A Multi-Functional Peptide Benefiting Expression, Purification, Stabilization and Catalytic efficiency of Recombinant Proteins
20180298058 ยท 2018-10-18
Inventors
Cpc classification
C07K2319/40
CHEMISTRY; METALLURGY
C07K2319/60
CHEMISTRY; METALLURGY
C07K14/00
CHEMISTRY; METALLURGY
International classification
C07K14/00
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a multi-functional peptide benefiting expression, purification, stabilization and catalytic efficiency of recombinant proteins, which relates to the field of enzyme engineering and protein purification. The present invention provides a self-assembling amphipathic peptide, which fused with proteins including alkaline polygalacturonate lyase (PGL), lipoxygenase (LOX) and green fluorescent protein (GFP), which leads to successful purification by the nickel affinity chromatography with recovery rates were 47.01%, 39.01% and 56.1%, respectively. Furthermore, the expression quantity and thermostability of the three proteins were enhanced in different degree. Of which the half-life of the PGL-S1v1 and LOX-S1v1 were 2.3 and 3.8-fold as compared with the corresponding wild-type and the specific activity were 1.1 and 1.9-fold increase, respectively. The crude enzyme activity of PGL-S1v1 was 9-fold increase than the PGL.
Claims
1. A self-assembling amphipathic peptide, comprising an amino acid sequence as set forth in SEQ ID NO:1.
2. The peptide of claim 1, wherein the peptide is encoded by a nucleotide sequence as set forth in SEQ ID NO:2.
3. A fusion protein comprising the peptide of claim 1 linked to a protein.
4. A method of producing the fusion protein of claim 3, comprising purifying the fusion protein using the peptide of claim 1 as a purification tag for the fused protein.
5. The method of claim 4, comprising enhancing expression quantity of the fused protein using the peptide of claim 1.
6. The method of claim 4, comprising improving thermal stability of the fused protein using the peptide of claim 1.
7. The method of claim 4, comprising improving catalytic efficiency of the fused protein using the peptide of claim 1.
8. A method of producing the fusion protein of claim 3, comprising ligating the peptide of claim 1 to a N-terminus or C-terminus of the protein using a linker peptide.
9. The fusion protein of claim 3, wherein said protein is a bioactive enzyme.
10. The fusion protein of claim 3, wherein said protein is an enzyme selected from the group consisting of an oxidase, a transferase, a hydrolase, a polymerase, an isomerase, and a ligase.
11. The fusion protein of claim 3, comprising a linker peptide that is configured to connect the peptide of claim 1 with the protein.
12. The fusion protein of claim 11, wherein the linker peptide is a PT-linker which comprises an amino acid sequence as shown in SEQ ID NO:3.
13. A method of producing the fusion protein of claim 3, comprising synthesizing an expression vector comprising a nucleic acid molecule, which codes for the peptide of claim 1 and a target protein; transfecting the expression vector into a suitable host cell.
14. The method of claim 13, wherein said target cells comprise Escherichia coli BL21 (DE3), or E. coli DH5, or E. coli TOP 10, or E. coli Rosetta (DE3).
Description
BRIEF DESCRIPTION OF DRAWINGS
Figure Captions
[0020]
[0021]
[0022]
[0023]
[0024]
DETAILED DESCRIPTION
Materials and Methods:
Strains and Plasmids:
[0025] The nucleotide sequence of PGL gene from Bacillus subtilis WSHB04-02 is shown as SEQ ID NO.4. The nucleotide sequence of LOX gene from Pseudomonas aeruginosa BBE is shown as SEQ ID NO.6. The nucleotide sequence of GFP gene from Aequorea victoria is shown as SEQ ID NO.8. E. coli JM109 was used as the host strain for cloning. E. coli BL21 (DE3) and E. coli Rosetta (DE3) were used as the expression hosts. The pET-22b (+) plasmid was used for expressing the recombinant proteins.
[0026] Primers used for amplifying the genes were shown in table 1.
TABLE-US-00001 TABLE1 Oligonucleotidesusedinthisstudy. Primer Sequence(5-3) products PGL-R CTAGCCATGGATGGATGCTGATTTAGGCCAC pgl PGL-F CCGCTCGAGTTAATTTAATTTACCCGCAC pgl LOX-R CTAGCCATGGAATGACTCGATATTCT lox LOX-F CCGCTCGAGTGCGGCCGCAAGCTTTCAG lox GFP-R CTAGCCATGGATGGGTAAGGGAGAAGAAC gfP GFP-F CCGCTCGAGTTATTTGTATAGTTCATCCATG gfP CCATG Underlined bases represent enzyme restriction sites.
Medium:
[0027] Seed medium: peptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, glucose 20 g/L, pH was adjusted to 7.0.
[0028] Fermentation medium: peptone 12 g/L, yeast extract 24 g/L, glycerol 5 g/L, K.sub.2HPO.sub.4 72 mmol/L, KH.sub.2PO.sub.4 17 mmol/L, pH 7.0.
Culture Conditions:
[0029] The E. coli BL21 (DE3) cells harboring the corresponding plasmid were cultured in Luria-Bertani (LB) medium with 2% glucose and 100 g/mL ampicillin supplemented at 37 C., 220 rpm shaking, respectively. And single colony of E. coli Rosetta (DE3) cells harboring plasmid pET-22b(+)/lox-S1v1 and pET-22b(+)/lox-His-tag was inoculated into 25 mL LB medium containing 34 g/mL chloramphenicol and 100 g/mL ampicillin at 37 C., 220 rpm shaking, respectively. After overnight culturing, strains were inoculated into 25 ml of terrific broth (TB) which contained the same content of antibiotics as the corresponding seed culture and incubated at 37 C. with 220 rpm. When the optical density of bacterial concentration at 600 nm reached 0.60.8, proteins production were induced by isopropyl -D-1-thiogalactopyranoside (IPTG) and cultured at the corresponding induction temperature, with shaking at 220 rpm. Induction conditions were: PGL: IPTG was added to a final concentration of 0.04 mM, 30 C., and 48 h induction culture; LOX: 1 mM IPTG, 20 C., 24 h; GFP: 0.05 mM IPTG, 20 C., 24 h.
Purification of the Recombinant Proteins:
[0030] The culture supernatant containing the PGL was obtained by centrifugation at 9,000g for 15 min. The cells contain LOX and GFP were harvested by centrifugation and pellets were re-suspended in buffer A (50 mM phosphate buffer [pH 7.4]) to 10 OD.sub.600 culture/mL, followed by sonication (Ultrasonic crasher; Bannuo FS-1200, Shanghai, China). The soluble fractions were isolated from the aggregates by centrifugation at 10,000g for 15 min at 4 C. After filtering through a Millipore filter (0.22 m) in prior of the purification, the samples were injected into a His trap FF Crude (5 mL) by using an AKTA purifier (GE Healthcare, Houston, Tex.). The column was washed with 20% ethanol to remove impurities and equilibrated with buffer A1 (50 mM phosphate buffer [pH 7.4] containing 0.3 M NaCl and 20 mM imidazole). The flow rate of the sample application was 2.0 ml/min. After eluting the unbound proteins with the buffer A1 at the flow rate of 3.0 mL/min, proteins were eluted with a linear gradient from 0% to 100% buffer B (50 mM phosphate buffer [pH 7.4] containing 0.3 M NaCl and 500 mM imidazole). Those eluted fractions with target proteins were subjected to the desalting column (5 mL) with buffer A at the flow rate of 2.0 mL/min to remove the NaCl and imidazole. Fractions were collected for activity assays and analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).
Enzyme Assay:
[0031] The polygalacturonate lyase (PGL) was determined by measuring the absorbance of unsaturated bonds between C4 and C5 at 235 nm. The reaction mixture contained 2 mL of 0.2% (w/v) polygalacturonic acid (Sigma Chemical Co. type P7276) in 200 mM glycine-NaOH buffer at pH 9.4 (containing 200 mM glycine, 200 mM NaOH, and 60 mM CaCl.sub.2) and 20 L of diluted enzyme solution. The reaction mixture was incubated at 45 C. for 15 min, and then the reaction was terminated by adding 3 mL of 30 mM phosphoric acid. The product was checked by a spectrophotometer (UV-2450; Shimadzu Co., Kyoto, Japan). One enzyme units is defined as formation of 1 mol unsaturated polygalacturonic acid per min, with a molar extinction coefficient of 4600.
[0032] Linoleic acid was dispersed in 0.15 M K.sub.2HPO.sub.4KH.sub.2PO.sub.4 buffer (pH 7.5). The substrate solution was freshly prepared daily and saturated with oxygen for 5 min before testing. Standard analytical mixture (3 mL) contains 0.3 mM linoleic acid and about 1.67 g/mL enzyme. One unit of activity was defined as enzyme required to synthesis 1 mol hydroperoxide per min at 25 C. Hydroperoxidaton was determined at 234 nm in a spectrophotometer (UV-2450; Shimadzu Co., Kyoto, Japan). The initial linear part of the wave was used to calculate enzyme activity.
The Fluorescent Spectral Properties Analyses:
[0033] The fluorescence was recorded using Cytation 3 imaging reader (BioTek, Winooski, Vt., USA) with excitation at 485 nm and emission at 515 nm, respectively. To determine the specific fluorescence activities of the green fluorescent protein (GFP), the samples of the equivalent protein concentration were detected.
Measurement of Enzyme Kinetics Stabilities:
[0034] The dynamic thermal stabilities of the PGL and LOX were determined by measuring the residual activity after incubating the enzyme solution at 60 C. and 50 C. in buffer A (50 mM phosphate buffer [pH 7.4]), respectively. Then the half-life was calculated using exponential fitting of the data points as previously described. The data were analyzed by fitting to first-order plots and the first-order rate constants (k.sub.d) were determined by linear regression of ln (residual activity) versus the incubation time (t). The time required for the residual activity to be reduced to half (t.sub.1/2) of the enzyme was calculated by the following equation: t.sub.1/2=ln 2/k.sub.d.
The Fluorescent Spectral Properties Analyses:
[0035] To assess the thermal stability of GFP and GFP-S1v1, protein samples were diluted in buffer A to prepare initial solution of equal protein concentration and incubated 5 min at different temperatures from 65 C. to 90 C. at 5 C. intervals. The fluorescence remaining after heat treatment was measured and plotted as a function of temperature. As for the time-dependent assay, samples were incubated at 75 C. for 50 min with 10 min time intervals to record the remaining fluorescence.
Example 1
[0036] (1) The nucleotide sequence (as shown in SEQ ID NO. 2) encoding the self-assembling amphipathic peptide (S1v1, amino acids sequence is shown in SEQ ID NO.1) was synthesized and cloned into pET-22b(+) between the restriction EcoRI and NcoI sites for expression, which constructed the recombinant vector pET-22b(+)/S1v1.
[0037] (2) The PGL gene (shown in SEQ ID NO. 4) was cloned into the recombinant vector pET-22b(+)/S1v1 at the restriction NcoI and XhoI sites to construct a recombinant plasmid pET-22b(+)/pgl-S1v1;
[0038] (3) The recombinant plasmid pET-22b (+)/S1v1-PGL was transformed into host E. coli BL21 (DE3) to construct the recombinant strain E. coli BL21 (DE3) pET-22b (+)/pgl-S1v1.
[0039] (4) The recombinant E. coli BL21 (DE3) pET-22b(+)/S1v1-PGL were inoculated and incubated. The IPTG was concentration of 0.04 mM was added to induced the PGL expression at 30 C. for 48 h. The culture broth was centrifuged and the fermentation supernatant was collected. The proteins in supernatant were purified and analyzed through SDS-PAGE
[0040] The recombinant PGL-S1v1 was purified to homogeneity by nickel affinity chromatography (
TABLE-US-00002 TABLE 2 Purification steps of the PGL-S1v1 from E. coli Total protein Total activity Specific activity Yield step (mg) (U) (U .Math. mg.sup.1) (%) Crude extract 58.47 4212.4 72.04 100 His Trap SP FF 2.56 1980.4 761.74 47.01
[0041] The results of measurement of enzyme kinetics stabilities showed that, the k.sub.cat value of PGL-S1v1 was increased by 3.6-fold. The catalytic efficiencies (k.sub.cat/K.sub.m) of PGL-S1v1 was also enhanced. Consequently, the specific activity of PGL-S1v1 was 1.1-fold higher than that of PGL. After fusing the S1v1, the half-time exhibited a 1.3-fold increase at 60 C., indicating the enhanced kinetic stability of PGL fused with S1v1 (Table 3).
TABLE-US-00003 TABLE 3 Enzymatic properties of the wild-type PGL and the fusion proteins Value SD Km kcat kcat/Km Specific activity crude enzyme half-life Enzyme (g/L) (min.sup.1) (L/gmin) (Umg.sup.1) activity (UmL.sup.1) (t.sub.1/2, min) PGL 0.27 0.011 12.69 0.41 47 1.22 279.14 8.96 131.2 2.1 5.2 0.41 PGL-His 0.3 0.01 13.21 0.76 44.03 0.9 267.66 9.77 129.4 5.78 5.4 0.32 PGL-Slvl 0.76 0.12 45.87 3.22 60.35 2.54 587.39 1.14 1330 13.1 11.85 1.2
Example 2
[0042] (1) The nucleotide sequence (as shown in SEQ ID NO. 2) encoding the self-assembling amphipathic peptide (S1v1, amino acids sequence is shown in SEQ ID NO.1) was synthesized and cloned into pET-22b(+) between the restriction EcoRI and NcoI sites for expression, which constructed the recombinant vector pET-22b(+)/S1v1.
[0043] (2) The LOX gene (shown in SEQ ID NO. 6) was cloned into the recombinant vector pET-22b(+)/S1v1 at the restriction NcoI and XhoI sites to construct a recombinant plasmid pET-22b(+)/lox-S1v1.
[0044] (3) The recombinant plasmid pET-22b (+)/lox-S1v1 was transformed into host E. coli Rosetta (DE3) to construct the recombinant strain E. coli Rosetta (DE3) pET-22b (+)/lox-S1v1.
[0045] (4) The recombinant E. coli Rosetta (DE3) pET-22b(+)/lox-S1v1 were inoculated and incubated. The IPTG was concentration of 1 mM was added to induced the LOX expression at 20 C. for 24 h. The culture broth was centrifuged. Cells were collected and broke before centrifugation, supernatant was obtained for purification and enzyme analysis.
[0046] As shown in
[0047] Due to the low expression quantity and poor thermostability, the wild-type LOX was unable to be purified by the nickel affinity column under the same purification condition without the procedures of concentration or glycerol addition. In previous study, when the LOX was fused to the other SAPs, only about 10% enzymes could be attached to the nickel affinity column, which was probably due to the interference from the fused SAPs. However, LOX-S1v1 presented relatively high affinity (
TABLE-US-00004 TABLE 4 Purification steps of the LOX-S1v1 from E. coli Total protein Total activity Specific activity Yield step (mg) (U) (U .Math. mg.sup.1) (%) Crude extract 29.67 45.7 1.54 100 His Trap SP FF 2.64 18.23 9.23 39.01
[0048] As summarized in Table 5, the k.sub.cat value of LOX-S1v1 was increased by 2.4-fold than that of the wild-type LOX. The specific activity of LOX-S1v1 was 1.9-fold increased, the catalytic efficiencies (k.sub.cat/K.sub.m) was 1.3-fold increased and the half-life of the LOX was increased from 10 min to 38 min. However, the fusion enzymes had the higher K.sub.m value than that of wild-types, suggesting a decrease in substrate affinity after S1v1 peptide fusion.
TABLE-US-00005 TABLE 5 Enzymatic properties of the wild-type LOX and the fusion proteins Value SD kcat kcat/Km Specific activity half-life Enzyme Km (mmol/L) (S.sup.1) (mmol/S .Math. L) (U .Math. mg.sup.1) (t.sub.1/2, min) LOX 0.057 0.0012 24.77 0.97 434.56.9 3.22 32.5 0.34 9.4 0.33 LOX-His 0.055 0.002 25.21 1.02 458.36 6.73 34.5 0.8 10.04 0.21 LOX-S1v1 0.083 0.002 83.2 3.25 1002.41 10.32 94.3 1.31 38.3 2.3
Example 3
[0049] (1) The nucleotide sequence (as shown in SEQ ID NO. 2) encoding the self-assembling amphipathic peptide (S1v1, amino acids sequence is shown in SEQ ID NO.1) was synthesized and cloned into pET-22b(+) between the restriction EcoRI and NcoI sites for expression, which constructed the recombinant vector pET-22b(+)/S1v1.
[0050] (2) The LOX gene (shown in SEQ ID NO. 6) was cloned into the recombinant vector pET-22b(+)/S1v1 at the restriction NcoI and XhoI sites to construct a recombinant plasmid pET-22b(+)/gfp-S1v1.
[0051] (3) The recombinant plasmid pET-22b (+)/S1v1-GFP was transformed into host E. coli BL21 (DE3) to construct the recombinant strain E. coli BL21 (DE3) pET-22b (+)/gfp-S1v1.
[0052] (4) The recombinant E. coli BL21 (DE3) pET-22b(+)/gfp-S1v1 were inoculated and incubated. The IPTG was concentration of 0.05 mM was added to induced the GFP expression at 20 C. for 24 h. The culture broth was centrifuged. Cells were collected and broke before centrifugation, supernatant was obtained for purification and enzyme analysis.
[0053] On account of the poor expression quantity in this culture condition, the purification yield of GFP with His-tag was only 7.25% while GFP-S1v1 was 56.1% without pretreatment under about 30 mL injection amount. After the purification by nickel affinity chromatography (
TABLE-US-00006 TABLE 4 Purification steps of the GFP from E. coli GFP GFP-S1v1 Enzyme Crude His Trap Crude His Trap Steps extract SP FF extract SP FF Total protein (mg) 40.8 1.02 23.5 3.3 Total fluorescence 338170 24527 1044235 586055 intensity Specific fluorescence 422.32 24524 44435.53 175992.42 intensity (mg.sup.1) Yield (%) 100 7.25 100 56.1
[0054] The GFP protein have the clear degradation mechanism and was evaluated to be relatively stable as well as fold very efficiently under different protein denaturation conditions. And herein, the thermal stability of GFP and GFP-S1v1 were measured and compared. In time-dependent assay at 75 C., the thermal inactivating curve of GFP was steeper than that of GFP-S1v1 which indicated fluorescence of GFP was decreased faster than that of GFP-S1v1 over time (
[0055] While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention. All figures, tables, appendices, patents, patent applications and publications, referred to above, are hereby incorporated by reference.