and Release of GlcNAc

(57) In order to investigate the hydrolysis of chitin to form the monomer GlcNAc, the T. reesei strain PEC/PSC1 was cultured on colloidal chitin as a carbon source. During the cultivation the increase in chitinase activity was monitored. After 90 h of cultivation time the chitinase activity reached its maximum and the supernatant was tested for the ability to hydrolyze chitin. The results are presented in Table 6. Colloidal chitin from crab shells yields ten times more GlcNAc than untreated chitin from crab shells. The GlcNAc thus released may be used as a starting substance for the production of NeuNAc with the strain PEC/PSC1.

(58) TABLE-US-00010 TABLE 6 Chitinase activity induced by cultivation of the T. reesei strain PEC/PSC1 on 1% chitin. Chitinase activity.sup.a Substrate [mU/ml] crab-shell chitin 2.7 0.5 colloidal crab-shell chitin 25.0 0.9 .sup.a1U: Release of 1 mol of GlcNAc/min at 37 C.

(59) In Vivo Formation of NeuNAc in T. reesei

(60) In the following experiment it was to be determined whether the two heterogeneously expressed enzymes are also functional and capable of forming NeuNAc from their culture medium in vivo. For this experiment, the recombinant strain PEC/PSC1 was cultured on GlcNAc. The parent strain QM9414 was cultivated as a negative control. The mycelium of both strains was harvested and assayed for the presence of NeuNAc by means of HPLC-MS. The results are shown in FIGS. 3a and 3b.

(61) The recombinant strain PEC/PSC1 produces ManNAc (FIG. 3a2) and NeuNAc (FIG. 3b2, 10 g per g of dry biomass). This result indicates that NeuNAc can be produced in T. reesei by co-expression of two bacterial enzymes. The parental strain QM9414 shows neither a formation of NeuNAc nor of ManNAc (FIG. 3a3 and FIG. 3b3).

(62) Summary of the Results

(63) In this example, the introduction of an intracellular synthesis pathway for the production of NeuNAc in the fungus Trichoderma reesei has been demonstrated. To the best of our knowledge, this was the first time that an intracellular two-stage enzyme cascade was introduced into a filamentous fungus in order to produce a fine chemical such as NeuNAc. While T. reesei itself is not capable of producing NeuNAc, it is well capable of producing the important intermediate metabolite GlcNAc. This substance is released in the depolymerization process of the renewable raw material chitin (Table 6). Because of its saprophytic nature, T. reesei produces a plurality of chitinases (Table 3) and is capable of effectively degrading the polymer chitin to yield its monomer GlcNAc. The specific biosynthesis of NeuNAc starts with intermediates of the chitin metabolic pathway (GlcNAc or UDP-GlcNAc) (see FIG. 1) which are available in T. reesei. However, no genes can be found in this organism that are similar to genes encoding an UDP-GlcNAc 2-epimerase, a ManNAc kinase, a NeuNAc 9-phosphate synthase or a NeuNAc 9-phosphatase. For an alternative synthesis pathway for NeuNAc, as can be found in bacteria, the activity of a GlcNAc 2-epimerase and a NeuNAc synthase (FIG. 1) is required. No genes for this pathway are present in Trichoderma reesei.

(64) The presence of NeuNAc on the surface of conidia has already been detected in Aspergillus fumigatus, while NeuNAc could not be detected on the conidia of the Trichoderma reesei strain QM9414. Neither the necessary enzymatic activity nor traces of ManNAc and NeuNAc could be detected in this strain. This indicates that naturally occurring Trichoderma reesei strains are not capable of synthesizing NeuNAc or ManNAc. Therefore, it is necessary to induce the corresponding enzymatic activities in this organism by means of heterologous expression in order to produce NeuNAc. The first enzyme in this cascade, a GlcNAc 2-epimerase, was obtained from Anabaena sp. This enzyme is well-characterized and requires a comparatively small amount of the cofactor ATP (20 M) to develop to its maximum activity.

(65) The second enzyme, a NeuNAc synthase, was obtained from C. jejuni. The codon usage of both genes was optimized with respect to the codon usage of Trichoderma reesei in order to improve the expression of the bacterial genes in the fungal host. The constitutive promoter of the pki gene on the one hand and the well-controllable promoter of the xyn1 gene on the other hand were chosen for the expression of the genes. Under the control of the xyn1 promoter no successful expression of the two genes could be achieved. Although it was shown that the genes are transcribed, no enzymatic activity could be detected. Under the control of the pki promoter the two heterologously expressed genes can not only be transcribed, but the corresponding enzymatic activity could also be detected. In a strain expressing both genes under the control of the constitutive pki promoter, the formation of NeuNAc could also be demonstrated in vivo. For this purpose, the fungus was cultured on the biopolymer chitin, which resulted in the release of the monomer GlcNAc. When cultivating the recombinant strain the production of NeuNAc could be detected in the mycelium (FIG. 3b2).

(66) It was shown by the introduction of a two-stage enzyme cascade into Trichoderma reesei that the fungus had acquired the capability of producing NeuNAc. This example shows that high-quality fine chemicals can be produced from a renewable resource, as for instance from chitin. However, not only chitin, but also a variety of other carbon sources, such as cellulose and hemicelluloses, can be utilized by the saprophytic fungus Trichoderma reesei and underscore its potential in the application as a cell factory for the production of various chemicals.