Methods of treating eye diseases associated with inflammation and vascular proliferation

11583535 · 2023-02-21

Assignee

Inventors

Cpc classification

International classification

Abstract

Methods for treating eye diseases associated with inflammation and/or vascular proliferation in subjects are disclosed. The methods include administering therapeutically effective amounts of a tranilast compound, in particular (E)-2-[[3-(3-Methoxy-4-propargyloxy)phenyl)-1-oxo-2-propenyl]amino]benzoic acid or (E)-2-[[3,4-Bis(difluoromethoxy)phenyl)-1-oxo-2-propenyl]amino]benzoic acid or pharmaceutically acceptable salts or solvates thereof.

Claims

1. A method for inhibiting the progression of or ameliorating a sign or symptom of diabetic retinopathy in a subject, comprising administering orally to the subject a therapeutically effective amount of a compound of the formula ##STR00076## or a pharmaceutically acceptable salt thereof.

2. A method as claimed in claim 1, wherein the subject is human.

3. A method as claimed in claim 1, wherein ##STR00077## is administered.

4. A method as claimed in claim 1, wherein a pharmaceutically acceptable salt of the compound is administered.

5. A method for inhibiting the progression of and/or ameliorating a sign and/or symptom of diabetic retinopathy in a subject, comprising administering orally to the subject a therapeutically effective amount of a pharmaceutical composition comprising: a) a compound of the formula ##STR00078## or a pharmaceutically acceptable salt thereof; and b) a pharmaceutically acceptable carrier, diluent, or excipient.

6. A method as claimed in claim 5, wherein the subject is human.

7. A method as claimed in claim 5, wherein the pharmaceutical composition comprises ##STR00079##

8. A method as claimed in claim 5, wherein the pharmaceutical composition comprises a pharmaceutically acceptable salt of the compound.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1 is a graph depicting the number of leukocytes in the retina of control rats, diabetic rats and diabetic rats treated with FT011 from the short term study. Data were expressed mean±SEM. *P<0.05 versus control and #P<0.05 versus diabetes.

(2) FIG. 2 illustrates representative photomicrographs of rhodamine-coupled Concanavalin A stained for endothelium and adherent leukocytes from retina of control rats (A), diabetic rats (B) and diabetic rats treated with FT011 (C).

(3) FIG. 3 is a graph showing changes in retinal ICAM-1 mRNA levels in control rats, diabetic rats and diabetic rats treated with FT011. Data were expressed mean±SEM. *P<0.05 versus control and #P<0.05 versus diabetes.

(4) FIG. 4 is a graph illustrating the number of acellular capillaries in PAS stained retinal sections from control rats, diabetic rats and diabetic rats treated with 100 mg/kg/day FT011 from a long term study. Acellular capillaries were expressed as number of acellular capillaries per field. Data were expressed mean±SEM. *P<0.05 versus control and #P<0.05 versus diabetes.

(5) FIG. 5 illustrates representative photomicrographs of acellular capillaries from PAS stained retina of control rats (A), diabetic rats (B) and diabetic rats treated with 100 mg/kg/day FT011 (C).

(6) FIG. 6 is a graph depicting the number of leukocytes in the retina of control rats, diabetic rats and diabetic rats treated with FT061. Data were expressed mean±SEM. *P<0.05 versus control and #P<0.05 versus untreated diabetes.

(7) FIG. 7 illustrates representative photomicrographs of rhodamine-coupled Concanavalin A stained for endothelium and adherent leukocytes from retina of control rats (A), diabetic rats (B) and diabetic rats treated with FT061 (C).

(8) FIG. 8 is a graph showing changes in retinal ICAM-1 mRNA levels in control rats, diabetic rats and diabetic rats treated with FT061. Data were expressed mean±SEM. *P<0.05 versus control and #P<0.05 versus untreated diabetes.

(9) FIG. 9 is a graph illustrating changes in retinal VEGF mRNA levels in control rats, diabetic rats and diabetic rats treated with FT061. Data were expressed mean±SEM. #P<0.05 versus control.

(10) Embodiments of the invention will now be discussed in more detail with reference to the following examples and figures which are provided for exemplification only and which should not be considered limiting on the scope of the invention in any way.

EXAMPLES

(11) Animals

(12) The animal studies were conducted with the approval from the Animal Welfare and Ethics Committee (St Vincent's Hospital and the National Health and Medical Research Foundation of Australia). All rats received normal rat chow (Certified Rodent Diet #5002, LabDiet, USA) and drinking water ad libitum. All animals were housed in a stable environment maintained at 22±1° C. with a 12-hour light/dark cycle commencing at 6 am.

Example 1

(13) Test Compound (FT011)

(E)-2-[[3-(3-Methoxy-4-propargyloxy)phenyl)-1-oxo-2-propenyl]amino]benzoic Acid (FT011) has the Structure

(14) ##STR00074##

(15) Diabetic Retinopathy Rats

(16) Ninety, six-week old female, heterozygous (mRen-2)27 rats (St. Vincent's Hospital Animal House, Melbourne, Australia) were assigned to receive either 55 mg/kg of streptozotocin (STZ) (Sigma, St. Louis, USA) diluted in 0.1 M citrate buffer, pH 4.5 or citrate buffer alone (non-diabetic control) by tail vein injection following an overnight fast. In short term study, rats were randomly assigned to receive (n=10/group) treatment with either FT011 (100 mg/kg bid gavage) or vehicle for 8 weeks. Non-diabetic animals (n=10) served as controls.

(17) In the long term study, at 16 weeks of STZ diabetes rats were randomly assigned to either treatment (n=15/group) with, FT011 (50 mg/kg/day BID), FT011 (100 mg/kg BID) or no treatment for a further 16 weeks. Non-diabetic animals (n=15) served as controls. Each week, rats were weighed and their blood glucose levels were measured (Accu-check Advantage II Blood Glucose Monitor, Roche Diagnostics, USA) and only STZ-treated animals with blood glucose >15 mmol/L were considered diabetic. Every 4 weeks, SBP was determined in preheated conscious rats via tail-cuff plethysmography using a non-invasive blood pressure (NIBP) controller and Powerab (AD instruments, NSW, Australia). Haemoglobin A1c (HbA1c) was measured by HPLC at the end of the study in the Department of Pathology, St Vincent's Hospital. Diabetic rats received a daily injection of insulin (2-4 units intraperitoneally; Humulin NPH, Eli Lilly and Co., Indianapolis, Ind.) to reduce mortality and to promote weight gain.

(18) Leukostasis (Short Term Study)

(19) At the end of the short term 8 week study, rats were anaesthetized with Lethobarb (60 mg/kg) and the chest cavity was opened. Animals were perfused via the left ventricle with 0.1M phosphate buffered saline (PBS) to remove non-adherent blood cells. The rats were then perfused with rhodamine-coupled Concanavalin A (25 mg/kg, Vector Laboratories) to stain endothelium and adherent leukocytes. Eyes were enucleated and fixed with 4% paraformaldehyde in 0.1M PBS for 30 minutes. Retinae were dissected and flat mounted on microscope slides then visualised on an epi-fluorescent microscope. The total number of leukocytes was counted per retina. The investigator was masked to the group.

(20) Real Time PCR (Short Term Study)

(21) At the end of the short term 8 week study, rats were anaesthetized with lethobarb (60 mg/kg), eyes were enucleated and retinae dissected and placed in RNAlater (#R0901, Sigma-Aldrich). Total RNA was extracted with an RNeasy Mini Kit (#74104, Qiagen) according to manufacturers' Instructions. RNA concentration was determined on a Nanodrop 3.1.2, after which 1 μg of RNA was DNase treated (DNA-free kit, Ambion) and reverse transcribed (First Strand cDNA Synthesis Kit for RT-PCR, Roche). Primers, probes (See Table) and cDNA were mixed with Taqman Universal Master Mix (#4304437, Applied Biosystems) and real-time PCR was conducted using an ABI 7900 HT Sequence Detection System (Applied Biosystems). mRNA was normalised to 18S rRNA endogenous control and the relative fold difference in expression calculated using the 2.sup.−ΔΔCT method.

(22) TABLE-US-00001 Primer and probe for ICAM-1 Accession Primers and Taqman probe Gene Species number (MGB, FAM label) ICAM1 rat NM_012967 Forward Primer: AGTGCTGTACCATGATCAGAATACCT Probe: TGA TCATTGCGGGCT Reverse Primer: TAAATGGACGCCACGATCAC 18S eukar- X03205.1 Applied Biosystems gene yote expression assay - endogenous control - VIC label

(23) Trypsin Digest (Long Term Study 32 Weeks)

(24) At the end of long term 32 week study, rats were anaesthetised with Lethobarb (60 mg/kg), and then eyes were enucleated and fixed in 2% Carsons Fixative overnight. Retinae were dissected and washed in 0.2M Tris Buffer (pH 8.0) followed by digestion in 1% Trypsin (#T4799, Sigma-Aldrich) in 0.2M Tris buffer at 37° C. for one hour. Retinae were then incubated in 1% Triton X in 0.2M Tris buffer for approximately one hour. Subsequently, retinae were flat mounted on a microscope slide and dried overnight. Slides were stained with Periodic Acid Schiff's Stain to observe acellular capillaries.

(25) Quantification was performed by scanning the entire retina with a 10× objective on a Zeiss Observer microscope system. Random 600 μm×800 μm fields were placed over the entire retina using Adobe Photoshop CS2. Acellular capillaries were counted per field with 10 retinae per group quantitated. Investigators were masked to the group. Data was analysed as an average of acellular capillaries per field.

(26) Statistics

(27) Statistics were performed using the Shapiro Wilkinson test for normality. A Krukal-Wallis test followed by Mann Whitney U test was performed for statistical significance of nonparametric data.

(28) Results

(29) TABLE-US-00002 TABLE 1 Animal characteristics (8 weeks study) Body SBP HbA1C Group Weight (g) (mmHg) (%) Control 289 ± 4 179 ± 8   3.7 ± 0.06  Diabetes 274 ± 6 217 ± 10*   11 ± 0.19** Diabetic + FT011  278 ± 12 190 ± 14  8.9 ± 0.50.sup.# (200 mg/kg/day) *P < 0.05 and **P< 0.01 versus control; .sup.#P < 0.05 versus untreated diabetes

(30) TABLE-US-00003 TABLE 2 Animal characteristics (32 weeks study) Body SBP HbA1C Group Weight (g) (mmHg) (%) Control 353 ± 11 152 ± 7  5.4 ± 0.5 Diabetes 324 ± 7  160 ± 8    8.4 ± 0.29* Diabetic + FT011 322 ± 8  176 ± 10  7.65 ± 0.25* (100 mk/kg/day) Diabetic + FT011 313 ± 9  170 ± 7   6.58 ± 0.37.sup.# (200 mk/kg/day) *P < 0.05 versus control; .sup.#P < 0.05 versus untreated diabetes

(31) FIG. 1 demonstrates the total number of leukocytes in the retina from the short term study were significantly less in diabetic rats treated with FT011 compared to untreated diabetic rats.

(32) The representative micrographs in FIG. 2 show that in diabetic rats (B) numerous leukocytes were observed in the capillaries (designated with arrows) when compared to control (A), and treatment with FT011 significantly reduced leukostasis (C).

(33) FIG. 3 shows there was an increase in ICAM-1 mRNA levels in diabetic rats when compared to controls. Moreover, treatment with FT011 was associated with a reduction in ICAM-1 mRNA levels.

(34) In FIG. 4. a quantitative assessment of acellular capillaries was made by counting the number of capillaries in PAS stained retinal sections from the long term study. Clearly, there were less acellular capillaries in diabetic rats treated with FT011 compared to untreated diabetic rats.

(35) The representative micrographs in FIG. 5 show that in diabetic rats (B) acellular capillaries (pericyte ghost) were observed (arrow), while pericyte ghosts were not apparent in control (A) and diabetic rats treated with FT011 (C).

Example 2

(36) Test Compound (FT061)

(E)-2-[[3,4-Bis(difluoromethoxy)phenyl)-1-oxo-2-propenyl]amino]benzoic Acid (FT061) has the Structure

(37) ##STR00075##

(38) Diabetic Retinopathy Rats

(39) Sixty, six-week old female, heterozygous (mRen-2)27 rats (St. Vincent's Hospital Animal House, Melbourne, Australia) were assigned to receive either 55 mg/kg of streptozotocin (STZ) (Sigma, St. Louis, USA) diluted in 0.1 M citrate buffer. pH 4.5 or citrate buffer alone (non-diabetic control) by tall vein injection following an overnight fast. Rats were randomly assigned to receive (n=15/group) treatment with either FT061 (100 mg/kg/day gavage) or vehicle for 8 weeks. Non-diabetic animals (n=15) served as controls. Each week, rats were weighed and their blood glucose levels were measured (Accu-check Advantage II Blood Glucose Monitor, Roche Diagnostics, USA) and only STZ-treated animals with blood glucose >15 mmol/L were considered diabetic. Every 4 weeks, SBP was determined in preheated conscious rats via tail-cuff plethysmography using a non-invasive blood pressure (NIBP) controller and Powerlab (AD instruments, NSW, Australia). Diabetic rats received a daily injection of insulin (2-4 units intraperitoneally; Humulin NPH, Eli Lilly and Co., Indianapolis, Ind.) to reduce mortality and to promote weight gain.

(40) Leukostasis

(41) At the end of the study, rats were anaesthetized with Lethobarb (60 mg/kg) and the chest caviy was opened. Animals were perfused via the left ventricle with 0.1M phosphate buffered saline (PBS) to remove non-adherent blood cells. The rats were then perfused with rhodamine-coupled Concanavalin A (25 mg/kg, Vector Laboratories) to stain endothelium and adherent leukocytes. Eyes were enucleated and fixed with 4% paraformaldehyde in 0.1M PBS for 30 minutes. Retinae were dissected and flat mounted on microscope slides then visualised on an epi-fluorescent microscope. The total number of leukocytes was counted per retina. The investigator was masked to the group.

(42) Real Time PCR

(43) At the end of the study, rats were anaesthetized with lethobarb (60 mg/kg), eyes were enucleated and retinae dissected and placed in RNAlater (#R0901, Sigma-Aldrich). Total RNA was extracted with an RNeasy Mini Kit (#74104, Qiagen) according to manufacturers' instructions. RNA concentration was determined on a Nanodrop 3.1.2, after which 1 μg of RNA was DNase treated (DNA-free kit, Ambion) and reverse transcribed (First Strand cDNA Synthesis Kit for RT-PCR, Roche). Primers, probes (See Table) and cDNA were mixed with Taqman Universal Master Mix (#4304437, Applied Biosystems) and real-time PCR was conducted using an ABI 7900 HT Sequence Detection System (Applied Biosystems). mRNA was normalised to 18S rRNA endogenous control and the relative fold difference in expression calculated using the 2-CT method.

(44) TABLE-US-00004 Primer and probe for ICAM-1 and VEGF Accession Primers and Taqman probe (MGB, Gene Species number FAM label) ICAM1 rat NM_012967 Forward Primer: AGTGCTGTACCATGATCAGAATACCT Probe: TGA TCATTGCGGGCT Reverse Primer: TAAATGGACGCCACGATCAC VEGF rat NM_031836.2 Applied Biosystems gene expression NM_001110333.1 assay - FAM label NM_001110334.1 18S eukaryote X03205.1 Applied Biosystems gene expression assay - endogenous control - VIC label

(45) Statistics

(46) Statistics were performed using the Shapiro Wilkinson test for normality. A Krukal-Wallis test followed by Mann Whitney U test was performed for statistical significance of nonparametric data.

(47) Results

(48) TABLE-US-00005 TABLE 1 Animal characteristics Group Body Weight (g) SBP (mmHg) Control 308 ± 8  192 ± 6 Diabetes 292 ± 10  201 ± 10 Diabetic + FT061 282 ± 4# 178 ± 4 #P < 0.05 versus control

(49) FIG. 6 demonstrates the total number of leukocytes in the retina was significantly less in diabetic rats treated with FT061 compared to untreated diabetic rats.

(50) The representative photomicrographs in FIG. 7 show that in diabetic rats (B) numerous leukocytes were observed in the capillaries (designated with arrows) when compared to control (A), and treatment with FT061 significantly reduced leukostasis (C).

(51) FIG. 8 illustrates a quantitative real time PCR assessment of retinal ICAM-1 mRNA levels. FIG. 8 shows there was an increase in ICAM-1 mRNA levels in diabetic rats compared to controls. Moreover, treatment with FT061 was associated with a reduction in ICAM-1 mRNA levels when compared to controls and untreated diabetes.

(52) In FIG. 9 a quantitative real time PCR assessment of retinal VEGF mRNA levels showed treatment with FT061 was associated with a reduction in VEGF mRNA levels when compared to controls and untreated diabetes.

(53) It will of course be realised that the above has been given only by way of illustrative example of the invention and that all such modifications and variations thereto as would be apparent to persons skilled in the art are deemed to fall within the broad scope and ambit of the invention as herein set forth.

REFERENCES

(54) Adamis, A. P. (2002). “is diabetic retinopathy an inflammatory disease?” Br J Ophthalmol 86(4): 363-5. Aiello, L. M. (2003). “Perspectives on diabetic retinopathy.” Am J Ophthalmol 136(1):122-35. Arita, R., Y. Hata, et al. “ROCK as a Therapeutic Target of Diabetic Retinopathy.” J Ophthalmol 2010:175163. Cheung, A. K., M. K. Fung, et al. (2005). “Aldose reductase deficiency prevents diabetes-induced blood-retinal barrier breakdown, apoptosis, and glial reactivation in the retina of db/db mice.” Diabetes 54(11): 3119-25. Joussen, A. M., V. Poulaki, et al. (2004). “A central role for inflammation in the pathogenesis of diabetic retinopathy.” Faseb J 18(12): 1450-2. Joussen, A. M., V. Poulaki, et al. (2002). “Nonsteroidal anti-inflammatory drugs prevent early diabetic retinopathy via TNF-alpha suppression.” Faseb J 16(3): 438-40. Joussen, A. M., V. Poulaki, et al. (2002). “Retinal vascular endothelial growth factor induces intercellular adhesion molecule-1 and endothelial nitric oxide synthase expression and initiates early diabetic retinal leukocyte adhesion in vivo.” Am J Pathol 160(2): 501-9. Khalfaoui, T., G. Lizard, et al. (2009). “Immunohistochemical analysis of cellular adhesion molecules (ICAM-1, VCAM-1) and VEGF in fibrovascular membranes of patients with proliferative diabetic retinopathy: preliminary study.” Pathol Biol (Paris) 57(7-8): 513-7. Klein, R., B. E. Klein, et al. (2004). “The relation of retinal vessel caliber to the incidence and progression of diabetic retinopathy: XIX: the Wisconsin Epidemiologic Study of Diabetic Retinopathy.” Arch Ophthalmol 122(1): 76-83. Santos, K. G., B. Tschiedel, et al. (2005). “Prevalence of retinopathy in Caucasian type 2 diabetic patients from the South of Brazil and relationship with clinical and metabolic factors.” Braz J Med Biol Res 38(2): 221-5. Sarlos, S., B. Rizkalla, et al. (2003). “Retinal angiogenesis is mediated by an interaction between the angiotensin type 2 receptor, VEGF, and angiopoietin.” Am J Pathol 163(3): 879-87. Watkins, P. J. (2003). “Retinopathy.” Bmj 326(7395): 924-6. Zammit, S. C., A. J. Cox, et al. (2009). “Evaluation and optimization of antifibrotic activity of cinnamoyl anthranilates.” Bioorg Med Chem Lett 19(24): 7003-6.