Efficient chondrocyte induction method
10100283 · 2018-10-16
Assignee
Inventors
Cpc classification
A61K35/32
HUMAN NECESSITIES
C12N2506/45
CHEMISTRY; METALLURGY
A61P19/08
HUMAN NECESSITIES
C12N2501/16
CHEMISTRY; METALLURGY
C12N2501/115
CHEMISTRY; METALLURGY
C12N2501/155
CHEMISTRY; METALLURGY
International classification
Abstract
Provided is a method for producing chondrocytes from pluripotent stem cells, the method comprising the steps of: (i) inducing pluripotent stem cells to differentiate into mesodermal cells in adherent culture, (ii) culturing the cells obtained by step (i) in adherent culture in a medium containing one or more substances selected from the group consisting of BMP2, TGF and GDF5, and (iii) culturing the cells obtained by step (ii) in suspension culture in a medium containing one or more substances selected from the group consisting of BMP2, TGF and GDF5. Also provided is a pharmaceutical product comprising the chondrocytes obtained by the method.
Claims
1. A method for producing chondrocytes from pluripotent stem cells, the method comprising the steps of: (i) inducing pluripotent stem cells to differentiate into mesodermal cells in adherent culture, (ii) culturing the cells obtained by step (i) in adherent culture in a medium containing an effective amount of ascorbic acid, bone morphogenetic protein 2 (BMP2), transforming growth factor beta (TGF) and growth differentiation factor 5, (GDF5), and (iii) culturing the cells obtained by step (ii) in suspension culture in the medium containing ascorbic acid, BMP2, TGF and GDF5, thereby producing chondrocytes; wherein the induction of differentiation into mesodermal cells in step (i) is achieved by culturing in a medium containing an effective amount of wingless-type MMTV integration site family, member 3A (Wnt3a) and Activin A.
2. The method of claim 1, further comprising the step of culturing the cells obtained by step (iii) in a serum-containing medium.
3. The method of claim 1, wherein the medium used in the steps (i), (ii) and (iii) further contains 1% fetal bovine serum (FBS).
4. The method of claim 1, wherein the culture in step (iii) is suspension culture of the cells obtained by step (ii) without prior use of a detachment solution comprising protease activity.
5. The method of claim 1, wherein step (i) takes 5 days or less.
6. The method of claim 1, wherein step (ii) takes 15 days or less.
7. The method of claim 1, wherein step (iii) takes 10 to 30 days.
8. The method of claim 5, wherein step (i) takes 3 days.
9. The method of claim 6, wherein step (ii) takes 11 days.
10. The method of claim 7, wherein step (iii) takes 14 to 28 days.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
DESCRIPTION OF EMBODIMENTS
(14) The present invention will be described in detail below.
(15) The present invention provides a method for producing chondrocytes from pluripotent stem cells, the method comprising the steps of:
(16) (i) inducing pluripotent stem cells to differentiate into mesodermal cells in adherent culture,
(17) (ii) culturing the cells obtained by step (i) in adherent culture in a medium containing one or more substances selected from the group consisting of BMP2, TGF and GDF5, and
(18) (iii) culturing the cells obtained by step (ii) in suspension culture in a medium containing one or more substances selected from the group consisting of BMP2, TGF and GDF5.
(19) Pluripotent stem cells that can be used in the present invention are stem cells having both pluripotency, by which the cells are capable of differentiating into any types of cells in the body, and proliferation potency. Examples of the pluripotent stem cells include, but are not limited to, embryonic stem (ES) cells, embryonic stem cells from clone embryos obtained by nuclear transplantation (nuclear transfer ES (ntES) cells), spermatogonial stem cells (germline stem (GS) cells), embryonic germ cells (EG cells), induced pluripotent stem (iPS) cells, and pluripotent cells (Muse cells) derived from cultured fibroblasts and myeloid stem cells. Preferred pluripotent stem cells are ES cells, ntES cells, and iPS cells.
(20) (A) Embryonic Stem Cells
(21) ES cells are stem cells having pluripotency and proliferation potency via self-replication and are established from the inner cell mass of early embryos (e.g., blastocysts) of a mammal such as a human or a mouse.
(22) ES cells are embryo-derived stem cells originated from the inner cell mass of blastocysts, which arise from the morula after the eight-cell stage of fertilized eggs. ES cells have so-called pluripotency, by which they are capable of differentiating into any types of cells composing an adult body, and proliferation potency via self-replication. ES cells were discovered in mice in 1981 (M. J. Evans and M. H. Kaufman (1981), Nature 292:154-156). Thereafter, ES cell lines were also established in primates including humans, monkeys, etc. (J. A. Thomson et al. (1998), Science 282:1145-1147; J. A. Thomson et al. (1995), Proc. Natl. Acad. Sci. USA, 92:7844-7848; J. A. Thomson et al. (1996), Biol. Reprod., 55:254-259; J. A. Thomson and V. S. Marshall (1998), Curr. Top. Dev. Biol., 38:133-165).
(23) ES cells can be established by harvesting the inner cell mass from blastocysts developed from fertilized eggs of a subject animal and then culturing the inner cell mass on fibroblasts as feeders. Cell maintenance by subculture can be performed using a medium supplemented with substances such as leukemia inhibitory factor (LIF) and basic fibroblast growth factor (bFGF). Methods for establishment and maintenance of human and monkey ES cells are described in, for example, U.S. Pat. No. 5,843,780; Thomson J A, et al. (1995), Proc Natl. Acad. Sci. USA. 92:7844-7848; Thomson J A, et al. (1998), Science. 282:1145-1147; H. Suemori et al. (2006), Biochem. Biophys. Res. Commun., 345:926-932; M. Ueno et al. (2006), Proc. Natl. Acad. Sci. USA, 103:9554-9559; H. Suemori et al. (2001), Dev. Dyn., 222:273-279; H. Kawasaki et al. (2002), Proc. Natl. Acad. Sci. USA, 99:1580-1585; and Klimanskaya I, et al. (2006), Nature. 444:481-485.
(24) Human ES cells can be maintained under humid atmosphere of 2% CO.sub.2/98% air at 37 C. in a medium for preparation of ES cells, for example, a DMEM/F-12 medium supplemented with 0.1 mM 2-mercaptoethanol, 0.1 mM nonessential amino acids, 2 mM L-glutamic acid, 20% KSR, and 4 ng/ml bFGF (O. Fumitaka et al. (2008), Nat. Biotechnol., 26:215-224). ES cells need to be subcultured every 3 to 4 days. The subculture can be performed using, for example, 0.25% trypsin and 0.1 mg/ml collagenase IV in PBS containing 1 mM CaCl.sub.2 and 20% KSR.
(25) ES cells can be generally selected by using the expression of gene markers as an index, such as alkaline phosphatase, Oct-3/4 and Nanog. The markers can be detected by Real-time PCR. In particular, for selection of human ES cells, the expression of gene markers such as OCT-3/4, NANOG and ECAD can be used as an index (E. Kroon et al. (2008), Nat. Biotechnol., 26:443-452).
(26) Human ES cell lines, for example, WA01 (HI) and WA09 (H9) are available from WiCell Research Institute, Inc., and KhES-1, KhES-2 and KhES-3 are available from the Institute for Frontier Medical Sciences, Kyoto University (Kyoto, Japan).
(27) (B) Spermatogonial Stem Cells
(28) Spermatogonial stem cells are testis-derived pluripotent stem cells, serving as an origin for spermatogenesis. Spermatogonial stem cells can also be induced to differentiate into cells of various lineages in a manner similar to that in ES cells. For example, spermatogonial stem cells can generate chimeric mice when transplanted into mouse blastocysts (M. Kanatsu-Shinohara et al. (2003) Biol. Reprod., 69:612-616; K. Shinohara et al. (2004), Cell, 119: 1001-1012). In addition, spermatogonial stem cells are self-replicable in a medium containing glial cell line-derived neurotrophic factor (GDNF), and spermatogonial stem cells can be maintained by repeated subculture under culture conditions similar to those for ES cells (Masancri Takebayashi et al., (2008), Experimental Medicine, Vol. 26, No. 5 (Extra Number), pp. 41-46, YODOSHA (Tokyo, Japan)).
(29) (C) Embryonic Germ Cells
(30) Embryonic germ cells are cells established from primordial germ cells at the prenatal period and have pluripotency similar to that of ES cells. Embryonic germ cells can be established by culturing primordial germ cells in the presence of substances such as LIF, bFGF, and stem cell factor (Y. Matsui et al. (1992), Cell, 70:841-847; J. L. Resnick et al. (1992), Nature, 359:550-551).
(31) (D) Induced Pluripotent Stem Cells
(32) Induced pluripotent stem (iPS) cells can be generated by introducing specific reprogramming factors in the form of DNA or protein into somatic cells. iPS cells are somatic cell-derived artificial stem cells having properties almost equivalent to those of ES cells, such as pluripotency and proliferation potency via self-replication (K. Takahashi and S. Yamanaka (2006) Cell, 126:663-676; K. Takahashi et al. (2007), Cell, 131:861-872; J. Yu et al. (2007), Science, 318:1917-1920; Nakagawa, M. et al., Nat. Biotechnol. 26:101-106 (2008); WO 2007/069666). The reprogramming factor may be a gene specifically expressed in ES cells, a gene product or non-coding RNA thereof, a gene playing an important role in maintenance of undifferentiation of ES cells, a gene product or non-coding RNA thereof, or a low-molecular-weight compound. Examples of the genes serving as the reprogramming factors include, for example, Oct3/4, Sox2, Sox1, Sox3, Sox15, Sox17, Klf4, Klf2, c-Myc, N-Myc, L-Myc, Nanog, Lin28, Fbx15, ERas, ECAT15-2, Tcl1, -catenin, Lin28b, Sal11, Sal14, Esrrb, Nr5a2, Tbx3 and Glis1. These reprogramming factors may be used alone or in combination. Examples of the combination of such reprogramming factors include those described in WO 2007/069666, WO 2008/118820, WO 2009/007852, WO 2009/032194, WO 2009/058413, WO 2009/057831, WO 2009/075119, WO 2009/079007, WO 2009/091659, WO 2009/101084, WO 2009/101407, WO 2009/102983, WO 2009/114949, WO 2009/117439, WO 2009/126250, WO 2009/126251, WO 2009/126655, WO 2009/157593, WO 2010/009015, WO 2010/033906, WO 2010/033920, WO 2010/042800, WO 2010/050626, WO 2010/056831, WO 2010/068955, WO 2010/098419, WO 2010/102267, WO 2010/111409, WO 2010/111422, WO 2010/115050, WO 2010/124290, WO 2010/147395, WO 2010/147612, Huangfu D, et al. (2008), Nat. Biotechnol., 26:795-797, Shi Y, et al. (2008), Cell Stem Cell, 2: 525-528, Eminli S, et al. (2008), Stem Cells. 26:2467-2474, Huangfu D, et al. (2008), Nat Biotechnol. 26:1269-1275, Shi Y, et al. (2008), Cell Stem Cell, 3, 568-574, Zhao Y, et al. (2008), Cell Stem Cell, 3:475-479, Marson A, (2008), Cell Stem Cell, 3, 132-135, Feng B, et al. (2009), Nat Cell Biol. 11:197-203, R. L. Judson et al., (2009), Nat. Biotech., 27:459-461, Lyssiotis C A, et al. (2009), Proc Natl Acad Sci USA. 106:8912-8917, Kim J B, et al. (2009), Nature. 461:649-643, Ichida J K, et al. (2009), Cell Stem Cell. 5:491-503, Heng J C, et al. (2010), Cell Stem Cell. 6:167-74, Han J, et al. (2010), Nature. 463:1096-100, Mali P, et al. (2010), Stem Cells. 28:713-720, and Maekawa M, et al. (2011), Nature. 474:225-9.
(33) The reprogramming factors also include factors used for enhancing the establishment efficiency, such as histone deacetylase (HDAC) inhibitors [e.g., low-molecular-weight inhibitors, such as valproic acid (VPA), trichostatin A, sodium butyrate, MC 1293, and M344, and nucleic acid-based expression inhibitors such as siRNA and shRNA against HDAC (e.g., HDAC1 siRNA Smartpool (Millipore), HuSH 29-mer shRNA Constructs against HDAC1 (OriGene)], MEK inhibitors (e.g., PD184352, PD98059, U0126, SL327, and PD0325901), glycogen synthase kinase-3 inhibitors (e.g., Bio and CHIR99021), DNA methyltransferase inhibitors (e.g., 5-azacytidine), histone methyltransferase inhibitors (e.g., low-molecular-weight inhibitors such as BIX-01294, and nucleic acid-based expression inhibitors such as siRNA and shRNA against Suv39h1, Suv39h2, SetDB1 and G9a), L-channel calcium agonists (e.g., Bayk8644), butyric acid, TGF inhibitors or ALK5 inhibitors (e.g., LY364947, SB431542, 616453, and A-83-01), p53 inhibitors (e.g., siRNA and shRNA against p53), ARID3A inhibitors (e.g., siRNA and shRNA against ARID3A), miRNAs such as miR-291-3p, miR-294, miR-295, and mir-302, Wnt signaling (e.g., soluble Wnt3a), neuropeptide Y, prostaglandins (e.g., prostagiandin E2 and prostaglandin J2), hTERT, SV40LT, UTF1, IRX6, GLIS1, PITX2, DMRTB1, etc. These factors used for enhancing the establishment efficiency are not distinguished from the reprogramming factors in the present invention.
(34) The reprogramming factors may be introduced in the form of protein into somatic cells by a technique such as lipofection, fusion with a cell membrane-permeable peptide (e.g., HIV-derived TAT and polyarginine), or microinjection.
(35) Alternatively, the reprogramming factors may be introduced in the form of DNA into somatic cells by a technique such as a technique using a vector (such as a viral vector, a plasmid vector and an artificial chromosome vector), lipofection, a technique using a liposome, or microinjection. Examples of the viral vector include retroviral vectors, lentiviral vectors (both described in Cell, 126, pp. 663-676, 2006; Cell, 131, pp. 861-872, 2007; Science, 318, pp. 1917-1920, 2007), adenoviral vectors (Science, 322, 945-949, 2008), adeno-associated viral vectors, and Sendai virus vectors (WO 2010/008054). Examples of the artificial chromosome vectors include human artificial chromosome (HAC) vectors, yeast artificial chromosome (YAC) vectors, and bacterial artificial chromosome (BAC, PAC) vectors. Examples of the plasmid vectors include plasmids for mammalian cells (Science, 322:949-953, 2008). Such a vector can contain regulatory sequences such as a promoter, an enhancer, a ribosome binding sequence, a terminator, and a polyadenylation site, so that a nuclear reprogramming factor can be expressed. The vector may further contain, if necessary, a selection marker sequence such as a drug resistance gene (e.g., a kanamycin resistance gene, an ampicillin resistance gene, and a puromycin resistance gene), a thymidine kinase gene, and a diphtheria toxin gene, and a reporter gene sequence such as a green fluorescent protein (GFP), -glucuronidase (GUS), and FLAG. In order to remove a gene encoding a reprogramming factor or remove a promoter together with a gene encoding a reprogramming factor binding thereto after introduction of the vector into somatic cells, LoxP sequences may be inserted upstream and downstream of the region to be removed.
(36) Alternatively, the reprogramming factors may be introduced in the form of RNA into somatic cells by a technique such as lipofection or microinjection. In order to prevent decomposition, RNAs containing 5-methylcytidine and pseudouridine (TriLink Biotechnologies) may be used (Warren L (2010), Cell Stem Cell. 7:618-630).
(37) A culture medium for iPS cell induction includes, for example, DMEM, DMEM/F12, or DME medium containing 10 to 15% FBS (these media may further contain LIF, penicillin/streptomycin, puromycin, L-glutamine, nonessential amino acids, -mercaptoethanol, etc. as needed) and commercially available media [e.g., a medium for mouse ES cell culture (e.g., TX-WES medium (Thromb-X)), a medium for primate ES cell culture (e.g., a medium for primate ES/iPS cells (ReproCELL)), and a serum-free medium (mTeSR (Stemcell Technology)].
(38) An exemplary culture method is as follows. Somatic cells are brought into contact with reprogramming factors in a DMEM or DMEM/F12 medium containing 10% FBS at 37 C. in an atmosphere of 5% CO.sub.2 and are cultured for about 4 to 7 days. The cells are then reseeded on feeder cells (e.g., mitomycin C-treated STO cells or SNL cells). About 10 days after contact between the somatic cells and the reprogramming factors, the cells are subjected to culture in a bFGF-containing medium for primate ES cell culture. About 30 to 45 days or more after of the contact, iPS cell-like colonies appear.
(39) Alternatively, the cells are cultured on feeder cells (e.g., mitomycin C-treated STO cells, SNL cells, etc.) in a 10% FBS-containing DMEM medium (this media may further contain LIF, penicillin/streptomycin, puromycin, L-glutamine, nonessential amino acids, -mercaptoethanol, etc. as needed) at 37 C. in an atmosphere of 5% CO.sub.2. About 25 to 30 days or more after the start of culture, ES-like colonies appear. Desirably, instead of feeder cells, the somatic cells to be reprogrammed are used as feeder cells (Takahashi K, et al. (2009), PLoS One. 4: e8067, or WO 2010/137746), or alternatively, an extracellular matrix (e.g., laminin-5 (WO 2009/123349) or Matrigel (BD)) is used.
(40) Alternatively, the cells may be cultured in a serum-free medium (Sun N, et al. (2009), Proc Natl Acad Sci USA. 106:15720-15725). iPS cells may be established under low oxygen conditions (oxygen concentration of 0.1 to 15%) for enhancing the establishment efficiency (Yoshida Y, et al. (2009), Cell Stem Cell. 5:237-241, or WO 2010/013845).
(41) During the above culture, medium exchange with a fresh medium is performed once a day from day 2 after the start of culture. The number of somatic cells to undergo nuclear reprogramming is not limited, but, for example, ranges from about 510.sup.3 to about 510.sup.8 cells per culture dish (100 cm.sup.2).
(42) iPS cells can be selected based on the shape of the colonies. When a drug resistance gene that is expressed along with the gene expressed during somatic reprogramming (e.g., Oct3/4, Nanog) is introduced as a marker gene, established iPS cells can be selected by culturing the cells in a medium containing the relevant drug (selective medium). When a fluorescent protein gene is used as a marker gene, iPS cells of interest can be detected by observation under a fluorescence microscope. When a luminescent enzyme gene is used as a marker gene, iPS cells of interest can be detected by adding a luminescent substrate. When a chromogenic enzyme gene is used as a marker gene, iPS cells of interest can be detected by adding a chromogenic substrate.
(43) The term somatic cells as used herein refers to any types of animal cells (preferably mammalian cells including human cells) other than germ cells or totipotent cells such as ova, oocytes and ES cells. Somatic cells include, but are not limited to, somatic cells of fetuses, somatic cells of neonates, and mature healthy or pathogenic somatic cells, as well as primary cultured cells, passage cells, and established cell lines. Specific example of the somatic cells include
(44) (1) tissue stem cells (somatic stem cells), such as neural stem cells, hematopoietic stem cells, mesenchymal stem cells, dental pulp stem cells, etc.,
(45) (2) tissue progenitor cells, and
(46) (3) differentiated cells, such as lymphocytes, epithelial cells, endothelial cells, muscle cells, fibroblasts (skin cells etc.), hair cells, hepatocytes, gastric mucosal cells, enterocytes, splenocytes, pancreatic cells (pancreatic exocrine cells etc.), brain cells, lung cells, renal cells and adipocytes.
(47) When iPS cells are used to generate cells to be transplanted, the iPS cells are desirably produced from somatic cells having the same or substantially the same HLA alleles as the recipient to prevent rejection. The term substantially the same herein means that the HLA alleles match to the extent that immune response against the transplanted cells can be inhibited by an immunosuppressant. The somatic cells have, for example, three matched HLA alleles including HLA-A, HLA-B and HLA-DR or four matched HLA alleles further including HLA-C.
(48) (E) ES Cells Derived from Clone Embryos Generated by Nuclear Transplantation
(49) ntES (nuclear transfer ES) cells are ES cells derived from clone embryos generated by nuclear transplantation techniques, and have properties almost the same as those of fertilized egg-derived ES cells (T. Wakayama et al. (2001), Science, 292:740-743; S. Wakayama et al. (2005), Biol. Reprod., 72:932-936; J. Byrne et al. (2007), Nature, 450:497-502). Specifically, ntES cells are ES cells established from the inner cell mass of a blastocyst from a clone embryo that is obtained via substitution of the nucleus of an unfertilized egg with the nucleus of a somatic cell. For preparation of ntES cells, nuclear transplantation techniques (J. B. Cibelli et al. (1998), Nature Biotechnol., 16: 642-646) and the above ES cell preparation techniques are used in combination (Kiyoka Wakayama et al., (2008), Experimental Medicine, Vol. 26, No. (Extra Number), pp. 47-52). In nuclear transplantation, the nucleus of a somatic cell is injected into a mammalian enucleated unfertilized egg and then the resulting cell is cultured for several hours so as to undergo reprogramming.
(50) (F) Multilineage-Differentiating Stress Enduring Cells (Muse Cells)
(51) Muse cells are pluripotent stem cells produced by the method described in WO 2011/007900. Specifically, Muse cells are pluripotent cells produced by subjecting fibroblasts or bone marrow stromal cells to trypsin treatment for a long period of time, preferably 8 or 16 hours, and then culturing the cells in suspension culture. Muse cells are SSEA-3 and CD105 positive.
(52) The term chondrocytes used herein refers to cells that produce an extracellular matrix (such as collagen) that forms cartilage, or refers to progenitor cells of such cells. The chondrocytes may be cells expressing a chondrocyte marker, for example, type II collagen (COL2A1) or SOX9. The COL2A1 herein includes human COL2A1 genes having nucleotide sequences of NCBI accession numbers NM_001844 and NM_033150, mouse COL2A1 genes having nucleotide sequences of NCBI accession numbers NM_001113515 and NM_031163, proteins encoded by the genes, and naturally occurring variants having the same functions as those of the genes or the proteins. The SOX9 herein includes a human SOX9 gene having a nucleotide sequence of NCBI accession number NM_000346, a mouse SOX9 gene having a nucleotide sequence of NCBI accession number NM_011448, proteins encoded by the genes, and naturally occurring variants having the same functions as those of the genes or the proteins.
(53) (i) Step of Inducing Pluripotent Stem Cells to Differentiate into Mesodermal Cells in Adherent Culture
(54) The term mesodermal cells herein refers to cells that occur between the endoderm and the ectoderm at the gastrula stage of animal development, and are preferably BRACHYURY positive. The BRACHYURY herein includes human BRACHYURY genes having nucleotide sequences of NCBI accession numbers NM_001270484 and NM_003181, a mouse BRACHYURY gene having a nucleotide sequence of NCBI accession number NM_009309, proteins encoded by the genes, and naturally occurring variants having the same functions as those of the genes or the proteins.
(55) According to the present invention, the induction of pluripotent stem cells to differentiate into mesodermal cells may be achieved by any method, and, for example, is achieved by culturing pluripotent stem cells in a medium containing Activin A and a GSK- inhibitor.
(56) Preferably, in step (i), pluripotent stem cells are cultured in adherent culture without feeder cells. After the cell colonies reach an appropriate size (cell nodules each containing 1 to 210.sup.5 cells), the medium is exchanged with a medium containing Activin A and a GSK-30 inhibitor, and culture is continued.
(57) The adherent culture herein may be culture in a culture vessel coated with an extracellular matrix. The coating may be applied by adding a solution containing an extracellular matrix to a culture vessel, followed by appropriately removing the solution.
(58) The extracellular matrix herein is a supramolecular assembly present outside the cells, and may be naturally occurring or artificial (recombinant). Examples of the extracellular matrix include collagens, proteoglycans, fibronectins, hyaluronic acid, tenascins, entactins, elastin, fibrillins, laminins, and fragments of these substances. These extracellular matrices may be used in combination. The extracellular matrix may be a product prepared using cells, such as BD Matrigel. Examples of the artificial extracellular matrix include laminin fragments. The laminins herein are hetero-trimeric proteins that contain an -chain, a -chain and a -chain, and are not particularly limited in the present invention. For example, the -chain is 1, 2, 3, 4, or 5, the chain is 1, 2, or 3, and the chain is 1, 2, or 3. The laminin fragments herein are not particularly limited as long as they have integrin-binding activity, and examples thereof include laminin E8 fragments produced by digesting laminins with elastase.
(59) The medium used in step (i) may be prepared by adding Activin A and a GSK-3 inhibitor to a basal medium for animal cell culture. Examples of the basal medium include IMDM medium, Medium 199, Eagle's minimum essential medium (EMEM), MEM medium, Dulbecco's modified Eagle's medium (DMEM), Ham's F12 medium, RPMI 1640 medium, Fischer's medium, and a mixed medium thereof. These media may contain serum (e.g., FBS) or no serum. If necessary, the media may contain one or more serum substitutes such as albumin, transferrin, KnockOut Serum Replacement (KSR) (serum substitute for FBS in ES cell culture) (Invitrogen), N2 supplement (Invitrogen), B27 supplement (Invitrogen), fatty acids, insulin, sodium selenite, collagen progenitors, trace elements, 2-mercaptoethanol, and 3-thiolglycerol, as well as one or more substances such as lipids, amino acids, L-glutamine, GlutaMAX (Invitrogen), nonessential amino acids (NEAAs), vitamins, growth factors, low-molecular-weight compounds, antibiotics, antioxidants, pyruvic acid, buffering agents, and inorganic salts. In one embodiment of this step, the basal medium is DMEM/F12 containing insulin, transferrin, sodium selenite and 1% serum.
(60) The Activin A in step (i) includes Activin A derived from an animal such as a human and a non-human animal and functionally modified derivatives thereof. The Activin A may be, for example, a commercially available product produced by R&D systems etc. The concentration of Activin A used in this step is 0.1 to 1000 ng/ml, preferably 1 to 100 ng/ml, more preferably 5 to 50 ng/ml, in particular 10 ng/ml.
(61) The GSK-3 inhibitor in step (i) is not particularly limited as long as it directly or indirectly inhibits the functions of GSK-3, for example, kinase activity. Examples of the GSK-3 inhibitor include Wnt3a, the indirubin derivative BIO (also called GSK-30 inhibitor IX (6-bromoindirubin-3-oxime)), the maleimide derivative SB216763 (3-(2,4-dichlorophenyl)-4-(1-methyl-1H-indol-3-yl)-1H-pyrrole-2,5-dione), the phenyl -bromomethyl ketone compound GSK-3 inhibitor VII (4-dibromoacetophenone), the cell-membrane permeable phosphopeptide L803-mts (also called GSK-3 peptide inhibitor (Myr-N-GKEAPPAPPQSpP-NH.sub.2)) and the highly selective inhibitor CHIR99021 (Nature (2008) 453:519-523). These compounds are commercially available from, for example, Stemgent, Calbiochem, Biomol, etc., or may be produced in-house. A preferred GSK-3 inhibitor used in this step is Wnt3a. The Wnt3a includes Wnt3a derived from an animal such as a human and a non-human animal and functionally modified derivatives thereof. The Wnt3a may be, for example, a commercially available product produced by R&D systems etc. The concentration of the GSK-GSK-3 inhibitor used in this step may be selected by a person skilled in the art as appropriate for the type of the GSK-3 inhibitor to be used. For example, the concentration of Wnt3a used as the GSK-3 inhibitor is 0.1 to 1000 ng/ml, preferably 1 to 100 ng/ml, more preferably 5 to 50 ng/ml, in particular 10 ng/ml.
(62) The culture temperature in step (i) is not particularly limited, but, for example, ranges from about 30 C. to about 40 C., and is preferably about 37 C. The culture is performed under an air atmosphere containing CO.sub.2. The CO.sub.2 concentration ranges from about 2% to 5%, and is preferably about 5%. The culture period in this step is, for example, 5 days or less, and is preferably 3 days.
(63) (ii) Step of Culturing the Cells Obtained by Step (i) in Adherent Culture in a Medium Containing One or More Substances Selected from the Group Consisting of BMP2, TGF and GDF5
(64) In this step, the medium of the cell culture in step (i) is removed and exchanged with a medium containing one or more substances selected from the group consisting of BMP2, TGF and GDF5. The cells in the culture in step (i) are adherent to culture dishes, and the adherent culture is continued in step (ii).
(65) The medium used in step (ii) may be prepared by adding one or more substances selected from the group consisting of BMP2, TGF and GDF5 to a basal medium for animal cell culture. Preferred media are a medium containing at least TGF, a medium containing BMP2 and TGF, a medium containing ascorbic acid, BMP2 and TGF, a medium containing GDF5, BMP2 and TGF, and a medium containing ascorbic acid, BMP2, TGF and GDF5, and more preferred is a medium containing bFGF, ascorbic acid, BMP2, TGF and GDF5. Examples of the basal medium include IMDM medium, Medium 199, Eagle's minimum essential medium (EMEM), MEM medium, Dulbecco's modified Eagle's medium (DMEM), Ham's F12 medium, RPMI 1640 medium, Fischer's medium, and a mixed medium thereof. These media may contain serum (e.g., FBS) or no serum. If necessary, the media may contain one or more serum substitutes such as albumin, transferrin, KnockOut Serum Replacement (KSR) (serum substitute for FBS in ES cell culture) (Invitrogen), N2 supplement (Invitrogen), B27 supplement (Invitrogen), fatty acids, insulin, collagen progenitors, trace elements, 2-mercaptoethanol, and 3-thiolglycerol, as well as one or more substances such as lipids, amino acids, L-glutamine, GlutaMAX (Invitrogen), nonessential amino acids (NEAAs), vitamins, growth factors, low-molecular-weight compounds, antibiotics, antioxidants, pyruvic acid, buffering agents, and inorganic salts. In one embodiment of this step, the basal medium is DMEM containing insulin, transferrin, sodium selenite, and 1% serum.
(66) The bFGF in step (ii) includes bFGF derived from an animal such as a human and a non-human animal and functionally modified derivatives thereof. The bFGF may be, for example, a commercially available product produced by WAKO etc. The concentration of bFGF used in this step is 0.1 to 1000 ng/ml, preferably 1 to 100 ng/ml, more preferably 5 to 50 ng/ml, in particular 10 ng/ml.
(67) The ascorbic acid in step (ii) may be, for example, a commercially available product produced by Nakarai etc. The concentration of the ascorbic acid used in this step is 5 to 500 g/ml, preferably 10 to 100 g/ml, more preferably 50 g/ml.
(68) The BMP2 in step (ii) includes BMP2 derived from an animal such as a human and a non-human animal and functionally modified derivatives thereof. The BMP2 may be, for example, a commercially available product produced by Osteopharma etc. The concentration of BMP2 used in this step is 0.1 to 1000 ng/ml, preferably 1 to 100 ng/ml, more preferably 5 to 50 ng/ml, in particular 10 ng/ml. BMP2 may be replaced by BMP4 in the present invention.
(69) The TGF in step (ii) includes TGF derived from an animal such as a human and a non-human animal and functionally modified derivatives thereof. The TGF may be, for example, a commercially available product produced by PeproTech etc. The concentration of TGF used in this step is 0.1 to 1000 ng/ml, preferably 1 to 100 ng/ml, more preferably 5 to 50 ng/ml, in particular 10 ng/ml.
(70) The GDF5 in step (ii) includes GDF5 derived from an animal such as a human and a non-human animal and functionally modified derivatives thereof. The GDF5 may be, for example, a commercially available product produced by PeproTech etc. The concentration of GDF5 used in this step is 0.1 to 1000 ng/ml, preferably 1 to 100 ng/ml, more preferably 5 to 50 ng/ml, in particular 10 ng/ml.
(71) The culture temperature in step (ii) is not particularly limited, but, for example, ranges from about 30 C. to about 40 C., and is preferably about 37 C. The culture is performed under an air atmosphere containing CO.sub.2. The CO.sub.2 concentration ranges from about 2% to 5%, and is preferably about 5%. The culture period in this step is, for example, 15 days or less, and is preferably 11 days.
(72) (iii) Step of Culturing the Cells Obtained by Step (ii) in Suspension Culture in a Medium Containing One or More Substances Selected from the Group Consisting of BMP2, TGF and GDF5
(73) In this step, the cells obtained in the culture in step (ii) are separated from the culture dishes and then subjected to suspension culture. The separation of the cells from the culture dishes in step (iii) is preferably achieved by mechanical means (pipetting etc.), not using a detachment solution with protease activity and/or collagenase activity (e.g., solutions containing trypsin and collagenase, such as Accutase and Accumax (Innovative Cell Technologies, Inc.)).
(74) The term suspension culture herein refers to culture of cells that are in a state of being non-adherent to a culture dish. The conditions of the suspension culture are not particularly limited, but preferably the suspension culture is performed in a culture vessel without artificial treatment for enhancing the cell adhesion to the vessel (e.g., without coating treatment using an extracellular matrix etc.) or a culture vessel with artificial treatment for preventing the cell adhesion to the vessel (e.g., with coating treatment using polyhydroxyethyl methacrylate (poly-HEMA)).
(75) The medium used in step (iii) may be prepared by adding one or more substances selected from the group consisting of BMP2, TGF and GDF5 to a basal medium for animal cell culture. Preferred media are a medium containing at least TGF, a medium containing BMP2 and TGF, a medium containing ascorbic acid, BMP2 and TGF, a medium containing GDF5, BMP2 and TGF, and a medium containing ascorbic acid, BMP2, TGF and GDF5, and more preferred is a medium containing ascorbic acid, BMP2, TGF and GDF5. Examples of the basal medium include IMDM medium, Medium 199, Eagle's minimum essential medium (EMEM), MEM medium, Dulbecco's modified Eagle's medium (DMEM), Ham's F12 medium, RPMI 1640 medium, Fischer's medium, and a mixed medium thereof. These media may contain serum (e.g., FBS) or no serum. If necessary, the media may contain one or more serum substitutes such as albumin, transferrin, KnockOut Serum Replacement (KSR) (serum substitute for FBS in ES cell culture) (Invitrogen), N2 supplement (Invitrogen), B27 supplement (Invitrogen), fatty acids, insulin, collagen progenitors, trace elements, 2-mercaptoethanol, and 3-thiolglycerol, as well as one or more substances such as lipids, amino acids, L-glutamine, GlutaMAX (Invitrogen), nonessential amino acids (NEAAs), vitamins, growth factors, low-molecular-weight compounds, antibiotics, antioxidants, pyruvic acid, buffering agents, and inorganic salts. In one embodiment of this step, the basal medium is DMEM containing insulin, transferrin, sodium selenite, and 1% serum.
(76) The ascorbic acid in step (iii) may be, for example, a commercially available product produced by Nakarai etc. The concentration of the ascorbic acid used in this step is to 500 g/ml, preferably 10 to 100 g/ml, more preferably 50 g/ml.
(77) The BMP2 in step (iii) includes BMP2 derived from an animal such as a human and a non-human animal and functionally modified derivatives thereof. The BMP2 may be, for example, a commercially available product produced by Osteopharma etc. The concentration of BMP2 used in this step is 0.1 to 1000 ng/ml, preferably 1 to 100 ng/ml, more preferably 5 to 50 ng/ml, in particular 10 ng/ml.
(78) The TGF in step (iii) includes TGF derived from an animal such as a human and a non-human animal and functionally modified derivatives thereof. The TGF may be, for example, a commercially available product produced by PeproTech etc. The concentration of TGF used in this step is 0.1 to 1000 ng/ml, preferably 1 to 100 ng/ml, more preferably 5 to 50 ng/ml, in particular 10 ng/ml.
(79) The GDF5 in step (iii) includes GDF5 derived from an animal such as a human and a non-human animal and functionally modified derivatives thereof. The GDF5 may be, for example, a commercially available product produced by PeproTech etc. The concentration of GDF5 used in this step is 0.1 to 1000 ng/ml, preferably 1 to 100 ng/ml, more preferably 5 to 50 ng/ml, in particular 10 ng/ml.
(80) The culture temperature in step (iii) is not particularly limited, but, for example, ranges from about 3 C. to about 40 C., and is preferably about 37 C. The culture is performed under an air atmosphere containing CO.sub.2. The CO.sub.2 concentration ranges from about 2% to 5%, and is preferably about 5%. The culture period in this step is, for example, 10 to 30 days, and is preferably 14 to 28 days.
(81) (iv) Step of Further Culturing the Cells Obtained by Step (iii) in Suspension Culture
(82) Chondrocytes are obtained at the end of step (iii), but in order to obtain more mature chondrocytes, the cells obtained in the culture in step (iii) may be further cultured in suspension culture.
(83) The medium used in step (iv) is a basal medium for animal cell culture. Examples of the basal medium include IMDM medium, Medium 199, Eagle's minimum essential medium (EMEM), MEM medium, Dulbecco's modified Eagle's medium (DMEM), Ham's F12 medium, RPMI 1640 medium, Fischer's medium, and a mixed medium thereof. These media may contain serum (e.g., FBS) or no serum. If necessary, the media may contain one or more serum substitutes such as albumin, transferrin, KnockOut Serum Replacement (KSR) (serum substitute for FBS in ES cell culture) (Invitrogen), N2 supplement (Invitrogen), B27 supplement (Invitrogen), fatty acids, insulin, collagen progenitors, trace elements, 2-mercaptoethanol, and 3-thiolglycerol, as well as one or more substances such as lipids, amino acids, L-glutamine, GlutaMAX (Invitrogen), nonessential amino acids (NEAAs), vitamins, growth factors, low-molecular-weight compounds, antibiotics, antioxidants, pyruvic acid, buffering agents, and inorganic salts. In one embodiment of this step, the basal medium is DMEM containing 10% serum.
(84) The culture temperature in step (iv) is not particularly limited, but, for example, ranges from about 30 C. to about 40 C., and is preferably about 37 C. The culture is performed under an air atmosphere containing CO.sub.2. The CO.sub.2 concentration ranges from about 2% to 5%, and is preferably about 5%. A longer culture period in this step causes no problems on the production of chondrocytes, and hence the culture period is, for example, 20 days or more, and is preferably 28 days or more.
(85) The present invention provides induced chondrocytes from pluripotent stem cells as described above. The induced chondrocytes have the following characteristics:
(86) (1) the chondrocytes have at least 100-fold increase in COL2A1 gene expression compared with that in the pluripotent stem cells,
(87) (2) the chondrocytes have at least 250-fold increase in SOX9 gene expression compared with that in the pluripotent stem cells, and
(88) (3) the chondrocytes have no foreign gene introduced therein (except for foreign genes used for iPS cell production).
(89) The expressions of COL2A1 and SOX9 genes herein are measured in terms of the mRNA levels per cell by a method well known to a person skilled in the art. Examples of the measurement method include RT-PCR, Northern blotting, etc. The measurement by PCR will be described in detail in Examples described later.
(90) The increase in the expression level of the COL2A1 gene in the induced chondrocytes of the present invention compared with that in the pluripotent stem cells is preferably at least 50-fold or more, 100-fold or more, 150-fold or more, 200-fold or more, 250-fold or more, 260-fold or more, 270-fold or more, 280-fold or more, 290-fold or more, 300-fold or more, 400-fold or more, 500-fold or more, 600-fold or more, 700-fold or more, 800-fold or more, 900-fold or more, or 1000-fold or more. The increase is more preferably 280-fold or more.
(91) The increase in the expression level of the SOX9 gene in the induced chondrocytes of the present invention compared with that in the pluripotent stem cells is preferably at least 50-fold or more, 100-fold or more, 150-fold or more, 200-fold or more, 250-fold or more, 260-fold or more, 270-fold or more, 280-fold or more, 290-fold or more, 300-fold or more, 400-fold or more, 500-fold or more, 600-fold or more, 700-fold or more, 800-fold or more, 900-fold or more, or 1000-fold or more. The increase is more preferably 500-fold or more.
(92) The induced chondrocytes of the present invention can be cultured in the medium used in step (iv). The culture temperature and other conditions are the same as those in step (iv).
(93) The present invention provides a cartilaginous tissue having three-dimensional structure produced by culturing the induced chondrocytes. The cartilaginous tissue is composed of an outer membrane and inner components surrounded by the outer membrane. The outer membrane comprises COL1 fibers but no COL2 fibers and has a thickness of 10 to 50 m. The inner components comprise COL11 fibers, COL2 fibers, proteoglycans and the induced chondrocytes.
(94) The cartilaginous tissue of the present invention is in the form of a spherical particle with a diameter of 0.5 mm to 5 mm. The spherical particles can be fused together, and hence the size is not particularly limited as long as the longest diameter is at least 0.5 mm or more.
(95) The thickness of the outer membrane herein is not particularly limited as long as the cartilaginous tissue maintains adequate mechanical strength in a joint of a living body and can be integrated with the tissue of the recipient when transplanted into a joint of a living body. The thickness is, for example, 10 to 50 m, 15 to 40 m, or 20 to 30 m. The thickness of the outer membrane can be measured as follows. Cartilaginous tissue sections are prepared and then stained with an anti-COL1 antibody, and the thickness of the stained part is measured on microscopic images. The section used for the measurement preferably has the largest cross-sectional area of the cartilaginous tissue. When the thickness of the outer membrane is not uniform in a cartilaginous tissue section, the largest thickness in the section can be taken as the thickness of the outer membrane.
(96) The COL1 fibers herein are fibers having a triple helix structure formed by protein chains encoded by the COL1 gene.
(97) The COL2 fibers herein are fibers having a triple helix structure formed by protein chains encoded by the COL2 gene.
(98) The COL11 fibers herein are fibers having a triple helix structure formed by protein chains encoded by the COL11 gene.
(99) The term proteoglycans herein refers to a group of compounds in which polysaccharides composed of repeating disaccharide units (such as chondroitin sulfate) are linked to amino acid (serine) residues on a core protein via saccharides (xylose, galactose and/or glucuronic acid).
(100) The present invention provides a pharmaceutical product comprising the chondrocytes obtained by the method described above. The pharmaceutical product is administered to a patient, for example, as follows. The culture products (particles) composed of the chondrocytes obtained by the above method and an extracellular matrix from the chondrocytes are gathered with a fibrin glue to form a cluster with an appropriate size for the transplantation site. The gathered particles are transplanted into the defect site in the cartilage of a patient. Alternatively, the particles are mixed with gelatin gel, collagen gel and/or hyaluronic acid gel, etc., and transplanted into the defect site. Alternatively, the particles are transplanted into the defect site and fixed with the periosteum.
(101) Examples of the diseases to be treated with the pharmaceutical product include defects in the cartilage in the face, such as nasal cartilage and conchal cartilage, and defects in the articular cartilage. The pharmaceutical product is preferably used for treatment of articular cartilage injury.
(102) In the present invention, the number of the particles contained in the pharmaceutical product is not particularly limited as long as the number is sufficient for successful grafting of the transplant. The number of the particles may be reduced or increased as appropriate for the size of the defect site or the body size of the patient.
(103) The present invention will be described more specifically with reference to Examples below, but the present invention is not limited thereto.
Examples
(104) Human iPS Cells
(105) The cell lines 409B2, HDF-11 and KF4009-1 were established from human dermal fibroblasts, and the cell line 604B1 was established from human peripheral blood cells, by the introduction of reprogramming factors using episomal vectors in accordance with Nature Methods 8, 409-412 (2011). These four human iPS cell lines were used in the experiments. The 409B2 cell line (Nat Methods. 8, 409-412 (2011)) and the 604B1 cell line (Stem Cells. 31, 458-466 (2013)) were gifts from Center for iPS Cell Research and Application, Kyoto University. The established iPS cell lines were reseeded on feeder cells (mitomycin-C-treated SNL cells), then human ES cell maintenance medium was added, and the cell lines were cultured for maintenance. The human ES cell maintenance medium was prepared by mixing DMEM/F12 (Sigma) with 20% KSR (Invitrogen), 2 mM L-glutamine (Invitrogen), 110.sup.4 M nonessential amino acids (Invitrogen), 110.sup.4 M 2-mercaptoethanol (Invitrogen), 50 units/ml penicillin (Invitrogen), 50 mg/ml streptomycin (Invitrogen), and 4 ng/ml bFGF (WAKO). The iPS cell lines were transferred to Matrigel (Invitrogen)-coated dishes, then Essential 8 medium (Life Technologies) supplemented with 50 units/ml penicillin and 50 mg/ml streptomycin was added, and the cell lines were cultured for maintenance in the feeder-free environment. The iPS cell lines formed colonies that consisted of 1 to 210.sup.5 cells 10 to 15 days after the start of maintenance under the feeder-free culture conditions. The colonies were subjected to differentiation into chondrocytes as described below.
(106) Isolation of RNAs and Quantitative Real-Time RT-PCR
(107) RNAs for RT-PCR were collected from the desired cells using RNeasy Mini Kit (Qiagen) with DNase I digestion in the column in accordance with the manufacturer's protocol. In cases where RNAs were collected from the cells in particles, the particles were homogenized using a mortar and then subjected to RNA collection. To prepare templates, 500 ng of the total RNAs were converted to cDNAs using ReverTra Ace (TOYOBO). Real-time PCR was performed on Step One system (ABI) using KAPA SYBR FAST qPCR kit Master Mix ABI prism (KAPA BIOSYSTEMS). The primers used for the PCR are shown below.
(108) TABLE-US-00001 Primer Sequence ACTBF TGGCACCACACCTTCTACAATGAGC (SEQIDNO:1) ACTBR GCACAGCTTCTCCTTAATGTCACGC (SEQIDNO:2) OCT3/4 FGACAACAATGAGAACCTTCA (SEQIDNO:3) OCT3/4R TTCTGGCGCCGGTTACAGAA (SEQIDNO:4) NANOGF CAAAGGCAAACAACCCACTT (SEQIDNO:5) NANOGR CTGGATGTTCTGGGTCTGGT (SEQIDNO:6) BRACHYURYF TATGAGCCTCGAATCCACATAGT (SEQIDNO:7) BRACHYURYR CCTCGTTCTGATAAGCAGTCAC (SEQIDNO:8) KDRF GGCCCAATAATCAGAGTGGCA (SEQIDNO:9) KDRR CCAGTGTCATTTCCGATCACTTT (SEQIDNO:10) SOX5F CAGCCAGAGTTACACAATAGG (SEQIDNO:11) SOX5R CTGTTGTTCCCGTCGGAGTT (SEQIDNO:12) SOX6F GGATGCAATGACCCAGGATTT (SEQIDNO:13) SOX6R TGAATGGTACTGACAAGTGTTGG (SEQIDNO:14) SOX9F AGACCTTTGGGCTGCCTTAT (SEQIDNO:15) SOX9R TAGCCTCCCTCACTCCAAGA (SEQIDNO:16) AGGRECANF TGAGGAGGGCTGGAACAAGTACC (SEQIDNO:17) AGGRECANR GGAGGTGGTAATTGCAGGGAACA (SEQIDNO:18) COL2A1F TTTCCCAGGTCAAGATGGTC (SEQIDNO:19) COL2A1R CTTCAGCACCTGTCTCACCA (SEQIDNO:20) COL11A2F TGTGATGACTACGGGGACAA (SEQIDNO:21) COL11A2R CCATATTCCTCTGCCTGGAA (SEQIDNO:22) LUBRICINF AAAGTCAGCACATCTCCCAAG (SEQIDNO:23) LUBRICINR GTGTCTCTTTAGCGGAAGTAGTC (SEQIDNO:24) IHHF AACTCGCTGGCTATCTCGGT (SEQIDNO:25) IHHR GCCCTCATAATGCAGGGACT (SEQIDNO:26) COL10A1F ATGCTGCCACAAAATACCCTTT (SEQIDNO:27) COL10A1F GGTAGTGGGCCTTTTATGCCT (SEQIDNO:28) COL1A1F GTCGAGGGCCAAGACGAAG (SEQIDNO:29) COL1A1R CAGATCACGTCATCGCACAAC (SEQIDNO:30) COL1A2F AATTGGAGCTGTTGGTAACGC (SEQIDNO:31) COL1A2R CACCAGTAAGGCCGTTTGC (SEQIDNO:32) OSTEOCALICNF CACTCCTCGCCCTATTGGC (SEQIDNO:33) OSTEOCALCINR CCCTCCTGCTTGGACACAAAG (SEQIDNO:34) Taqmanhuman Hs01060665-gl ACTB Taqmanhuman Mn00607939-sl Actb Taqmanrat Rn00667869-ml Actb eGFPCOL11A2F CATACAATGGGGTACCTTCTGG (SEQIDNO:35) eGFPCOL11A2R GCATGGACGAGCTGTACAAGTAA (SEQIDNO:36)
Generation of iPS Cells that Express GFP in a Chondrocyte-Specific Manner
(109) The piggyBac vector carrying a transgene construct linked to the promoter and enhancer of the chondrocyte-specific Col11a2 gene (the type XI collagen a2 chain gene) (Col11a2-EGFP-IRES-Puro, see
(110) Optimization of Induction of Differentiation Toward Chondrocytes
(111) Ten to fifteen days after the start of maintenance culture under feeder-free conditions, the medium of the Col11a2 gene reporter iPS cells were exchanged with mesodermal medium (prepared by mixing DMEM/F12 with 10 ng/ml Wnt3A (R&D), 10 ng/ml Activin A (R&D), 1% insulin-transferrin-sodium selenite (Invitrogen), 1% fetal calf serum, 50 units/ml penicillin, and 50 mg/ml streptomycin). After three days of culture (day 3), one of the chondrogenic supplements with the formula (1) to (3) shown below was added to DMEM/F12 supplemented with 1% insulin-transferrin-sodium selenite, 1% FBS, 50 units/ml penicillin, and 50 mg/ml streptomycin. The cells were cultured until day 14 from the start of the differentiation induction. The 14-day culture process was performed by adherent culture. During day 3 to day 14, 10 ng/ml bFGF was added to promote the growth.
(112) (1) A: 50 g/ml ascorbic acid (Nakarai).
(113) (2) ABT: mixed solution of 50 g/ml ascorbic acid, 10 ng/ml BMP2 (Osteopharma) and 10 ng/ml TGF (PeproTech).
(114) (3) ABTG: 50 g/ml ascorbic acid, 10 ng/ml BMP2 (Osteopharma), 10 ng/ml TGF (PeproTech) and 10 ng/ml GDF5.
(115) The cultures were examined under a phase-contrast microscope on day 14 (
(116) The terms day 0, day 3, day 10, day 14, day 15, day 21, day 28, day 42, day 52, day 56, day 70 and day 140 as used herein to indicate the culture period for the differentiation induction step mean the start of the differentiation induction, day 3 after the start of the differentiation induction, day 10 after the start of the differentiation induction, day 14 after the start of the differentiation induction, day 15 after the start of the differentiation induction, day 21 after the start of the differentiation induction, day 28 after the start of the differentiation induction, day 42 after the start of the differentiation induction, day 52 after the start of the differentiation induction, day 56 after the start of the differentiation induction, day 70 after the start of the differentiation induction, and day 140 after the start of the differentiation induction, respectively.
(117) On day 14 after the start of the differentiation induction, the cell nodules were separated from the dishes by pipetting, transferred to petri dishes, and suspension culture was performed in the same medium. The cell nodules were easily separated due to the decrease in the adhesion ability by the action of the chondrocyte extracellular matrix (ECM). The medium was changed every 2 to 7 days. RNAs were extracted from the particles on day 28 after the start of the differentiation induction, and subjected to real-time PCR analysis of the expressions of chondrocyte marker genes (
(118) The above results revealed that the ABTG-supplemented medium most efficiently produced chondrocytes in the adherent culture step on day 3 to day 14 and the suspension culture step on day 14 to day 42. Based on this, ABTG supplementation was used in the subsequent experiments.
(119) The same protocol performed showed that chondrocytes could also be generated from other human iPS cell lines (409B2, HDF-11, KF4009-1 and 604B1 cell lines) (day 42).
(120) Two types of chondrocytes were generated either by the conventional suspension culture (micromass formation) for chondrogenic induction (Sci Rep. 3, 1978 (2013)) or the protocol of the present invention involving the mesoderm induction on day 0 to day 3 of culture (adherent culture in a medium supplemented with Wnt3A and Activin A). The RT-PCR analysis of chondrocyte marker genes for comparison of the chondrocytes showed that significantly higher expressions of the marker genes in the protocol of the present invention involving the mesoderm induction (
(121) Analysis of Particles
(122) The iPS cells were subjected to induction by the cell differentiation culture protocol as represented in
(123) Effects of Suspension Culture
(124) Suspension culture was performed after day 14 according to the protocol of the present invention. Separately, adherent culture was continued beyond day 14, and poor cartilage formation was observed on day 42 (
(125) Time-Course Analysis of Induction of Chondrogenic Differentiation
(126) The protocol of the present invention mimics the developmental path way from the mesoderm to chondrocytes in living bodies, not using chondrogenic medium from the beginning of cell differentiation culture, and in this protocol, mesodermal medium was used instead of chondrogenic medium on day 0 to day 3. At the time of medium exchange, time-course analysis of the cells was performed at various intervals from the start of the differentiation induction using pluripotent markers, mesoderm markers and chondrocyte markers to examine the changes of the human iPS cells during differentiation culture. The analysis results are shown in
(127) After the analysis on day 0, the addition of Wnt3a and Activin A in mesodermal medium decreased the expressions of pluripotent markers and transiently increased the expression of a marker specific to early stage mesoderm, BRACHYURY, in the cells on day 3. After switching the mesodermal medium to chondrogenic medium on day 3, the expressions of pluripotent markers further decreased from days 7 through 14, while the expression level of a marker specific to mesoderm, KDR, transiently increased on day 7. Culture of the particles were further continued, and the expression levels of markers specific to chondrocytes or the extracellular matrix, such as AGGRECAN, COL2A1 and LUBRICIN, exceeded the expression levels in articular cartilage as a positive control. Unlike articular cartilage as a positive control, the expressions of cartilage hypertrophy markers, IHH and COL10A1, were very low.
(128) The live cell numbers were counted at various intervals and the time course was analyzed (
(129) The average number of particles was 14.63.96 per dish. The average diameter of the particles was 0.690.2 mm on day 21, 0.80.16 mm on day 28, 1.130.18 mm on day 42, and 1.40.47 mm on day 70.
(130) The amount of FBS used in this protocol was the minimum amount that provides the essential amount of growth factors required for chondrocyte survival. The non-chondrocytic cells might die under these conditions and drop out from the particles. As a result of the accumulation of non-chondrocytic cells on the dish bottoms and the harvest of floating particles, pure chondrocytes are successfully obtained without the use of cell sorting. Chondrocytes are lubricious and easily separated from the bottom of the dishes to be transferred from adherent culture to suspension culture. On the other hand, non-chondrocytic cells strongly adhere to the dish bottoms. Due to the difference in adhesive strength, pure chondrocytes are successfully separated from non-chondrocytic cells.
(131) Assessment of Tumor Formation in Mice
(132) For analysis of the in vivo activity of the human iPS cell-derived chondrocytes produced as above, the day-42 chondrocytes were injected into the subcutaneous space of SCID mice. A histochemical analysis 12 weeks after injection revealed the formation of cartilaginous tissues in four out of six injection sites (
(133) No human -actin mRNA was detected in the tissues and lymph nodes of the SCID mice, including cervix, peritoneal cavity, axillary lymph nodes, groin lymph nodes. The results deny the possibility of metastasis formation (
(134) Long-Term Assessment In Vivo
(135) Day-42 chondrocytes were injected into the subcutaneous space of SCID mice in the same manner as above, the transplanted sites were harvested 12 months after transplantation, and the harvested sites were subjected to histochemical analysis. All six samples showed partial cartilage hypertrophy, as indicated by the expression of type X collagen (
(136) Transplantation of Human iPS Cell-Derived Chondrocytes
(137) Shallow defect sites were created in the articular cartilage of the SCID rats, and the human iPS cell-derived chondrocytes obtained on day 42 were transplanted into the defect sites. The mature chondrocyte particles obtained on day 42 were lubricious and unsuitable for transplantation into the shallow defect sites in the articular cartilage of the rats, and accordingly the chondrocyte particles obtained on day 28 were used. In three of four knee joints subjected to transplantation, the transplanted cells were survived 4 weeks after transplantation, as indicated by histological staining (