URINE METABOLITE PROFILES IDENTIFY KIDNEY ALLOGRAFT STATUS
20180292384 ยท 2018-10-11
Inventors
Cpc classification
G01N2800/245
PHYSICS
C12Q2537/16
CHEMISTRY; METALLURGY
C12Q1/6876
CHEMISTRY; METALLURGY
G01N2400/00
PHYSICS
C12Q2537/16
CHEMISTRY; METALLURGY
C12Q1/6883
CHEMISTRY; METALLURGY
G01N2430/00
PHYSICS
International classification
Abstract
Methods and assay processes are described herein for identifying and treating subjects who have or will have dysfunction or rejection of a kidney transplant. The methods and assay procedures are noninvasive.
Claims
1. A method for analysis of a urine sample from a subject with a kidney transplant comprising: (a) assaying to measure a ratio of 3-sialyllactose xanthosine in the urine sample; (b) assaying to measure a ratio of quinolinate to X-6397 in the urine sample; and/or determining combined metabolite signature=1.1164*log(3-sialyllactose/xanthosine)+0.6937*log(quinolinate/X-16397), to thereby analyze the urine sample from the subject with the kidney transplant.
2. The method of claim 1, further comprising informing the subject of the combined metabolite signature.
3. The method of claim 1, further comprising treating the subject for allograft rejection.
4. The method of claim 1, further comprising treating the subject for allograft rejection when a log ratio of 3-sialyllactoose to xanthosine is greater than 0.55, or is equal or greater than 0.59836.
5. The method of claim 1, further comprising treating a subject for allograft rejection when a urine sample from the subject has a combined metabolite signature greater than 0.4, or is equal to or greater than 0.4271.
6. A method for analysis of a urine sample from a subject with a kidney transplant comprising: (a) assaying the urine sample to measure an absolute urinary CD3 mRNA copy number per microgram of total RNA in the urine sample, an absolute urinary IP-10 mRNA copy number per microgram of total RNA in the urine sample, and an absolute urinary 18S rRNA copy number per microgram of total RNA times 10.sup.6 in the urine sample; (b) assaying to measure a ratio of 3-sialyllactose to xanthosine in the urine sample; (c) assaying to measure a ratio of quinolinate to X-16397 in the urine sample; (d) determining an RNA signature=6.1487+0.8534 log.sub.10(CD3/18S)+0.6376 log.sub.10(IP-10/18S)+1.6464 log.sub.10(18S); (e) determining a metabolite signature=1.1164*log(3-sialyllactose/xanthosine)+0.6937*log(quinolinate/X-16397); and/or (f) identifying a composite diagnostic signature=RNA-signature+1.1164*log(3SL/X)+0.6937*log(quinolinate/X-16397); where: CD3 is an absolute urinary CDR mRNA copy number per microgram of total RNA in the urine sample; IP-10 is an absolute urinary IP-10 mRNA copy number per microgram of total RNA in the urine sample; and 18S is an absolute urinary 18S rRNA copy number per microgram of total RNA in the urine sample times 10.sup.6; to thereby analyze the urine sample from the subject with the kidney transplant.
7. The method of claim 6, further comprising informing the subject of the composite diagnostic signature.
8. The method of claim 6, further comprising treating the subject for allograft rejection.
9. The method of claim 6, further comprising treating the subject for allograft rejection when the urine sample has a combined diagnostic signature score above 0.45, or above 0.5, or equal to or above 0.5095.
10. A method comprising treating a subject for allograft rejection when a urine sample from the subject has a composite diagnostic signature above 0.45, or above 0.5, or equal to or above 0.5095; wherein: he composite diagnostic signature=mRNA-signature+164*log(3SL/X)+0.6937*log(quinolinate/X-16397); and the RNA signature=6.1487+0.8534 log.sub.10(CD3/18S)+0.6376 log.sub.10(IP-10/18S)+1.6464 log.sub.10(18S).
Description
DESCRIPTION OF THE FIGURES
[0015]
[0016]
[0017]
DETAILED DESCRIPTION
[0018] Methods and devices are described herein for detecting, monitoring, and predicting acute cellular rejection in a subject with a kidney transplant from levels of metabolites in the subject's urine. As described herein, noninvasive diagnosis of acute cellular rejection (ACR) of the kidney transplant can accurately be identified and/or predicted by measurement of just four metabolites. These methods and devices can be combined with a diagnostic method that involves quantification of just three RNA transcripts levels. The combination of measurement of just four metabolite levels and of just three RNA transcript levels in urine (estimated cost of the assay: $250 to 300) can reduce biopsy-associated costs and risks.
[0019] Described herein is the largest prospective study of metabolite profiling of urine from kidney graft recipients, and the first to investigate the diagnostic accuracy of a composite signature of metabolites and RNAs in urine. A combination of non-targeted LC-MS/MS and GC-MS based metabolomics platforms were used to analyze 1516 urine samples from 241 kidney allograft recipients. Metabolite signatures diagnostic of ACR were identified, including a metabolite signature relating to the ratio of 3-sialyllactose (3SL) to Xanthosine (X) and the ratio of quinolinate to X-16397 was complementary to the information content in the RNA signature.
[0020] A composite metabolite-RNA signature was diagnostic of ACR with high accuracy. The composite metabolite and RNA signature was diagnostic of ACR, for examples, in patients who underwent for-cause biopsies and in patients who underwent surveillance biopsies. Applied to urine samples taken four to 30 days collected prior to biopsy, the signatures developed using only biopsy matched urine samples predicted future ACR in pristine samples.
[0021] Multivariate machine learning techniques and non-linear fitting algorithms have been applied in biomarker searches. However, metabolites showing a strong association in a linear univariate model are generally the most robust candidate clinical biomarkers. Also, the more metabolites that enter a metabolomics-based signature, the higher are the chances that one of the measurements may fail (e.g., due to ion-suppression in the presence of other metabolites) and thereby invalidate the entire signature. Hence, more sophisticated biomarker discovery algorithms were not employed in the studies described herein.
[0022] Each year 15,000 or more kidney transplants are performed in USA alone, and with an estimated incidence of 0.4 biopsies/patient during the first year of transplantation, the charges for performing 7,000 or so biopsies in kidney graft recipients during the first year of transplantation alone can be estimated to be $21 million based the reported charge of $3,000 per biopsy. Collins et al., Am J Kidney Dis 59: A7, e1-420, 2012); Collins et al., Am J Kidney Dis 45: A5-7, S1-280 (2005).
Metabolites
[0023] As described in the Examples, 749 different metabolites from 65 metabolic pathways were detected in 4300 urine samples collected from the 485 kidney graft recipients. Some of these metabolites are highly useful indicators for detection of transplant rejection even before clinically significant rejection occurs.
[0024] As described herein for the first time, 3-sialyllactose is linked to kidney allograft rejection. The 3-sialyllactose molecule has CAS number 35890-38-1; and it is also called -NeuNAc-(2.fwdarw.3)--D-Gal-(1.fwdarw.4)-D-Glc, 3-N-Acetylneuraminyl-D-lactose sodium salt, 3-SL, 3-Sialyl-D-lactose, and NANA-Lactose.
[0025] A structure for 2,3-sialylactose is shown below.
##STR00001##
[0026] Although the 2,3-sialylactose form of 3-sialylactose is a major form, in some cases, the 3-sialyllactose compound can be linked to other positions of the lactose molecule. For example, the sialyl moiety can be linked via position 2 (as shown above), or via position 4, or via position 5, or via any of positions 7-9 of the sialyl moiety to the lactose molecule.
[0027] The 3-sialyllactose has an ion mass of 632.2 grams, and a retention index of 725.6 as detected under basic negative ion optimized conditions using a Waters ACQUITY UPLC and a Thermo-Finnigan LTQ mass spectrometer, having an electrospray ionization (ESI) source and linear ion-trap (LIT) mass analyzer.
[0028] Pro-inflammatory (e.g., stimulation of CD11c+ dendritic cells) as well as anti-inflammatory (e.g., inhibition of cholera toxin) properties have been ascribed to this sialylated component. Also, sialyllactose may represent a molecular recognition pattern for dendritic cell capture and contribute to alloantigen presentation and triggering of acute rejection. Their increased levels during ACR may represent aberrant membrane glycolipid metabolism in immune and/or kidney parenchymal cells.
[0029] Quinolinate has CAS number 89-00-9; and is also referred to as quinolinic acid, or pyridine-2,3-dicarboxylic acid. It is a dicarboxylic acid with a pyridine backbone, and is a colorless solid. It is the biosynthetic precursor to nicotine. The structure of quniolinate is shown below.
##STR00002##
[0030] Quinolinate has an ion mass of 296.1, and a retention index of 1697.7, when separating metabolites from urine sample using a Thermo-Finnigan Trace DSQ fast-scanning single-quadruple mass spectrometer using electron impact ionization and operated at unit mass resolving power (GC/MS).
[0031] Quinolinate is a product of tryptophan metabolism and is generated from kynurenine via a spontaneous, non-enzymatic reaction, and then oxidized by quinolinate phosphoribosyltransferase to nicotinic acid ribonucleotide, nicotinic acid adenine dinucleotide and nicotinamide adenine dinucleotide (NAD+). By serving as a precursor for the biosynthesis of NAD+, quinolinate may help meet the metabolic demands of activated immune cells contributing to ACR.
[0032] The X-16397 compound is readily identified by its ion mass, which is 248.1 g/mole, and its retention index, which is 2200.8 when separating metabolites from urine samples using acidic positive ion optimized conditions (Pos) and detection using a Waters ACQUITY UPLC and a Thermo-Finnigan LTQ mass spectrometer; having an electrospray ionization (ESI) source and linear ion-trap (LIT) mass analyzer (LC/MS Pos).
[0033] Xanthosine is also known as 9-[(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]-3H-purine-2,6-dione, xanthine riboside, bmse000128, 9-beta-D-ribofuranosylxanthine, beta-D-ribofuranoside, and xanthine-9. The structure of xanthosine is shown below.
##STR00003##
[0034] Xanthosine has an ion mass of 285 g/mole and a retention index of 1785 when separating metabolites from urine samples using acidic positive ion optimized conditions (Pos) and detection a Waters ACQUITY UPLC and a Thermo-Finnigan LTQ mass spectrometer, having an electrospray ionization (ESI) source and linear ion-trap (LIT) mass analyzer (LC/MS Pos).
[0035] Xanthosine is a nucleoside derived from the purine base xanthine and ribose. Xanthine monophosphate (XMP) is produced by inosine monophosphate dehydrogenase (IMPDH) and facilitates proliferation of T and B cells. IMPDH inhibition by mycophenolic acid (MPA) is one mechanism by which MPA reduces the incidence of acute rejection. A potential mechanism for the lower level of xanthosine during ACR is inefficient inhibition of IMPDH leading to efficient conversion of IMP to guanosine and consequent lack of substrate for xanthine biosynthesis.
Collection of Urine
[0036] Urine is collected from transplant recipients. Such transplant recipients can include any recipient of a transplanted organ. For example, in some instances the recipient received an HLA matched transplant organ from a living or deceased donor. Transplant organs can include kidneys, hearts, livers, lungs, pancreas, intestines, and combinations thereof. In some instances, the transplant is a kidney.
[0037] Urine is collected from a subject (e.g., fifty to 100 ml of midstream urine) in a sterile, sealed urine collection cup without addition of any preservatives. Urine can be processed within 1 hour of collection. If this was not possible, urine can be refrigerated at 4 C. for a maximum time of 4 hours. The urine sample can be centrifuged to separate urinary cells (that sediment) from metabolites (that do not sediment). For example, urine samples can be centrifuged at 2000 g at room temperature for 30 minutes in sterile disposable tubes. After centrifugation, both the supernatant and the pellet can be processed or stored at 80 C. The supernatant can be tested for metabolites of 3-sialyllactose (3SL), xanthosine (X), quinolinate and X-16397. The pellet can be evaluated for expression levels of 18S ribosomal RNA, CD3 mRNA and interferon inducible protein-10 mRNA.
[0038] It can be useful to collect a series of urine samples, for example, to monitor the status of a transplant. For example, samples can be obtained daily, or every two days, or every three days, or every four days, or every five days, or every six days, or once a week, or twice a week, or three times a week, or every two weeks, or once every month, or once every two months, or at selected times that are convenient for the subject.
[0039] Urine samples can be de-salted, for example, using graphite. As illustrated herein, urinary samples can be de-salted and concentrated using a graphite-carbon (type D) mini-SPE cartridge from Agilent Technologies.
[0040] Urine samples (e.g., urine supernatants) can be concentrated or diluted in some cases. Because ratios of metabolites in a particular sample are the indicator of transplant rejection, dilution or concentration of a sample does not affect such ratios. For example, urine samples can be diluted in solvents conveniently employed for analysis by various chromatographic or spectroscopic equipment. Examples of solvents or diluents that can be employed include water, acetonitrile, and/or ammonium hydroxide.
Metabolites Analysis
[0041] Urine samples can be evaluated for metabolites using gas chromatography, mass spectrometry, liquid chromatography, high pressure liquid chromatography, or combinations thereof. In some cases, a combination of gas chromatography and mass spectrometry (GC/MS) and/or a combination of liquid chromatography and mass spectrometry (LC/MS or LC/MS/MS) can be employed to determine the amounts of metabolites in samples. For example, in some cases a combination of a gas chromatography (GC) column such as a 5% diphenyl/95% dimethyl polysiloxane fused silica column and a Quadrupole Time-of-Flight (QTOF) mass spectrometer can be employed. For example, in some instances a fast-scanning single-quadruple mass spectrometer using electron impact ionization can be employed. In some cases, a Waters ACQUITY UPLC and a Thermo-Finnigan LTQ mass spectrometer, which consisted of an electrospray ionization (ESI) source and linear ion-trap (LIT) mass analyzer can be employed.
[0042] The ratios of 3-sialyllactose/xanthosine or quinolinate/X-16397 identifies transplant rejection in urinary samples of subjects undergoing transplant rejection or in urinary samples of subjects who will develop transplant rejection in about four to thirty days.
[0043] Use of ratios of two urine metabolites (e.g., 3-sialyllactose and xanthosine; or quinolinate and X-16397) eliminates the problem of normalization and thus renders these metabolite biomarkers more robust and easily applicable in the clinic. Ratios of metabolite concentrations can be developed efficiently, for example, into a targeted mass spectrometric assay as ratio of two metabolite-specific fragmentation patterns (MRMs), thereby obviating the need for measurement of an external calibration standards, such as urine creatinine or osmolality.
[0044] For example, the ratios of 3-sialyllactose/xanthosine (e.g., log.sub.10(3-sialyllactose/xanthosine)) and quinolinate/X-16397 (e.g., log.sub.10(quinolinate/X-16397)) are detectably different in urine samples of subjects who have ongoing transplant rejection, or who will develop transplant rejection than in urine samples of subjects who are not undergoing or will not develop transplant rejection for at least the next 4 days, or at least the next 10 days, or at least the next 30 days, or for at least 31-90 days. For example, transplant rejection (e.g., acute cellular rejection) can or will be ongoing in subjects where the subjects' urinary samples have log ratios of 3-sialyllactose/xanthosine and quinolinate/X-16397 that are detectably different by about 5%, or about 10%, or about 15%, or about 20%, or about 25%, or about 30%, or about 35%, or about 40%, or about 45%, or about 50%, or about 55%, or about 60%, or about 65%, or about 70%, or about 75%, or about 80%, or about 85%, or about 90%, or about 95%, or about 100%, or about 150% than these log ratios are in samples from subjects that are not undergoing transplant rejection for at least the next 4-30 days, or 31-90 days (e.g., No Rejection biopsy-matched subject samples).
[0045] Analysis involving receiver-operating-characteristic (ROC) curves identified a specific cut-off value that identified and predicted acute cellular rejection with a sensitivity of 59% and a specificity of 76% by a ratio of 3-sialyllactose/xanthosine. In some cases, transplant rejection is occurring or will occur when urine sample is tested and identified as having a 3-sialyllactose/xanthosine log ratio higher than 0.5, or higher than 0.52, or higher than 0.55, or higher than 0.56, or higher than 0.58, or higher than 0.59, or higher than 0.59836, than these ratios are in samples from subjects that are not undergoing transplant rejection (e.g., No Rejection biopsy-matched subject samples from sample not undergoing transplant rejection for the next 4-30 days, or next 31-90 days). See, e.g.,
[0046] In some cases, the cut-off is 0.59836 for a log ratio of mean levels of 3-sialyllactose/xanthosine metabolites in urine samples, where subjects have or will have acute cellular rejection if their urine sample has a sialyllactose/xanthosine log ratio higher than 0.59836.
[0047] Analysis involving ROC curve also identified a cut-off value that identified or predicted acute cellular rejection with a sensitivity of 82% and a specificity of 71% when anyalyzing the combination of ratios of 3-sialyllactose/xanthosine and quinolinate/X-16397 metabolite levels using. Hence a combined metabolite diagnostic signature of metabolite levels was an excellent indicator of whether or not a subject is exhibiting symptoms of transplant rejection or will exhibit symptoms of transplant rejection. For example, the following combined metabolite signature can be employed to diagnose transplant rejection.
Log.sub.10(3-sialyllactose/xanthosine)+0.9513*log.sub.10(quinolinate/X-16397).
[0048] In some cases, transplant rejection is occurring or will occur when urine sample is tested and identified as having a combined metabolite signature higher than 0.2, or higher than 0.3, or higher than 0.35, or higher than 0.37, or higher than 0.38, or higher than 0.39, or higher than 0.4, or higher than 0.41, or higher than 0.42, or higher than 0.4271. Such a cut-off distinguishes subjects currently exhibiting symptoms of transplant rejection and subjects who will exhibit symptoms of transplant rejection in the next 4-30 days, or next 31-90 days from subjects that are not undergoing transplant rejection. See, e.g.,
[0049] In some cases, a reliable cut-off of such a combined metabolite signature in subjects that are or will undergo acute cellular rejection and a No Rejection group of subjects is 0.4271. For example, transplant rejection (e.g., acute cellular rejection) can or will be ongoing in subjects where the subjects' urinary samples have a combined metabolite signature that is above 0.4271.
[0050] The combined metabolite signature can also predict that transplant rejection will occur in subjects who do not currently have detectable transplant rejection symptoms. For example, the combined metabolite signature is detectably different in urine samples of subjects who are ongoing or will undergo transplant rejection than in urine samples of subjects who are not undergoing or will not undergo transplant rejection for at least the next 4-30 days, or for at least the next 31-90 days.
[0051] In some embodiments, the combined metabolite signature can be greater than about 0.4, or greater than 0.41, or greater than 0.42, or greater than 0.4271, or greater than 0.45 when transplant rejection is occurring or will occur.
[0052] The diagnostic signatures for such metabolite ratios were remarkably stable in sequential urine samples collected from clinically stable patients. Hence, these signatures can help reduce the need for surveillance biopsies in this patient population. The determination described herein that such metabolite signatures cross the diagnostic threshold during the month prior to an ACR biopsy shows that these signatures can help initiate preemptive anti-rejection therapy and treatment prior to changes in renal allograft function.
RNA Signature as an Indicator of Transplant Rejection.
[0053] As described in Applicants' U.S. Ser. No. 14/170,132, which is specifically incorporated herein by reference in its entirety, acute cellular rejection can be noninvasively and accurately diagnosed using a 3-gene signature determined from quantified levels of CD3 mRNA, IP-10 mRNA and 18S rRNA in urine samples.
[0054] For example, the 3-gene RNA diagnostic signature measured in urine specimens from clinically stable allograft patients can be used to monitor the likelihood of such a patient to subsequently develop acute cellular rejection. The studies reported in U.S. Ser. No. 14/170,132 demonstrate that the diagnostic signature obtained from measurements conducted on urine specimens from patients with normal allograft biopsies and in clinically stable patients was relatively flat and distinct compared to the progressive increase observed in specimens from those who later developed biopsy confirmed acute cellular rejection.
[0055] The 3-gene RNA diagnostic signature can also serve to direct the immunosuppressive therapy of a transplant patient. The levels of this signature reflect the potency of immunosuppressive regimens. For example, a marked rise in the RNA levels in the absence of clinical manifestations of acute cellular rejection indicates that preemptive anti-rejection therapy can be needed.
[0056] In addition, the gene signature can distinguish acute cellular rejection from antibody-mediated rejection (AMR), borderline and other changes.
[0057] The RNA expression levels correlated with development of acute cellular rejection (and other kidney problems) include 18S-normalized CD3 mRNA, IP-10 mRNA and 18S rRNA expression levels. In some cases, a diagnostic signature of RNA expression levels can be employed to identify transplant rejection.
RNA signature=6.1487+0.8534 log.sub.10(CD3/18S)+0.6376 log.sub.10(IP-10/18S)+1.6464 log.sub.10(18S) [0058] where: [0059] CD3 is the absolute urinary CD3 mRNA copy number per microgram of total RNA in the urine sample; [0060] IP-10 is the absolute urinary IP-10 mRNA copy number per microgram of total RNA in the urine sample; and [0061] 18S is the an absolute urinary 18S rRNA copy number per microgram of total RNA in the urine sample times 10.sup.6; [0062] to thereby detect a developing or existing dysfunction or rejection of a kidney transplant in the subject.
[0063] The 3-gene RNA signature discriminated acute cellular rejection biopsies from biopsies without rejection. For example, the AUC was 0.85 (95% CI: 0.78-0.91, P<0.0001) by ROC curve analysis. The optimism-adjusted AUC was 0.83 by bootstrap re-sampling and the Hosmer-Lemeshow test indicated excellent fit (P=0.77). The calibration curve showed excellent calibration (Cox's intercept=0.06; slope=0.92). In an external validation dataset, the AUC was 0.74 (95% CI: 0.61 to 0.86, P=0.0002) and not different from CTOT-04's AUC (P=0.13). The RNA signature distinguished ACR from acute antibody mediated rejection and borderline rejection (AUC=0.78, P<0.0001), patients induced with anti-IL-2 receptor antibodies from T cell depleting antibodies (P=0.0009), and diagnostic of ACR in both groups. Urinary tract infection did not impact the RNA signature (P=0.69). The average trajectory of the RNA signature in repeat urine samples remained below the threshold diagnostic of ACR in the group without an ACR whereas there was a sharp rise during the weeks prior to an ACR biopsy (P<0.0001).
[0064] Heretofore, robust yardsticks for defining the immune status of the transplant recipient have not been developed. The relatively flat trajectory of the 3-gene diagnostic RNA signature of those who do not manifest acute cellular rejection is in contrast to this signature's increasing trajectory in those who do develop acute cellular rejection. Thus, the 3-gene RNA diagnostic signature provides a tool not only for detecting acute cellular rejection but also for monitoring a subject's immune status and for titrating an appropriate immunosuppressive therapy. The finding that the RNA signature can reflect the potency of immunosuppressive therapy offers new opportunities for more precise treatment and reduced trauma to the patient.
[0065] Although acute cellular rejection is frequently treatable, it is a well-recognized precursor of chronic rejection and ultimate graft loss. Current preventive strategies include immunosuppression, initiated at the time of transplant with adjustments in medications made based on drug levels, toxicity and clinical events such as increased creatinine. The marked increase in the trajectory of the diagnostic RNA signature in 1-12 weeks preceding acute cellular rejection, in addition to foreshadowing the development of ACR, offers new opportunities for preemptive anti-rejection therapy, prior to irreversible tissue injury.
[0066] In sum, the well-calibrated, parsimonious diagnostic RNA signature described herein is determined from the RNA expression levels of three genes relevant to acute cellular rejection. The RNA signature provides both physician and patient with direct measures of risk (the predicted probability that a biopsy would reveal acute cellular rejection) and a means of assessing progress/decline over repeated assessments. The RNA signature provides a reliable method for discrimination and diagnosis and an exceptional tool for assessing the likelihood of acute cellular rejection in a given patient at any point following transplantation. The results of the CTOT-4 clinical trial study described herein show that, in addition to minimizing invasive biopsies, the urinary cell mRNA and rRNA profiling described here can direct preemptive anti-rejection therapy and personalized immunosuppression.
[0067] Diagnostic signature algorithms are provided herein that can be employed in a method for detecting, monitoring and diagnosing kidney function from a urine sample obtained from a subject.
[0068] A method for detecting developing or existing dysfunction or rejection of a kidney transplant in a subject from a urine sample obtained from the subject that includes consideration of RNA expression levels can involve: [0069] (a) determining an absolute urinary CD3 mRNA, and absolute urinary IP-10 mRNA copy numbers per microgram of total RNA in the urine sample; [0070] (b) determining an absolute urinary 18S rRNA copy number per microgram of total RNA times 10.sup.6 in the urine sample; [0071] (c) ascertaining a diagnostic signature of developing or existing dysfunction or rejection of a kidney transplant in the subject with the following algorithm:
RNA signature=6.1487+0.8534 log.sub.10(CD3/18S)+0.6376 log.sub.10(IP-10/18S)+1.6464 log.sub.10(18S)
[0072] where: [0073] CD3 is the absolute urinary CD3 mRNA copy number per microgram of total RNA in the urine sample; [0074] IP-10 is the absolute urinary IP-10 mRNA copy number per microgram of total RNA in the urine sample; and [0075] 18S is the an absolute urinary 18S rRNA copy number per microgram of total RNA in the urine sample times 10.sup.6; [0076] to thereby detect a developing or existing dysfunction or rejection of a kidney transplant in the subject.
[0077] The RNA expression levels are determined as described herein, or using other procedures available to those of skill in the art.
[0078] An RNA diagnostic signature above 0.7, or above 0.8, or above 0.9, or above 1.0, or above 1.1, or above 1.2, or above 1.3, or above 1.4, or above 1.5, or above 1.6, or above 1.7, indicates that the subject can be undergoing transplant rejection or can develop transplant rejection in the next 8 days to 365 days. See
[0079] Acute cellular rejection was defined as Banff Grade 1A or higher and No Rejection biopsies were those classified by the on-site pathologist as showing no histological features of rejection. From those models in which each predictor was significant at P<0.05, one with the greatest log-likelihood and greatest area under the receiver-operating-characteristic (ROC) curve was provisionally selected as the best-fitting model. The regression estimates from this model defined a diagnostic signature, and area under the curve (AUC), sensitivity, and specificity were used to evaluate the ability of this signature to discriminate ACR biopsies from No Rejection biopsies.
[0080] The model was validated in several ways. The generalizability of the fitted model to other data sets was evaluated using bootstrap re-sampling methods. Logistic regression with backwards elimination was used to identify the best subset of the RNA measures and 18S rRNA in each of 500 data sets obtained by sampling with replacement from the original data set. The best subset model was then fit to 500 additional bootstrap samples from which optimism-adjusted measures of discrimination (i.e., AUC) and model fit (i.e., Cox's intercept and slope) and a LOESS-smoothed calibration plot, were obtained (LOESS: locally estimated scatterplot smoothing).
[0081] ROC curve analysis showed that this 3-gene signature yielded an AUC of 0.85 (95% confidence interval [CI] 0.78 to 0.91, P<0.0001). Using the cut-off point of 1.563099 (or 1.56), which maximizes Youden's index, this diagnostic signature has 79% sensitivity and 78% specificity to discriminate ACR biopsies from No Rejection biopsies (see FIG. 3C; and U.S. Ser. No. 14/170,132, FIG. 3A).
[0082] The Hosmer-Lemeshow test indicated an excellent fit of this model to the data (chi-square .sup.2=4.84, with 8 df, and P=0.77). The 3-gene signature also discriminated between the group of patients with biopsy specimens showing acute cellular rejection and the group of patients with stable graft function who did not undergo biopsy ((see U.S. Ser. No. 14/170,132,
[0083] Bootstrap validation of this three-gene model yielded a cross-validated estimate of the AUC of 0.83, which is an estimate of the expected value of the AUC in independent samples (i.e., samples not used to derive the diagnostic signature). The calibration-curve intercept and slope of 0.06 and 0.92, respectively, revealed that the predicted probabilities of a biopsy showing acute cellular rejection, across the range of the diagnostic signature, tended to be only very slightly higher than the actual probabilities (see U.S. Ser. No. 14/170,132,
[0084] The RNA signature can be combined with any of the metabolite signatures described herein. For example, the following combined signatures can be employed to discriminate kidney transplant subjects who are or will undergo transplant rejection from those who will not.
RNA signature+1.1164*log(3-sialyllactose/xanthosine)
RNA signature+0.8932*log(quinolinate/X-16397)
[0085] For example, when a 3-sialyllactose/xanthosine+RNA signature is used, a cut-off value that distinguishes subjects that can be undergoing transplant rejection or can develop transplant rejection, from subjects who are not and/or will not under transplant rejection can be about 0.88, or about 0.8815479. Thus, in some cases, patients undergoing transplant rejection or that can develop transplant rejection have a 3-sialyllactose/xanthosine+RNA signature above 0.87, or above 0.88, or above 0.8815479, or above 0.89, or above 0.9, or above 0.91 (where above means less negative).
[0086] A composite of the 3-sialyllactose/xanthosine, quinolinate/X-16397, and RNA signatures called a composite metabolite-RNA diagnostic signature has the following formula:
RNA-signature+1.1164*log(3-sialyllactose/xanthosine)+0.6937*log(quinolinate/X-16397).
[0087]
[0088] Determination of CDR mRNA, IP-10 mRNA and 18S rRNA Expression Levels
[0089] Any procedure available to those of skill in the art can be employed to determine the expression levels of CD3 mRNA, IP-10 mRNA and 18S rRNA. For example, probes, primers, and/or antibodies can be employed in quantitative nucleic acid amplification reactions (e.g., quantitative polymerase chain reaction (PCR)), primer extension, Northern blot, immunoassay, immunosorbent assay (ELISA), radioimmunoassay (RIA), immunofluorimetry, immunoprecipitation, equilibrium dialysis, immunodiffusion, immunoblotting, mass spectrometry and other techniques available to the skilled artisan.
[0090] In some embodiments, the expression levels of CD3 mRNA, IP-10 mRNA and 18S rRNA are determined using probes or primers that can hybridize to the CD3 mRNA, IP-10 mRNA or 18S rRNA. Sequences for CD3 mRNA, IP-10 mRNA and 18S rRNA are readily available and can be used to make such probes and primers.
[0091] For example, the following sequence for a human 18S rRNA is available from the National Center for Biotechnology Information database (see website at ncbi.nlm.nih.gov) as accession number K03432 (SEQ ID NO:1).
TABLE-US-00001 1 CGCTGCTCCTCCCGTCGCCGTCCGGGCCCGTCCGTCCGTC 41 CGTCCGTCGTCCTCCTCGCTNNNNCGGGGCGCCGGGCCCG 61 TCCTCACNGGCCCCCGNNNNNGTCCNGGCCCGTCGGGGCC 121 TCGCCGCGCTCTACCTTACCTACCTGGTTGATCCTGCCAG 161 TAGCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTA 201 AGTACGCACGGCCGGTACAGTGAAACTGCGAATGGCTCAT 241 TAAATCAGTTATGGTTCCTTTGGTCGCTCGCTCCTCTCCT 281 ACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCCG 321 ACGGGCGCTGACCCCCTTCGCGGGGGGGATGCGTGCATTT 361 ATCAGATCAAAACCAACCCGGTCAGCCCCTCTCCGGCCCC 401 GGCCGGGGGGCGGGCGCCGGCGGCTTTGGTGACTCTAGAT 441 AACCTCGGGCCGATCGCACGCCCCCCGTGGCGGCGACGAC 481 CCATTCGAACGTCTGCCCTATCAACTTTCGATGGTAGTCG 521 CCGTGCCTACCATGGTGACCACGGGTGACGGGGAATCAGG 561 GTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACA 601 TCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGA 641 CCCGGGGAGGTAGTGACGAAAAATAACAATACAGGACTCT 681 TTCGAGGCCCTGTAATTGGAATGAGTCCACTTTAAATCCT 721 TTAACGAGGATCCATTGGAGGGCAAGTCTGGTGCCAGCAG 761 CCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGC 801 TGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCG 841 GGCGGTCCGCCGCGAGGCGAGCCACCGCCCGTCCCCGCCC 881 CTTGCCTCTCGGCGCCCCCTCGATGCTCTTAGCTGAGTGT 921 CCCGCGGGGCCCGAAGCGTTTACTTTGAAAAAATTAGAGT 961 GTTCAAAGCAGGCCCGAGCCGCCTGGATACCGCAGCTAGG 1001 AATAATGGAATAGGACCGCGGTTCTATTTTGTTGGTTTTC 1041 GGAACTGAGGCCATGATTAAGAGGGACGGCCGGGGGCATT 1081 CGTATTGCGCCGCTAGAGGTGAAATTCCTTGGACCGGCGC 1121 AAGACGGACCAGAGCGAAAGCATTTGCCAAGAATGTTTTC 1161 ATTAATCAAGAACGAAAGTCGGAGGTTCGAAGACGATCAG 1201 ATACCGTCGTAGTTCCGACCATAAACGATGCCGACCGGCG 1241 ATGCGGCGGCGTTATTCCCATGACCCGCCGGGCAGCTTCC 1281 GGGAAACCAAAGTCTTTGGGTTCCGGGGGGAGTATGGTTG 1321 CAAAGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACC 1361 AGGAGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGAA 1401 ACCTCACCCGGCCCGGACACGGACAGGATTGACAGATTGA 1441 TAGCTCTTTCTCGATTCCGTGGGTGGTGGTGCATGGCCGT 1481 TCTTAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGATAA 1521 CGAACGAGACTCTGGCATGCTAACTAGTTACGCGACCCCC 1561 GAGCGGTCGGCGTCCCCCAACTTCTTAGAGGGACAAGTGG 1601 CGTTCAGCCACCCGAGATTGAGCAATAACAGGTCTGTGAT 1641 GCCCTTAGATGTCCGGGGCTGCACGCGCGCTACACTGACT 1681 GGCTCAGCGTGTGCCTACCCTACGCCGGCAGGCGCGGGTA 1721 ACCCGTTGAACCCCATTCGTGATGGGGATCGGGGATTGCA 1761 ATTATTCCCCATGAACGAGGAATTCCCAGTAAGTGCGGGT 1801 CATAAGCTTGCGTTGATTAAGTCCCTGCCCTTTGTACACA 1841 CCGCCCGTCGCTACTACCGATTGGATGGTTTAGTGAGGCC 1881 CTCGGATCGGCCCCGCCGGGGTCGGCCCACGGCCCTGGCG 1921 GAGCGCTGAGAAGACGGTCGAACTTGACTATCTAGAGGAA 1961 GTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGA 2001 AGGATCATTAACGGAGCCCGGACGGCGGCCCGCGGCGGCG 2041 CCGCGCCGCGCTTCCCTCCGCACACCCACCCCCCCACCGC 2081 GACGGCGCGTGCGGGCGGGGCCGTGCCCGTTCGTTCGCTC 2121 GCTCGTTCGTTCGCCGCCCGGCCCGGCCGCGAGAGCCGAG 2161 AACTCGGGAGGGAGACGGGGGAGAGAGAGAGAGAGAGAGA 2201 GAGAGAGAGAGAGAGAGAGAGAAAGAAGGGCGTGT
[0092] A cDNA sequence for a human CD3 is also available from the National Center for Biotechnology Information database as accession number NM_000733 (SEQ ID NO:2.
TABLE-US-00002 1 TATTGTCAGAGTCCTCTTGTTTGGCCTTCTAGGAAGGCTG 41 TGGGACCCAGCTTTCTTCAACCAGTCCAGGTGGAGGCCTC 81 TGCCTTGAACGTTTCCAAGTGAGGTAAAACCCGCAGGCCC 121 AGAGGCCTCTCTACTTCCTGTGTGGGGTTCAGAAACCCTC 161 CTCCCCTCCCAGCCTCAGGTGCCTGCTTCAGAAAATGAAG 201 TAGTAAGTCTGCTGGCCTCCGCCATCTTAGTAAAGTAACA 241 GTCCCATGAAACAAAGATGCAGTCGGGCACTCACTGGAGA 281 GTTCTGGGCCTCTGCCTCTTATCAGTTGGCGTTTGGGGGC 321 AAGATGGTAATGAAGAAATGGGTGGTATTACACAGACACC 361 ATATAAAGTCTCCATCTCTGGAACCACAGTAATATTGACA 401 TGCCCTCAGTATCCTGGATCTGAAATACTATGGCAACACA 441 ATGATAAAAACATAGGCGGTGATGAGGATGATAAAAACAT 481 AGGCAGTGATGAGGATCACCTGTCACTGAAGGAATTTTCA 521 GAATTGGAGCAAAGTGGTTATTATGTCTGCTACCCCAGAG 561 GAAGCAAACCAGAAGATGCGAACTTTTATCTCTACCTGAG 601 GGCAAGAGTGTGTGAGAACTGCATGGAGATGGATGTGATG 641 TCGGTGGCCACAATTGTCATAGTGGACATCTGCATCACTG 681 GGGGCTTGCTGCTGCTGGTTTACTACTGGAGCAAGAATAG 721 AAAGGCCAAGGCCAAGCCTGTGACACGAGGAGCGGGTGCT 761 GGCGGCAGGCAAAGGGGACAAAACAAGGAGAGGCCACCAC 801 CTGTTCCCAACCCAGACTATGAGCCCATCCGGAAAGGCCA 841 GCGGGACCTGTATTCTGGCCTGAATCAGAGACGCATCTGA 881 CCCTCTGGAGAACACTGCCTCCCGCTGGCCCAGGTCTCCT 921 CTCCAGTCCCCCTGCGACTCCCTGTTTCCTGGGCTAGTCT 961 TGGACCCCACGAGAGAGAATCGTTCCTCAGCCTCATGGTG 1001 AACTCGCGCCCTCCAGCCTGATCCCCCGCTCCCTCCTCCC 1041 TGCCTTCTCTGCTGGTACCCAGTCCTAAAATATTGCTGCT 1081 TCCTCTTCCTTTGAAGCATCATCAGTAGTCACACCCTCAC 1121 AGCTGGCCTGCCCTCTTGCCAGGATATTTATTTGTGCTAT 1161 TCACTCCCTTCCCTTTGGATGTAACTTCTCCGTTCAGTTC 1201 CCTCCTTTTCTTGCATGTAAGTTGTCCCCCATCCCAAAGT 1241 ATTCCATCTACTTTTCTATCGCCGTCCCCTTTTGCAGCCC 1281 TCTCTGGGGATGGACTGGGTAAATGTTGACAGAGGCCCTG 1321 CCCCGTTCACAGATCCTGGCCCTGAGCCAGCCCTGTGCTC 1361 CTCCCTCCCCCAACACTCCCTACCAACCCCCTAATCCCCT 1401 ACTCCCTCCACCCCCCCTCCACTGTAGGCCACTGGATGGT 1441 CATTTGCATCTCCGTAAATGTGCTCTGCTCCTCAGCTGAG 1481 AGAGAAAAAAATAAACTGTATTTGGCTGCAAGAAAAAAAA 1521 AAAAAAAAAAAAAA
[0093] The following cDNA sequence is also available for a human IP-10 from the National Center for Biotechnology Information database as accession number NM_001565.1 (GI:4504700) (SEQ ID NO:3).
TABLE-US-00003 1 GAGACATTCCTCAATTGCTTAGACATATTCTGAGCCTACA 41 GCAGAGGAACCTCCAGTCTCAGCACCATGAATCAAACTGC 81 GATTCTGATTTGCTGCCTTATCTTTCTGACTCTAAGTGGC 121 ATTCAAGGAGTACCTCTCTCTAGAACCGTACGCTGTACCT 161 GCATCAGCATTAGTAATCAACCTGTTAATCCAAGGTCTTT 201 AGAAAAACTTGAAATTATTCCTGCAAGCCAATTTTGTCCA 241 CGTGTTGAGATCATTGCTACAATGAAAAAGAAGGGTGAGA 281 AGAGATGTCTGAATCCAGAATCGAAGGCCATCAAGAATTT 321 ACTGAAAGCAGTTAGCAAGGAAATGTCTAAAAGATCTCCT 361 TAAAACCAGAGGGGAGCAAAATCGATGCAGTGCTTCCAAG 401 GATGGACCACACAGAGGCTGCCTCTCCCATCACTTCCCTA 441 CATGGAGTATATGTCAAGCCATAATTGTTCTTAGTTTGCA 481 GTTACACTAAAAGGTGACCAATGATGGTCACCAAATCAGC 521 TGCTACTACTCCTGTAGGAAGGTTAATGTTCATCATCCTA 561 AGCTATTCAGTAATAACTCTACCCTGGCACTATAATGTAA 601 GCTCTACTGAGGTGCTATGTTCTTAGTGGATGTTCTGACC 641 CTGCTTCAAATATTTCCCTCACCTTTCCCATCTTCCAAGG 681 GTACTAAGGAATCTTTCTGCTTTGGGGTTTATCAGAATTC 721 TCAGAATCTCAAATAACTAAAAGGTATGCAATCAAATCTG 761 CTTTTTAAAGAATGCTCTTTACTTCATGGACTTCCACTGC 801 CATCCTCCCAAGGGGCCCAAATTCTTTCAGTGGCTACCTA 841 CATACAATTCCAAACACATACAGGAAGGTAGAAATATCTG 881 AAAATGTATGTGTAAGTATTCTTATTTAATGAAAGACTGT 921 ACAAAGTATAAGTCTTAGATGTATATATTTCCTATATTGT 961 TTTCAGTGTACATGGAATAACATGTAATTAAGTACTATGT 1001 ATCAATGAGTAACAGGAAAATTTTAAAAATACAGATAGAT 1041 ATATGCTCTGCATGTTACATAAGATAAATGTGCTGAATGG 1081 TTTTCAAATAAAAATGAGGTACTCTCCTGGAAATATTAAG 1121 AAAGACTATCTAAATGTTGAAAGATCAAAAGGTTAATAAA 1161 GTAATTATAACT
[0094] The level of expression is determined for one or more genes in sample obtained from a subject. The sample can be a fluid sample such as a blood sample, a peripheral blood mononuclear cell (PBMC) sample, a urine sample, a sample of broncho-alveolar lavage fluid, a sample of bile, pleural fluid or peritoneal fluid, any other fluid secreted or excreted by a normally or abnormally functioning allograft, or any other fluid resulting from exudation or transudation through an allograft or in anatomic proximity to an allograft, or any fluid in fluid communication with the allograft. One convenient example of a sample for determination of the level of gene expression is a urine sample.
[0095] RNA can be isolated from the samples by procedures available in the art. Commercially available kits can be employed for such isolation. Alternatively, the urine sample can be treated to lyse any cells therein and the RNA expression levels can be determined with little or no RNA purification step.
[0096] For example, the CD3 mRNA, IP-10 mRNA and 18S rRNA can be determined from a urinary cell sample from the recipient of an organ transplant. Any method known to those in the art can be employed for determining the level of CD3 mRNA, IP-10 mRNA and 18S rRNA. For example, total RNA, which includes mRNA and rRNA, can be isolated from the sample by use of a commercial kit, such as the TRI Reagent commercially available from Molecular Research Center, Inc. (Cincinnati, Ohio), can be used to isolate RNA.
[0097] Any method available to those in the art can be employed for determining the level of gene expression. Examples include Microarrays, TaqMan Gene Expression Assays (Applied Biosystems), TaqMan Low Density Array microfluidic cards (Applied Biosystems), molecular beacons, scorpions, SYBR Green, and/or RT-PCR. Such methods provide quantitative measurements of RNA levels. The Examples section describes quantitative data obtained by quantitative nucleic acid amplification (e.g., real-time RT-PCR) in a small reaction volume.
[0098] In another example, a microarray can be used. Microarrays are known in the art and consist of a surface to which probes that correspond in sequence to gene products (e.g. RNAs, polypeptides, fragments thereof etc.) can be specifically hybridized or bound to a known position. Hybridization intensity data detected by the scanner are automatically acquired and processed by the Affymetrix Microarray Suite (MAS5) software. Raw data is normalized to expression levels using a target intensity of 150.
[0099] The transcriptional state of a cell may be measured by other gene expression technologies known in the art. Several such technologies produce pools of restriction fragments of limited complexity for electrophoretic analysis, such as methods combining double restriction enzyme digestion with phasing primers (e.g. EP-Al-0534858), or methods selecting restriction fragments with sites closest to a defined RNA end (e.g. Prashar et al; Proc. Nat. Acad. Sci., 93, 659-663, 1996). Other methods statistically sample cDNA pools, such as by sequencing sufficient bases (e.g. 20-50 bases) in each multiple cDNAs to identify each cDNA, or by sequencing short tags (e.g. 9-10 bases) which are generated at known positions relative to a defined RNA end (e.g. Velculescu, Science, 270, 484-487, 1995) pathway pattern.
[0100] The quantification of CD3 nRNA, IP-10 mRNA and 18S rRNA from the total RNA of a sample can be performed by any method known to those in the art. For example, kinetic, quantitative PCR involves reverse transcribing CD3 mRNA, IP-10 mRNA and 18S rRNA by using reverse-transcriptase polymerase chain reaction (RT-PCR) to obtain CD3, IP-10, and 18S rRNA cDNA. The cDNA can then, for example, be amplified by PCR followed by quantitation using a suitable detection apparatus. Determination of CD3 mRNA, IP-10 mRNA and 18S rRNA expression levels can involve a preamplification step followed by an amplification process. See Example 2 for exemplary methods for quantitation of CD3 mRNA, IP-10 mRNA and 18S rRNA by kinetic, quantitative PCR.
[0101] Amplification systems utilizing, for example, PCR or RT-PCR methodologies are available to those skilled in the art. For a general overview of amplification technology, see, for example, Dieffenbach et al., PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York (1995).
[0102] An alternative method for determining the level of CD3 mRNA, IP-10 mRNA and 18S rRNA includes the use of molecular beacons and other labeled probes useful in, for example multiplex PCR. In a multiplex PCR assay, the PCR mixture contains primers and probes directed to the CD3 mRNA, IP-10 mRNA and 18S rRNA. Typically, a single fluorophore is used in the assay. The molecular beacon or probe is detected to determine the level of CD3 mRNA, IP-10 mRNA and 18S rRNA. Molecular beacons are described, for example, by Tyagi and Kramer (Nature Biotechnology 14, 303-308, (1996)) and by Andrus and Nichols in U.S. Patent Application Publication No. 20040053284.
[0103] Another method includes, for instance, quantifying cDNA (obtained by reverse transcribing the CD3 mRNA, IP-10 mRNA and 18S rRNA using a fluorescence based real-time detection method, such as the ABI PRISM 7500, 7700, or 7900 Sequence Detection System (TaqMan) commercially available from Applied Biosystems, Foster City, Calif., or similar system as described by Heid et al., (Genome Res. 1996; 6:986-994) and Gibson et al. (Genome Res. 1996; 6:995-1001).
[0104] Ribosomal RNA constitutes about 80-85% of the total cellular RNA and is more stable compared to mRNA. The inventors used 510.sup.7 18 S ribosomal RNA copies per microgram of total RNA as an additional cutoff point to qualify a urine specimen. A threshold of 510.sup.7 copies of rRNA ensured that 25,000 rRNA copies (rRNA from about 10 cells in view of data showing that 2501 copies of 18S rRNA are typically present in a single human peripheral blood mononuclear cell) were present in the 2.5 ul cDNA used in 1:2000 dilutions for measuring 18S rRNA abundance in the PCR assay.
[0105] In some embodiments, the expression level is determined using log-transformed levels of CD3 mRNA, IP-10 mRNA and 18S rRNA in a urine cell sample from the patient. Such a method can include using a logistic regression model to evaluate CD3 mRNA, IP-10 mRNA, and 18S rRNA expression levels, or a weighted combination of log transformed, normalized RNA levels of CD3 mRNA, IP-10 mRNA, and 18S rRNA based on a logistic regression model. The log transformation or RNA levels substantially reduces a positive skew in the data.
[0106] A method that includes measuring RNA expression levels can include normalizing the determined amounts of CD3 mRNA and IP-10 mRNA against the amount of 18S rRNA in the sample, to generate 18S rRNA-normalized CD3 mRNA and 18S rRNA-normalized IP-10 mRNA. The level of gene expression can be determined using log-transformed RNA levels determined by normalizing mRNA levels to 18S rRNA using a logistic regression model of CD3 mRNA, IP-10 mRNA and 18S rRNA or a weighted combination of log transformed, normalized RNA levels of CD3 mRNA, IP-10 mRNA and 18S rRNA based on a logistic regression model. Logistic regression models are used for prediction of the probability of occurrence of acute rejection by fitting data to a logistic curve. It is a generalized linear model used for binomial regression.
[0107] In some embodiments, for interpretation of quantitative gene expression measurements, a normalizer may be used to correct expression data for differences in cellular input, RNA quality, and RT efficiency between samples. In some embodiments, to accurately assess whether increased RNA is significant, the gene expression can be normalized to accurately compare levels of expression between samples, for example, between a baseline (control) level and an expression level detected in a test sample. In quantitative assays, such as for example, quantitative real-time Reverse Transcriptase-PCR (RT-PCR) normalization can be performed using housekeeping genes (e.g., 18S rRNA) as references against the expression level of a gene under investigation. Normalization includes rendering the measurements of different arrays or PCR or in particular RT-PCR experiments comparable by reducing or removing the technical variability. Within these experiments there exists a multiplicity of sources capable of falsifying the measurements. Possible technical sources of interference are: different efficiency in reverse transcription, labeling or hybridization reactions, as well as problems with the arrays, batch effects in reagents, or lab-specific conditions. A more robust detection of gene expression can occur when normalization is employed.
[0108] Normalization can involve use of a housekeeping gene which is utilized as a reference, internal control or reference value in the quantification of gene expression. The housekeeping gene allows an identification and quantitative analysis of a gene whose activity is regulated differentially in different pathological conditions. A housekeeping gene exhibits minimum change of expression and transcription across different RNA samples and thus serves as a control, or reference, for the measurement of variable gene activities across different samples. Housekeeping genes for RNA detection include, for example, 2-Microglobulin 032M), Glucose-6-phosphate dehydrogenase (G6PDH), 5-aminolevulinate synthase (ALAS or ALAS 1) Hypoxanthinephophoribosyltransferase (HPRT), Porphobilinogen deaminase (PBGD), 18S rRNA, or the like. Various housekeeping genes and normalization reagents are available from many sources including Applied Biosystems, (Foster City, Calif.), and geNorm kits Hoffmann-La Roche (Nutley, N.J.).
[0109] In some embodiments, 18S rRNA is used for normalization in gene expression analysis. For example, the values of 18S rRNA-normalized CD3c mRNA and 18S rRNA-normalized IP-10 mRNA can be used in the diagnostic signature provided herein.
[0110] The rationale for the use of 18S rRNA to normalize mRNA is as follows. The strategy of absolute quantification of mRNA abundance rather than relative quantification (wherein the reference gene abundance is integral to the calculation of target gene abundance) facilitated the identification that 18S rRNA levels are higher in urine specimens from the acute cellular rejection biopsy group compared to the No Rejection biopsy group or the Stable (no biopsy) group. One consequence of 18S rRNA levels being higher is that 18S rRNA normalization of the target leads to underestimation of the increase in the target gene abundance in urine specimens from the acute cellular rejection biopsy group. This was seen from the finding that that the levels of CD103 (P<0.0001), CXCR3 (P<0.0001), PI-9 (P=0.002) and TGF-1 (P=0.0001) are all significantly different between the acute cellular rejection biopsy group and the No Rejection biopsy group when non-normalized levels are used (see, e.g., U.S. Ser. No. 14/170,132, Table 5B, analysis using non-normalized levels).
[0111] The reasons for the use of 18S rRNA levels to normalize target gene levels include: (i) to ensure that the differences in the levels of a target gene between the acute cellular rejection biopsy group and the No Rejection biopsy group or Stable (no biopsy) group are not due to reasons such as variations in RNA integrity and reverse transcription efficiency, with normalization serving as an internal control; and (ii) to demonstrate that increased levels of specific mRNAs (e.g., IP-10) in association with acute cellular rejection are above and beyond the increase in the transcriptional machinery of the cell from which the total RNA was isolated. The data provided in U.S. Ser. No. 14/170,132 (see, e.g., Table 5B) show that 18S rRNA levels are about 2-fold higher in the acute cellular rejection biopsy group compared to the No Rejection biopsy group or the Stable (no biopsy) group (similar to the increases seen in CD103, CXCR3, PI-9, and TGF-1) whereas the levels of mRNA for CD3, granzyme B, perforin and IP-10 are 10-fold higher or more in the acute cellular rejection biopsy group compared to the No Rejection biopsy group or the Stable (no biopsy) group. Also, scholarly guidelines on the reporting of real-time PCR experiments consider normalization to be an essential component of a reliable PCR assay (The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments; Bustin et al., Clin Chem 55:611-22 (2009)).
[0112] The basis for 18S rRNA levels being about 2-fold higher in the acute cellular rejection biopsy group compared to the No Rejection biopsy group or the Stable (no biopsy) group may reflect more than cell activation alone. It is however unlikely that the increase is due to a higher number of cells since irrespective of the RNA yield from a given cell pellet, reverse transcription of RNA to cDNA is adjusted to result in a final concentration of 1.0 microgram of cDNA in 100 l solution prior to measurement of transcript abundance. This normalization of RNA yield from different urinary cell pellets, that is one urine cell pellet containing 110.sup.6 urinary cells yielding a higher amount of RNA compared to another urinary cell pellet containing 110.sup.5 urinary cells, would tend to minimize the cell number dependent differences in 18S rRNA abundance and for that matter all of the mRNAs measured in this study. On the other hand, differences in the types of cells contributing to the cell pellet could contribute to differences in transcript abundance. It is known that 18S rRNA abundance is lower in highly differentiated cells compared to less differentiated cells (Lodish, Annual Review of Biochemistry 45:39-72 (1976)), and a urine cell pellet that contains mostly highly differentiated renal tubular cells compared to a cell pellet that contains mostly activated lymphocytes would be expected to have lesser amounts of 18S rRNA.
[0113] Generally, the level of CD3 mRNA, IP-10 mRNA and 18S rRNA in a sample is upregulated if the gene expression of CD3 mRNA, IP-10 mRNA and 18S rRNA is increased. In some embodiments, upregulation includes increases above a control or baseline level of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or higher.
[0114] For example, a discriminatory level for upregulated gene expression (e.g., the baseline magnitude of gene expression) of CD3 mRNA, IP-10 mRNA and 18S rRNA includes the mean+95% confidence interval of a group of values observed in non-rejecting transplants (e.g., baseline levels or control levels). Upregulation of CD3 mRNA, IP-10 mRNA and 18S rRNA expression is considered to be significantly greater if the value is greater than the mean+95% confidence interval of a group of values observed in non-rejecting transplants. Similarly, the level of CD3 mRNA, IP-10 mRNA and 18S rRNA in the sample is considered to be significantly lower if the amount of CD3 mRNA, IP-10 mRNA and 18S rRNA detected is lower than the mean95% confidence interval of the amount detected in non-rejecting transplants.
[0115] The method described in U.S. Ser. No. 14/170,132 for detecting or predicting kidney dysfunction based on RNA expression levels can be used herein in conjunction with the method for detecting or predicting transplant rejection based on urinary metabolite levels. A method that involves evaluation of RNA expression levels can include steps of measuring amounts of CD3 mRNA, IP-10 mRNA and 18S rRNA in a sample; and comparing the amount of CD3 mRNA, IP-10 mRNA and 18S rRNA in the sample to a control or baseline amount of CD3 mRNA, IP-10 mRNA and 18S rRNA, wherein increases between the amount of CD3 mRNA, IP-10 mRNA and 18S rRNA in the sample relative to the control indicates that the subject can have or can develop kidney dysfunction (e.g., acute cellular rejection).
Prediction of Transplant Rejection
[0116] Methods described herein can detect or predict kidney dysfunction (e.g., acute cellular rejection) a number of days prior to acute rejection. For example, the methods can detect or predict kidney dysfunction (e.g., acute cellular rejection) about 15 to 90 days before transplant rejection. In some case, the methods can detect or predict kidney dysfunction (e.g., acute cellular rejection) 90 to 60 days before confirmation by biopsy, or 59 to 30 days before confirmation by biopsy, or 29 to 16 days before confirmation by biopsy, or 4 to 30 days before confirmation by biopsy. Thus, kidney transplant dysfunction such as acute cellular rejection can be predicted about 3 months to about four days before it happens. Such RNA profile analysis can be a new non-invasive gold standard to replace and/or supplement an invasive allograft biopsy.
[0117] In some embodiments, the method for predicting acute rejection employs log-transformed RNA values determined from an urine sample and that are determined by combinations of log transformed and/or normalized RNA values using a logistic regression model of CD3 mRNA, IP-10 mRNA, and 18S rRNA expression levels, which predict acute rejection of the transplanted organ within about 90 to about 60 days after the urine sample is tested. In some embodiments; the log-transformed RNA levels of the urine sample are determined by combinations of log transformed, normalized RNA levels using a logistic regression model of CD3 mRNA, IP-10 mRNA, and 18S rRNA expression levels that predicts acute rejection of the transplanted organ in about 59 to about 30 days after the urine sample is tested. In some embodiments, the log-transformed RNA levels of the urine sample are determined by combinations of log transformed, normalized CD3 mRNA, IP-10 mRNA, and 18S rRNA expression levels that predict acute rejection of the transplanted organ in about 29 to about 15 days after the urine sample is tested.
[0118] Quantified expression levels of 18S rRNA-normalized CD3 mRNA, 18S rRNA-normalized IP-10 mRNA, and 18S rRNA can be used in the diagnostic signature algorithm provided herein. In some instances, the values of 18S-normalized CD3 mRNA, 18S-normalized IP-10 mRNA and 18S rRNA can deviate from a normal distribution (P<0.001). Log.sub.10-transformation of these values can substantially reduce this deviation.
[0119] Moreover, 18S rRNA can be expressed at higher levels than CD3 mRNA and IP-10 mRNA. Hence, the quantified amount of 18S rRNA in the diagnostic signature algorithm can be adjusted by a factor of 10.sup.6 to allow better relationship between the expression levels of these three genes.
Serum Creatinine
[0120] The method can further comprise determining the patient's serum creatinine protein level. The determination of the level of serum creatinine can be made by any method known to those skilled in the art. The next step in this embodiment can include correlating the level of serum creatinine in peripheral blood with predicting acute rejection and eventual loss of the transplanted organ. A significantly greater level of serum creatinine in peripheral blood and increased levels of CD3 mRNA, IP-10 mRNA, and 18S rRNA in urine correlates with acute rejection and may also increase risk of loss of the transplanted kidney.
[0121] Generally, the level of serum creatinine in peripheral blood is considered to be significantly greater if the level is at least about 25% greater than the level of creatinine in a control sample. Commercial kits can be utilized to test creatinine. An example of a commercial kit for determining creatinine level is the QuantiChrom Creatinine Assay Kit from BioAssay Systems (Hayward, Calif.).
[0122] A control sample can be the level of serum creatinine in peripheral blood of a healthy person or a person with a well-functioning (e.g., stable) transplant. For example, the normal level of serum creatinine in a healthy person or a person with a well-functioning transplant is generally about 0.8-1.6 milligrams/deciliter. In either case, the person may be the patient or a person different from the patient.
[0123] It is not necessary to determine the level of creatinine in a control sample every time the method is conducted. For example, the serum creatinine level from the patient can be compared to that of one or more previously determined control samples or to a level recognized by the physician or clinician conducting the method, or by a consensus of medical and/or clinical practitioners.
Treatment
[0124] The methods can further include informing medical personnel or the patient about the test results. Information about whether the patient will have acute rejection can also be communicated.
[0125] If a difference in 3-sialyllactose/xanthosine ratios, quinolinate/X-16397 ratios, CD3 mRNA levels, IP-10 mRNA levels, and/or 18S rRNA levels is determined, the patient can be informed that there is increased risk of developing transplant rejection. Similarly, if any of the methods described herein that include a diagnostic signature algorithm indicate that a subject's urine sample is different from a baseline or control value, the patient can be informed that there is increased risk of developing transplant rejection. The increased risk varies in different patients, and the organ transplanted. Generally, the increased risk for developing acute rejection is at least about 25%, at least about 50%, at least about 75%, or at least about 90%, or at least about 99% or at least about 100%.
[0126] If the patient is likely to develop kidney dysfunction, the patient can be prescribed and/or administered a treatment to delay or obviate rejection of the transplanted organ. Such treatment can include increased or decreased dose of an anti-rejection agent or an anti-rejection agent can be added. Anti-rejection agents, include for example, azathioprine, cyclosporine, FK506, tacrolimus, mycophenolate mofetil, anti-CD25 antibody, antithymocyte globulin, rapamycin, ACE inhibitors, perillyl alcohol, anti-CTLA4 antibody, anti-CD40L antibody, anti-thrombin III, tissue plasminogen activator, antioxidants, anti-CD 154, anti-CD3 antibody, thymoglobin, OKT3, corticosteroid, or a combination thereof.
[0127] For example, if acute rejection is predicted or ongoing, a steroid pulse therapy can be started and may include the administration for three to six days of a high dose corticosteroid (e.g., greater than 100 mg). An antibody can be added. An example of an antibody therapy includes the administration for seven to fourteen days of the polyclonal antibody Thymoglobin or the monoclonal antibody, OT3.
[0128] Another example of a treatment that can be administered is plasmapheresis. Plasmapheresis is a process in which the fluid part of the blood (i.e., plasma) is removed from blood cells. Typically, the plasma is removed by a device known as a cell separator. The cells are generally returned to the person undergoing treatment, while the plasma, which contains antibodies, is discarded.
[0129] The implications of immunosuppressive therapy relating to the diagnostic signatures disclosed herein are as follows. The lower trajectory (lower diagnostic score) in those induced with T cell depleting antibodies compared to subjects induced with non-depleting antibodies is consistent with T cell depleting antibodies inducing a greater degree of immunosuppression and being associated with a lower incidence of acute rejection as compared to IL-2 receptor antagonists. The findings described herein and U.S. Ser. No. 14/170,132, in addition to suggesting a mechanistic basis for the lower incidence of acute rejection for induction with depleting antibodies vs. non-depleting antibodies, indicate that the signature can serve as an accurate indicator of the kidney graft recipient's immune status and help personalize immunosuppressive therapy.
[0130] The impact of anti-rejection therapy on the diagnostic signature is as follows. A comparison of the diagnostic signature values showed a significant decrease following treatment of an episode of acute cellular rejection. While this decrease in the mean value of the diagnostic signature remained statistically significant in the subset of patients who responded to therapy, almost 30% of the responders did not show a numerical decrease in the diagnostic signature. (The number of non-responders to acute cellular rejection treatment [N=4] was too small to yield meaningful results.) These findings indicate that a successful clinical response is associated with a reduction or normalization of the signature in many, but not in all cases. This lack of complete resolution of the molecular signature is reminiscent of the previously published finding wherein almost two-thirds of kidney graft recipients with clinical reversal of acute rejection had residual inflammation in their follow-up graft biopsies (Gaber et al., Kidney Int 55:2415-22 (1999)). In the U.S. double blind, randomized, multicenter, phase III clinical trial of Thymoglobulin versus ATGAM in the treatment of acute graft rejection episodes after renal transplantation, a subset of patients (n=38) had both a baseline inclusion biopsy and a protocol biopsy one to two weeks following the end of therapy and it was found that treatment was clinically successful in 94% of patients receiving Thymoglobulin and in 79% of patients receiving ATGAM, but only 35% and 33% of the respective biopsies demonstrated total resolution of the rejection on the repeat biopsies (Gaber et al., Kidney Int 55:2415-22 (1999)).
[0131] The implications of infections upon the diagnostic signatures described herein are as follows. The data demonstrate that urinary tract infection, blood infection and CMV are not associated with the diagnostic score, giving strong assurance that these types of infections will not impact the diagnostic accuracy of the signature. Thus, these infections will not increase the diagnostic signature score and result in a false positive acute cellular rejection diagnosis. On the other hand, the association of BKV infection with the signature suggests that the presence or absence of BKV infections needs to be confirmed prior to ascribing an elevated diagnostic signature score to acute cellular rejection. In the clinical setting, this can and should be accomplished by screening for BKV in blood or urine, a routine clinical practice in many transplant centers.
Kits
[0132] The methods can also be performed by use of kits that are described herein. In general, kits can include a detection reagent that is suitable for detecting the presence of a metabolite or an RNA of interest.
[0133] The kits can include a panel of probe and/or primer sets. Such probe and/or primer sets are designed to detect expression of one or more genes and provide information about the rejection of a graft. Preferred probe sets comprise probes or primers that can be labeled (e.g., fluorescer, quencher, etc.). Unlabeled probes or primers can also be provided in the kits.
[0134] The probes and primers are useful for detection of CDR mRNA, IP-10 mRNA, and 18S rRNA. The probe and/or primer sets are targeted at the detection of gene transcripts that are informative about acute rejection. Probe and/or primer sets may also comprise a large or small number of probes or primers that detect gene transcripts that are not informative about transplant rejection. Such probes and primers are useful as controls and for normalization. Probe and/or primer sets can be provided in the kits as a dry material or dissolved in solution. In some embodiments, probe and/or primer sets can be affixed to a solid substrate to form an array of probes. Probe and/or primer sets can be configured for multiplex PCR. The probes and/or primers can be nucleic acids (e.g., DNA, RNA, chemically modified forms of DNA and RNA), LNA, or PNA, or any other polymeric compound capable of specifically interacting with the desired nucleic acid sequences.
[0135] The kits can include components for isolating and/or detecting mRNA in essentially any sample (e.g., urine, blood, etc.), and a wide variety of reagents and methods are, in view of this specification, known in the art. Hence, the kits can include vials, swabs, needles, syringes, labels, pens, pencils, or combinations thereof.
[0136] Commercially available components can also be included in the kits.
[0137] For example, the kit can include components from QIAGEN, which manufactures a number of components for RNA isolation, including RNEASY, a Total RNA System (involving binding total RNA to a silica-gel-based membrane and spinning the RNA); OLIGOTEX for isolation of RNA utilizing spherical latex particles; and QIAGEN total RNA kit for In Vitro Transcripts and RNA clean-up.
[0138] The kits can include components for a fluorescence based real-time detection method. For example, the kits can include primers for generating cDNA and/or for amplification of mRNA and rRNA. The kits can include components for 5 nuclease assays employ oligonucleotide probes labeled with at least one fluorescer and at least one quencher. Prior to cleavage of the probe, the fluorescer excites the quencher(s) rather than producing a detectable fluorescence emission. The oligonucleotide probe hybridizes to a target oligonucleotide sequence for amplification in PCR. The nuclease activity of the polymerase used to catalyze the amplification of the primers of the target sequence serves to cleave the probe, thereby causing at least one fluorescer to be spatially separated from the quencher so that the signal from the fluorescer is no longer quenched. A change in fluorescence of the fluorescer and/or a change in fluorescence of the quencher due to the oligonucleotide probe being digested can be used to indicate the amplification of the target oligonucleotide sequence. Although some primers and probes are described in Table 4, other suitable primers and probes can be employed. Probes and primers can be designed using techniques available to those of skill in the art.
[0139] The kits can also include any of the following components: materials for obtaining a sample, enzymes, buffers, probes, primers for generating cDNA, primers for amplifying RNA or cDNA, materials for labeling nucleic acids, microarrays, one or more microarray reader, competitor nucleic acids, probes and/or primers for a housekeeping gene for normalization, control nucleic acids, and antibodies.
[0140] In further embodiments, kits can include a urine collection system. Urine collection systems can include essentially any material useful for obtaining and/or holding a urine sample. Urine collection systems may include, for example, tubing, a beaker, a flask, a vial, a test tube, a container, and/or a lid for a vial, test tube or container (e.g., a plastic container with a snap-on or screw top lid).
[0141] In certain embodiments, kits can also include a urine presentation system. A urine presentation system can include essentially any material that is useful for presenting the urine to be contacted with the appropriate detection or purification reagents. A urine presentation system may comprise, for example, a sample well, which may be part of a multi-well plate, a petri dish, a filter (e.g., paper, nylon, nitrocellulose, PVDF, cellulose, silica, phosphocellulose, or other solid or fibrous surface), a microchannel (which may be part of a microchannel array or a microfluidics device), a small tube such as a thin-walled PCR tube or a 1.5 ml plastic tube, a microarray to which urine or material obtained from urine may be applied, a capillary tube or a flat or curved surface with detection reagent adhered thereto, or a flat or curved surface with material that adheres to proteins or nucleic acids present in the urine sample.
[0142] Kits can include probes that may be affixed to a solid surface to form a customized array.
[0143] Kits may also comprise a sample preparation system. A sample preparation system comprises, generally, any materials or substances that are useful in preparing the urine sample to be contacted with the detection reagents. For example, a sample preparation system may comprise materials for separating urine sediments from the fluids, such as centrifuge tube, a microcentrifuge, or a filter (optionally fitted to a tube designed to permit a pressure gradient to be established across the filter). One example of a filter that can be used is a filter within a syringe, such as those available from Zymo Research (see website at zymoresearch.com/columns-plastics/column-filter-assemblies/zrc-gf-filter; e.g., ZRC-GF Filter). Other components that can be included in the kit include buffers, precipitating agents for precipitating either wanted or unwanted materials, chelators, cell lysis reagents, RNase inhibitors etc.
[0144] Collection, presentation and preparation systems can accomplished in various ways. For example, a filter can be used to separate urine sediments from the fluids, and the filter may be coated with antibodies suitable for specifically detecting the desired proteins. One of skill in the art would, in view of this specification, readily understand many combinations of components that a kit of the invention may comprise.
Definitions
[0145] An anti-rejection agent is any substance administered to a subject for the purpose of preventing or ameliorating a rejection state. Anti-rejection agents include, but are not limited to, azathioprine, cyclosporine, FK506, tacrolimus, mycophenolate mofetil, anti-CD25 antibody, antithymocyte globulin, rapamycin, ACE inhibitors, perillyl alcohol, anti-CTLA4 antibody, anti-CD40L antibody, anti-thrombin III, tissue plasminogen activator, antioxidants, anti-CD 154, anti-CD3 antibody, thymoglobin, OKT3, corticosteroid, or a combination thereof. Baseline therapeutic regimen is understood to include those anti-rejection agents being administered at a baseline time, subsequent to the transplant. The baseline therapeutic regimen may be modified by the temporary or long-term addition of other anti-rejection agents, or by a temporary or long-term increase or decrease in the dose of one, or all, of the baseline anti-rejection agents.
[0146] The term biopsy refers to a specimen obtained by removing tissue from living patients for diagnostic examination. The term includes aspiration biopsies, brush biopsies, chorionic villus biopsies, endoscopic biopsies, excision biopsies, needle biopsies (specimens obtained by removal by aspiration through an appropriate needle or trocar that pierces the skin, or the external surface of an organ, and into the underlying tissue to be examined), open biopsies, punch biopsies (trephine), shave biopsies, sponge biopsies, and wedge biopsies. Biopsies also include a fine needle aspiration biopsy, a minicore needle biopsy, and/or a conventional percutaneous core needle biopsy.
[0147] A sample includes fluid samples obtained from a subject. A sample can contain metabolites, cells, proteins, nucleic acids or other cellular matter. A sample for analysis of metabolites may be the liquid phase of a body fluid from which sedimentary materials have been substantially removed. A sample for analysis of RNA may be the sedimentary materials from centrifugation of a sample. Exemplary samples include, but are not limited to, blood samples containing peripheral blood mononuclear cells (PBMCs), urine samples containing urinary cells, urine supernatant that is substantially free of cells, a sample of bronchoalveolar lavage fluid, a sample of bile, pleural fluid or peritoneal fluid, or any other fluid secreted or excreted by a normally or abnormally functioning allograft, or any other fluid resulting from exudation or transudation through an allograft or in anatomic proximity to an allograft, or any fluid in fluid communication with the allograft. A sample can be directly obtained from a subject or it can be obtained indirectly, for example, after retrieval, transport and/or storage of the sample by another. A sample may also be obtained from essentially any body fluid including: urine, blood (including peripheral blood), lymphatic fluid, sweat, peritoneal fluid, pleural fluid, bronchoalveolar lavage fluid, pericardial fluid, gastrointestinal juice, bile, feces, tissue fluid or swelling fluid, joint fluid, cerebrospinal fluid, or any other named or unnamed fluid gathered from the anatomic area in proximity to the allograft or gathered from a fluid conduit in fluid communication with the allograft.
[0148] A post-transplantation sample refers to a sample obtained from a subject after the transplantation has been performed.
[0149] Baseline level of gene expression level includes the particular gene expression level of a healthy subject or a subject with a well-functioning transplant. The baseline level of gene expression includes the gene expression level of a subject without acute rejection. The baseline level of gene expression can be a number on paper or the baseline level of gene expression from a control sample of a healthy subject or a subject with a well-functioning transplant.
[0150] The term determining is used herein to mean testing, assaying, and/or physically manipulating a sample to ascertain what the sample contains. In some cases, determining can also include quantifying a component of a sample.
[0151] The term diagnosis is used herein to refer to the identification or classification of a molecular or pathological state, disease or condition. For example, diagnosis may refer to identification of a particular type of acute rejection, e.g., acute cellular rejection.
[0152] The term aiding diagnosis is used herein to refer to methods that assist in making a clinical determination regarding the presence, degree or other nature, of a particular type of symptom or condition of acute rejection.
[0153] The term prediction or predicting is used herein to refer to the likelihood that a patient will develop acute rejection. Thus, prediction also includes the time period without acute rejection.
[0154] A probe or primer as used herein refers to a group of nucleic acids that may be used to detect one or more genes (e.g., 18S rRNA, CD3, and IP-10). Detection may be, for example, through amplification as in PCR, QPCR, RT-PCR, or primer extension. Detection can also be through hybridization, or through selective destruction and protection, as in assays based on the selective enzymatic degradation of single or double stranded nucleic acids, or by detecting RNA affixed to a solid surface (e.g., a blot). Probes and/or primers may be labeled with one or more fluorescent labels, radioactive labels, fluorescent quenchers, enzymatic labels, or other detectable moieties. Probes may be any size so long as the probe is sufficiently large to selectively detect the desired nucleic acid or to serve as a primer for amplification.
[0155] Primers can be polynucleotides or oligonucleotides capable of being extended in a primer extension reaction at their 3 end. In order for an oligonucleotide to serve as a primer, it typically needs only be sufficiently complementary in sequence to be capable of forming a double-stranded structure with the template, or target, under the conditions employed. Establishing such conditions typically involves selection of solvent and salt concentration, incubation temperatures, incubation times, assay reagents and stabilization factors known to those in the art. The term primer or primer oligonucleotide refers to an oligonucleotide as defined herein, which is capable of acting as a point of initiation of synthesis when employed under conditions in which synthesis of a primer extension product that is complementary to a nucleic acid strand is induced, as, for example, in a DNA replication reaction such as a PCR reaction. Like non-primer oligonucleotides, primer oligonucleotides may be labeled according to any technique known in the art, such as with radioactive atoms, fluorescent labels, enzymatic labels, proteins, haptens, antibodies, sequence tags, mass label or the like. Such labels may be employed by associating them, for example, with the 5 terminus of a primer by a plurality of techniques known in the art. Such labels may also act as capture moieties. A probe or primer may be in solution, as would be typical for multiplex PCR, or a probe or primer may be adhered to a solid surface, as in an array or microarray. It is well known that compounds such as PNAs may be used instead of nucleic acids to hybridize to genes. In addition, probes may contain rare or unnatural nucleic acids such as inosine.
[0156] As used herein, the term polynucleotide or nucleic acid includes nucleotide polymers of any number. The term polynucleotide includes a molecule comprising any number of nucleotides, preferably, less than about 200 nucleotides. More preferably, polynucleotides are between 5 and 100 nucleotides in length. Most preferably, polynucleotides are 15 to 100 nucleotides in length. The exact length of a particular polynucleotide, however, will depend on many factors, which in turn depend on its ultimate function or use. Some factors affecting the length of a polynucleotide are, for example, the sequence of the polynucleotide, the assay conditions in terms of such variables as salt concentrations and temperatures used during the assay, and whether or not the polynucleotide is modified at the 5 terminus to include additional bases for the purposes of modifying the mass: charge ratio of the polynucleotide, or providing a tag capture sequence which may be used to geographically separate a polynucleotide to a specific hybridization location on a DNA chip, for example.
[0157] As used herein, the term transplantation refers to the process of taking a cell, tissue, or organ, called a transplant or graft from one individual and placing it or them into a (usually) different individual. The individual who provides the transplant is called the donor and the individual who received the transplant is called the recipient (or host). An organ, or graft, transplanted between two genetically different individuals of the same species is called an allograft. A graft transplanted between individuals of different species is called a xenograft.
[0158] As used herein, transplant rejection or allograft rejection refers to a functional and structural deterioration of the organ due to an active immune response expressed by the recipient, and independent of non-immunologic causes of organ dysfunction. Acute transplant rejection can result from the activation of recipient's T cells and/or B cells; the rejection primarily due to T cells is classified as T cell mediated acute rejection or acute cellular rejection (ACR) and the rejection in which B cells are primarily responsible is classified as antibody mediated acute rejection (AMR). In some embodiments, the methods and compositions provided can detect and/or predict acute cellular rejection.
[0159] As used herein, subject means a mammal. Mammals means any member of the class Mammalia including, but not limited to, humans, non-human primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, and swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice, and guinea pigs; or the like. The term subject does not denote a particular age or sex. Preferably the subject is a human patient. In some embodiments, the subject is a human who has received an organ transplant.
[0160] The term up-regulation, up-regulated, increased expression, and higher expression are used interchangeably herein and refer to the increase or elevation in the amount of a target mRNA or a target protein. In some embodiments, up-regulation, up-regulated, increased expression, and higher expression includes increases above a baseline (e.g., a control, or reference) level of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%. 95%, 100% or higher.
[0161] The term hybridization includes a reaction in which one or more nucleic acids or polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of a PCR reaction, primer extension reaction, or the enzymatic cleavage of a polynucleotide by a ribozyme.
[0162] As used herein, the terms hybridize and hybridization refer to the annealing of a complementary sequence to the target nucleic acid, i.e., the ability of two polymers of nucleic acid (polynucleotides) containing complementary sequences to anneal through base pairing. The terms annealed and hybridized are used interchangeably throughout, and are intended to encompass any specific and reproducible interaction between a complementary sequence and a target nucleic acid, including binding of regions having only partial complementarity. Certain bases not commonly found in natural nucleic acids may be included in the nucleic acids of the present invention and include, for example, inosine and 7-deazaguanine. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the complementary sequence, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs. The stability of a nucleic acid duplex is measured by the melting temperature, or T.sub.m. The T.sub.m of a particular nucleic acid duplex under specified conditions is the temperature at which on average half of the base pairs have disassociated.
[0163] Hybridization reactions can be performed under conditions of different stringency. The stringency of a hybridization reaction includes the difficulty with which any two nucleic acid molecules will hybridize to one another. Under stringent conditions, nucleic acid molecules at least 60%, 65%, 70%, 75% identical to each other remain hybridized to each other, whereas molecules with low percent identity cannot remain hybridized. A preferred, non-limiting example of highly stringent hybridization conditions are hybridization in 6sodium chloride/sodium citrate (SSC) at about 45 C., followed by one or more washes in 0.2SSC, 0.1% SDS at 50 C., preferably at 55 C., more preferably at 60 C., and even more preferably at 65 C. When hybridization occurs in an antiparallel configuration between two single-stranded polynucleotides, the reaction is called annealing and those polynucleotides are described as complementary. A double-stranded polynucleotide can be complementary or homologous to another polynucleotide if hybridization can occur between one of the strands of the first polynucleotide and the second polynucleotide.
[0164] Complementarity or homology is quantifiable in terms of the proportion of bases in opposing strands that are expected to hydrogen bond with each other, according to generally accepted base-pairing rules.
[0165] The term stringency is used in reference to the conditions of temperature, ionic strength, and the presence of other compounds, under which nucleic acid hybridizations are conducted. With high stringency conditions, nucleic acid base pairing will occur only between nucleic acid fragments that have a high frequency of complementary base sequences. Thus, conditions of medium or low stringency are often required when it is desired that nucleic acids which are not completely complementary to one another be hybridized or annealed together. The art knows well that numerous equivalent conditions can be employed to comprise medium or low stringency conditions. The choice of hybridization conditions is generally evident to one skilled in the art and is usually guided by the purpose of the hybridization, the type of hybridization (DNA-DNA or DNA-RNA), and the level of desired relatedness between the sequences (e.g., Sambrook et al. (1989); Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington D.C. 1985, for a general discussion of the methods).
[0166] The stability of nucleic acid duplexes is known to decrease with an increased number of mismatched bases, and further to be decreased to a greater or lesser degree depending on the relative positions of mismatches in the hybrid duplexes. Thus, the stringency of hybridization can be used to maximize or minimize stability of such duplexes. Hybridization stringency can be altered by: adjusting the temperature of hybridization; adjusting the percentage of helix destabilizing agents, such as formamide, in the hybridization mix; and adjusting the temperature and/or salt concentration of the wash solutions. For filter hybridizations, the final stringency of hybridizations often is determined by the salt concentration and/or temperature used for the post-hybridization washes.
[0167] High stringency conditions when used in reference to nucleic acid hybridization include conditions equivalent to binding or hybridization at 42 C. in a solution consisting of 5SSPE (43.8 g/l NaCl, 6.9 g/1NaH.sub.2PO.sub.4 H.sub.2O and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5Denhardt's reagent and 100 g/ml denatured salmon sperm DNA followed by washing in a solution comprising 0.1SSPE, 1.0% SDS at 42 C. when a probe of about 500 nucleotides in length is employed. In general, the stringency of hybridization is determined by the wash step. Hence, a wash step involving 0.1SSPE, 1.0% SDS at a temperature of at least 42 C. can yield a high stringency hybridization product. In some instances the high stringency hybridization conditions include a wash in 1SSPE, 1.0% SDS at a temperature of at least 50 C., or at about 65 C.
[0168] Medium stringency conditions when used in reference to nucleic acid hybridization include conditions equivalent to binding or hybridization at 42 C. in a solution consisting of 5SSPE (43.8 g/l NaCl, 6.9 g/l NaH.sub.2PO.sub.4 H.sub.2O and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5Denhardt's reagent and 100 g/ml denatured salmon sperm DNA followed by washing in a solution comprising 1.0SSPE, 1.0% SDS at 42 C. when a probe of about 500 nucleotides in length is employed. Hence, a wash step involving 1.0SSPE, 1.0% SDS at a temperature of 42 C. can yield a medium stringency hybridization product.
[0169] Low stringency conditions include conditions equivalent to binding or hybridization at 42 C. in a solution consisting of 5SSPE (43.8 g/l NaCl, 6.9 g/l NaH.sub.2PO.sub.4 H.sub.2O and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.1% SDS, 5Denhardt's reagent [50Denhardt's contains per 500 ml: 5 g Ficoll (Type 400, Pharmacia), 5 g BSA (Fraction V; Sigma)] and 100 g/ml denatured salmon sperm DNA followed by washing in a solution comprising 5SSPE, 0.1% SDS at 42 C. when a probe of about 500 nucleotides in length is employed. Hence, a wash step involving 5SSPE, 1.0% SDS at a temperature of 42 C. can yield low stringency hybridization product.
[0170] A gene product includes a peptide, polypeptide, or structural RNA generated when a gene is transcribed and/or translated. While an mRNA encoding a peptide or polypeptide can be translated to generate the peptide or polypeptide, a structural RNA (e.g., an rRNA) is not translated. In some embodiments, the target gene expresses 18S rRNA, CD3c, and IP-10.
[0171] The term level of gene expression as used herein refers to quantifying gene expression. In some embodiments, to accurately assess whether increased mRNA or rRNA is significant, it is preferable to normalize gene expression to accurately compare levels of expression between samples, i.e., it is a baseline level against which gene expression is compared. Quantification of gene expression can be accomplished by methods known in the art, such as, for example, reverse transcription polymerase chain reaction (RT-PCR), TAQMAN assays or the like. Gene expression can also be quantified by detecting a protein, peptide or structural RNA gene product directly, in a variety of assay formats known to those of ordinary skill in the art. For example, proteins and peptides can be detected by an assay such as an enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunofluorimetry, immunoprecipitation, equilibrium dialysis, immunodiffusion, immunoblotting, mass spectrometry and other techniques. See, e.g., Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1 88; Weir, D. M., Handbook of Experimental Immunology, 1986, Blackwell Scientific, Boston.
[0172] As used herein, the term biomarker includes a polynucleotide or polypeptide molecule which is present or increased in quantity or activity in subjects having acute rejection or where the acute rejection is anticipated.
[0173] As used herein, the term panel of biomarkers includes a group of markers, the quantity or activity of each member of which is correlated with subjects having acute rejection or where the acute rejection is anticipated. In certain embodiments, a panel of markers may include only those markers which are either increased in quantity or activity in those subjects. In some embodiments, the panel of markers include 18S rRNA, CD3-epsilon, and IP-10.
[0174] The following non-limiting Examples describe some of the experiments performed in the development of the invention.
Example 1: Materials and Methods
[0175] This Example describes some of the materials and methods employed in various experiments.
Urine Sample Collection
[0176] Four hundred and eighty five patients with end stage renal disease were enrolled in the parent CTOT-04 multicenter, prospective observational study (Suthanthiran et al., N Engl J Med 369: 20-31 (2013)). Five clinical sites enrolled the CTOT-04 study participants.
[0177] Fifty to 100 ml of midstream urine were collected in a sterile, sealed urine collection cup without addition of any preservatives. Urine was processed within 1 hour of collection and if this was not possible, urine was refrigerated at 4 C. for a maximum time of 4 hours. The urine sample was centrifuged at 2000 g at room temperature for 30 minutes in sterile disposable tubes. After centrifugation, 6 ml of the supernatant was aspirated using a pipette without disturbing the cell pellet and transferred to four (4) 1.5 ml microcentrifuge polypropylene tubes.
[0178] The supernatants and the cell pellets were stored as specified by the NIH-sponsored Statistical Analysis and Clinical Coordinating Center. In brief, the supernatants and the cell pellets from the urine specimens were first stored at the clinical site at 80 C. and shipped in a Styrofoam container with dry ice. The samples from the 80 C. freezer were transferred into the middle of the dry ice to avoid any thawing of the samples. The samples were then covered with more dry ice so that the samples were completely surrounded by at least 10 cm of dry ice on all sides. The Styrofoam container was covered with a well-fitting cover and the box was sealed with duct tape. The samples were shipped to Weill Cornell Medical College Core Laboratory and stored at 80 C.
[0179] Sequential urine samples were collected from the study participants on post-transplant days 3, 7, 15 and 30 and in months 2, 3, 4, 5, 6, 9 and 12 and at the time of biopsy. A total of 4300 urine samples were prospectively collected from 485 kidney graft recipients (patients), and urine pellet and cell free supernatants were prepared at each clinical site using the standard protocol summarized above. Non-targeted metabolomics and targeted metabolite measurements were performed on aliquots of supernatants that were never thawed prior to metabolite analysis.
[0180]
TABLE-US-00004 TABLE 1 Characteristics of CTOT-04 kidney transplant recipients included in the analysis to develop metabolite/RNA signatures discriminating ACR biopsies from No Rejection biopsies Patients with Patients with ACR No Rejection Total* Biopsies Biopsies (N = 185) (N = 36) (N = 149) p-value Recipient Characteristics Age, years Mean (SD) 46.9 (12.8) 45.1 (12.3) 47.3 (12.9) 0.20 Median 46 42 47 Min, Max 0.1, 76 24, 72 0.1, 77 Gender, N (%) Female 58 (31.4)) 9 (25.0) 49 (32.9) 0.87 Male 127 (68.6) 27 (75.0) 100 (67.1) Ethnicity, N (%) Hispanic or 28 (15.1) 3 (8.3) 25 (16.8) 0.18 Latino Not Hispanic 149 (80.5) 31 (86.1) 118 (79.2) or Latino Unknown or 8 (4.3) 2 (5.6) 6 (4.0) Not Reported Race, N (%) Black or 68 (36.8) 14 (38.9) 54 (36.2) 0.54 African American White 99 (53.5) 21 (58.3) 78 (52.4) Asian 11 (6.0)) 1 (2.8) 10 (6.7) American 0 0 0 Indian or Alaskan Native Other 2 (1.1) 0 2 (1.1) More Than 0 0 0 One Race Unknown or 5 (2.7) 0 5 (3.4) Not Reported Induction Therapy, N (%) IL-2 Receptor 23 (13.1) 7 (19.4) 16 (11.4) 0.83 Antibody CAMPATH- 72 (40.9) 11 (30.6) 61 (43.6) IH Thymo- 69 (39.2) 15 (41.7) 54 (38.6) globulin More than one 9 (5.1) 2 (5.6) 7 (5.0) induction therapy No induction 3 (1.7) 1 (2.8) 2 (1.4) Therapy Missing 9 0 9 information, N BMI Mean (SD) 28.8 (6.3) 30.1 (6.5) 28.4 (6.2) 0.09 Median 27.5 28.6 27.5 Min, Max 17, 45 20, 43 17, 45 <18.5, N (%) 55 (31.6) 11 (33.3) 44 (31.2) 0.29 18.5-24.9, N 53 (30.5) 7 (21.2) 46 (32.6) (%) 25.0-29.9, N 3 (1.7) 0 3 (2.1) (%) 30.0, N (%) 63 (36.2) 15 (45.5) 48 (34.0) Missing 11 3 8 eGFR (mL/min)** Number of 183 37 146 Measurements Mean (SD) 30 (17) 43 (23) 0.003 Median 27 40 Min, Max 4.7, 72.3 3.4, 107.7 Serum Creatinine (mg/dL) Number of 183 37 146 Measurements Mean (SD) 3.7 (2.9) 2.5 (2.3) 0.0003 Median 2.8 1.9 Min, Max 1 .1, 13.3 0.7, 21.2 Donor Characteristics Age Mean (SD) 40.8 (14.4) 42.4 (11.5) 40.4 (15.1) 0.28 Median 41 40 41 Min, Max 0.4, 66 24, 65 0.4, 66 Missing 3 0 3 Gender, N (%) Female 88 (47.6) 18 (50.0) 70 (47.0) 0.54 Male 97 (52.4) 18 (50.0) 79 (53.0) Ethnicity, N (%) Hispanic or 29 (15.7) 4 (11.1) 25 (16.8) 0.27 Latino Not Hispanic 138 (74.6) 29 (80.6) 109 (58.9) or Latino Unknown or 18 (9.7) 3 (8.3) 15 (10.1) Not Reported Race, N (%) Black or 47 (25.4) 10 (27.8) 37 (24.8) 0.78 African American White 122 (66.0) 24 (66.7) 98 (65.8) Asian 5 (2.7) 1 (2.8) 4 (2.7) American 0 0 0 Indian or Alaskan Native Other 1 (0.5) 0 1 (0.7) Unknown or 10 (5.4) 1 (2.8) 9 (6.0) Not Reported Source of Donor, N (%) Deceased 86 (46.5) 17 (47.2) 69 (46.3) 0.43 Living, related 53 (28.7) 9 (25.0) 44 (29.5) Living, 46 (24.9) 10 (27.8) 36 (24.2) unrelated
Urine Sample Selection for Metabolomics.
[0181] From a total of 4300 urine samples prospectively collected from the 485-kidney allograft recipients (patients) enrolled in the parent CTOT-04 study, 1518 urine samples were selected for metabolite analysis to include the following urine samples: (1) all biopsy-matched urine samples, 298 samples matched to 298 kidney allograft biopsies performed in 190 patients (biopsy matched urine samples=urine samples collected from 3 days before to 1 day after the biopsy); (2) all 808 sequential samples from 112 patients that preceded a first biopsy classified using Banff classification schema2 as acute cellular rejection, antibody-mediated rejection, borderline changes, or other, and sequential samples that preceded No Rejection biopsies; and (3) all 412 sequential samples from 40 patients with stable graft function and who had at least 10 sequential samples collected in the first 400 days of transplantation and with sufficient RNA for urinary cell RNA profiling. The kidney allograft recipients designated as patients with stable graft function did not undergo biopsy during the first 400 days of transplantation and met the following additional criteria: (i) average serum creatinine less than or equal to 2.0 mg per deciliter [180 micromol per liter] at 6, 9 and 12 months following transplantation, (ii) no treatment for acute rejection, and (iii) no evidence of cytomegalovirus (CMV) or polyomavirus type BK (BKV) infection.
[0182] The number of patients in the three categories listed under the metabolomics (
[0183] Two of the 1,518 samples were excluded from all analyses: one biopsy-matched urine sample (sample ID: 4202) from a patient (patient ID: 10137) with a No Rejection biopsy result was excluded due to failed osmolality measurements and only 80 metabolites being measured in that sample; and one of the sequential, non-biopsy associated samples from a patient with other biopsy findings (urine sample ID:0988; patient ID: 10014) did not contain sufficient cell free supernatant for non-targeted metabolite analysis. After exclusion of these two samples, high-quality metabolite data from 1516 samples collected from 241 kidney patients were available for data analysis.
[0184] Among the 298 biopsy matched urine samples, all 50 ACR biopsy matched urine samples from 36 patients and all 198 No Rejection biopsy urine samples from 149 patients were included in the analysis to determine whether metabolite profiles are diagnostic of acute cellular rejection. Urine samples matched to biopsies classified as borderline changes (27 samples from 25 patients), AMR (13 samples from 11 patients) and other findings (9 samples from 8 patients) were all also analyzed but excluded from the analyses to generate the diagnostic signature distinguishing ACR biopsies from No Rejection biopsies. The sequential samples preceding borderline changes, AMR and other findings were also not included in the analysis to determine whether the signature distinguishes patients who developed ACR from those whose biopsies did not show rejection changes (No Rejection biopsies).
[0185] A total of 2782 urine samples collected during the parent CTOT-04 study were excluded from non-targeted metabolite analysis because: (1) the urine samples were not matched to biopsy specimens or were collected following a biopsy (1074 specimens from 187 patients), (2) had unstable allograft function and no biopsy or were lost to follow up (272 urine samples from 63 patients) or (3) had stable graft function but had less than 10 sequential samples collected in the first 400 days of transplantation; urine samples collected after 400 days and with insufficient RNA for RNA profiling are also included in this group of 1436 specimens from 180 patients. The number of patients in the three categories excluded from metabolomics exceeds 243 unique patients because several patients had multiple urine samples and contributed urine samples to more than one category and thereby counted in each category.
Metabolomics Data Acquisition.
[0186] The extracted samples were split into equal parts for analysis on the GC/MS and LC/MS/MS platforms; also included were several technical replicate samples created from a homogeneous pool containing a small amount of all study samples (Client Matrix). Instrument variability was determined by calculating the median relative standard deviation (RSD) for the internal standards that were added to each sample prior to injection into the mass spectrometers. Overall process variability was determined by calculating the median RSD for all endogenous metabolites (i.e., non-instrument standards) present in 100% of the Client Matrix samples, which are technical replicates of pooled client samples. Metabolites of known structural identity (named biochemicals) as well as metabolites of unknown structural identity (unnamed biochemicals) detected in the samples were detected.
[0187] Non-targeted metabolomics of urine was performed at Metabolon Inc. (Durham). Following receipt of samples by Metabolon, samples were inventoried and immediately stored at 80 C. Samples were maintained at 80 C. until processed. Sample preparation was carried out using an automated system (MicroLab STAR, Hamilton Robotics). Recovery standards were added prior to the first step in the extraction process for QC purposes. At the time of analysis, samples were extracted and prepared for analysis using Metabolon's standard solvent extraction method. The extracted samples were split into equal parts for analysis on the GC/MS and LC/MS/MS platforms. Sample preparation was conducted using a proprietary series of organic and aqueous extractions to remove the protein fraction while allowing maximum recovery of small molecules. The resulting extract was divided into two fractions; one for analysis by LC and one for analysis by GC.
[0188] The samples were placed briefly on a TurboVap (Zymark) to remove the organic solvent. Each sample was then frozen, dried under vacuum, and prepared for the appropriate instrument, either LC/MS or GC/MS. For QA/QC purposes, a number of additional samples were included with each day's analysis. Furthermore, a selection of QC metabolites was added to every sample, including those under test. These metabolites were carefully chosen so as not to interfere with the measurement of the endogenous metabolites.
Liquid Chromatography/Mass Spectrometry (LC/MS, LC/MS2) for Metabolite Profiling.
[0189] The LC/MS portion of the platform was based on a Waters ACQUITY UPLC and a Thermo-Finnigan LTQ mass spectrometer, which consisted of an electrospray ionization (ESI) source and linear ion-trap (LIT) mass analyzer. The dried sample extract was split into two aliquots, and then reconstituted in acidic or basic LC-compatible solvents, each of which contained 11 or more injection standards at fixed concentrations. One aliquot was analyzed using acidic positive ion optimized conditions and the other using basic negative ion optimized conditions in two independent injections using separate dedicated columns (Waters UPLC BEH C18-2.1100 mm, 1.7 m). Extracts reconstituted in acidic conditions were gradient eluted using water and methanol both containing 0.1% formic acid, while the basic extracts, which also used water/methanol, contained 6.5 mM ammonium bicarbonate. The MS analysis alternated between MS and data-dependent MS2 scans, using dynamic exclusion, and the scan range was from 80-1000 m/z. For ions with counts greater than 2 million, an accurate mass measurement could be performed. Accurate mass measurements were made for the parent ion as well as fragments. The typical mass error was less than 5 ppm. Ions with less than two million counts require a greater amount of effort to characterize. Fragmentation spectra (MS/MS) were typically generated in a data dependent manner, but if necessary, targeted MS/MS was employed, such as in the case of lower level signals.
Gas Chromatography/Mass Spectrometry (GC/MS) for Metabolite Profiling.
[0190] The samples destined for GC/MS analysis were re-dried under vacuum desiccation for a minimum of 24 hours prior to being derivatized under dried nitrogen using bistrimethyl-silyl-trifluoroacetamide (BSTFA). The GC column was 5% diphenyl/95% dimethyl polysiloxane fused silica column (20 m0.18 mm ID; 0.18 urn film thickness) with helium as the carrier gas and a temperature ramp from 60 to 340 C. over a 17.5-min period. Samples were analyzed on a Thermo-Finnigan Trace DSQ fast-scanning single-quadruple mass spectrometer using electron impact ionization and operated at unit mass resolving power. The scan range was 50-750 m/z. The instrument was tuned and calibrated for mass resolution and mass accuracy on a daily basis.
Metabolite Identification
[0191] The informatics system consisted of four major components, the Metabolon Laboratory Information Management System, the data extraction and peak-identification software, data processing tools for QC and metabolite identification, and a collection of information interpretation and visualization tools for use by data analysts. The data extraction of the raw mass spectroscopy data files yielded information that was loaded into a relational database. Once in the database the information was examined and appropriate QC limits were imposed, peaks were identified using Metabolon's proprietary peak integration software; and component parts were stored in a separate, specifically designed complex data structure.
[0192] Metabolites were identified by comparison to library entries of purified standards or recurrent unknown entities. More than 3,500 commercially available purified standard compounds have been acquired and registered into the LIMS for distribution to both the LC and GC platforms for determination of their analytical characteristics. The combination of chromatographic properties and mass spectra provided a match to a specific compound or an isobaric entity.
[0193] Using the Metabolon platform, metabolite data (ion-counts) was obtained for a total of 1516 urine samples. In total, 749 different metabolites from 65 metabolic pathways, including 368 metabolites of unknown identity, were identified on at least one of the three mass spectrometry based metabolomics platforms. A first data normalization step was performed to correct for variation resulting from instrument inter-day tuning differences. Essentially, each compound was corrected in run-day blocks by registering the medians to equal one and normalizing each data point proportionately. Values were then divided by urine osmolality and log.sub.10-scaled. Outliers of more than four standard deviations (S.D.) from the mean were removed. Mean and S.D. values were determined on the 5% to 95% range of the data for this purpose. It was rare that more than two outlier values were removed from a metabolite. Finally, the data were z-scaled (mean=0, s.d.=1).
Metabolomics Data.
[0194] In total, 749 different metabolites from 65 metabolic pathways, including 368 metabolites of unknown identity, were identified on at least one of the three mass spectrometry based metabolomics platforms. 358 metabolites were reported from the LC/MS platform running in negative ionization mode, 245 using LC/MS in positive mode, and 146 using GC/MS. The median number of different metabolites detected in any single sample was 616. The median technical error as determined from technical replicates on pooled sample material (s.d./mean) was 10.2%, while the median experimental variance computed from data on all patient samples was 113.9%, showing overall excellent signal-to-noise performance.
Stability of Metabolites in Urine.
[0195] The stability of metabolites in stored samples is can be an issue; urine supernatants stored for different durations were not analyzed. The data obtained indicates that urine supernatants stored over several years yield robust metabolite signatures diagnostic of acute cellular rejection. The first urine specimen included the 1516 samples analyzed for metabolites was collected in 2006 and the last urine specimen was collected in 2009. Non-targeted metabolite analysis of the stored urine supernatants was performed in year 2012 at Metabolon Inc. and showed that the metabolite profiles including the ratio of 3-sialyllactose to xanthosine (3SL/X) are diagnostic of acute cellular rejection. Rapid Fire-QTOF MS/MS assay for the measurement of 3SL/X ratio was developed and the assays demonstrated that the ratio of 3SL/X is diagnostic of acute cellular rejection. Importantly, the observed correlation between the 3SL/X ratio calculated from the Metabolon data and the 3SL/X ratio measured using RapidFire-QTOF assay was 0.65 (Pearson R), and the Bland-Altman method for comparison showed that only 12 samples (6%) were beyond the 95% limit of agreement.
Statistical Analyses
[0196] R and R-studio (R-project, versions 2.12.1 and 3.0.1) and SPSS (IBM, version 21) were used for statistical analysis. Linear models were computed using the lm-package, logistic models using the glm-package (family binomial), and ROC curves using the ROC-package. Linear regression [M.sub.i=f(ACR status)] and logistic regression [ACR=f(M.sub.i)] were computed for all 749 log-normalized and then z-scored metabolite data vectors (M.sub.i) for all samples with valid data taken at the time of a biopsy diagnosed as either ACR (coded 1) or No rejection (coded 0). Full association data from these analyses are provided in Tables 2 and 3.
[0197] For Table 2, the numerator refers to a Metabolon compound identifier in the numerator; the denominator refers to a Metabolon compound identifier in the denominator (where one indicates no ratio); the term ncases refers to the number of data points used in the statistics; the term beta refers to the differences in mean levels of metabolites between ACR and No Rejection groups; the p-value refers to the p-value of the association with ACR; the p-gain refers to the p-gain of the association with ACR (when using ratios).
[0198] As shown, the difference in mean levels of metabolites quinolinate/X-16397 between ACR and No Rejection groups is 0.89. The difference in mean levels of metabolites 3-sialyllactose/xanthosine is 0.86.
TABLE-US-00005 TABLE 2 Linear regression [Mi = f(ACR)] using all samples with matching biopsy numerator denominator ncases beta p-value p-gain quinolinate X-16397 248 0.89 7.3E09 25,031 quinolinate 4-hydroxy 248 0.88 1.1E08 16,954 mandelate neopterin xanthosine 234 0.90 2.0E08 72,220 quinolinate X-16570 242 0.87 2.6E08 7,103 proline X-13723 233 0.87 2.8E08 1,749 quinolinate xylitol 247 0.86 3.1E08 5,796 quinolinate X-12748 248 0.85 3.5E08 5,259 3-sialyllactose xanthosine 242 0.86 5.0E08 201,100 X-12117 X-13723 229 0.86 6.6E08 5,568 quinolinate cis-aconitate 246 0.83 9.0E08 2,012 quinolinate ribulose 241 0.85 9.2E08 1,984 neopterin X-16570 235 0.84 9.7E08 14,493 neopterin N1-methyl- 238 0.83 1.2E07 11,361 guanosine quinolinate homo- 247 0.82 1.4E07 1,273 vanillate (HVA) quinolinate X-13723 235 0.83 1.6E07 1,155 X-12690 xanthosine 242 0.83 1.6E07 61,644 X-12117 xanthosine 236 0.83 2.0E07 2,374 3-sialyllactose X-16397 247 0.77 5.9E07 26,062 fucitol xylitol 244 0.77 6.1E07 4,288 neopterin X-12748 240 0.77 9.9E07 1,433 kynurenate xanthosine 241 0.78 1.0E06 1,262 neopterin xylitol 239 0.77 1.2E06 1,165 neopterin X-16674 224 0.78 1.4E06 1,002 neopterin N2-methyl- 236 0.77 1.6E06 910 guanosine X-12690 N2-methyl- 242 0.76 1.6E06 3,297 guanosine fucitol N2-methyl- 239 0.76 1.6E06 3,259 guanosine X-17366 N2-methyl- 237 0.75 2.9E06 1,830 guanosine 3-sialyllactose X-16570 242 0.73 3.1E06 1,115 fucitol 4-hydroxy- 244 0.72 3.7E06 1,493 mandelate X-17366 xanthosine 237 0.74 3.7E06 2,732 X-18486 N2-methyl- 243 0.74 3.9E06 1,338 guanosine N-acetyl- N2-methyl- 242 0.74 4.0E06 1,325 neuraminate guanosine X-18486 xanthosine 242 0.73 4.7E06 2,172 X-12715 4-hydroxy- 247 0.71 5.1E06 814 phenyl- acetate hydantoin-5- xanthosine 223 0.74 5.4E06 1,894 propionic acid 5-oxoproline xanthosine 242 0.70 1.1E05 898 X-11945 xanthosine 242 0.70 1.3E05 788 X-11491 4-imidazole- 132 1.07 1.4E05 3,701 acetate fucitol isocitrate 243 0.67 1.7E05 3,699 fucitol ribitol 243 0.66 2.3E05 886 X-11491 7-methyl- 128 1.00 2.6E05 1,977 xanthine fucitol xylulose 244 0.64 4.5E05 899 proline one 245 0.63 4.9E05 1 fucitol ribulose 238 0.64 6.3E05 835 fucitol 5-amino- 233 0.64 7.4E05 849 levulinate X-11491 X-12267 150 0.86 8.7E05 1,547 3-hydroxy- X-13724 165 0.77 9.1E05 825 butyrate (BHBA) diglycerol X-12747 91 1.09 9.7E05 947 quinolinate one 247 0.59 1.8E04 1 X-12832 X-11452 202 0.64 2.0E04 811 isoleucine one 244 0.58 2.1E04 1 X-13723 one 235 0.57 3.7E04 1 X-12117 one 242 0.55 4.9E04 1 X-16940 one 241 0.55 5.8E04 1 leucine one 246 0.52 9.9E04 1 pipecolate one 239 0.52 1.1E03 1 paraxanthine one 158 0.63 1.1E03 1 1,5-anhydro- one 197 0.57 1.1E03 1 glucitol (1,5-AG) X-19434 one 126 0.77 1.3E03 1 kynurenate one 245 0.51 1.3E03 1 neopterin one 240 0.51 1.4E03 1 myo-inositol one 248 0.49 1.7E03 1 gentisate one 243 0.50 1.8E03 1 valine one 243 0.49 1.9E03 1 N-methyl- one 175 0.58 2.5E03 1 acetaminophen sulfate 1* xylitol one 248 0.47 2.6E03 1 homovanillate one 247 0.47 3.1E03 1 (HVA) uracil one 248 0.47 3.1E03 1 trigonelline one 247 0.46 3.3E03 1 (N-methyl- nicotinate) X-16570 one 242 0.47 3.5E03 1 4-hydroxy- one 248 0.45 4.2E03 1 phenylacetate phenylalanine one 245 0.45 4.2E03 1 X-12230 one 212 0.50 4.6E03 1 N2-methyl- one 244 0.45 5.3E03 1 guanosine 4-hydroxy- one 248 0.44 5.5E03 1 mandelate xanthine one 247 0.43 5.8E03 1 3-(N-acetyl-L- one 147 0.55 5.9E03 1 cystein-S-yl) acetaminophen* kynurenine one 245 0.43 6.4E03 1 phosphate one 248 0.43 6.6E03 1 X-14625 one 239 0.42 8.9E03 1 stachydrine one 248 0.41 9.3E03 1 X-17320 one 154 0.51 9.9E03 1 acetylcarnitine one 248 0.41 9.9E03 1 xanthosine one 242 0.42 1.0E02 1 X-17366 one 240 0.40 1.2E02 1 2-methoxy- one 124 0.53 1.2E02 1 acetaminophen sulfate* X-17185 one 194 0.48 1.4E02 1 4-vinylphenol one 239 0.39 1.4E02 1 sulfate X-12114 one 247 0.39 1.5E02 1 3-sialyllactose one 248 0.38 1.5E02 1 X-17370 one 161 0.48 1.6E02 1 X-12221 one 234 0.39 1.6E02 1 urate one 248 0.38 1.6E02 1 lysine one 246 0.38 1.7E02 1 3-hydroxy- one 162 0.43 1.7E02 1 kynurenine p-acetamido- one 170 0.46 1.7E02 1 phenyl- glucuronide hydantoin-5- one 229 0.38 1.7E02 1 propionic acid 1-(3-amino- one 235 0.38 1.7E02 1 propyl)-2- pyrrolidone citrate one 248 0.37 1.8E02 1 X-17735 one 232 0.39 1.8E02 1 1-methyl- one 222 0.41 1.8E02 1 xanthine X-18945 one 232 0.38 1.8E02 1 3-(3-hydroxy- one 170 0.45 1.9E02 1 phenyl)propionate arginine one 229 0.39 1.9E02 1 propionyl- one 233 0.37 1.9E02 1 carnitine 5-hydroxy- one 238 0.38 2.0E02 1 methyl-2-furoic acid ribitol one 247 0.37 2.1E02 1 X-12690 one 247 0.37 2.1E02 1 3,4-dihydroxy- one 244 0.37 2.1E02 1 phenylacetate X-18887 one 246 0.36 2.1E02 1 2-methyl- one 239 0.37 2.2E02 1 butyryl-carnitine (C5) imidazole one 245 0.36 2.3E02 1 lactate X-16947 one 245 0.36 2.3E02 1 X-11843 one 161 0.45 2.4E02 1 3,5-dihydroxy- one 233 0.37 2.4E02 1 benzoic acid glucose one 248 0.35 2.5E02 1 X-15503 one 248 0.35 2.6E02 1 X-16674 one 232 0.36 2.6E02 1 pantothenate one 244 0.35 2.8E02 1 X-12379 one 205 0.38 2.9E02 1 X-12738 one 155 0.44 2.9E02 1 1,7- one 223 0.37 2.9E02 1 dimethylurate X-17369 one 93 0.55 2.9E02 1 3- one 248 0.34 3.1E02 1 aminoisobutyrate X-12306 one 133 0.61 3.1E02 1 catechol sulfate one 247 0.34 3.1E02 1 X-18486 one 248 0.34 3.1E02 1 5alpha- one 97 0.55 3.2E02 1 androstan- 3beta,17beta-diol disulfate X-12107 one 229 0.37 3.3E02 1 X-12039 one 246 0.34 3.3E02 1 X-12685 one 225 0.35 3.3E02 1 androsterone one 233 0.34 3.4E02 1 sulfate X-12364 one 228 0.36 3.4E02 1 homocitrulline one 244 0.34 3.4E02 1 X-12840 one 183 0.39 3.5E02 1 3-(cystein-S-yl)- one 133 0.47 3.5E02 1 acetaminophen* X-17398 one 178 0.40 3.6E02 1 1,6- one 248 0.33 3.6E02 1 anhydroglucose X-13726 one 240 0.34 3.7E02 1 4-acetaminophen one 203 0.36 3.9E02 1 sulfate hypoxanthine one 246 0.33 3.9E02 1 X-17350 one 211 0.35 3.9E02 1 azelate one 220 0.34 4.1E02 1 (nonanedioate) xylulose one 247 0.32 4.1E02 1 cystine one 188 0.37 4.2E02 1 methionine one 246 0.32 4.2E02 1 X-17300 one 130 0.45 4.4E02 1 X-12125 one 247 0.31 4.8E02 1 X-12855 one 211 0.34 4.8E02 1
[0199] For Table 3, the numerator refers to a Metabolon compound identifier in the numerator; the denominator refers to a Metabolon compound identifier in the denominator (where one indicates no ratio); the term ncases refers to the number of data points used in the statistics; the term OR refers to the odds ratio of the association with ACR, per 1 standard deviation change in predictor; the p-value refers to the p-value of the association with ACR; and the p-gain refers to the p-gain of the association with ACR (when using ratios).
TABLE-US-00006 TABLE 3 Logistic regression [ACR = f(Mi)] using all samples with matching biopsy Numerator denominator ncases OR p-value p-gain Quinolinate X-16397 248 2.59 1.9E07 1,769 neopterin xanthosine 234 2.54 6.0E07 3,658 3-sialyllactose xanthosine 242 2.47 9.9E07 11,463 neopterin X-16570 235 2.46 1.3E06 1,642 X-12690 xanthosine 242 2.54 1.7E06 6,590 neopterin N1-methyl- 238 2.36 1.9E06 1,126 guanosine fucitol xylitol 244 2.33 4.1E06 833 3-sialyllactose X-16397 247 2.24 4.5E06 3,778 fucitol isocitrate 243 2.02 4.9E05 1,324 proline one 245 1.79 1.4E04 1 quinolinate one 247 1.81 3.4E04 1 isoleucine one 244 1.77 4.5E04 1 X-13723 one 235 0.52 6.1E04 1 X-12117 one 242 1.70 8.5E04 1 X-16940 one 241 0.57 9.0E04 1 pipecolate one 239 1.63 1.6E03 1 leucine one 246 1.62 1.7E03 1 kynurenate one 245 1.63 2.0E03 1 neopterin one 240 1.61 2.2E03 1 myo-inositol one 248 1.70 2.3E03 1 gentisate one 243 0.59 2.4E03 1 valine one 243 1.63 2.5E03 1 xylitol one 248 0.62 3.4E03 1 uracil one 248 0.62 3.9E03 1 trigonelline (N- one 247 0.62 4.2E03 1 methylnicotinate) X-16570 one 242 0.62 4.3E03 1 homovanillate one 247 0.64 4.7E03 1 (HVA) 4-hydroxy one 248 0.62 5.1E03 1 phenylacetate phenyl- one 245 1.55 5.3E03 1 alanine X-12230 one 212 0.59 5.7E03 1 N2-methyl- one 244 0.63 6.2E03 1 guanosine 4-hydroxy- one 248 0.64 6.6E03 1 mandelate xanthine one 247 0.64 6.7E03 1 phosphate one 248 1.64 7.2E03 1 kynurenine one 245 1.56 7.5E03 1 X-14625 one 239 1.52 1.0E02 1 stachydrine one 248 1.54 1.0E02 1 xanthosine one 242 0.65 1.1E02 1 acetylcarnitine one 248 1.51 1.1E02 1 X-17366 one 240 1.49 1.4E02 1 4-vinylphenol one 239 0.67 1.5E02 1 sulfate X-12114 one 247 1.49 1.6E02 1 3-sialyllactose one 248 1.44 1.7E02 1 X-12221 one 234 0.67 1.7E02 1 urate one 248 1.49 1.8E02 1 lysine one 246 1.46 1.8E02 1 hydantoin-5- one 229 1.44 1.9E02 1 propionic acid 1-(3-aminopropyl)- one 235 1.45 1.9E02 1 2-pyrrolidone citrate one 248 0.69 2.0E02 1 X-17735 one 232 0.66 2.0E02 1 1-methylxanthine one 222 0.65 2.0E02 1 X-18945 one 232 1.47 2.0E02 1 arginine one 229 1.46 2.1E02 1 propionyl- one 233 1.47 2.1E02 1 carnitine 5-hydroxymethyl- one 238 0.67 2.1E02 1 2-furoic acid X-18887 one 246 1.46 2.2E02 1 ribitol one 247 0.70 2.3E02 1 X-12690 one 247 1.44 2.3E02 1 3,4-dihydroxy- one 244 0.70 2.4E02 1 phenylacetate 2-methylbutyryl- one 239 1.48 2.4E02 1 carnitine (C5) imidazole lactate one 245 0.69 2.4E02 1 X-16947 one 245 1.43 2.5E02 1 3,5-dihydroxy- one 233 0.66 2.6E02 1 benzoic acid X-15503 one 248 1.43 2.7E02 1 glucose one 248 1.40 2.7E02 1 X-16674 one 232 0.68 2.7E02 1 pantothenate one 244 0.70 2.9E02 1 1,7-dimethylurate one 223 0.70 3.1E02 1 X-12379 one 205 1.45 3.1E02 1 3-aminoisobutyrate one 248 0.70 3.2E02 1 X-18486 one 248 1.44 3.3E02 1 catechol sulfate one 247 0.72 3.4E02 1 X-12107 one 229 0.67 3.4E02 1 X-12039 one 246 0.71 3.5E02 1 X-12685 one 225 0.68 3.5E02 1 X-12364 one 228 1.46 3.5E02 1 androsterone one 233 1.42 3.6E02 1 sulfate homocitrulline one 244 1.40 3.6E02 1 1,6-anhydro- one 248 1.40 3.8E02 1 glucose X-13726 one 240 1.42 3.9E02 1 hypoxanthine one 246 0.71 4.0E02 1 4-acetaminophen one 203 1.44 4.1E02 1 sulfate X-17350 one 211 1.41 4.1E02 1 azelate one 220 0.69 4.3E02 1 (nonanedioate) xylulose one 247 0.73 4.3E02 1 methionine one 246 1.36 4.5E02 1 X-12125 one 247 1.36 4.9E02 1
[0200] Similarly, linear and logistic regressions were also computed limiting the sample set further to samples with both metabolite data and successful RNA quantification, that is, samples with available RNA signatures. Full association data from these analyses are provided in Tables 4, 5, and 6.
[0201] For Table 4, the numerator refers to a Metabolon compound identifier in the numerator; the denominator refers to a Metabolon compound identifier in the denominator (where one indicates no ratio); the term ncases refers to the number of data points used in the statistics; the term beta refers to the differences in mean levels of metabolites between ACR and No Rejection groups; the p-value refers to the p-value of the association with ACR; the p-gain refers to the p-gain of the association with ACR (when using ratios).
TABLE-US-00007 TABLE 4 Linear regression [Mi = f(ACR)] using all samples with matching biopsy and available RNA signature numerator denominator ncases beta p-value p-gain quinolinate 4-hydroxy- 206 0.96 6.7E09 59,573 mandelate quinolinate xylitol 205 0.93 2.3E08 17,578 3- xanthosine 201 0.93 4.5E08 191,212 sialyllactose proline 4-hydroxy- 205 0.90 5.1E08 823 phenylacetate quinolinate X-16397 206 0.89 8.2E08 4,854 neopterin xanthosine 195 0.92 1.0E07 50,721 quinolinate xylulose 206 0.86 2.2E07 1,773 quinolinate Homovanillate 205 0.87 2.3E07 1,692 (HVA) pipecolate 4-hydroxy- 199 0.87 2.4E07 1,763 phenylacetate X-12117 xanthosine 196 0.89 2.7E07 2,971 neopterin N1-methyl- 198 0.87 3.0E07 17,759 guanosine quinolinate arabitol 206 0.85 3.4E07 1,158 X-17366 xanthosine 197 0.88 3.5E07 24,658 X-12117 X-13723 193 0.87 4.0E07 2,048 X-18486 xanthosine 201 0.87 4.7E07 18,221 quinolinate X-16570 203 0.85 4.9E07 802 neopterin 4-hydroxy- 200 0.85 5.3E07 796 phenylacetate pipecolate xanthosine 194 0.87 6.2E07 912 X-12117 xylonate 201 0.84 6.3E07 1,292 kynurenate xanthosine 201 0.85 7.1E07 12,163 X-12117 galactose 200 0.84 7.2E07 1,126 X-12114 4-hydroxy- 204 0.82 8.2E07 1,364 mandelate X-12117 N2-methyl- 195 0.86 8.4E07 961 guanosine neopterin xylitol 199 0.84 8.4E07 816 X-12117 4-hydroxy- 201 0.83 8.8E07 917 mandelate X-12117 aconate 198 0.83 1.1E06 751 (methyl- fumarate) 2-methyl- xanthine 199 0.82 1.3E06 865 butyryl- carnitine (C5) X-11491 X-13723 126 1.09 1.3E06 929 neopterin X-16570 197 0.82 1.5E06 3,384 X-12690 xanthosine 201 0.82 1.8E06 4,760 neopterin X-16674 186 0.83 2.0E06 2,612 3-sialyl- X-16397 206 0.79 2.3E06 11,237 lactose methionine xanthosine 199 0.82 2.4E06 1,764 X-17366 N2-methyl- 197 0.82 2.4E06 3,487 guanosine neopterin aconate 197 0.80 2.7E06 1,928 (methyl- fumarate) stachydrine elline 206 0.78 2.8E06 770 (N-methyl- nicot X-11491 4-imidazole- 114 1.21 2.8E06 16,735 acetate neopterin X-12748 200 0.79 3.5E06 1,514 X-18486 N2-methyl- 201 0.80 4.1E06 2,026 guanosine neopterin trans-urocanate 199 0.78 4.1E06 1,268 neopterin hylarginine 200 0.77 5.2E06 1,005 (SDMA + A X-11491 X-12267 126 1.02 1.0E05 4,717 3-sialyl- X-12748 205 0.73 1.2E05 2,059 lactose X-11491 7-methyl- 109 1.05 1.6E05 2,946 xanthine glucose melate 185 0.77 1.7E05 784 (heptanedioate) 3-sialyl- aconate 203 0.71 2.4E05 1,055 lactose (methyl- fumarate) 3-sialyl- N1-methyl- 205 0.71 2.6E05 985 lactose guanosine 5-oxoproline aconate 203 0.71 2.8E05 1,303 (methyl- fumarate) pregnendiol Droxy- 163 0.83 3.5E05 3,508 disulfate* pregnenolone disulfate proline one 204 0.69 4.2E05 1 leucine one 203 0.69 4.4E05 1 X-11491 X-12712 128 0.94 5.1E05 919 X-11491 X-17349 66 1.16 5.2E05 899 X-11491 1-methyl- 120 1.00 5.4E05 868 xanthine X-12637 X-17699 165 0.79 5.5E05 994 1,5-anhydro- one 165 0.74 7.0E05 1 glucitol (1,5-AG) X-17327 X-12819 201 0.66 1.1E04 1,256 X-12116 galactose 184 0.70 1.4E04 882 3-hydroxy- X-13724 136 0.80 1.6E04 759 butyrate (BHBA) X-12742 X-12819 202 0.64 1.8E04 771 fucitol allo-threonine 203 0.63 2.1E04 935 isoleucine one 202 0.62 2.8E04 1 N-methyl one 145 0.74 3.4E04 1 Acetaminophen sulfate 1* fucitol arabitol 204 0.61 3.5E04 779 quinolinate one 205 0.60 4.0E04 1 4-hydroxy- one 206 0.60 4.3E04 1 phenylacetate X-16940 one 201 0.60 5.5E04 1 pipecolate one 199 0.59 5.6E04 1 xylitol one 206 0.58 6.9E04 1 X-12117 one 201 0.58 8.1E04 1 Homo- one 205 0.57 8.2E04 1 vanillate (HVA) 3-(N-acetyl-L- one 119 0.71 1.1E03 1 cysteine-S-yl) acetamin- ophen* gentisate one 201 0.57 1.1E03 1 4-hydroxy- one 205 0.55 1.1E03 1 mandelate xanthine one 206 0.55 1.1E03 1 X-13723 one 198 0.56 1.3E03 1 uracil one 206 0.55 1.3E03 1 phenylalanine one 204 0.53 1.8E03 1 stachydrine one 206 0.52 2.2E03 1 valine one 203 0.52 2.4E03 1 trigonelline one 206 0.51 2.5E03 1 (N-methyl- nicotinate) X-12855 one 174 0.56 2.8E03 1 lysine one 204 0.51 2.8E03 1 X-17320 one 128 0.63 3.1E03 1 paraxanthine one 131 0.62 3.3E03 1 X-12230 one 177 0.56 3.4E03 1 3,4- one 203 0.50 3.7E03 1 dihydroxy- phenylacetate 2-methoxy- one 101 0.67 3.8E03 1 Acetaminophen sulfate* methionine one 204 0.49 4.2E03 1 kynurenine one 204 0.48 4.8E03 1 X-16570 one 203 0.48 5.1E03 1 X-19434 one 110 0.71 5.1E03 1 neopterin one 200 0.48 5.2E03 1 X-12221 one 195 0.48 6.0E03 1 p-acetamido- one 137 0.55 7.8E03 1 phenyl- glucuronide 5-hydroxy- one 199 0.46 8.2E03 1 methyl- 2-furoic acid N2-methyl- one 202 0.46 8.4E03 1 guanosine acetyl- one 206 0.45 8.6E03 1 carnitine xanthosine one 201 0.46 8.6E03 1 kynurenate one 204 0.45 9.0E03 1 X-17366 one 200 0.45 9.3E03 1 ornithine one 204 0.44 9.4E03 1 X-14625 one 200 0.45 9.6E03 1 propionyl- one 193 0.45 1.0E02 1 carnitine 2-methyl- one 198 0.45 1.0E02 1 Butyryl- carnitine (C5) isobutyryl- one 200 0.45 1.1E02 1 glycine myoinositol one 206 0.43 1.2E02 1 imidazole one 203 0.43 1.2E02 1 lactate isovaleryl- one 203 0.43 1.3E02 1 glycine urate one 206 0.42 1.3E02 1 glucose one 206 0.42 1.3E02 1 mannose one 206 0.42 1.4E02 1 5alpha- one 83 0.68 1.4E02 1 androstan- 3beta,17- beta-diol disulfate 3-hydroxy- one 133 0.48 1.5E02 1 kynurenine X-12039 one 205 0.42 1.5E02 1 isocitrate one 206 0.41 1.6E02 1 X-12107 one 187 0.46 1.6E02 1 X-11843 one 130 0.53 1.6E02 1 ribitol one 205 0.41 1.6E02 1 arginine one 191 0.42 1.8E02 1 4-hydroxy- one 206 0.40 1.8E02 1 benzoate 3-(cystein- one 106 0.57 1.8E02 1 S-yl) Acetamin- ophen* X-17369 one 74 0.65 2.0E02 1 X-12685 one 187 0.42 2.0E02 1 X-17735 one 194 0.42 2.0E02 1 3-amino- one 206 0.40 2.0E02 1 isobutyrate X-12193 one 204 0.40 2.1E02 1 X-16674 one 192 0.41 2.1E02 1 allantoin one 197 0.40 2.2E02 1 X-17185 one 161 0.49 2.2E02 1 X-12114 one 204 0.39 2.3E02 1 hydantoin- one 190 0.40 2.3E02 1 5-propionic acid xylulose one 205 0.39 2.4E02 1 lactate one 202 0.39 2.4E02 1 1,7-dimethyl- one 187 0.41 2.5E02 1 urate X-12849 one 206 0.38 2.5E02 1 trans- one 204 0.38 2.5E02 1 urocanate tyrosine one 204 0.38 2.5E02 1 3-sialyl- one 206 0.38 2.6E02 1 lactose 3-(3-hydroxy- one 141 0.46 2.6E02 1 phenyl) propionate X-15461 one 200 0.39 2.6E02 1 citrate one 206 0.38 2.6E02 1 cystine one 164 0.42 2.8E02 1 pantothenate one 203 0.38 2.8E02 1 X-18965 one 201 0.38 2.9E02 1 X-12726 one 204 0.38 3.1E02 1 hypoxanthine one 206 0.37 3.2E02 1 X-17335 one 205 0.37 3.3E02 1 X-18486 one 206 0.36 3.4E02 1 3,5-dihydroxy- one 194 0.38 3.4E02 1 benzoic acid X-15484 one 142 0.43 3.4E02 1 X-18887 one 205 0.36 3.5E02 1 X-11668 one 199 0.37 3.5E02 1 X-13850 one 139 0.43 3.6E02 1 N-(2-furoyl)- one 206 0.36 3.6E02 1 glycine guanine one 198 0.37 3.6E02 1 mesaconate one 202 0.36 3.7E02 1 (methyl- fumarate) glutamine one 204 0.36 3.7E02 1 X-17361 one 192 0.37 3.8E02 1 taurine one 193 0.38 4.2E02 1 X-17398 one 153 0.42 4.2E02 1 X-12747 one 132 0.43 4.4E02 1 4-acetamino- one 169 0.38 4.5E02 1 phenyl sulfate X-12738 one 128 0.46 4.5E02 1 X-18945 one 195 0.35 4.5E02 1 2-hydroxy- one 143 0.40 4.6E02 1 Acetaminophen sulfate* phosphate one 206 0.34 4.7E02 1 X-11491 one 127 0.48 4.7E02 1 Dimethyl- one 206 0.34 4.8E02 1 arginine (SDMA + ADMA) catechol one 206 0.34 5.0E02 1 sulfate
[0202] Table 5 is shown below. For Table 5, the numerator refers to a Metabolon compound identifier in the numerator; the denominator refers to a Metabolon compound identifier in the denominator (where one indicates no ratio); the term ncases refers to the number of data points used in the statistics; the term OR refers to the odds ratio of the association with ACR, per 1 standard deviation change in predictor; the p-value refers to the p-value of the association with ACR; and the p-gain refers to the p-gain of the association with ACR (when using ratios)
TABLE-US-00008 TABLE 5 Logistic regression [ACR = f(M.sub.i)] using all samples with matching biopsy and available RNA signature numerator denominator ncases OR p-value p-gain quinolinate 4-hydroxy- 206 2.67 7.3E07 1,139 mandelate quinolinate xylitol 205 2.56 9.1E07 909 3-sialyl- xanthosine 201 2.74 1.7E06 5,814 lactose neopterin xanthosine 195 2.65 2.7E06 2,631 X-17366 xanthosine 197 2.59 4.5E06 2,194 neopterin N1-methyl- 198 2.47 5.4E06 1,315 guanosine X-18486 xanthosine 201 2.61 6.1E06 1,626 kynurenate xanthosine 201 2.62 7.1E06 1,392 X-12690 xanthosine 201 2.51 1.2E05 818 3-sialyl- X-16397 206 2.31 1.9E05 1,499 lactose pregnen- droxypregnenolone 163 2.39 1.2E04 992 diol disulfate disulfate* proline one 204 1.89 1.5E04 1 leucine one 203 1.97 1.8E04 1 1,5-anhydro- one 165 2.30 2.1E04 1 glucitol (1,5-AG) isoleucine one 202 1.87 5.6E04 1 4-hydroxy- one 206 0.53 7.7E04 1 phenylacetate quinolinate one 205 1.79 8.3E04 1 N-methyl- one 145 2.07 8.8E04 1 acetaminophen sulfate 1* X-16940 one 201 0.55 9.3E04 1 pipecolate one 199 1.77 1.0E03 1 xylitol one 206 0.55 1.2E03 1 X-12117 one 201 1.72 1.4E03 1 gentisate one 201 0.55 1.6E03 1 xanthine one 206 0.55 1.7E03 1 X-13723 one 198 0.52 1.9E03 1 uracil one 206 0.57 1.9E03 1 4-hydroxy- one 205 0.58 1.9E03 1 mandelate homovanillate one 205 0.58 2.0E03 1 (HVA) 3-(N-acetyl- one 119 2.25 2.3E03 1 L-cystein-S-yl) acetaminophen* phenylalanine one 204 1.67 2.8E03 1 stachydrine one 206 1.77 2.8E03 1 valine one 203 1.67 3.3E03 1 trigonelline one 206 0.59 3.5E03 1 (N-methyl- nicotinate) lysine one 204 1.67 3.8E03 1 X-12855 one 174 1.76 4.1E03 1 X-17320 one 128 0.49 4.5E03 1 X-12230 one 177 0.54 4.5E03 1 paraxanthine one 131 0.51 5.1E03 1 methionine one 204 1.61 5.8E03 1 kynurenine one 204 1.67 5.8E03 1 3,4-dihydroxy- one 203 0.62 6.1E03 1 phenylacetate X-16570 one 203 0.60 6.2E03 1 2-methoxy- one 101 2.09 7.1E03 1 acetaminophen sulfate* neopterin one 200 1.57 7.1E03 1 X-12221 one 195 0.61 7.3E03 1 X-19434 one 110 2.07 8.2E03 1 5-hydroxy- one 199 0.61 9.6E03 1 methyl- 2-furoic acid N2-methyl- one 202 0.62 9.8E03 1 guanosine xanthosine one 201 0.61 9.9E03 1 p-acetamido- one 137 1.83 1.0E02 1 phenyl- glucuronide Acetyl- one 206 1.57 1.0E02 1 carnitine X-17366 one 200 1.58 1.1E02 1 kynurenate one 204 1.55 1.1E02 1 ornithine one 204 1.54 1.1E02 1 X-14625 one 200 1.57 1.1E02 1 Propionyl- one 193 1.59 1.2E02 1 carnitine 2-methyl- one 198 1.62 1.2E02 1 Butyryl- carnitine (C5) Isobutyryl- one 200 0.63 1.2E02 1 glycine myo-inositol one 206 1.58 1.3E02 1 Imidazole one 203 0.64 1.4E02 1 lactate urate one 206 1.58 1.4E02 1 Isovaleryl- one 203 0.64 1.4E02 1 glycine glucose one 206 1.50 1.5E02 1 mannose one 206 1.50 1.6E02 1 X-12039 one 205 0.65 1.7E02 1 X-12107 one 187 0.61 1.8E02 1 3-hydroxy- one 133 1.60 1.8E02 1 kynurenine ribitol one 205 0.67 1.9E02 1 X-11843 one 130 1.70 1.9E02 1 4-hydroxy- one 206 0.63 2.0E02 1 benzoate arginine one 191 1.51 2.0E02 1 5 alpha-androstan- one 83 1.94 2.1E02 1 3-beta,17-beta- diol disulfate isocitrate one 206 0.68 2.1E02 1 X-12685 one 187 0.62 2.2E02 1 3-(cystein- one 106 1.80 2.2E02 1 S-yl)acetamino- phen* 3- one 206 0.66 2.2E02 1 aminoisobutyrate X-17735 one 194 0.64 2.2E02 1 X-12193 one 204 0.66 2.3E02 1 X-16674 one 192 0.65 2.3E02 1 allantoin one 197 1.52 2.4E02 1 X-17185 one 161 0.54 2.4E02 1 X-12114 one 204 1.51 2.5E02 1 X-17369 one 74 2.10 2.5E02 1 hydantoin- one 190 1.47 2.6E02 1 5-propionic acid trans- one 204 0.68 2.7E02 1 urocanate xylulose one 205 0.68 2.7E02 1 1,7-dimethyl- one 187 0.67 2.7E02 1 urate X-12849 one 206 0.69 2.8E02 1 lactate one 202 1.44 2.8E02 1 tyrosine one 204 1.47 2.8E02 1 X-15461 one 200 0.67 2.8E02 1 3-(3-hydroxy- one 141 0.62 2.8E02 1 phenyl)propionate 3-sialyllactose one 206 1.44 2.8E02 1 citrate one 206 0.68 2.8E02 1 pantothenate one 203 0.68 3.1E02 1 cystine one 164 1.54 3.1E02 1 X-18965 one 201 0.68 3.1E02 1 X-12726 one 204 0.68 3.4E02 1 hypoxanthine one 206 0.68 3.4E02 1 X-17335 one 205 0.69 3.5E02 1 X-18486 one 206 1.48 3.6E02 1 3,5-dihydroxy- one 194 0.65 3.6E02 1 benzoic acid X-15484 one 142 1.58 3.7E02 1 X-18887 one 205 1.45 3.7E02 1 N-(2-furoyl)- one 206 0.69 3.8E02 1 glycine X-11668 one 199 0.70 3.8E02 1 X-13850 one 139 1.53 3.9E02 1 guanine one 198 0.69 3.9E02 1 glutamine one 204 1.44 3.9E02 1 mesaconate one 202 0.69 3.9E02 1 (methyl- fumarate) X-17361 one 192 0.68 4.0E02 1 taurine one 193 0.69 4.4E02 1 X-17398 one 153 0.62 4.4E02 1 4-acetamino- one 169 1.45 4.7E02 1 phen sulfate X-18945 one 195 1.42 4.8E02 1 X-12738 one 128 0.62 4.9E02 1 2-hydroxy- one 143 1.52 4.9E02 1 acetaminophen sulfate* phosphate one 206 1.43 4.9E02 1 X-12747 one 132 0.67 5.0E02 1
Table 6 is shown below. For Table 6, the numerator refers to a Metabolon compound identifier in the numerator; the denominator refers to a Metabolon compound identifier in the denominator (where one indicates no ratio); the term ncases refers to the number of data points used in the statistics; the term OR(metabolite) refers to the odds ratio of the association with ACR, per 1 standard deviation change in predictor; the p-value(metabolite) refers to the p-value for a metabolite; the p-gain(metabolite refers to the p-gain of the metabolite (when using ratios); the term OR(RNA signature) refers to the odds ratio of the RNA signature; and the p-value(RNA signature) refers to the p-value of the RNA signature.
TABLE-US-00009 TABLE 6 Logistic regression [ACR = f(Mi, RNA_signature)] using all samples with matching biopsy and available RNA signature Metabolite RNA signature numerator denominator ncases OR p-value p-gain OR p-value 3-sialyl- xanthosine 200 3.81 1.6E06 3,702 3.25 3.8E08 lactose X-12690 xanthosine 200 3.72 4.3E06 1,024 3.17 1.0E08 X-12715 4-hydroxy- 205 3.02 1.0E05 1,199 3.42 4.7E09 phenyl- acetate X-12225 homo- 202 3.13 1.1E05 1,255 3.38 2.5E09 vanillate (HVA) X-11334 xanthosine 200 2.81 3.8E05 1,189 3.17 3.0E09 X-11945 xanthosine 200 2.95 3.9E05 784 3.02 1.0E08 X-12117 one 200 2.66 6.9E05 1 3.25 1.7E09 leucine one 202 2.14 5.4E04 1 2.81 7.2E09 quinolinate one 204 2.16 7.9E04 1 2.91 1.8E09 stachydrine one 205 2.21 9.4E04 1 3.00 1.7E09 X-16940 one 200 0.50 1.3E03 1 2.83 1.5E08 Phenyl- one 203 2.03 1.4E03 1 2.86 1.8E09 alanine X-17366 one 199 2.07 1.8E03 1 3.00 1.3E09 proline one 203 1.95 1.9E03 1 2.69 4.9E09 methionine one 203 2.04 1.9E03 1 2.90 1.4E09 lysine one 203 1.92 2.1E03 1 2.84 1.8E09 trigonelline one 205 0.50 2.7E03 1 2.85 1.8E09 (N-methyl- nicotinate) 1,5-anhydro- one 165 2.44 2.8E03 1 3.43 6.5E08 glucitol (1,5-AG) X-18887 one 204 1.93 3.3E03 1 2.99 9.8E10 neopterin one 199 1.81 3.4E03 1 2.79 2.3E09 lactate one 201 1.88 3.9E03 1 2.89 2.3E09 X-12690 one 204 1.90 4.4E03 1 3.00 6.6E10 isoleucine one 201 1.95 4.5E03 1 2.74 6.3E09 X-18486 one 205 2.06 5.1E03 1 2.93 7.3E10 kynurenine one 203 1.87 5.4E03 1 2.86 3.4E09 3-sialyl- one 205 1.78 5.8E03 1 2.93 8.6E10 lactose gentisate one 200 0.52 5.9E03 1 2.67 1.1E08 myo- one 205 1.94 6.0E03 1 2.94 1.6E09 inositol 5-oxopro- one 204 1.86 6.8E03 1 3.03 6.4E10 line xanthine one 205 0.54 7.1E03 1 2.79 4.4E09 kynurenate one 203 1.80 7.4E03 1 2.79 2.4E09 ornithine one 203 1.79 7.6E03 1 2.84 2.1E09 X-12364 one 188 1.92 8.4E03 1 2.99 1.7E08 X-12125 one 204 1.81 9.4E03 1 2.98 1.1E09 X-12100 one 202 1.87 9.5E03 1 3.15 6.5E10 X-12637 one 203 1.76 1.0E02 1 2.98 1.5E09 X-12855 one 173 1.92 1.0E02 1 2.58 1.7E07 valine one 202 1.75 1.1E02 1 2.72 4.2E09 X-13737 one 203 1.76 1.2E02 1 2.96 9.7E10 arginine one 190 1.78 1.2E02 1 2.75 5.5E09 4-hydroxy- one 205 0.57 1.2E02 1 2.69 5.0E09 phenyl- acetate pipecolate one 198 1.72 1.3E02 1 2.69 4.1E09 1-(3-amino- one 195 1.81 1.3E02 1 2.90 2.0E09 propyl)-2- pyrrolidone X-12221 one 194 0.57 1.3E02 1 2.67 9.0E09 homo- one 204 0.57 1.3E02 1 2.67 5.1E09 vanillate (HVA) X-13723 one 197 0.54 1.4E02 1 2.63 7.6E09 X-12707 one 205 1.76 1.4E02 1 3.10 5.2E10 X-12039 one 204 0.59 1.4E02 1 2.80 1.6E09 phosphate one 205 1.75 1.5E02 1 2.90 1.1E09 X-16947 one 202 1.67 1.6E02 1 2.84 8.0E10 cysteine one 197 1.65 1.6E02 1 3.02 1.1E09 X-18475 one 194 1.76 1.7E02 1 2.87 3.3E09 X-14625 one 199 1.64 1.8E02 1 2.74 1.6E09 urate one 205 1.73 1.9E02 1 2.77 1.5E09 X-12906 one 203 1.70 2.2E02 1 3.04 1.6E09 uracil one 205 0.61 2.2E02 1 2.62 3.2E09 X-12685 one 186 0.56 2.2E02 1 2.64 1.1E08 Vanillyl- one 203 1.65 2.4E02 1 3.12 1.1E09 mandelate (VMA) X-12225 one 203 1.60 2.6E02 1 2.98 9.7E10 Acetyl- one 205 1.61 2.6E02 1 2.77 3.1E09 carnitine Homo- one 201 1.55 2.7E02 1 2.85 1.8E09 citrulline glutamine one 203 1.67 2.7E02 1 2.77 1.5E09
[0203] The level of significance for association of a metabolite after Bonferroni correction at a nominal level of significance of 0.05 is a P<6.710.sup.5 (=0.05/749). Some studies suggest that testing all possible combinations of ratios between metabolite concentrations may reveal new and biologically relevant associations in an unbiased approach (Dehaven et al., J Cheminform 2: 9 (2010). Therefore, all pairs of metabolite ratios were included in the association tests. For the ratios, the significance level after Bonferroni correction was P<1.810.sup.7 (=0.05/(749*748/2)). Note that since the data are log-scaled, the symmetry log(a/b)=log(b/a) halves the multiple testing burden. A ratio between two metabolites where one already shows a strong association signal may suggest false positive implication of the other in the association. Therefore, the inventors also required that the P-gain statistic to be significant after Bonferroni correction. The P-gain is defined as the change in the P values of the association of the two single metabolites when compared to their ratio. An association of a ratio is thus considered significant if P-gain>7,490 (=10*749) and P-value<1.810.sup.7. Due to the inherent correlations among metabolic traits, the less conservative false discovery rate (FDR), introduced by Benjamini-Hochberg (Benjamini et al., J R Stat Soc Series B Methodol 57: 289-300 (1995)) is generally used in metabolomics studies. In order not to miss metabolites of potential biological interest we report associations that are significant at the FDR level of 5% in Table 1, and for all nominal associations in Tables 2, 3, 4, 5, and 6.
[0204] In summary, the urine metabolomics study discovered that the ratio of 3-sialyllactose to xanthosine and the ratio of quinolinate to X-16397 were best associated with ACR biopsy diagnosis.
Example 2: Urine Samples for Metabolomics
[0205] From a total of 4300 urine samples prospectively collected from the 485 kidney graft recipients (patients) enrolled in the parent CTOT-04 study, 1518 urine samples were selected from 242 patients for metabolomics (
Example 3: Urine Metabolites and ACR
[0206] Metabolite data from 50 urine samples matched to 50 ACR biopsies from 36 patients and 198 urine samples matched to 198 No rejection biopsies from 149 patients were analyzed to determine whether metabolite profiles distinguish ACR biopsies from No Rejection biopsies.
[0207] Table 1 lists transplant recipient's characteristics such as age, gender, ethnicity, race and BMI. Among the 50 ACR biopsies graded using the Banff schema, 23 were graded as ACR grade IA, 11 were graded as ACR grade IB, 12 were graded as ACR grade IIA, 3 were graded as ACR grade IIB and 1 was graded as ACR grade III.
[0208] The 198 biopsies classified as No Rejection biopsies did not show histologic features of ACR, AMR, Borderline, bacterial infection/pyelonephritis, CMV, BKV/polyoma nephropathy or post-transplant lymphoproliferative disease. However, several of the No Rejection biopsies displayed histological changes consistent with ATN (n=79), tubular atrophy (n=75), interstitial fibrosis (n=67), glomerulosclerosis (n=30), vascular narrowing (n=20), calcineurin inhibitor toxicity (n=18), and/or recurrent disease (n=2). Also, several of the biopsies showed more than one histological abnormality such as the presence of both interstitial fibrosis and tubular atrophy.
[0209] Kidney allograft function, measured at the time of biopsy, showed that the graft function was significantly inferior in the ACR biopsy group compared to the No Rejection biopsy group. As summarized in Table 1, the mean (+SD) serum creatinine level at the time of kidney allograft biopsy in the ACR biopsy group was 3.7+2.9 mg/dl (number of measurements=37) and was 2.5+2.3 mg/dl (number of measurements=146) in the No Rejection biopsy group (Mann Whitney P=0.0003). The mean (+SD) estimated glomerular filtration rate (eGFR) in the ACR biopsy group was 30+17 mL/min (number of measurements=37) compared to 43+23 mL/min (number of measurements=146) in the No Rejection biopsy group (Mann Whitney P=0.003).
[0210] Metabolite data was also analyzed from urine samples matched to antibody-mediated rejection, borderline changes, BKV nephropathy, or other biopsy findings. Due to the small group sizes and the resulting lack of statistical power, results from these analyses are not included herein.
[0211] Table 7 lists all metabolites and ratios of metabolites in urine that distinguished ACR biopsies from No Rejection biopsies at a false discovery rate of 5% (Benjamini et al., J R Stat Soc Series B Methodol 57: 289-300 (1995).
TABLE-US-00010 TABLE 7 Metabolite ratios and metabolite concentrations distinguishing acute cellular rejection biopsies from no rejection biopsies at a false discovery rate of 5%. Metabolite Ratio or Metabolite N.sup.a beta.sup.b P-value.sup.c P-gain.sup.c 3-Sialyllactose/Xanthosine 242 0.86 5.0 10.sup.8 201,100 Neopterin/Xanthosine 234 0.90 2.0 10.sup.8 72,220 3-(3-aminocarboxypropyl) 242 0.83 1.6 10.sup.7 61,644 Uridine/Xanthosine 3-Sialyllactose/X-16397.sup.d 247 0.77 5.9 10.sup.7 26,062 Quinolinate/X-16397.sup.d 248 0.89 7.3 10.sup.9 25,031 Quinolinate/4-hydroxy- 248 0.88 1.1 10.sup.8 16,954 mandelate Neopterin/X-16570.sup.d 235 0.84 9.7 10.sup.8 14,493 Neopterin/N1-Methyl- 238 0.83 1.2 10.sup.7 11,361 guanosine Proline 245 0.63 4.9 10.sup.5 Quinolinate 247 0.59 1.8 10.sup.4 Isoleucine 244 0.58 2.1 10.sup.4 X-13723.sup.d 235 0.57 3.7 10.sup.4 X-12117.sup.d 242 0.55 4.9 10.sup.4 1,2,3 Benzenetriol 241 0.55 5.8 10.sup.4 sulfate Leucine 246 0.52 9.9 10.sup.4 Pipecolate 239 0.52 1.1 10.sup.3 Paraxanthine 158 0.63 1.1 10.sup.3 1,5-Anhydroglucitol 197 0.57 1.1 10.sup.3 X-19434.sup.d 126 0.77 1.3 10.sup.3 Kynurenate 245 0.51 1.3 10.sup.3 Neopterin 240 0.51 1.4 10.sup.3 Myo-inositol 248 0.49 1.7 10.sup.3 Gentisate 243 0.50 1.8 10.sup.3 Valine 243 0.49 1.9 10.sup.3 N-Methyl-acetaminophen sulfate 1 175 0.58 2.5 10.sup.3 Xylitol 248 0.47 2.6 10.sup.3 .sup.aN is the number of urine samples with valid metabolite data following analysis of 248 urine samples from 185 patients matched to either ACR biopsies (number of urine samples = 50; number of patients = 36) or No rejection biopsies (number of urine samples = 198; number of patients = 149). One No Rejection biopsy associated sample contained insufficient material for metabolomics, and reduced the number of urine samples from 199 to 198, and the number of patients from 150 to 149, reported in the parent CTOT-04 study (Suthanthiran et al., N Engl J Med 369: 20-31 (2013)). Urine samples matched to biopsies classified as Borderline changes (number of urine samples = 27; number of patients = 25), AMR (number of urine samples = 13: number of patients = 11) or Other biopsies (number of urine samples = 9; number of patients = 8) were also excluded from data analysis since the objective was to determine whether urine metabolite profiles distinguish ACR biopsies from No Rejection biopsies. The number of patients with a biopsy diagnosis exceeds the 190 patients providing 298 biopsy matched urine samples since several patients had multiple biopsies with different biopsy diagnoses. .sup.bbeta is the slope of the linear model fitted to log.sub.10-transformed and z-scored metabolite data (ion-counts, coding of the independent variable: 0 = No Rejection, 1 = ACR). .sup.cP-value and P-gain refer to the linear model metabolite or metabolite ratio = f(ACR); associations listed here are limited to those with a false discovery rate (FDR) of <5% for single metabolite associations; P value and P-gain that are significant at the p < 0.05 level after Bonferroni correction are shown in bold. See Table 2 for all nominally significant associations (i.e., with no adjustment for the number of tests) by linear regression and Table 3 for all nominally significant associations by logistic regression. Although statistically less powered, the top associations that emerged from these alternative statistical analyses were essentially the same, demonstrating the robustness of the association of metabolite profiles with ACR biopsy diagnosis. .sup.dAny metabolite of unknown structural identity is labeled as X-nnnnn (e.g., X-16397).
[0212] Tables 2 and 3 provide all nominally significant associations (i.e., with no adjustment for the number of tests) by linear regression (Table 2) or logistic regression (Table 3).
[0213] The ratio of the concentrations of the metabolites 3-sialyllactose to xanthoine (3SL/X) in the urine supernatant was strongly associated with ACR (P=5.010.sup.8) and this ratio had the highest increase in the strength of association (P-gain=2.010.sup.5, compared to the association of the single metabolites in the ratio). For a definition of the P-gain statistic see Example 1 and Petersen et al. (BMC Bioinformatics 13: 120 (2012)). The 3SL/X ratio was statistically significant even under conservative Bonferroni correction of the P value and the P-gain.
[0214] The diagnostic signature of the ratio of 3SL/X was not associated with age (P=0.95, Spearman regression), gender (P=0.52, Mann-Whitney test), or ethnicity (P=0.19, Kruskal-Wallis-Analysis of Variance). The signature was only weakly associated with eGFR (P=0.054, Spearman regression, S.sub.r=0.168) and the 3SL/X ratio continued to be diagnostic of ACR after adjusting for eGFR.
Example 4: A Composite Metabolite Signature of ACR
[0215] The ratio of 3SL/X showed by far the strongest P-gain and was therefore considered the prime candidate for a metabolite signature. After controlling for the 3SL/X ratio in a logistic regression model predicting ACR, the next strongest independent predictor of ACR was the ratio of quinolinate to X-16397, a metabolite of unknown identity. Analysis of the receiver-operating-characteristics (ROC) curve showed that the area under the curve (AUC) for the 3SL/X was 0.75, and the signature at the Youden-index (Le, Stat Methods Med Res 15: 571-584 (2006)) based cutoff was diagnostic of ACR with a specificity of 76% and a sensitivity of 59% (Table 8).
TABLE-US-00011 TABLE 8 Performance characteristics of the metabolite signature, RNA diagnostic signature and the combined signature discriminating acute cellular rejection biopsies from no rejection biopsies. Specificity Sensitivity Youden Signature.sup.a, b AUC [95%] (1-FP, %) (TP, %) index, % Log(3-sialyllactose/xanthosine) 0.75 [0.60] 76 59 36 Log(quinolinate/X-16397) 0.71 [0.60] 88 51 39 Log(3-sialyllactose/xanthosine) + 0.81 [0.77] 71 82 53 0.9513 * log(quinolinate/X- 16397) RNA signature 0.84 [0.60] 72 85 56 RNA signature + 0.91 [0.85] 82 87 69 1.1164 * log(3-sialyllactose/ xanthosine) RNA signature + 0.88 [0.85] 77 85 62 0.8932 * log(quinolinate/X- 16397) RNA-signature + 0.93 [0.92] 84 90 74 1.1164 * log(3-sialyllactose/ xanthosine) + 0.6937 * log(quinolinate/X- 16397) .sup.aThe signature that optimizes the area under the curve (AUC) is given together [in square brackets] with the largest AUC that can be observed by chance (P = 0.05) when the last term of the signature is randomized in the optimization procedure (95.sup.th percentile of 1000 randomizations). Sensitivity and specificity based on Youden index maximizing the difference between the true positive (TP) and the false positive (FP) rate for the signatures are listed. .sup.bTo make performance characteristics of the signatures comparable, the values shown in Table 8 were all computed using 198 urine samples from 154 patients (39 ACR biopsy urine samples from 31 patients and 159 No Rejection biopsy matched urine samples from 123 patients) that contained both valid metabolite data and urinary cell RNA signature score. This resulted in the RNA signature having slightly different values in the metabolomics study compared to the values reported in the parent CTOT-04 study in which 43 ACR biopsy matched urine samples from 34 patients and 163 No rejection biopsy matched urine samples from 126 patients were analyzed and the RNA signature was diagnostic of ACR with a specificity of 78% and a sensitivity of 79% and the AUC by ROC curve analysis was 0.85. Suthanthiran et al., N Engl J Med 369: 20-31 (2013).
[0216] The ratio of quinolinate to X-16397 also showed a strong association in the logistic model and a linear combination of the ratios of 3SL/X and quinolinate to X-16397 increased the AUC from 0.75 to 0.81 and the Youden index from 36% to 53% (Table 8).
[0217] The inventors examined whether any of the other metabolites and metabolite ratios reported in Table 7 outperformed the combined metabolite signature of the ratios of 3SL/X and quinolinate to X-16397, and none of the other metabolites or metabolite ratios did.
Example 5: A Composite Metabolite and the RNA Signature of ACR
[0218] The performance characteristics of the newly discovered metabolite signatures were investigated in combination with the inventor's previously established diagnostic signature of 18S rRNA and of 18S-normalized CD3 RNA and IP-10 RNA measures in urinary cells. For consistency in the comparisons between the metabolite signatures and the RNA signature urine samples were only used for which both metabolite and RNA data were available for all computed signatures. Tables 4 and 5 provide metabolite association data when samples without RNA data were excluded.
[0219] To identify the combined metabolite- and RNA-based signature, a logistic regression was performed with ACR=f(M.sub.i, RNA-signature), where M.sub.i represents a log-scaled metabolite concentration or a log-scaled ratio between two metabolite concentrations. The log-scaled ratio of 3SL/X had the highest log-odds ratio (1.34, P=1.610.sup.6) after inclusion of the RNA signature in the model and thus represented the best candidate for a combined metabolite-RNA signature (Table 6). The linear combination between log (3SL/X) and the RNA-signature that maximized the AUC were selected. The resulting combined metabolite-RNA signature was:
RNA-signature+1.1164*log(3SL/X).
[0220] Compared to the RNA-signature alone (AUC=0.84), the combined metabolite-RNA signature had a significantly higher AUC of 0.91 (significance determined by random sampling, an AUC of 0.85 or below was observed in 95% of 1,000 random samplings) (Table 8).
[0221] With the RNA signature and the 3SL/X ratio included in the logistic analysis, the quinolinate/X-16397 ratio was the next strongest predictor. With this additional metabolite ratio, the resulting combined signature that maximized the AUC was the following:
RNA-signature+1.1164*log(3SL/X)+0.6937*log(quinolinate/X-16397).
[0222] This combined two-metabolite-ratios-RNA signature increased the AUC of the one-metabolite-ratio-RNA signature to 0.93 (Table 8). This composite signature was diagnostic of ACR with a specificity of 84% and a sensitivity of 90%. Taken together, these results show that adding metabolite information to the RNA signature substantially improves its diagnostic utility as indicated by the more than 30% increase in the Youden index from 56% for the RNA signature alone to 74% for the combined two-metabolite-ratio-RNA signature.
[0223] Among the 39 ACR biopsies from 31 patients (Table 8), 34 biopsies were for-cause biopsies and 5 biopsies were surveillance biopsies. Among the 159 No Rejection biopsies from 123 patients, 104 biopsies were for-cause biopsies, and 55 biopsies were surveillance biopsies. The composite metabolite and RNA signature distinguished the 34 for-cause ACR biopsies from the 159 for-cause No Rejection biopsies (P=1.610.sup.17); the composite metabolite and RNA signature also distinguished the five surveillance ACR biopsies from the 55 surveillance No Rejection biopsies (P=0.0002).
Example 6: Prognostic Performance of the Signatures
[0224] The signatures were examined to ascertain whether, in addition to being diagnostic of ACR, the signatures could predict future occurrence of an ACR. For this analysis, the day of kidney biopsy was designated as day 0 and a total of 337 urine samples with both urine metabolite data and urinary cell RNA data and collected up to one year prior to an ACR biopsy or a No Rejection biopsy were analyzed to investigate whether the signatures predict future ACR biopsies.
[0225] Data from this analysis are illustrated as bean plots (
[0226] The ratio of 3SL/X in urine samples collected during 4 days to 30 days prior to biopsy predicted future development of an ACR with a specificity of 72% and a sensitivity of 59% (
Example 7: Longitudinal Analysis in Clinically Stable Patients
[0227] A total of 385 sequential urine samples with both metabolite and RNA data were analyzed to investigate the characteristics of the signatures in the first year of transplantation in clinically stable patients (see the legend to
Example 8: Targeted Assay Development
[0228] For clinical application, a high-throughput assay was developed using robotic solid-phase (RapidFire 365) extraction and Quadrupole Time-of-Flight (QTOF) MS/MS for simultaneous absolute quantification of urinary 3-sialyllactose and xanthosine levelsmetabolites suggested by our non-targeted metabolomics to offer diagnostic and prognostic information regarding ACR. Notably, this novel platform allows for a theoretical urinary sample throughput of over 5000 samples daily. Because metabolite-profiling results found that ACR diagnosis may be best afforded by considering the ratio of 3SL/X, rather than absolute metabolite levels, this platform was optimized for high-throughput ratiometric assay for these analytes (see, Example 1 and
REFERENCES
[0229] 1. Suthanthiran, M, Schwartz, J E, Ding, R, Abecassis, M, Dadhania, D, Samstein, B, Knechtle, S J, Friedewald, J, Becker, Y T, Sharma, V K, Williams, N M, Chang, C S, Hoang, C, Muthukumar, T, August, P, Keslar, K S, Fairchild, R L, Hricik, D E, Heeger, P S, Han, L, Liu, J, Riggs, M, Ikle, D N, Bridges, N D, Shaked, A: Urinary-cell mRNA profile and acute cellular rejection in kidney allografts. N Engl J Med 369: 20-31, 2013. [0230] 2. Hricik, D E, Nickerson, P, Formica, R N, Poggio, E D, Rush, D, Newell, K A, Goebel, J, Gibson, I W, Fairchild, R L, Riggs, M, Spain, K, Ikle, D, Bridges, N D, Heeger, P S, consortium, C-: Multicenter validation of urinary CXCL9 as a risk-stratifying biomarker for kidney transplant injury. Am J Transplant 13: 2634-2644, 2013. [0231] 3. Bouatra, S, Aziat, F, Mandal, R, Guo, A C, Wilson, M R, Knox, C, Bjorndahl, T C, Krishnamurthy, R, Saleem, F, Liu, P, Dame, Z T, Poelzer, J, Huynh, J, Yallou, F S, Psychogios, N, Dong, E, Bogumil, R, Roehring, C, Wishart, D S: The human urine metabolome. PLoS One 8: e73076, 2013. [0232] 4. Bohra, R, Klepacki, J, Klawitter, J, Thurman, J M, Christians, U: Proteomics and metabolomics in renal transplantation-quo vadis? Transpl Int 26: 225-241, 2013. [0233] 5. Psychogios, N, Hau, D D, Peng, J, Guo, A C, Mandal, R, Bouatra, S, Sinelnikov, I, Krishnamurthy, R, Eisner, R, Gautam, B. Young, N, Xia, J, Knox, C, Dong, E, Huang, P, Hollander, Z, Pedersen, T L, Smith, S R, Bamforth, F, Greiner, R, McManus, B, Newman, J W. Goodfriend, T, Wishart, D S: The human serum metabolome. PLoS One 6: e16957, 2011. [0234] 6. Nicholson, J K, Lindon, J C: Systems biology: Metabonomics. Nature 455: 1054-1056, 2008. [0235] 7. Fiehn, O: Metabolomicsthe link between genotypes and phenotypes. Plant Mol Biol 48: 155-171, 2002. [0236] 8. Pauling, L, Robinson, A B, Teranishi, R, Cary, P: Quantitative analysis of urine vapor and breath by gas-liquid partition chromatography. Proc Natl Acad Sci USA 68: 2374-2376, 1971. [0237] 9. Suhre, K, Shin, S Y, Petersen, A K, Mohney, R P, Meredith, D, Wagele, B, Altmaier, E, Deloukas, P, Erdmann, J. Grundberg, E, Hammond, C J, de Angelis, M H, Kastenmuller, G, Kottgen, A, Kronenberg, F, Mangino, M, Meisinger, C, Meitinger, T, Mewes, H W, Milburn, M V, Prehn, C, Raffler, J, Ried, J S, Romisch-Margl, W, Samani, N J, Small, K S, Wichmann, H E, Zhai, G, Illig, T, Spector, T D, Adamski, J, Soranzo, N, Gieger, C, Assimes, T L, Holm, H, Kathiresan, S, Konig, I R, McPherson, R, Reilly, M P, Roberts, R, Schunkert, H, Stewart, A F: Human metabolic individuality in biomedical and pharmaceutical research. Nature 477: 54-60, 2011. [0238] 10. Gall, W E, Beebe, K, Lawton, K A, Adam, K P, Mitchell, M W, Nakhle, P J, Ryals, J A, Milburn, M V, Nannipieri, M, Camastra, S, Natali, A, Ferrannini, E, Group, R S: alpha-hydroxybutyrate is an early biomarker of insulin resistance and glucose intolerance in a nondiabetic population. PLoS One 5: e10883, 2010. [0239] 11. Sreekumar, A, Poisson, L M, Rajendiran, T M, Khan, A P. Cao, Q, Yu. J, Laxman, B, Mehra, R, Lonigro, R J, Li, Y, Nyati, M K, Ahsan, A, Kalyana-Sundaram, S, Han, B, Cao, X, Byun, J. Omenn, G S, Ghosh, D, Pennathur, S, Alexander, D C, Berger, A, Shuster, J R, Wei, J T, Varambally, S, Beecher, C, Chinnaiyan, A M: Metabolomic profiles delineate potential role for sarcosine in prostate cancer progression. Nature 457: 910-914, 2009. [0240] 12. Spratlin, J L. Serkova, N J, Eckhardt, S G: Clinical applications of metabolomics in oncology: a review. Clin Cancer Res 15: 431-440, 2009. [0241] 13, Benjamini Y, H Y: Controlling the false discovery ratea practical and powerful approach to multiple testing. J R Stat Soc Series B Methodol 57: 289-300, 1995. [0242] 14. Petersen, A K, Krumsiek, J, Wagele, B, Theis, F J, Wichmann, H E, Gieger, C, Suhre, K: On the hypothesis-free testing of metabolite ratios in genome-wide and metabolome-wide association studies. BMC Bioinformatics 13: 120, 2012. [0243] 15. Le, C T: A solution for the most basic optimization problem associated with an ROC curve. Stat Methods Med Res 15: 571-584, 2006. [0244] 16. Peter, K: Beanplot: A Boxplot Alternative for Visual Comparison of Distributions. Journal of Statistical Software 28: 1-9, 2008. [0245] 17, Bland, J M, Altman, D G: Statistical methods for assessing agreement between two methods of clinical measurement. Lancet 1: 307-310, 1986. [0246] 18. Blydt-Hansen, T D, Sharma, A, Gibson, I W, Mandal, R, Wishart, D S: Urinary metabolomics for noninvasive detection of borderline and acute T cell-mediated rejection in children after kidney transplantation. Am J Transplant 14: 2339-2349, 2014. [0247] 19. Goek, O N, Prehn, C, Sekula, P, Romisch-Margl, W, Doring, A, Gieger, C, Heier, M, Koenig, W, Wang-Sattler, R. Illig, T, Suhre, K, Adamski, J, Kottgen, A, Meisinger, C: Metabolites associate with kidney function decline and incident chronic kidney disease in the general population. Nephrol Dial Transplant 28: 2131-2138, 2013. [0248] 20. Goek, O N, Doring, A, Gieger, C, Heier, M, Koenig, W, Prehn, C, Romisch-Margl, W, Wang-Sattler, R, Illig, T, Suhre, K, Sekula, P, Zhai, G, Adamski, J, Kottgen, A, Meisinger, C: Serum metabolite concentrations and decreased GFR in the general population. Am J Kidney Dis 60: 197-206, 2012. [0249] 21. Suhre, K, Romisch-Margl, W, de Angelis, M H, Adamski, J, Luippold, G, Augustin, R: Identification of a potential biomarker for FABP4 inhibition: the power of lipidomics in preclinical drug testing. J Biomol Screen 16: 467-475, 2011. [0250] 22. Kurakevich, E, Hennet, T, Hausmann, M, Rogler, G, Borsig, L: Milk oligosaccharide sialyl(alpha2,3)lactose activates intestinal CD11c+ cells through TLR4. Proc Natl Acad Sci USA 110: 17444-17449, 2013. [0251] 23. Idota, T, Kawakami, H, Murakami, Y, Sugawara, M: Inhibition of cholera toxin by human milk fractions and sialyllactose. Biosci Biotechnol Biochem 59: 417-419, 1995. [0252] 24. Izquierdo-Useros, N, Lorizate, M, Contreras, F X, Rodriguez-Plata, M T, Glass, B, Erkizia, I, Prado, J G, Casas, J, Fabrias, G, Krausslich, H G, Martinez-Picado, J: Sialyllactose in viral membrane gangliosides is a novel molecular recognition pattern for mature dendritic cell capture of HIV-1. PLoS Biol 10: e1001315, 2012. [0253] 25. Moffett, J R, Namboodiri, M A: Tryptophan and the immune response. Immunology and Cell Biology 81: 247-265, 2003. [0254] 26. Hartono, C, Muthukumar, T, Suthanthiran, M: Immunosuppressive drug therapy. Cold Spring Harb Perspect Med 3: a015487, 2013. [0255] 27. Sollinger, H W: Mycophenolate mofetil for the prevention of acute rejection in primary cadaveric renal allograft recipients. U.S. Renal Transplant Mycophenolate Mofetil Study Group. Transplantation 60: 225-232, 1995. [0256] 28. Collins, A J, Foley, R N, Chavers, B, Gilbertson, D, Herzog, C, Johansen, K, Kasiske, B, Kutner, N, Liu, J, St Peter, W, Guo, H, Gustafson, S, Heubner, B, Lamb, K, Li, S, Peng, Y, Qiu, Y, Roberts, T, Skeans, M, Snyder, J, Solid, C, Thompson, B, Wang, C, Weinhandl, E, Zaun, D, Arko, C, Chen, S C, Daniels, F, Ebben, J, Frazier, E, Hanzlik, C, Johnson, R, Sheets, D, Wang, X, Forrest, B, Constantini, E, Everson, S, Eggers, P, Agodoa, L: United States Renal Data System 2011 Annual Data Report: Atlas of chronic kidney disease & end-stage renal disease in the United States. Am J Kidney Dis 59: A7, e1-420, 2012. [0257] 29. Collins, A I, Kasiske, B, Herzog, C, Chavers, B, Foley, R, Gilbertson, D, Grimm, R, Liu, J, Louis, T, Manning, W, Matas, A, McBean, M, Murray, A, St Peter, W, Xue, J, Fan, Q, Guo, H, Li, S, Roberts, T, Snyder, J, Solid, C, Wang, C, Weinhandl, E, Arko, C, Chen, S C, Dalleska, F, Daniels, F, Dunning, S, Ebben, J, Frazier, E, Johnson, R, Sheets, D, Forrest, B, Berrini, D, Constantini, E, Everson, S, Frederick, P, Eggers, P, Agodoa, L: Excerpts from the United States Renal Data System 2004 annual data report: atlas of end-stage renal disease in the United States. Am J Kidney Dis 45: A5-7, S1-280, 2005. [0258] 30. Dehaven, C D, Evans, A M, Dai, H, Lawton, K A: Organization of G C/M S and LC/MS metabolomics data into chemical libraries. J Cheminform 2: 9, 2010. [0259] 31. Racusen, L C, Colvin, R B, Solez, K, Mihatsch, M J, Halloran, P F, Campbell, P M, Cecka, M J, Cosyns, J P, Demetris, A J, Fishbein, M C, Fogo, A, Furness, P, Gibson, I W, Glotz, D, Hayry, P, Hunsickern, L, Kashgarian, M, Kerman, R, Magil, A J, Montgomery, R, Morozumi, K, Nickeleit, V, Randhawa, P, Regele, H, Seron, D, Seshan, S, Sund, S, Trpkov, K: Antibody-mediated rejection criteriaan addition to the Banff 97 classification of renal allograft rejection. Am J Transplant 3: 708-714, 2003.
[0260] All patents and publications referenced or mentioned herein are indicative of the levels of skill of those skilled in the art to which the invention pertains, and each such referenced patent or publication is hereby specifically incorporated by reference to the same extent as if it had been incorporated by reference in its entirety individually or set forth herein in its entirety. Applicants reserve the right to physically incorporate into this specification any and all materials and information from any such cited patents or publications.
[0261] The following statements describe features of the invention.
Statements:
[0262] 1. A method comprising: (a) measuring the amount or concentration of 3-sialyllactose and xanthosine; quinolinate and X-16397; or a combination thereof in a subject's urine sample; (b) obtaining a ratio of the concentration or the amount of sialyllactose/xanthosine; quinolinate/X-16397; or a combination thereof in the urine sample; and (c) determining whether the ratio of the concentration or the amount of sialyllactose/xanthosine; quinolinate/X-16397; or a combination thereof is distinct from a control ratio of a control concentration or a control amount of sialyllactose/xanthosine; quinolinate/X-16397; or a combination thereof. [0263] 2. The method of statement 1, further comprising obtaining the subject's urine sample prior to the measuring step (a). [0264] 3. The method of statement 1 or 2, further comprising removing cells from the urine sample from the subject prior to the measuring step (a). [0265] 4. The method of any of statements 1-3, wherein determining step (c) comprises ascertaining a log ratio of 3-sialyllactose/xanthosine (Log.sub.10(3-sialyllactose/xanthosine)); a log ratio of quinolinate/X-16397 (log.sub.10(quinolinate/X-16397)); or a combination thereof; and identifying whether the sialyllactose/xanthosine log ratio; the quinolinate/X-16397 log ratio; or a combination thereof is detectably different from a control sialyllactose/xanthosine log ratio; a control quinolinate/X-16397 log ratio; or a combination thereof in one or more urine samples of control subjects who are not undergoing or will not undergo transplant rejection for the next 4-30 days. [0266] 5. The method of any of statements 1-4, wherein determining step (c) comprises ascertaining whether the ratio of the concentration or the amount of sialyllactose/xanthosine; quinolinate/X-16397; or a combination thereof in the urine sample is greater than a cut-off value. [0267] 6. The method of any of statements 1-5, wherein determining step (c) comprises ascertaining whether: [0268] (i) a log ratio of 3-sialyllactoose to xanthosine is greater than 0.45, or greater than 0.5, or equal or greater than 0.55, or equal or greater than 0.59836; or [0269] (ii) the following metabolite signature:
log.sub.10(3-sialyllactose/xanthosine)+0.9513*log.sub.10(quinolinate/X-16397) [0270] is greater than 0.38, or greater than 0.39, or greater than 0.4, or greater than 0.4, or greater than 0.41, or equal or greater than 0.4271, or greater than 0.43, or greater than 0.44. [0271] 7. The method of any of statements 1-6, wherein dysfunction or rejection of a kidney transplant can or will be ongoing in subjects where the subjects' urinary sample has: [0272] (i) a log ratio of 3-sialyllactoose to xanthosine that is equal or greater than 0.5, or equal or greater than 0.55, or equal or greater than 0.59836; or [0273] (ii) a value calculated from the following metabolite signature:
log.sub.10(3-sialyllactose/xanthosine)+0.9513*log.sub.10(quinolinate/X-16397) [0274] is greater than 0.38, or greater than 0.39, or greater than 0.4, or greater than 0.4, or greater than 0.41, or equal or greater than 0.4271, or greater than 0.43, or greater than 0.44. [0275] 8. The method of any of statements 1-7, further comprising identifying a subject for treatment when the subjects' urinary sample has: [0276] (i) a log ratio of 3-sialyllactoose to xanthosine that is equal or greater than 0.5, or equal or greater than 0.55, or equal or greater than 0.59836; or [0277] (ii) a value calculated from the following combined metabolite signature:
log.sub.10(3-sialyllactose/xanthosine)+0.9513*log.sub.10(quinolinate/X-16397) [0278] is greater than 0.38, or greater than 0.39, or greater than 0.4, or greater than 0.4, or greater than 0.41, or equal or greater than 0.4271, or greater than 0.43, or greater than 0.44. [0279] 9. The method of any of statements 1-8, comprising treating a subject for allograft rejection when a urine sample from the subject has a log ratio of 3-sialyllactoose to xanthosine that is equal or greater than 0.5, or equal or greater than 0.55, or equal or greater than 0.59836; or when a urine sample from the subject has a combined metabolite signature that is greater than 0.38, or greater than 0.39, or greater than 0.4, or greater than 0.4, or greater than 0.41, or equal or greater than 0.4271, or greater than 0.43, or greater than 0.44; wherein the combined metabolite signature=log.sub.10(3-sialyllactose/xanthosine)+0.9513*log.sub.10(quinolinate/X-16397). [0280] 10. The method of any of statements 1-9, comprising isolating and/or purifying RNA from the urine sample. [0281] 11. The method of any of statements 1-10, further comprising isolating and/or purifying RNA from cells present in the urine sample. [0282] 12. The method of any of statements 1-11, comprising quantifying CD3c mRNA, IP-10 mRNA, 18S rRNA, or a combination thereof in the urine sample. [0283] 13. The method of any of statements 1-12, comprising hybridizing at least one probe or primer to RNA from the urine sample obtained from the subject. [0284] 14. The method of any of statements 1-13, comprising hybridizing at least one probe or primer to CDR mRNA, IP-10 mRNA, 18S rRNA, or a combination thereof from the urine sample. [0285] 15. The method of any of statements 1-14, comprising hybridizing at least one probe or primer to CDR mRNA, at least one probe or primer to IP-10 mRNA, at least one probe or primer to 18S rRNA, or a combination thereof from the urine sample. [0286] 16. The method of any of statements 1-15, comprising quantifying CD3 mRNA, IP-10 mRNA, 18S rRNA, or a combination thereof, in the urine sample by a method comprising quantitative nucleic acid amplification reactions (e.g., quantitative polymerase chain reaction (PCR)), primer extension, Northern blot, immunoassay, immunosorbent assay (ELISA), radioimmunoassay (RIA), immunofluorimetry, immunoprecipitation, equilibrium dialysis, immunodiffusion, immunoblotting, mass spectrometry, or a combination thereof [0287] 17. The method of any of statements 10-16, comprising normalizing the amount (or copy number) of CD3 mRNA, IP-10 mRNA, or both against the amount (or copy number) of a housekeeping gene. [0288] 18. The method of statement 17, wherein the housekeeping gene is 2-Microglobulin ((32M), Glucose-6-phosphate dehydrogenase (G6PDH), 5-aminolevulinate synthase (ALAS or ALAS 1) Hypoxanthinephophoribosyltransferase (HPRT), Porphobilinogen deaminase (PBGD), or 18S rRNA. [0289] 19. The method of statement 17 or 18, wherein the housekeeping gene is 18S rRNA. [0290] 20. The method of any of statements 17-19, wherein normalizing the amount of CD3 mRNA comprises dividing a determined absolute urinary CD3 mRNA copy number per microgram of total RNA from a sample by a determined absolute urinary 18S rRNA copy number per microgram of total RNA times 10.sup.6 from the same sample:
[0295] 25. The method of any of statements 22-24, wherein the baseline, control or reference level of urinary cell expression of CD3 mRNA, IP-10 mRNA, and 18S rRNA is the respective amount of urinary cell expression of CD3 mRNA, IP-10 mRNA, and 18S rRNA expressed by a population of healthy persons or a population of persons with a well-functioning (e.g., stable) transplanted organ. [0296] 26. The method of any of statements 1-25, comprising ascertaining a RNA diagnostic signature of developing or existing dysfunction or rejection of a kidney transplant in the subject with the following algorithm:
RNA signature=6.1487+0.8534 log.sub.10(CD3/18S)+0.6376 log.sub.10(IP-10/18S)+1.6464 log.sub.10(18S) [0297] where: [0298] CD3 refers to an absolute urinary CD3 mRNA copy number per microgram of total RNA; [0299] IP-10 refers to an absolute urinary IP-10 mRNA copy number per microgram of total RNA; [0300] 18S refers to an absolute urinary 18S rRNA copy number per microgram of total RNA times 10.sup.6. [0301] 27. The method of statement 26, further comprising identifying a subject that has an RNA signature above 1.2, or above 1.3, or above 1.4, above 1.45, or above 1.5, or above, 1.55, or above 1.563099, or above 1.56, or above 1.65, or above 1.7. [0302] 28. The method of any of statements 26-28, further comprising informing the subject that he or she has or can develop dysfunction or rejection of a kidney transplant when the subject's RNA signature is above 1.2, or above 1.3, or above 1.4, above 1.45, or above 1.5, or above, 1.55, or above 1.563099, or above 1.56, or above 1.65, or above 1.7. [0303] 29. The method of any of statements 26-29, further comprising treating a subject that has a urine sample with an RNA signature above 1.2, or above 1.3, or above 1.4, above 1.45, or above 1.5, or above, 1.55, or above 1.563099, or above 1.56, or above 1.65, or above 1.7. [0304] 30. The method of any of statements 26-30, comprising ascertaining a composite diagnostic signature with the following algorithm:
RNA-signature+1.1164*log(3SL/X)+0.6937*log(quinolinate/X-16397). [0305] 31. The method of statement 31, further comprising identifying a subject with a urine sample that has a composite diagnostic signature above 0, or above 0.1, or above 0.2, or above 0.3, or above 0.5, or above 0.5095, or above 0.51, or above 0.52 (wherein above means less negative). [0306] 32. The method of statement 31 or 32, further comprising treating a subject for transplant rejection when the urine sample from the subject has a composite diagnostic signature above 0, or above 0.1, or above 0.2, or above 0.3, or above 0.5, or above 0.5095, or above 0.51, or above 0.52 (wherein above means less negative). [0307] 33. The method of any of statements 1-33, comprising monitoring a subject over time for developing or existing dysfunction or rejection of a kidney transplant in a subject. [0308] 34. The method of any of statements 1-34, comprising monitoring a subject over time for developing or existing dysfunction or rejection of a kidney transplant in a subject by collecting urine samples from the subject and performing the method with those urine samples. [0309] 35. The method of any of statements 1-35, comprising monitoring a subject over time and informing the subject if there is continuing change in metabolite ratios or RNA levels over time. [0310] 36. The method of any of statements 1-36, comprising informing the subject of a developing or existing dysfunction or rejection of a kidney transplant in the subject. [0311] 37. The method of any of statements 1-37, further comprising treating a developing or existing dysfunction or rejection of a kidney transplant in the subject. [0312] 38. The method of any of statements 1-38, further comprising treating the subject for acute cellular rejection of the kidney allograft. [0313] 39. The method of any of statements 1-39, further comprising treating the subject wherein treating comprises plasmapheresis, administration of an anti-rejection agent, increasing a dosage of an anti-rejection agent that the subject is receiving or any combination thereof [0314] 40. The method of statement 40, wherein the anti-rejection agent is azathioprine, cyclosporine, FK506, tacrolimus, mycophenolate mofetil, anti-CD25 antibody, antithymocyte globulin, rapamycin, ACE inhibitors, perillyl alcohol, anti-CTLA4 antibody, anti-CD40L antibody, anti-thrombin III, tissue plasminogen activator, antioxidants, anti-CD 154, anti-CD3 antibody, thymoglobin, OKT3, corticosteroid, or a combination thereof [0315] 41. A method for analysis of a urine sample from a subject with a kidney transplant comprising: [0316] (a) assaying the urine sample to measure an absolute urinary CD3 mRNA copy number per microgram of total RNA in the urine sample, an absolute urinary IP-10 mRNA copy number per microgram of total RNA in the urine sample, and an absolute urinary 18S rRNA copy number per microgram of total RNA times 10.sup.6 in the urine sample; [0317] (b) assaying to measure a ratio of 3-sialyllactose to xanthosine in the urine sample; [0318] (c) assaying to measure a ratio of quinolinate to X-16397 in the urine sample; [0319] (d) determining an RNA signature=6.1487+0.8534 log.sub.10(CD3/18S)+0.6376 log.sub.10(IP-10/18S)+1.6464 log.sub.10(18S); [0320] (e) determining a metabolite signature=1.1164*log(3-sialyllactose/xanthosine)+0.6937*log(quinolinate/X-16397); and/or [0321] (f) identifying a composite diagnostic signature=RNA-signature+1.1164*log(3SL/X)+0.6937*log(quinolinate/X-16397); [0322] where: [0323] CD3 is an absolute urinary CD3 mRNA copy number per microgram of total RNA in the urine sample; [0324] IP-10 is an absolute urinary IP-10 mRNA copy number per microgram of total RNA in the urine sample; and [0325] 18S is an absolute urinary 18S rRNA copy number per microgram of total RNA in the urine sample times 10.sup.6; [0326] to thereby analyze the urine sample from the subject with the kidney transplant. [0327] 42. The method of statement 42, further comprising informing the subject of the combined diagnostic signature. [0328] 43. The method of statement 42 or 43, further comprising treating the subject for allograft rejection. [0329] 44. The method of any of statements 42-44, further comprising treating the subject for allograft rejection when a urine sample from the subject has a combined diagnostic signature score greater than 0.2, or greater than 0.3, or greater than 0.4, or greater than 0.45, or greater than 0.5, or greater than 0.5095 (where greater than means less negative). [0330] 45. A method comprising treating a subject for allograft rejection when a urine sample from the subject has a combined diagnostic signature greater than 0.2, or greater than 0.3, or greater than 0.4, or greater than 0.45, or greater than 0.46, or greater than 0.47, or greater than 0.48, or greater than 0.49, or greater than 0.5, or greater than 0.5095, or greater than 0.51, or greater than 0.52 (where greater than means less negative); wherein
the combined diagnostic signature=mRNA-signature+1.1164*log(3SL/X)+0.6937*log(quinolinate/X-16397); and
the RNA signature=6.1487+0.8534 log.sub.10(CD3/18S)+0.6376 log.sub.10(IP-10/18S)+1.6464 log.sub.10(18S).
[0331] The specific methods and compositions described herein are representative of preferred embodiments and are exemplary and not intended as limitations on the scope of the invention. Other objects, aspects, and embodiments will occur to those skilled in the art upon consideration of this specification, and are encompassed within the spirit of the invention as defined by the scope of the claims. It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, or limitation or limitations, which is not specifically disclosed herein as essential. The methods and processes illustratively described herein suitably may be practiced in differing orders of steps, and the methods and processes are not necessarily restricted to the orders of steps indicated herein or in the claims.
[0332] As used herein and in the appended claims, the singular forms a, an, and the include plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to a nucleic acid or a polypeptide includes a plurality of such nucleic acids or polypeptides (for example, a solution of metabolites, RNA, or polypeptides or a series of metabolite, RNA, or polypeptide preparations), and so forth. Under no circumstances may the patent be interpreted to be limited to the specific examples or embodiments or methods specifically disclosed herein. Under no circumstances may the patent be interpreted to be limited by any statement made by any Examiner or any other official or employee of the Patent and Trademark Office unless such statement is specifically and without qualification or reservation expressly adopted in a responsive writing by Applicants.
[0333] The terms and expressions that have been employed are used as terms of description and not of limitation, and there is no intent in the use of such terms and expressions to exclude any equivalent of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention as claimed. Thus, it will be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims and statements of the invention.
[0334] The following claims describe some aspects of the invention.