Hexokinase 2-specific inhibitors for use in acute central nervous system injury
11584802 · 2023-02-21
Assignee
Inventors
- Guangmei Yan (Guangdong, CN)
- Wei Yin (Guangdong, CN)
- Yuan Li (Guangdong, CN)
- Bingzheng Lu (Guangdong, CN)
- Longxiang Sheng (Guangdong, CN)
Cpc classification
A61K45/06
HUMAN NECESSITIES
A61K45/00
HUMAN NECESSITIES
A61K31/416
HUMAN NECESSITIES
A61K31/506
HUMAN NECESSITIES
A61K31/7004
HUMAN NECESSITIES
A61K31/416
HUMAN NECESSITIES
A61K31/7004
HUMAN NECESSITIES
A61K31/7105
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
International classification
A61K45/06
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Provided are applications of a hexokinase 2-specific inhibitor in preparing a medicament for preventing and treating acute central nervous system injury.
Claims
1. A method for treatment of acute central nervous system injury mediated by microglia activation, comprising administering to a subject a pharmaceutically effective amount of lonidamine, wherein the acute central nervous system injury mediated by microglia activation comprises acute ischemic brain injury, ischemic stroke, acute cerebral infarction or lacunar infarction.
2. The method of claim 1, wherein the lonidamine is comprised in a composition.
3. The method of claim 2, wherein the composition further comprises one or more compounds selected from a group consisting of 2-deoxyglucose, bromopyruvic acid, glucose 6-phosphate, Imatinib, 5-thio-glucose and methyl jasmonate.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
DETAILED DESCRIPTION OF THE INVENTION
(10) The invention is now described in reference to following embodiments which should not be constructed as limiting to the scope of the invention. Any equivalent changes or variation made in accordance with the principle or spirit of the invention is contemplated within the scope of the invention.
(11) In one aspect, the invention provides use of a hexokinase 2-specific inhibitor for the manufacture of a medicament for the prophylaxis and treatment of an acute central nervous system injury. The hexokinase 2-specific inhibitor as used herein refers to a substance capable of specifically or selectively inhibiting the biological activity of hexokinase 2 (also referred to as hexokinase II or HK2).
(12) In some embodiments, the hexokinase 2 specific inhibitor comprises an antibody to hexokinase 2 or a fragment thereof. The antibody refers to a protein capable of specifically binding to hexokinase 2 and inhibiting or quenching the activity of hexokinase 2. A fragment of antibody can include, for example, Fab, Fab′, (Fab′).sub.2, and Fv. The production and purification of antibodies or fragments thereof are known in the art.
(13) In some embodiments, a hexokinase 2 antibody of the invention may also exist in the form of an amino acid or nucleotide sequence encoding the antibody or an expression vector comprising the nucleotide or amino acid sequence. In some embodiments, the hexokinase 2 antibody described in the present invention may also be present in an expression vector or a host cell in the form of a fusion protein.
(14) In some embodiments, the hexokinase 2 specific inhibitor comprises a substance capable of specifically inhibiting translation of mRNA of hexokinase 2, or a substance capable of specifically degrading mRNA of hexokinase 2, such as siRNA, shRNA, miRNA or its modifications, thereby interfering with the synthesis of hexokinase 2 by the RNAi mechanism. siRNA, shRNA or miRNA can be obtained by in vitro synthesis techniques, which are well known in the art. In some embodiments, the siRNA, shRNA or miRNA described in the present invention is present in a particular vector, such as in a cell.
(15) In some embodiments, the acute central nervous system injury refers to a disease or condition of central nervous system damage caused by acute ischemia or hypoxia, including but not limited to, encephalon/spinal damage caused by acute spinal injury, brain trauma, retinal damage, hypoxic brain injury, acute ischemic brain injury, ischemic stroke, hypoxic stroke, neonatal hypoxic ischemic encephalopathy, toxic encephalopathy, acute cerebral infarction, lacunar infarction, transient ischemic attack, severe craniocerebral injury, cerebrospinal surgery and encephalon/spinal radiotherapy.
(16) In another aspect, the invention provides use of a composition comprising a hexokinase 2-specific inhibitor for the manufacture of a medicament for the prophylaxis and treatment of an acute central nervous system injury disease.
(17) In some embodiments, the hexokinase 2 specific inhibitors comprised in the composition are those as described above, and the composition may further comprise other hexokinase 2 inhibitors, including but not limited to, 2-deoxyglucose, Lonidamine, bromo-pyruvic acid, glucose 6-phosphate, Imatinib, 5-thio-glucose and methyl jasmonate.
(18) A further aspect of the invention provides a method of preventing and treating an acute central nervous system injury, the method comprising administering to a subject in need thereof a prophylactically effective amount or a therapeutically effective amount of a hexokinase 2 specific inhibitor or a composition comprising a hexokinase 2 specific inhibitor.
(19) In some embodiments, the subject is a mammalian subject, such as a human. The administration is performed subcutaneously, transdermally, intramuscularly, intravenously, intraarterially, sublingually, buccally, gastrointestinally or the like to a e.g. human subject. In some embodiments, a hexokinase 2 specific inhibitor (e.g., in nucleic acid form) can be administered to a subject being treated or prevented by gene therapy.
(20) A further aspect of the present invention provides a method for preventing and treating an acute central nervous system injury, comprising selectively or specifically reducing or inactivating the activity of hexokinase 2 in a subject in need thereof. That reducing or inactivating the activity of hexokinase can be achieved, for example, by genetic engineering measures to reduce or eliminate the expression of the hexokinase 2 protein. An exemplary measure is to alter the hexokinase 2-encoding nucleotide sequence by site directed mutagenesis. Another exemplary means is interfering of the translation process of mRNA of hexokinase 2 by RNAi technology. Any method known to those skilled in the art to reduce the expression of a particular protein in a cell is contemplated for use in the methods of the invention.
EXAMPLES
(21) The materials and methods employed in the present invention are conventional materials and methods, unless otherwise specified.
Example 1. Enhanced Glycolytic Flux is Essential for Hypoxia-Induced Microglial Activation
(22) Materials
(23) Mouse BV2 microglia cells, Dulbecco's modified Eagle's medium (DMEM, Gibco, 11965-118), fetal bovine serum (Gibco, 10099-141), 2-deoxy-D-glucose (Sigma-Aldrich, D8375), 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxy-D-glucose (2-NBDG, Thermo Fisher Scientific, N13195), Annexin/PI detection kit (Biotool, B32115), flow cytometer (CytoFLEX S), laser scanning confocal microscope (Nikon A1 Spectral Confocal Microscope), anoxic chamber (Coy Laboratory Products).
(24) Antibodies used in Western blot and immunofluorescence:
(25) CD 11b antibody (Novus biologicals, NB 110-89474);
(26) TNF-α antibody (CST, 11498);
(27) IL-1β antibody (CST, 12507);
(28) IL-6 antibody (Bioss, bs-6309R);
(29) α-Tubulin antibody (Bioworld, AP0064).
(30) Methods
(31) a) Cell culture: BV2 cells were grown in DMEM containing 10% fetal bovine serum (FBS), placed in 5% CO.sub.2, cultured in a 37° C. constant temperature incubator (relative humidity was 95%), and observed under inverted microscope. Passage was performed approximately 2-3 days, and logarithmic growth phase cells were used for formal experiments. The cells in the hypoxic treatment group were placed in the Coy anoxic chamber with 1% 02, 5% CO.sub.2, and 94% N2; other conditions were the same as normal culture conditions.
(32) b) Protein extraction and proinflammatory cytokine protein expression assay: After incubated in 35 mm culture dishes and placed for 24 hours, the cells were subject to hypoxia treatment for indicated time. The total cellular protein was then extracted to detect protein expression of the proinflammatory cytokines TNF-α, IL-1β and IL-6.
(33) c) CD 11b expression detected by Immunofluorescence: BV2 cells were seeded in a laser confocal-specific culture plate, and treated with hypoxia for 24 hours, fixed in 4% paraformaldehyde at room temperature for 20 minutes, and then washed three times with PBST for 5 minutes each time. After washing, CD 11b antibody diluted with DAKO antibody dilution was added and incubated overnight at 4° C. The next day, the samples were incubated with indicated fluorescently labeled secondary antibody at 37° C. for 1 hour. After the incubation, DAPI working solution was added for nuclear staining for 10 minutes. Samples were then washed three times with PBST and imaged using a laser confocal microscope.
(34) d) 2-NBDG uptake assay: BV2 cells were seeded in a 96-well plate culture plate (black on the sides, transparent at the bottom) and cell medium was replaced with DPBS buffer containing 200 μM 2-NBDG after 24 hours. Cells were then cultured in normoxic or hypoxic conditions. After 1 hour of incubation, the medium was exchanged for fresh DPBS. Finally, images were captured and 2-NBDG uptake was quantified with a fluorescence microplate assay.
(35) e) Annexin/PI staining: Cells were seeded in a 35 mm culture dish and cultured for 24 hours, and then cultured in hypoxic condition for 24 hours. The cells were harvested with 0.25% trypsin and stained by Annexin and PI dyes following the instructions provided by the manufacturer. Flow cytometry analysis was performed after 30 minutes to detect whether hypoxia caused cell death.
(36) f) Metabolite extraction and profiling: BV2 cells were seeded in a 60 mm culture dishes and cultured for 24 hours and then cultured in normoxic or hypoxic conditions for 6 hours. For metabolite profiling, metabolites were extracted using 1.5 mL of ice-cold 80% methanol. After incubation at −80° C. for 30 minutes, cells were scrapped and centrifuged at 14, 000 g for 15 minutes at 4° C. The upper methanol/water phase were transferred into new tubes and incubated at −80° C. for another 30 minutes. The upper phases were centrifuged and dried under nitrogen gas and dried samples were stored at −80° C. prior to LC-MS analysis.
(37) Results
(38) As shown in
(39) Aerobic glycolysis pathway in BV2 cells were significantly elevated after hypoxia exposure. As depicted in
Example 2. Upregulation of Hexokinase Family Members was Involved in the Microglial Activation after Hypoxia Exposure
(40) Materials
(41) Mouse BV2 microglia cell line, primary cultured mouse microglia, high glucose DMEM medium (Gibco, 11965-118), fetal bovine serum (Gibco, 10099-141), RNA extraction reagent TRIzol (Thermo Fisher Scientific, 15596-018), RNA quantification kit (Thermo Fisher Scientific, Q10211), SuperReal qPCR PreMix (SYBR Green) (Tiangen, FP202-01), real-time PCR system (Applied Biosystems), anoxic chamber (Coy Laboratory Products)
(42) Antibodies used in Western blotting:
(43) Hexokinase 1 antibody (Abcam, 150423),
(44) Hexokinase 2 antibody (CST, 2867s),
(45) Hexokinase 3 antibody (Santa Cruz, sc-28890),
(46) α-Tubulin antibody (Bioworld, AP0064).
(47) The following mouse gene primer sequences were used in real-time PCR.
(48) TABLE-US-00001 Primers Forward Reverse HK1 GTAGGGGTACGCTTAGGTGG ACCCAGGAGTCCATAAAGCC HK2 GAGAAAGCTCAGCATCGTGG TCCATTTGTACTCCGTGGCT HK3 GCTCCGTTGAGAGCAGATTT TTGCTGCAAGCATTCCAGTT PFKM GTTTGGAAGCCTCTCCTCCTC GACGGCAGCATTCATACCTT PFKL CGCAAGGTATGAATGCTGCT CGATGGTCAAGTGTGCGTAG PGK1 CGAGCCTCACTGTCCAAACT GTCTGCAACTTTAGCGCCTC PKM1 CGTCCGCAGGTTTGATGAGA TTCAAACAGCAGACGGTGGA PKM2 GGCTCCTATCATTGCCGTGA AAGGTACAGGCACTACACGC Actb TGAGCTGCGTTTTACACCCT TTTGGGGGATGTTTGCTCCA
(49) Methods
(50) a) Cell culture: BV2 cells were grown in DMEM containing 10% fetal bovine serum (FBS), placed in 5% CO.sub.2, cultured in a 37° C. constant temperature incubator (relative humidity was 95%), and observed under inverted microscope. Passage was performed approximately 2-3 days, and logarithmic growth phase cells were used for formal experiments.
(51) For the isolation and culture of primary microglia, cells were isolated from newborn C57BL/6J mice. Briefly, cerebral cortices devoid of meninges and blood vessels were dissociated from P0-2 mice and digested by 0.125% trypsin at 37° C. for 15 minutes. The digestion was terminated by addition of DMEM containing 10% FBS and isolated single cells were seeded in culture dishes. After the mixed cultures became confluent, microglia were separated from other cell types by slight shaking and purification was identified by the microglial-specific marker CD 11b.
(52) b) Total protein extraction and hexokinase family proteins expression assay: Cells were seeded in 35 mm culture dishes for 24 hours, and stimulated with hypoxia for indicated time. The total protein was then extracted to detect protein expressions of the hexokinase family.
(53) Results
(54) After 6 hours of hypoxia, an overall up-regulation of the mRNA levels of these enzymes was detected. All three HK isoforms tested exhibited significantly increased mRNA expression (
Example 3 Hexokinase 2, Instead of Other Hexokinase Family Members, Mediated Hypoxia-Induced Activation of Microglia
(55) (1) Hexokinase 2 Interference could Effectively Inhibit the Hypoxia-Induced Activation Process of Microglia
(56) Materials
(57) Mouse BV2 microglia cell line, primary cultured mouse microglia, high glucose DMEM medium (Gibco, 11965-118), fetal bovine serum (Gibco, 10099-141), siRNA fragments, siRNA transfection reagent (Lipofectamine RNAiMAX Reagent, Thermo Fisher Scientific, 13778-500), inverted phase contrast microscope (Nikon ECLIPSE Ti Microscope), laser confocal microscope (Nikon A1 Spectral Confocal Microscope), anoxic chamber (Coy Laboratory Products).
(58) Antibodies used in Western blotting:
(59) Hexokinase 1 antibody (Abcam, 150423),
(60) Hexokinase 2 antibody (CST, 2867s),
(61) Hexokinase 3 antibody (Santa Cruz, sc-28890),
(62) CD 11b antibody (Novus biologicals, NB 110-89474),
(63) α-Tubulin antibody (Bioworld, AP0064).
(64) Methods
(65) a) Cell culture: BV2 cells were grown in DMEM containing 10% fetal bovine serum (FBS), placed in 5% CO.sub.2, cultured in a 37° C. constant temperature incubator (relative humidity was 95%), and observed under inverted microscope. Passage was performed approximately 2-3 days, and logarithmic growth phase cells were used for formal experiments.
(66) b) RNA interference: Cells were seeded in a 35 mm culture dish for 24 hours. Short-interfering RNAs (siRNAs) were transfected with RNAiMAX Reagent. Scrambled RNA was used as a control. In total, 50 nM siRNAs were transfected into the cultures, and after 12 hours, the medium was replaced with fresh medium. Cells were then stimulated with hypoxia for 24 hours to detect the expression level of the indicated proteins.
(67) Results
(68) As shown in
(69) (2) Hexokinase 1 and Hexokinase 3 Interference could not Inhibit Hypoxia-Induced Activation of Microglia
(70) Materials
(71) Mouse BV2 microglia cell line, high glucose DMEM medium (Gibco, 11965-118), fetal bovine serum (Gibco, 10099-141), siRNA fragments, siRNA transfection reagent (Lipofectamine RNAiMAX Reagent, Thermo Fisher Scientific, 13778-500), inverted phase contrast microscope (Nikon ECLIPSE Ti Microscope), laser confocal microscope (Nikon A1 Spectral Confocal Microscope), anoxic chamber (Coy Laboratory Products).
(72) Antibodies used in Western blotting: Hexokinase 1 antibody (Abcam, 150423), Hexokinase 2 antibody (CST, 2867s), Hexokinase 3 antibody (Santa Cruz, sc-28890),
(73) α-Tubulin antibody (Bioworld, AP0064).
(74) Methods
(75) a) Cell culture: BV2 cells were grown in DMEM containing 10% fetal bovine serum (FBS), placed in 5% CO.sub.2, cultured in a 37° C. constant temperature incubator (relative humidity was 95%), and observed under inverted microscope. Passage was performed approximately 2-3 days, and logarithmic growth phase cells were used for formal experiments.
(76) b) RNA interference: Cells were inoculated to a 35 mm culture dish for 24 hours. Short-interfering RNAs (siRNAs) were transfected with RNAiMAX Reagent. Scrambled RNA was used as a control. In total, 50 nM siRNAs were transfected into the cultures, and after 12 hours, the medium was replaced with fresh medium. Cells were then stimulated with hypoxia for 24 hours to detect the expression level of the indicated proteins.
(77) Results
(78) As shown in
(79) (3) Pyruvate Kinase M2 Subtype (PKM2) Interference could not Inhibit Hypoxia-Induced Activation of Microglia
(80) Materials
(81) Mouse BV2 microglia cell line, high glucose DMEM medium (Gibco, 11965-118), fetal bovine serum (Gibco, 10099-141), siRNA fragments, siRNA transfection reagent (Lipofectamine RNAiMAX Reagent, Thermo Fisher Scientific, 13778-500), inverted phase contrast microscope (Nikon ECLIPSE Ti Microscope), laser confocal microscope (Nikon A1 Spectral Confocal Microscope), anoxic chamber (Coy Laboratory Products).
(82) Antibodies used in Western blotting: PKM2 antibody (Abcam, 150423), CD 11b antibody (Novus biologicals, NB 110-89474), α-Tubulin antibody (Bioworld, AP0064).
(83) Methods
(84) a) Cell culture: BV2 cells were grown in DMEM containing 10% fetal bovine serum (FBS), placed in 5% CO.sub.2, cultured in a 37° C. constant temperature incubator (relative humidity 95%), and observed under inverted microscope. Passage was performed approximately 2-3 days, and logarithmic growth phase cells were used for formal experiments.
(85) b) RNA interference: Cells were inoculated to a 35 mm culture dish for 24 hours. Short-interfering RNAs (siRNAs) were transfected with RNAiMAX Reagent. Scrambled RNA was used as a control. In total, 50 nM siRNAs were transfected into the cultures, and after 12 hours, the medium was replaced with fresh medium. Cells were then stimulated with hypoxia for 24 hours to detect the expression level of the indicated proteins.
(86) Results
(87) Results showed PKM2 protein expression exhibited transient increases in hypoxia-stimulated BV 2 cells (
(88) (4) Lonidamine, a Hexokinase 2 Inhibitor, was Effective to Inhibit the Activation of Microglia Induced by Hypoxia.
(89) Materials
(90) Mouse BV2 microglia cell line, primary cultured mouse microglia, high glucose DMEM medium (Gibco, 11965-118), fetal bovine serum (Gibco, 10099-141), Lonidamine (Selleck, S2610), inverted phase contrast microscope (Nikon ECLIPSE Ti Microscope), laser confocal microscope (Nikon A1 Spectral Confocal Microscope), anoxic chamber (Coy LABORATORY PRODUCTS). Antibodies used in Western blotting: CD 11b antibody (Novus biologicals, NB 110-89474), α-Tubulin antibody (Bioworld, AP0064).
(91) Methods
(92) a) Cell culture: BV2 cells were grown in DMEM containing 10% fetal bovine serum (FBS), placed in 5% CO.sub.2, cultured in a 37° C. constant temperature incubator (relative humidity was 95%), and observed under inverted microscope. Passage was performed approximately 2-3 days, and logarithmic growth phase cells were used for formal experiments.
(93) For the isolation and culture of primary microglia, cells were isolated from newborn C57BL/6J mice. Briefly, cerebral cortices devoid of meninges and blood vessels were dissociated from P0-2 mice and digested by 0.125% trypsin at 37° C. for 15 minutes. The digestion was terminated by addition of DMEM containing 10% FBS and isolated single cells were seeded in culture dishes. After the mixed cultures became confluent, microglia were separated from other cell types by slight shaking and purification was identified by the microglial-specific marker CD 11b.
(94) b) CD 11b expression detected by Immunofluorescence: BV2 cells were seeded in a laser confocal-specific culture plate, and treated with hypoxia for 24 hours, fixed in 4% paraformaldehyde at room temperature for 20 minutes, and then washed three times with PBST for 5 minutes each time. After washing, CD 11b antibody diluted with DAKO antibody dilution was added and incubated overnight at 4° C. The next day, the samples were incubated with indicated fluorescently labeled secondary antibody at 37° C. for 1 hour. After the incubation, DAPI working solution was added for nuclear staining for 10 minutes. Samples were then washed three times with PBST and imaged using a laser confocal microscope.
(95) Results
(96) Hypoxia stimulation led to profound morphological changes in BV 2 and pMG cells, as well as an enhanced expression of CD 11b (
Example 4 Hexokinase 2 Induction LED to Increased Histone Acetylation and Translational Activation of Il1b
(97) Materials
(98) Mouse BV2 microglia cell line, primary cultured mouse microglia, high glucose DMEM medium (Gibco, 11965-118), fetal bovine serum (Gibco, 10099-141), lonidamine (Selleck, S2610), 3-bromopyruvate (Sigma, 16490), RNA extraction reagent TRIzol (Thermo Fisher Scientific, 15596-018), RNA quantification kit (Thermo Fisher Scientific, Q10211), SuperReal qPCR PreMix (SYBR Green) (Tiangen, FP202-01), real-time PCR system (Applied Biosystems), chromatin immunoprecipitation kit (Millipore, 17-245), anoxic chamber (Coy Laboratory Products), inverted phase contrast microscope (Nikon ECLIPSE Ti Microscope). Antibodies used in Western blot: acetyl-Histone H3 antibody (Millipore, 06-599); acetyl-Histone H4 antibody (Millipore, 06-866); α-Tubulin antibody (Bioworld, AP0064).
(99) Methods
(100) a) Cell culture: BV2 cells were grown in DMEM containing 10% fetal bovine serum (FBS), placed in 5% CO.sub.2, cultured in a 37° C. constant temperature incubator (relative humidity was 95%), and observed under inverted microscope. Passage was performed approximately 2-3 days, and logarithmic growth phase cells were used for formal experiments.
(101) For the isolation and culture of primary microglia, cells were isolated from newborn C57BL/6J mice. Briefly, cerebral cortices devoid of meninges and blood vessels were dissociated from P0-2 mice and digested by 0.125% trypsin at 37° C. for 15 minutes. The digestion was terminated by addition of DMEM containing 10% FBS and isolated single cells were seeded in culture dishes. After the mixed cultures became confluent, microglia were separated from other cell types by slight shaking and purification was identified by the microglial-specific marker CD 11b.
(102) b) Total protein extraction and acetylated histone expression assay: Cells were incubated in a 35 mm culture plate for 24 hours, and stimulated with hypoxia for indicated time. The total protein was then extracted to detect protein expressions of acetylated histone.
(103) c) Metabolite profiling: BV2 cells were seeded in a 60 mm culture dish and cultured for 24 hours and then cultured in normoxic or hypoxic conditions for 6 hours. Metabolites were extracted using 1.5 mL of ice-cold 80% methanol. After incubation at −80° C. for 30 minutes, cells were scrapped and centrifuged at 14, 000 g for 15 min at 4° C. The upper methanol/water phase were transferred into new tubes and incubated at −80° C. for another 30 minutes. The upper phases were centrifuged and dried under nitrogen gas and dried samples were stored at −80° C. prior to LC-MS analysis.
(104) d) Chromatin immunoprecipitation (ChIP) assay: BV 2 cells were treated with dimethylsulfoxide or lonidamine for 1 hour prior to 6 hours hypoxic exposure. Then, cells were cross-linked with a 1% formaldehyde solution (Sigma, F8775) for 10 minutes at 37° C. Cell lysates were sonicated to generate 100-1000 bp DNA fragments. Samples were diluted, and 10% of the total amount was retained for input. The remaining portions of each sample were pre-cleared, and anti-H3 or anti-H4 antibodies were added; a normal rabbit IgG antibody was simultaneously used as the negative control. The next day, protein G agarose was added and samples were washed after 2 hours of incubation. Cross-links were then reversed by incubation at 65° C. for 4 hours in 0.2 M NaCl. DNAs were extracted from the input and IP samples, and qPCR assays were performed. The Il1b promoter primer sequences were as follows: 5′-AGGTCAAAGGTTTGGAAGCAG-3′ (forward) (SEQ ID NO. 19) and 5′-ATGGAAGTCTGTCTGCTCAGTATTG-3′ (reverse) (SEQ ID NO. 20).
(105) Results
(106) As shown in
(107) Next, quantitative reverse transcription polymerase chain reaction assays were performed to examine the mRNA levels of several proinflammatory cytokines in the presence or absence of HK2 inhibitors. Lonidamine (50 μM) and 3-BrPA (10 μM) dramatically inhibited hypoxia-induced Il1b expression at the mRNA level but had no effect on Tnfa and 116 expression. Chromatin immunoprecipitation assays were carried out to examine endogenous binding of acetylated histones to Il1b promoter. The binding of AcH3 and AcH4 to the Il1b promoter increased during hypoxia, whereas it could be decreased by pretreatment with lonidamine (
Example 5. Hexokinase 2 Blockade Prevented Ischemic Brain Injury Through Repressing Microglia-Mediated Neuroinflammation in an Experimental Stroke Model
(108) (1) Lonidamine Protected the Brain from Ischemic Injury in a Rat MCAo Model
(109) Materials
(110) Lonidamine (Selleck, S2610), healthy male SPF Spague-Dawley (SD) rats, 2,3,5-TriphenylTetrazolium Chloride (TTC) (analytically pure), chloral hydrate (analytical grade) (purchased from Tianjin Kemiou Chemical Reagent Co., Ltd.), MCAo nylon monofilament.
(111) Methods
(112) a) Middle Cerebral Artery Occlusion (MCAO) model was established by intraluminal thread technique from the right Internal Carotid Artery. Before surgery, SD rats were fasted for 12 hours, but with free access to drinking water. Animals were anesthetized by intraperitoneal injection of 10% chloral hydrate, and placed in a supine position on a 37° C. thermostatic operating table to maintain a smooth breathing. Under the operating microscope, the right CCA was exposed through a midline incision and occluded with a microvascular clip. The right external carotid artery was exposed and ligated at the distal end. A loose knot was made between the right common carotid artery bifurcation and the anterior external carotid artery ligature. The right internal carotid artery was dissected and clamped with a microvascular clip. A microscopic ophthalmic surgical scissors was used to cut a small opening between the two ligatures, and the nylon thread was insert down to the common carotid artery. Then the loose knot was tightened, and the right external carotid artery was cut under the distal ligation of the external carotid artery but above the suture insertion point. The microvascular clip at the internal carotid artery was then withdrawn, and the insertion end of the thread was placed at the bifurcation of the right common carotid artery. The external carotid artery was pulled outward and downward so that it was in line with the internal carotid artery. A nylon monofilament suture was inserted into the internal carotid artery until a mild resistance was felt. To prevent bleeding, the thread was tightened. The microvascular clip was withdrawn and the incision was sutured. Two hours after the operation, lonidamine or the indicated solvent control was administered at 10 mg/kg, and then the thread was withdrawn, and the cerebral infarction volume was measured 24 hours after the perfusion.
(113) b) Infarct volume measurement: The rats were decapitated and brains were quickly removed and placed in iced saline for 10 minutes. Brain tissues were frozen and sliced into coronal sections (2-mm thick). The sections were then incubated in 1.0% 2,3,5-triphenyltetrazolium chloride (TTC) at 37° C. for 30 minutes and fixed in a 4.0% paraformaldehyde solution overnight. For each coronal slice, the infarct tissue (unstained area) and total bihemispheric area were delineated in the scanned image with Adobe Photoshop CS6. The infarcted volume was calculated as the ratio of the total unstained areas (white) over the total bihemispheric area.
(114) Results
(115) As shown in
(116) (2) In Vivo Hexokinase 2 Knockdown Effectively Protected Rats from Brain Damage in a Rat MCAo Model
(117) Materials
(118) Lonidamin (Selleck, S2610), healthy male SPF Spague-Dawley (SD) rats, 2,3,5-TriphenylTetrazolium Chloride (TTC) Analytically pure, chloral hydrate (analytical grade) (purchased from Tianjin Kemiou Chemical Reagent Co., Ltd.), MCAo nylon suture, recombinant adeno-associated virus serotype 9 carrying shHK2 fragment (rAAV-shHK2), recombinant adeno-associated virus serotype 9 carrying scrambled control fragments (rAAV-shNC), immunohistochemistry kit (Abcam, ab80436), brain stereotaxic system, inverted phase contrast microscope (Nikon ECLIPSE Ti Microscope), laser confocal microscope (Nikon A1 Spectral Confocal Microscope).
(119) Methods
(120) a) Middle Cerebral Artery Occlusion (MCAO) model was established by intraluminal thread technique from the right Internal Carotid Artery. Before surgery, SD rats were fasted for 12 hours, but with free access to drinking water. Animals were anesthetized by intraperitoneal injection of 10% chloral hydrate, and placed in a supine position on a 37° C. thermostatic operating table to maintain a smooth breathing. Under the operating microscope, the right CCA was exposed through a midline incision and occluded with a microvascular clip. The right external carotid artery was exposed and ligated at the distal end. A loose knot was made between the right common carotid artery bifurcation and the anterior external carotid artery ligature. The right internal carotid artery was dissected and clamped with a microvascular clip. A microscopic ophthalmic surgical scissors was used to cut a small opening between the two ligatures, and the nylon thread was insert down to the common carotid artery. Then the loose knot was tightened, and the right external carotid artery was cut under the distal ligation of the external carotid artery but above the suture insertion point. The microvascular clip at the internal carotid artery was then withdrawn, and the insertion end of the thread was placed at the bifurcation of the right common carotid artery. The external carotid artery was pulled outward and downward so that it was in line with the internal carotid artery. A nylon monofilament suture was inserted into the internal carotid artery until a mild resistance was felt. To prevent bleeding, the thread was tightened. The microvascular clip was withdrawn and the incision was sutured. Two hours after the operation, lonidamine or the indicated solvent control was administered at 10 mg/kg, and then the thread was withdrawn, and the cerebral infarction volume was measured 24 hours after the perfusion.
(121) b) Infarct volume measurement: The rats were decapitated and brains were quickly removed and placed in iced saline for 10 minutes. Brain tissues were frozen and sliced into coronal sections (2-mm thick). The sections were then incubated in 1.0% 2,3,5-triphenyltetrazolium chloride (TTC) at 37° C. for 30 minutes and fixed in a 4.0% paraformaldehyde solution overnight. For each coronal slice, the infarct tissue (unstained area) and total bihemispheric area were delineated in the scanned image with Adobe Photoshop CS6. The infarcted volume was calculated as the ratio of the total unstained areas (white) over the total bihemispheric area.
(122) c) Recombinant adeno-associated virus (rAAV) vectors were produced in 293T cells. The genomic titers of the viruses ranged from 3.2×10.sup.12 to 3.5×10.sup.12 V.G./mL, as determined by qPCR. To construct the AAV2/9 vectors, the following sequences targeting HK2 were used: 5′-GCGCAACATTCTCATCGATTT-3′ (SEQ ID NO. 21) and 5′-AAATCGATGAGAATGTTGCGC-3′ (SEQ ID NO. 22). The control shRNA sequence was 5′-TTCTCCGAACGTGTCACGT-3′ (SEQ ID NO. 23). In total, 2 μL of the viral vectors were injected unilaterally into the striata of anesthetized rats fixed in a stereotaxic frame. The injection site coordinates were: 1.0 mm rostral to bregma, 3.0 mm lateral to the midline, and 4.5 mm ventral to the dura, with the tooth bar set to zero. Microinjections were carried out at a rate of 0.2 μL/minutes. After injection, the microsyringe remained in situ for an additional 5 minutes before being withdrawn.
(123) d) Tissue immunofluorescence was used to detect the distribution of virus in the brain (eGFP), and expressions of hexokinase 2 and Iba-1 (another molecular marker of microglia activation): After ischemia for 2 hours and reperfusion for 24 hours, the intact brain tissue was removed by anesthesia and embedded in paraffin-embedded to obtain sections. The thickness of the brain slices was approximately 4 μm. The brain slices were deparaffinized and hydrated, and subjected to antigen retrieval. Samples were incubated in indicated antibodies at 4° C. overnight. The next day, the fluorescently labeled secondary antibody was added and samples were incubated at 37° C. for 1 hour. After the incubation, DAPI working solution was added for nuclear staining for 10 minutes. At the end of the treatment, samples were washed three times with PBST and imaged using a laser confocal microscope.
(124) e) Immunohistochemical detection of IL-1β expression: After ischemia for 2 hours and reperfusion for 24 hours, the intact brain tissue was removed by anesthesia and embedded in paraffin-embedded to obtain sections. The thickness of the brain slices was approximately 4 μm. The brain slices were deparaffinized and hydrated, and subjected to antigen retrieval. Samples were incubated in indicated primary antibodies overnight at 4° C. The next day, samples were washed in phosphate-buffered saline, subjected to serial incubation in complement and a horseradish peroxidase (HRP) conjugate. After incubating for 15 minutes at room temperature, samples were incubated with DAB developing solution for 1 minute. Finally, samples were stained with hematoxylin and imaged using a Nikon microscope.
(125) Results
(126) Animal weights were monitored constantly, and no statistical significance was detected 20 days after rAAV9-shHK2 and rAAV9-shNC injections. (Animal weights in the AAV2/9-shNC and AAV2/9-shHK2 groups were 273.2±6.9 g and 269.3±5.0 g, respectively). Before surgery, whole-brain tissues from rats were collected to detect the spread of AAVs using in vivo optical imaging technology based on eGFP expression (
(127) As revealed in