Decapeptide-12 Modulation of Sirtuin Gene Expression in Epidermal Keratinocyte Progenitors

20180296456 ยท 2018-10-18

    Inventors

    Cpc classification

    International classification

    Abstract

    Recent reports detail the pleiotropic roles sirtuins play in repressing premature aging, delaying cellular senescence, enhancing longevity, and ameliorating a wide range of aging disorders. Herein, we report our findings on the potent sirtuin activator, decapeptide-12, and compare its performance to the well documented oxyresveratrol. Treatment of human epidermal keratinocyte progenitors with 100 M decapeptide-12 increased transcription of SIRT1 by 14111 percent relative to control cells, whereas levels of SIRT3, SIRT6, and SIRT7 were increased by 12113 percent, 1478 percent and 95.414 percent, respectively. Decapeptide-12 upregulated sirtuin transcription to similar levels as oxyresveratrol but with reduced cytotoxicity.

    Claims

    1. A peptide consisting of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ. ID NO: 12.

    2. The peptide of claim 1 wherein the peptide consists of SEQ ID NO: 9 modified by a modifying group, the modifying group being either a palmitoyl group or an acetyl group at an amino-terminal end, or amidation of a carboxy-terminal end, or both.

    3. The peptide according to any of claims 1-2 consisting of SEQ ID NO: 11 having a tyrosine amino acid at a position 6 as a D-isoform, and all other amino acids being L-isoforms.

    4. A composition comprising a first peptide consisting of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ. ID NO: 12.

    5. The composition of claim 4 wherein the peptide consists of SEQ ID NO: 9 modified by a modifying group, the modifying group being either a palmitoyl group or an acetyl group at an amino-terminal end, or amidation of a carboxy-terminal end, or both.

    6. The composition according to any of claims 4-5 consisting of SEQ ID NO: 11 having a tyrosine amino acid at a position 6 as a D-isoform, and all other amino acids being L-isoforms.

    7. The composition according to any of claims 4-6 wherein the peptide is present in a concentration of 1 m or greater.

    8. A method of treating a subject by modulating expression of a sirtuin gene in a skin cell to reduce symptoms of skin aging, the method comprising administering to a subject in need thereof a composition comprising an effective amount of one or more peptides, wherein the one or more peptides consist of, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ. ID NO: 12.

    9. The method according to claim 8 wherein the peptide consists of SEQ ID NO: 9 modified by a modifying group, the modifying group being either a palmitoyl group or an acetyl group at an amino-terminal end, or amidation of a carboxy-terminal end, or both.

    10. The method according to any of claims 8-9 wherein the peptide consists of SEQ ID NO: 11 having a tyrosine amino acid at a position 6 as a D-isoform, and all other amino acids being L-isoforms.

    11. The method according to any of claims 8-10 wherein the skin cell is a progenitor.

    12. The method according to claim 11 wherein the progenitor is an epidermal keratinocyte progenitor, a melanoblast, a fibroblast, a histioblast, or a dendroblast.

    13. The method according to any of claims 8-10 wherein the skin cell is terminally differentiated.

    14. The method according to claim 13 wherein the skin cell is a keratinocyte, a melanocyte, a fibrocyte, a histiocyte, or a dendrocyte.

    15. The method according to any of claims 8-14 wherein the peptide is present in a concentration of 1 m or greater.

    16. The method of according to any of claims 8-15 wherein the sirtuin gene comprises SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7.

    17. The method according to any of claims 8-16 wherein the composition further comprises oxyresveratrol.

    18. The method according to any of claims 8-17 wherein the skin cell is a mammal cell.

    19. The method according to claims 18 wherein the skin cell is human.

    20. A method of modulating expression of a sirtuin gene in a skin cell, the method comprising administering to a subject in need thereof a composition comprising an effective amount of one or more peptides, wherein the one or more peptides consist of, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ. ID NO: 12.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0026] FIG. 1A shows dose-dependent transcriptional upregulation of SIRT1 (a). Data are expressed as fold increase relative to the internal control gene 18S, and represent meansSEM of 3 independent experiments.

    [0027] FIG. 1B shows dose-dependent transcriptional upregulation of SIRT3, (b). Data are expressed as fold increase relative to the internal control gene 18S, and represent meansSEM of 3 independent experiments.

    [0028] FIG. 1C shows dose-dependent transcriptional upregulation of SIRT6 (c). Data are expressed as fold increase relative to the internal control gene 18S, and represent meansSEM of 3 independent experiments.

    [0029] FIG. 1D shows dose-dependent transcriptional upregulation of SIRT7 (d). Data are expressed as fold increase relative to the internal control gene 18S, and represent meansSEM of 3 independent experiments.

    [0030] FIG. 2A shows cytotoxic effects of decapeptide-12 and oxyresveratrol on epidermal keratinocytes. Data are expressed as percent control and represent meansSEM of 3 separate experiments. *P<0.05.

    [0031] FIG. 2B shows effects of decapeptide-12 and oxyresveratrol on epidermal keratinocytes proliferation. Data are expressed as percent control and represent meansSEM of 3 separate experiments. *P<0.05.

    DETAILED DESCRIPTION OF THE INVENTION

    [0032] Skin manifests the consequences of chronological and photoaging rendering us constantly aware of the aging process and seeking remedies to slow or reverse its impact. Skin aging has traditionally been categorized as extrinsic or intrinsic. Recent evidence indicates that both types share important molecular features including altered signal transduction pathways that promote matrix metalloproteinase expression, decreased procollagen synthesis, and connective tissue damage.

    [0033] In human skin, aging is associated with an increased number of senescent cells and a reduced capacity for cellular proliferation and differentiation. Substantial evidence supports the theory that aging is predominantly a consequence of free radical damage by various endogenous reactive oxygen species (ROS). Velarde et al. reported on the in vivo evidence for a causal relationship between mitochondrial oxidative damage, cellular senescence, and aging phenotypes in the skin. Furthermore, ultraviolet (UV) radiation stimulates ROS synthesis, which has been implicated in mutagenesis and photoaging. In line with these findings, data suggest altered expression of sirtuin activity in UV irradiated versus sun-protected skin and that these differences may be responsible for certain aspects of skin aging.

    [0034] Cellular senescence describes a process in which cells cease dividing and undergo distinctive phenotypic alterations, including profound chromatin and secretome changes, as well as tumor-suppressor activation. Numerous reports helped establish the concept of sirtuins as potent anti-aging proteins, detailing their pleiotropic roles in delaying cellular senescence and premature aging. Sirtuins are key effectors in pathways such as DNA damage repair, telomere shortening, the cellular response to oxidative stress, and ameliorating ROS-induced pathologies.

    [0035] In mammals, there are seven sirtuin genes (SIRT1-7) localized in different cellular compartments and capable of diverse actions. Biochemically, sirtuins are a class of proteins that possesses mainly NADtdependent lysine deacetylase activity. Sirtuins are broadly recognized as critical regulators of multiple metabolic pathways, sensors of energy and redox status in cells, and modulators of oxidative stress.

    [0036] These findings have triggered interest in developing small molecule activators or pharmaceuticals to help slow the progression of aging and its wide range of age-associated disorders. Of the seven mammalian sirtuins, SIRT1 has been the most extensively studied with regards to aging and longevity. For instance, the anti-aging effects of resveratrol are primarily attributed to SIRT1 activation. Indeed, Ido et al. reported that resveratrol, via increasing the activity of AMP-activated protein kinase and sirtuins, ameliorated cellular senescence and proliferative dysfunction.

    [0037] We have previously reported the potent hypopigmenting efficacy of decapeptide-12 in human skin. Further clinical studies revealed an overall improvement in facial skin appearance in patients with dyschromia who were treated twice daily with topical cream containing 0.01 percent of decapeptide-12 for 8 weeks. These findings led us to hypothesize that decapeptide-12 may modulate sirtuin activity to improve overall skin appearance. To clarify this possibility, we assessed the effects of decapeptide-12 on sirtuin transcription in human epidermal progenitors.

    [0038] Materials and Methods

    [0039] Reagents

    [0040] Decapeptide-12 (YRSRKYSSWY) SEQ ID NO: 9 was synthesized by Bio Basic, Inc. (Ontario, Canada) using solid-phase FMOC chemistry. Oxyresveratrol was purchased from Sigma-Aldrich (St. Louis, Mo.).

    [0041] Cell Culture

    [0042] Human neonatal epidermal progenitors (Thermo Fisher Scientific, NY) were seeded in 6-well plates at a density of 210.sup.5 cells/well. Each well received 2 ml of Epilife media containing 60 M calcium chloride (Thermo Fisher Scientific, NY). Plates were incubated in a humidified chamber at 37 degrees Celsius and 5 percent CO.sub.2. Twenty-four hours later, cells were treated with various concentrations of oxyresveratrol or decapeptide-12 dissolved in PBS containing 5 percent DMSO. Control wells received vehicle only (5 percent DMSO and PBS). Final concentration of DMSO in each well was 0.05 percent.

    [0043] Total RNA Extraction, Quantitation, and cDNA Synthesis

    [0044] After a 72 hour incubation period, cells were trypsinized and total RNA extracted, using RNeasy kit (Qiagen, Valencia, Calif.) according to the manufacturer's protocol.

    [0045] RNA concentration was determined using nanodrop (Thermo fisher scientific, NY). Two g of total RNA were used to synthesize cDNA using oligo dT primers and TaqMan reverse transcription reagents (Thermo fisher scientific, NY). The reaction was carried out in DNA Engine Peltier Thermal Cycler (Bio-Rad, Hercules, Calif.). The annealing temperature was 25 degrees Celsius for 10 minutes, followed by first strand synthesis at 48 degrees Celsius for 1 hour, and heat inactivation at 95 degrees Celsius for 5 minutes.

    [0046] Semi-Quantitative Analysis

    [0047] The SIRT1-7 primers (table 1) were designed using Primer3. The semi-quantitative PCR reactions were performed on a DNA Engine Peltier Thermo Cycler (Bio-Rad, Hercules, Calif.). PCR was carried under the following conditions: denaturation at 94 degrees Celsius for 2 minutes and primer extension at 54 degrees Celsius for 30 seconds in 34 cycles for SIRT 1-7 and the housekeeping gene 18S.

    [0048] Table 1: Primer sequences for SIRT1-7 and 18S

    TABLE-US-00001 TABLE1 Gene Primersequence(5-3) SIRT1 FGCCAATCATAAGATGTTGCTGAAC SEQID RTAGAGCCTCACATGCAAGCTCTA NO:1 SIRT2 FAACCTCCCTCATCTCTAACT SEQID RGTCTCCAATAAGCAATGTCT NO:2 SIRT3 FGTTGGTTACAAGATCCAGAC SEQID RAGATAGAAAGTGCTGGAATG NO:3 SIRT4 FAGAGCTGTGAGAGAATGAAG SEQID RTTTCTGACCTGTAGTCTGGT NO:4 SIRT5 FTCTTCCATACACTTTACTACCTT SEQID RTTTATATGATAGTGTCTTGTTGC NO:5 SIRT6 FCAGCTTAAACAGGAGTGAAC SEQID RTTATTGCATTGAGGACTTTT NO:6 SIRT7 FGACATTTTTAGCCATTTGTC SEQID RCATCCAGTACAGAGAGGATT NO:7 18S FCGGAGGTTCGAAGACGATCAGATA SEQID RTTGGTTTCCCGGAAGCTGCC NO:8

    [0049] Samples were run and resolved on a 1.5 percent agarose gel containing 0.5 g/ml of ethidium bromide and imaged using the FluorChem HD2 Imaging System (Protein simple, San Jose, Calif.). Densitometry analysis was carried out using the AlphaEase FC software (Protein simple, San Jose, Calif.). Intensity ratios were calculated as the intensity value for each gene divided by the intensity value of the internal control gene 18S.

    [0050] Viability/Proliferation and Cytotoxicity Assays

    [0051] Proliferation rates were determined using a TACS MTT Cell Proliferation Kit (R&D systems, Minneapolis, Minn.). Cells were seeded at 2.510.sup.4/well in 96-well plates in a humidified atmosphere with 5 percent CO.sub.2 at 37 degrees Celsius. Twenty-four hours later, decapeptide-12 or oxyresveratrol were added to the corresponding wells at varying concentrations (0, 3, 10, 30, 100, 300, and 1000 M), and cultures were then incubated for 72 hours. The remainder of the procedure was performed following the manufacturer's protocol.

    [0052] Cellular toxicity was measured using a trypan blue dye exclusion assay. Cells were cultured in 6-well plates at a density of 410.sup.5 cells/well. Each well received a different concentration of decapeptide-12 or oxyresveratrol (0, 3, 10, 30, 100, 300, and 1000 M). Plates were incubated at 37 degrees Celsius in a humidified 5 percent CO.sub.2 chamber. After 72 h, an aliquot was taken and cells counted using a hemacytometer. Cytotoxicity was measured according to the following formula: [1(# of cells in control# of live cells in test sample)/# of cells in control]100 percent.

    [0053] Statistical Analysis

    [0054] The means and their standard errors were calculated from 3 independent runs using Microsoft Excel, and statistical significance was determined using a paired analysis of variance. P values were taken to be statistically significant at P<0.05.

    [0055] Results

    [0056] Effects of Decapeptide on Proliferation Rates and Cytotoxicity:

    [0057] We first assessed the cytotoxic effect of decapeptide-12 and oxyresveratrol on human epidermal progenitors. FIG. 2A shows that treatment with 100 M decapeptide-12 or oxyresveratrol resulted in 31 percent or 61 percent cell death, respectively. At 1 mM, decapeptide-12 or oxyresveratrol resulted in 72 percent or 162 percent cell death, respectively.

    [0058] We also evaluated the effects of decapeptide-12 and oxyresveratrol on the viability and proliferation of human epidermal progenitors. FIG. 2B shows that treatment with 300 M decapeptide-12 or oxyresveratrol resulted in 21 percent or 51 percent reduced cell proliferation, respectively. However, unlike 1 mM decapeptide-12 which reduced proliferation 32 percent, 3-d incubation with oxyresveratrol reduced proliferation 122 percent.

    [0059] Decapeptide-12 Upregulated Transcription of SIRT1-7:

    [0060] We next assessed the effect of oxyresveratrol and decapeptide-12 on sirtuin expression in human epidermal progenitors. FIGS. 1A-1D and table 2 show decapeptide-12 and oxyresveratrol modulated transcription of SIRT1-7 in a dose-dependent fashion. At 30 oxyresveratrol, SIRT1 transcription levels were upregulated by 1259 percent relative to control cells, whereas SIRT3, SIRT6, and SIRT7 were upregulated by 1335 percent, 738 percent, and 957 percent, respectively.

    [0061] Table 2. Gene expression profile of SIRT 1-7 in response to treatment with decapeptide-12 (a) and oxyresveratrol (b). Results are averages of 3 independent runs.

    TABLE-US-00002 TABLE 2a Deca [M] SIRT1 SIRT2 SIRT3 SIRT4 SIRT5 SIRT6 SIRT7 3 3 1% 1 1% 4 1% 3 1% 3 1% 3 1% 5 1% 10 12.2 3.1%.sup. 4.1 3% 9.2 2.8% 8.1 4%.sup. 5.2 3%.sup. 21.3 8.1% 15 4.2% 30 34 6.7% 11.2 3.7% 32.2 6.1% 12.1 7% 21 6.7% 52 5.1% 34.4 9.2% 50 79.2 12% 21.5 4.9% .sup.65 12.1% 41.2 13.1% 33.1 6.1% 95.4 13.4% 61.3 10.2% 100 141.2 11% 35.4 5.5% 121 13.2% 71.4 14.1% 46 7.3% 147 8.4% 95.4 14.2% 300 188 12%.sup. 61.1 6.8% 165.2 12.4% 115 11.7% 67 9.3% 189 9.5% 148 9.6% 500 205 13.3% .sup.76 6.1% 177 9.2% 145 12.7% 87.4 15.1% 194 14% 171.4 8.4% 1000 213 13.4% .sup.76 7.1% 171 9% 151 13.4% 92.1 16.8% 167 12.2% 181.1 8.4%

    TABLE-US-00003 TABLE 2b Oxy [M] SIRT1 SIRT2 SIRT3 SIRT4 SIRT5 SIRT6 SIRT7 3 8.7 1% 7.9 2% 10 3% 8.1 1% 7.1 1% 6.1 1% 6.3 1% 10 45 7.7% 14.9 1.9% 52.7 5.1% 12.4 2.1% 12.3 3%.sup. .sup.34 5.5% 65 2.9% 30 124.5 8.6% 43.1 2.4% 133 4.8% .sup.49 6.7% 45.1 4.3% .sup.73 8.1% 95 6.7% 50 166 14.5% 56.3 7.7% 156 9.2% 52.1 6.6% 46 4% 81.3 8.1% 114 8.1% 100 187 16.6% 41.2 8.1% 148 7.3% 64.1 7.4% 36.1 6.7% 82.4 8.4% 132 7.6% 300 187 15.4% .sup.39 9.3% 152.2 9% .sup.67 8.7% 33.4 7.1% 87.4 9.3% 168 4.8% 500 176 10%.sup. 33.1 12.4% 151 8.1% 61.2 8.8% 35.1 8.1% 81.2 12.4% 177 6.6% 1000 175 9% 31.2 12.3% 151 7.4% 71.3 9.2% .sup.37 6.8% 75 15.1% 165 5.1%

    [0062] The data shows that 100 M decapeptide-12 increased transcription of SIRT1 by 14111 percent relative to untreated cells, whereas SIRT3, SIRT6 and SIRT7 increased by 12113 percent, 1478 percent, and 9514 percent, respectively (FIGS. 1A-1D).

    [0063] Discussion

    [0064] The pleiotropic roles sirtuins play in delaying cellular senescence and blocking the development of premature aging has helped substantiate them as potent anti-aging proteins. Therapeutic use of resveratrol as a SIRT1 activator and potential anti-aging agent has been extensively researched and documented. Resveratrol protects human endothelium from H.sub.2O.sub.2-induced oxidative stress and senescence via SIRT1 activation. Similarly, oxyresveratrol is also a potent antioxidant and free radical scavenger. However, unlike resveratrol, it exhibits less cytotoxicity and better water solubility. Consequently, we elected to use it as a positive control against which we compared decapeptide-12s performance and ability to modulate sirtuin transcription in human epidermal keratinocytes.

    [0065] Even though all 7 sirtuins were upregulated after treatment with decapeptide-12, our discussion will focus on those sirtuins directly implicated in skin aging.

    [0066] At 100 M or 1 mM, decapeptide-12 increased SIRT1 transcription by an impressive 141 or 213 percent, respectively. SIRT1 is primarily a nuclear deacetylase. It controls various cellular processes such as cell proliferation, differentiation, apoptosis, metabolism, stress response, genome stability, and cell survival. Cao et al reported that SIRT1 confers protection against UVB- and H.sub.2O.sub.2-induced cell death via modulation of p53 and c-Jun N-terminal kinases in cultured skin keratinocytes, suggesting that SIRT1 activators could serve as new anti-skin aging agents. Other researchers reported that SIRT1 can suppress NF-B signaling and thus delay the aging process and extend lifespan. SIRT1 activation inhibits NF-B signaling directly by deacetylating the p65 subunit of NF-B complex and enhances oxidative metabolism and the resolution of inflammation. Consequently, SIRT1 can be regarded as a crucial anti-aging protein which mediates its widespread effects in preventing premature senescence and accelerated aging by regulating multiple molecular pathways.

    [0067] SIRT3 transcription was increased by 121 percent following treatment with 100 M decapeptide. SIRT3 has been primarily linked to the regulation of a variety of mitochondrial processes, such as -oxidation, ATP generation, and management of ROS. SIRT3 has also been implicated in the maintenance of regenerative capacity of hematopoietic stem cells. SIRT3 is suppressed with aging, and SIRT3 upregulation in aged hematopoietic stem cells improves their regenerative capacity. This discovery establishes the significant role SIRT3 plays in maintaining stemness, and more importantly, helps lay the path for future stem cell-based interventions for metabolic disorders resulting in premature aging.

    [0068] SIRT6 can be regarded as an important anti-aging protein with multifaceted roles in DNA damage repair, metabolic regulation, inflammation, and tumor suppression. SIRT6 gained prominence when its knockout mouse model developed severe premature aging phenotypes with mortality resulting within a month. Moreover, SIRT6 is the only mammalian sirtuin which displayed clear increase in lifespan when overexpressed in the whole body of mice. Furthermore, Kawahara et al. reported that SIRT6 attenuates hyperactive NF-B signaling by deacetylating histone H3 at K9 on the promoters of NF-B target genes, which enhances the role of SIRT6 as a critical anti-inflammatory protein.

    [0069] Baohua et al. showed that SIRT6 plays a key role in the process of skin aging via modulation of collagen metabolism and NF-B signaling. They reported that blocking SIRT6 significantly decreased hydroxyproline content by inhibiting transcription of type 1 collagen, prompting matrix metalloproteinasel secretion and increasing NF-B signaling. Taken together, SIRT6 stands out as a key modulator of anti-aging processes, by regulating multiple pathways to delay cellular senescence and accelerated aging. Hence, decapeptide-12, which enhanced SIRT6 transcription by 147 percent at 100 M, may hold great promise as a therapeutic anti-aging candidate to address the often concurrent phenotypes of premature skin aging and photodamaged skin.

    [0070] In summary, decapeptide-12 was shown in this report to significantly upregulate transcription levels of SIRT1, SIRT3, and SIRT6, all 3 of which play significant roles in counteracting skin aging and other age-associated pathologies. Clinical studies with various topical formulations containing decapeptide-12 are currently being designed to help validate the in vitro findings and test the efficacy of this potent sirtuin activator in vivo.

    EXAMPLE

    [0071] In this example, certain modifications to the P4 decapeptide were made, as detailed in the following Table 3.

    TABLE-US-00004 TABLE3 Short Peptide Ref. Sequence Modification Native-P4 P4 YRSRKYSSWY None SEQIDNO:9 Palm-P4-Amid P4A Palmitoyl-YRSRKYSSWY-amide N-terminal:Palmitoyl. SEQIDNO:10 C-terminal:Amide. Palm-D-ISO-Amid P4B Palmitoyl-YRSRK[*Y]SSWY-amide N-terminal:Palmitoyl. SEQIDNO:11 Internal:Tyrosineat position6intheD- Isoform. C-terminal:Amide. Accet-P4-Amid P4C Acetyl-YRSRKYSSWY-amide N-Terminal:Acetyl. SEQIDNO:12 C-terminal:Amide.

    [0072] These modifications to decapeptide P4 may serve to improve stability against proteases and to enhance transcutaneous or transcellular penetration, or both.

    [0073] Peptides of the present invention may comprise residues from any of the naturally occurring amino acids, or from nonnaturally occurring amino acids. These naturally occurring and nonnaturally-occurring amino acids may be in the D or L configuration, or may include both dextrorotary forms. The terms D and L are used in this application as they are known to be used in the art. Peptides of the invention include single amino acids and short spans (e.g., 1-20) of amino acids. In addition, modified peptides of the present invention may also include a monomer or dimer.

    [0074] The standard single letter and three letter codes for amino acids are used in this application and are in TABLE A below.

    TABLE-US-00005 TABLE A A (Ala) Alanine C (Cys) Cysteine D (Asp) Aspartic acid E (Glu) Glutamic acid F (Phe) Phenylalanine G (Gly) Glycine H (His) Histidine I (Ile) Isoleucine K (Lys) Lysine L (Leu) Leucine M (Met) Methionine N (Asn) Asparagine P (Pro) Proline Q (Gln) Glutamine R (Arg) Arginine S (Ser) Serine T (Thr) Threonine V (Val) Valine W (Trp) Tryptophan Y (Tyr) Tyrosine

    [0075] As described above, the indicated residues may be the naturally occurring L amino acid, or a modification of these, that is, a chemical modification, an optical isomer, or a link to a modifying group. It is contemplated that specific modifications may be made within the peptide that maintain the ability of the present peptides to specifically modulate the expression of sirtuin gene(s).

    [0076] The effect of the decapeptides P4, P4A, P4B, and P4C upon the transcription levels of sirtuins 1-7 was evaluated. Table 4 summarizes transcription levels for all four decapeptides with the corresponding genes, at tested concentrations of: 10, 30, 50, 100, and 300 (all in M).

    TABLE-US-00006 TABLE 4 Concentration Gene P4 P4A P4B P4C 10 M SIRT1 12 3% 18 2% 10 4% 7 3% SIRT2 4 3% 14 1% 5 1% 5.00 SIRT3 9 3% 25 4% 22 3% 8 3% SIRT4 8 3% 16 1% 9 1% 3 1% SIRT5 5 3% 13 2% 2.00 4 1% SIRT6 21 8% 24 5% 21 5% 12 3% SIRT7 15 4% 29 6% 20 6% 14 5% 30 M SIRT1 34 7% 19 1% 10 3% 5.00 SIRT2 11 4% 15 1% 8 3% 2 1% SIRT3 32 6% 26 3% 23 2% 6 2% SIRT4 12 7% 16 1% 10 1% 3 1% SIRT5 21 7% 12 2% 1.00 2 1% SIRT6 52 5% 25 5% 22 4% 9 4% SIRT7 34 9% 33 5% 23 5% 7 2% 50 M SIRT1 79 12% 42 5% 48 3% 1.00 SIRT2 22 5% 6 3% 17 6% 1.00 SIRT3 65 12% 60 4% 28 5% 45 9% SIRT4 41 13% 9 4% 17 1% 11 6% SIRT5 33 6% 10 3% 1.00 3 1% SIRT6 95 13% 33 7% 10 4% 31 5% SIRT7 61 10% 52 4% 54 7% 46 5% 100 M SIRT1 141 11% 144 5% 135 12% 137 8% SIRT2 35 5% 48 1% 52 4% 42 1% SIRT3 121 13% 152 2% 78 10% 82 8% SIRT4 71 14% 98 12% 86 6% 32 9% SIRT5 46 7% 47 7% 35 3% 35 2% SIRT6 147 8% 135 10% 107 2% 124 7% SIRT7 95 14% 87 6% 61 7% 80 11% 300 M SIRT1 188 12% 184 2% 155 3% 190 9% SIRT2 61 7% 30 5% 40 4% 31 9% SIRT3 165 12% 147 2% 142 5% 159 6% SIRT4 115 12% 65 1% 49 4 67 9% SIRT5 67 9% 29 4% 29 5% 28 9% SIRT6 189 10% 85 5% 81 4% 87 3% SIRT7 148 10% 113 2% 103 8% 130 9%

    [0077] At low concentrations, the native decapeptide P4 exhibited enhanced transcription levels relative to the modified decapeptides. However, each of the three of the modified decapeptides (P4A, P4B, and P4C) upregulated the transcription levels of the sirtuin genes relative to the control. At a concentration of 100 the effect upon transcription level was comparable across all four decapeptides.

    [0078] Proliferation rates for three human cell lines (epidermal progenitors, melanoblasts, and fibroblasts) were determined using a TACS MTT Cell Proliferation Kit. Cells were seeded at 2.510.sup.4/well in 96-well plates in a humidified atmosphere with 5 percent CO.sub.2 at 37 degrees Celsius. Twenty-four hours later, the decapeptides were added to the corresponding wells at varying concentrations and incubated for 72 hours. The remainder of the procedure was performed following the manufacturer's protocol.

    [0079] Table 5 shows epidermal progenitor proliferation rate after 72 hours.

    TABLE-US-00007 TABLE 5 Concentration (M) P4 P4A P4B P4C 3 100% 99 1% 99 1% 99 1% 10 99 1% 99 1% 99 1% 99 1% 30 98 1% 98 1% 98 1% 98 1% 50 97 1% 97 1% 98 1% 98 1% 100 97 1% 97 2% 97 1% 97 1% 300 96 1% 96 2% 97 1% 97 1% 500 96 2% 96 2% 95 2% 96 2% 1000 94 2% 94 2% 94 2% 96 2%

    [0080] Table 6 shows melanoblast proliferation rate after 72 hours.

    TABLE-US-00008 TABLE 6 Concentration (M) P4 P4A P4B P4C 3 100% 100% 100% 100% 10 100% 100% 100% 100% 30 99 1% 99 1% 99 1% 99 1% 50 98 1% 98 1% 98 1% 98 1% 100 97 1% 97 2% 97 2% 97 2% 300 97 1% 97 2% 96 2% 96 3% 500 95 2% 96 2% 95 2% 95 2% 1000 95 2% 95 2% 94 2% 95 2%

    [0081] Table 7 shows fibroblast proliferation rate after 72 hours.

    TABLE-US-00009 TABLE 7 Concentration (M) P4 P4A P4B P4C 3 100% 100% 100% 100% 10 99 1% 99 1% 99 1% 99 1% 30 99 1% 98 1% 99 1% 99 1% 50 98 1% 98 1% 99 1% 99 1% 100 97 1% 97 2% 98 2% 98 2% 300 97 1% 97 2% 97 2% 97 2% 500 97 2% 96 2% 96 2% 96 2% 1000 96 2% 95 2% 96 2% 96 2%

    [0082] After a 72-hour incubation of epidermal progenitors, melanoblasts, and fibroblasts with 100 M of decapeptide P4A, the result was a 3 percent reduction in the proliferation rate of all three cell lines.

    [0083] At 1000 the proliferation rate of epidermal progenitors was reduced by 6 percent, whereas that of melanoblasts and fibroblasts was reduced by 5 percent and 4 percent, respectively.

    [0084] The effect of each of the decapeptides upon cell viability was also tested. In particular, cells were incubated with the decapeptide at various concentrations and then counted for viability relative to the control (untreated cells) using trypan blue. Cytotoxicity was measured according to the following formula:


    [1(# of cells in control# of live cells in test sample)/# of cells in control]100 percent.

    [0085] Table 8 shows epidermal progenitor viability after 7 days.

    TABLE-US-00010 TABLE 8 Concentration (M) P4 P4A P4B P4C 3 100% 100% 100% 100% 10 99 1% 99 1% 99 1% 99 1% 30 98.4 1% 98.2 1% 98.2 1% 98 1% 50 97.8 1% 97.5 1% 98 1% 97.4 1% 100 97.1 1% 96.9 2% 97 1% 96.6 2% 300 95.6 2% 95.6 2% 96.5 2% 95.7 3% 500 94.2 2% 94.3 2% 95.5 2% 94.8 3% 1000 93.8 2% 93.6 3% 94.5 2% 94 3%

    [0086] Table 9 shows melanoblast viability after 7 days.

    TABLE-US-00011 TABLE 9 Concentration (M) P4 P4A P4B P4C 3 100% 100% 100% 100% 10 99 1% 99 1% 98.5 1% 99 1% 30 98.3 1% 98.5 1% 97.8 3% 98.4 1% 50 98 1% 98 1% 97.2 2% 97.9 1% 100 97.3 1% 97 2% 96.3 2% 97 2% 300 95.2 2% 96.2 2% 95.6 2% 96 3% 500 94.6 2% 95.6 2% 94.6 2% 95.5 3% 1000 94 2% 94.8 2% 93.8 2% 94.8 3%

    [0087] Table 10 shows fibroblast viability after 7 days.

    TABLE-US-00012 TABLE 10 Concentration (M) P4 P4A P4B P4C 3 100% 100% 100% 100% 10 98.6 1% 98.9 1% 98.8 1% 98.9 1% 30 98.2 1% 98.4 1% 98.3 1% 98.3 1% 50 97.8 1% 98 1% 97.6 1% 97.8 1% 100 97.2 1% 97.4 2% 97.3 2% 97.4 2% 300 95.6 2% 96.6 2% 96.5 2% 96.5 2% 500 94.5 2% 95.5 2% 95.3 3% 95.7 2% 1000 93.8 1% 94.3 2% 94.2 3% 94.9 3%

    [0088] At the 100 M concentration, cell viability remained over 97 percent for all three cell lines. At 1000 cell viability dropped by 6 percent relative to the control.

    [0089] In conclusion, recent reports detail the pleiotropic roles sirtuins play in repressing premature aging, delaying cellular senescence, enhancing longevity, and ameliorating a wide range of aging disorders. Herein, we report our findings on the potent sirtuin activator, decapeptide-12, and compare its performance to the well documented oxyresveratrol. Treatment of human epidermal progenitors with 100 M decapeptide-12 increased transcription of SIRT1 by 14111 percent relative to control cells, whereas levels of SIRT3, SIRT6, and SIRT7 were increased by 12113 percent, 1478 percent, and 95.414 percent, respectively. Decapeptide-12 upregulated sirtuin transcription to similar levels as oxyresveratrol but with reduced cytotoxicity. Thus, decapeptide-12 may hold promise as a safer therapeutic to counteract skin aging and other age-associated pathologies.

    [0090] While the above description mentions a typical decapeptide concentration of 100 M or greater in noting where the effect was evident, the results also demonstrate lower concentrations as having a positive effect. Thus some embodiments may utilize a decapeptide concentration of 1 M or greater, with particular embodiments employing a peptide concentration range of 100 M or greater. Examples of peptide concentration ranges according to various embodiments are 1 M or greater, 5 M or greater, 10 M or greater, 30 M or greater, 50 M or greater, 100 M or greater, 300 M or greater, 500 M or greater, and 1000 M or greater.

    [0091] It is further noted that a particular decapeptide may be used in combination with other component(s) in order to achieve the desired effect. For example, a particular decapeptide could be used in combination with other peptides such as decapeptides P4A, 4B, and/or 4C and/or with other components such as oxyresveratrol. According to such embodiments, a synergistic effect realized by including other components may ultimately reduce the concentration of any individual component (e.g., decapeptide, other) that is needed to achieve the desired result.

    [0092] While the above specifically includes decapeptides and oxyresveratrol as possible additional components, embodiments are not limited to this. Examples of other possible additives can include but are not limited to, -lipoic acid, biotin, caffeine, ceramides, coenzyme Q10, glycolic acid, green tea, human stem cells, human stem cell extracts, hyaluronic acid, hydroquinone, jojoba oil, kojic acid, lactic acid, malic acid, niacinamide, oligopeptides, peptides, plant stem cells, plant stem cell extracts, resveratrol, retinol, vitamin C, vitamin E, and vitamin K, amongst others.

    [0093] It is noted that embodiments may be utilized to treat a variety of skin cell types. Examples of terminally differentiated skin cells can include but are not limited to keratinocytes, fibrocytes, melanocytes, and immune cells such as langerhans cells (e.g., histiocyte or dendrocytes) that age over time as well.

    [0094] Embodiments may also be utilized to treat skin progenitor cells to reduce skin aging and allow for skin renewal over its lifetime. Examples of such progenitor cells may include but are not limited to epidermal keratinocyte progenitors, fibroblasts, melanoblasts, histioblasts, or dendroblasts which are progenitors for langerhans cells that lodge in the epidermis.

    [0095] Finally, while the above has described the treatment of human skin cells, specific embodiments are not limited to such approaches. Alternative embodiments could employ the treatment of skin cells from other organisms, including but not limited to mammals such as cows (e.g., in the manufacture of leather), pigs, and other animals (e.g., dogs, cats, and others that may be valued based upon skin appearance for contest purposes).

    [0096] This description of the invention has been presented for the purposes of illustration and description. It is not intended to be exhaustive or to limit the invention to the precise form described, and many modifications and variations are possible in light of the teaching above. The embodiments were chosen and described in order to best explain the principles of the invention and its practical applications. This description will enable others skilled in the art to best utilize and practice the invention in various embodiments and with various modifications as are suited to a particular use. The scope of the invention is defined by the following claims.