A METHOD FOR ALTERING THE FUNCTIONAL STATE OF MRNA ALLOWING ITS SELECTIVE AND SPECIFIC RECOGNITION
20180291366 · 2018-10-11
Inventors
Cpc classification
C12N2310/113
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/10
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
A method of altering the functional state of any mRNA enabling its selective and specific recognition and subsequent selective manipulation and a universal principle for increasing the specificity and selectivity of molecular target recognition at the level of nucleic acids. The principle of the specific and selective recognition of nucleic acids is based on simultaneous recognition of two or more sequences of the target nucleic acid, whereas these have to be spaced from each other by a certain defined distance. Such method of nucleic acid recognition through specific recognition of well-defined sequences of the nucleic acid that are spaced from each other by a defined distance, minimizes the probability of stable binding of the interfering construct to inadvertent nucleic acids, thereby dramatically increasing the selectivity of recognition of the targeted nucleic acid. Specific recognition of defined sequences of a nucleic acid localized at a certain defined distance from each other is achieved by simultaneous complementary interference of short sequence-specific oligonucleotides being mutually interconnected by size-specific polymeric linking moiety.
Claims
1. A method for altering of the functional state of any mRNA enabling its selective and specific recognition, and subsequently selective intervention, manipulation, detection, quantification, labeling, pre-targeting and sorting thereof, wherein the mRNA is targeted via a construct formed by at least two sequence-specific oligonucleotides being mutually interconnected through a size-specific polymeric linking moiety which defines their mutual distance, wherein each of the sequence-specific oligonucleotides is targeted to a pre-defined target sequence of the mRNA resulting in the formation of a stable heteroduplex and on the basis of such alternation the mRNA is selectively and specifically recognized.
2. The method according to claim 1, wherein any mRNA is a fusion mRNA.
3. The method according to claim 2, wherein each of the fusion partners of the target fusion mRNA is targeted by at least one sequence-specific oligonucleotide.
4. The method of claim 2, wherein the target sequences are localized not more than 100 nucleotides from the fusion breakpoint site.
5. The method of claim 1, wherein the sequences of individual sequence-specific oligonucleotides of the construct are targeted according to the complementarity to individual pre-defined regions of mRNA.
6. The method of claim 1, wherein the mRNA is targeted with a construct comprising at least 3 oligonucleotides, each of the oligonucleotides targets a pre-defined target sequence of the individual regions of mRNA, wherein the oligonucleotides are being mutually interconnected through a corresponding number of the size-specific polymeric linking moieties.
7. The method of claim 1, wherein the length of the size-specific polymeric linking moiety ranges between 5 and 1000 angstrom.
8. The method of claim 1, wherein the size-specific polymeric linking moiety is attached to the 5 end of the first oligonucleotide and to the 3 end of the second oligonucleotide.
9. The method of claim 1, wherein the size-specific polymeric linking moiety comprises: a) any sequence and number of nucleotides or nucleotide derivatives/analogues, preferably between 1 and 50 nucleotides in any mutual combination, wherein the polymeric linking moiety may also consist of a sugar-phosphate backbone or any chemically modified abasic backbone; b) a polypeptide of any sequence; c) a polysaccharide; d) a saturated or unsaturated hydrocarbon (C2-C40); and e) a non-nucleotide polymer such as poly(meth)acrylate or modified poly(meth)acrylate (preferably poly(ethyleneoxy) and 2(N,N-dimethylamino)ethyl (meth)acrylate), poly(vinylalcohol), poly(vinylpyrrolidone), poly(ethylene glycol), poly(acrylamide), poly(oxazoline), poly(ethyleneimine), poly(alkyleneoxide), lactone-based polymer, poly(acrylic acid), poly(lactide acid), poly(glycolic acid), poly(propylene), poly(styrene), poly(olefin), poly(amide), poly(cyanoacrylate), poly(imide), poly(ethylene terephtalate), poly(tetramethylene glycol), poly(urethane), polymer obtained by a mutual combination thereof, optionally by a combination with other natural or synthetic polymers.
10. The method of claim 1, wherein the length of sequence-specific oligonucleotides is at least 3 nucleotides, wherein they comprise any nucleotides or chemical derivatives/analogues thereof and may be mutually combined either as blocks of oligonucleotides with a specific chemical modification or as individual oligonucleotides consisting of differently modified nucleotides.
11. The method of claim 10, wherein the sequence-specific oligonucleotides are selected from DNA, RNA, 2-O-(2-methoxyethyl)-RNA, 2-O-methyl-RNA, 2-O-fluoro-RNA, LNA, PNA, morpholino, INA, FANA, ANA, UNA or HNA units, optionally a combination thereof.
12. The method of claim 10, wherein the length of sequence-specific oligonucleotides ranges between 10 and 25 nucleotides.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0066]
[0067]
EXAMPLES
[0068] The solution described in this invention can be considered as universally applicable for selective and specific recognition of any target nucleic acid, preferably fusion mRNA. In the context of antisense systems, when the target nucleic acid is a fusion mRNA (its presence unequivocally characterizes and distinguishes tumor cells from healthy ones), the present invention enables selective recognition and targeting solely of the tumor cells. The innovation in the form of enhanced selectivity and specificity of recognition solely of the target nucleic acid, preferably a fusion mRNA, allows controlled intervention of target fusion genes.
Example 1
[0069] Selective and specific recognition of the BCR-ABL fusion mRNA in chronic myelogenous leukemia or Ph+ acute lymphoblastic leukemia, or other neoplasia where BCR-ABL fusion mRNA is present, using the present invention.
[0070] The proposed construct selectively and specifically recognizes the BCR-ABL mRNA in a way when the first sequence-specific oligonucleotide targets the sequence of BCR and the second oligonucleotide targets the sequence of ABL, whilst both of the oligonucleotides are mutually interconnected through a size-specific polymeric linking moiety. It is also possible to apply more than two sequence-specific oligonucleotides, when each of them targets either the BCR or ABL, wherein each of the fusion partners is targeted by at least one oligonucleotide. The sequence-specific oligonucleotides are mutually interconnected through a corresponding number of polymeric linking moieties. A stable, thermodynamically and energetically preferable complementary interaction between the construct and the targeted BCR-ABL mRNA is formed only in the case, when each of the target sequences is fully recognized and moreover spaced from each other by a certain distance defined by the size-specific polymeric linking moiety. By this means the probability of stable binding of the construct to partially homologous mRNAs is minimized that prevents a stable intervention with inadvertent mRNA molecules. With respect to the fact, that fusion BCR-ABL mRNA is exclusively present in tumor cells, the described principle of BCR-ABL mRNA recognition results in preferential and stable intervention solely in tumor cells, thereby to a selective recognition and targeting of tumor cells.
[0071] The sequences of individual sequence-specific oligonucleotides within the construct are complementary to the target sequences of individual fusion partners BCR, ABL. The target sequences of BCR, ABL may be optional referring to the primary sequence of the fusion BCR-ABL mRNA, however in a preferred embodiment the distance of the target sequences from the fusion breakpoint site is no more than 100 nucleotides, irrespective of the particular fusion BCR-ABL mRNA variant.
TABLE-US-00001 5 acgttcctgatctcctctgactatgagcgtgcagagt ggagggagaacatccgggagcagcagaagaagtgtttcag aagcttctccctgacatccgtggagctgcagatgctgacc aactcgtgtgtgaaactccagactgtccacagcattccgc tgaccatcaataaggaagaagcccttcagcggccagtagc atctaactttgagcctcagggtatgaatgaagccgctcat tggaactccaaagaaaaccttctcgctggacccagtgaaa atgaccccaaccttttcgttgcactgtatgattttgtggc cagtggagataacactctaagcataactaaaggtgaaag
[0072] Partial primary sequence of fusion BCR-ABL mRNA (GenBank: AJ311467.1); BCRblack, ABLgrey; target sequences are underlined.
TABLE-US-00002 linkingmoiety(8ntgap) 3 CTGGTAGTTATTCCTTC----------------GTCGCCGGTCATCGTAG5
[0073] Example of the construct designed for selective and specific recognition of BCR-ABL mRNA. The complementary oligonucleotide to BCR (17nt) and ABL1 (17nt) are shown in black and grey, respectively.
[0074] Analogously to Example 1, Examples 2-7 in an abridged form as well as the list of other fusion mRNAs are given below.
Example 2
[0075] Selective and specific recognition of the AML1-ETO fusion mRNA in acute myeloid leukemia M2 or other neoplasia where AML1-ETO fusion mRNA is present, using the present invention.
TABLE-US-00003 5 atcaaaatcacagtggatgggccccgagaacctcgaa atcgtactgagaagcactccacaatgccagactcacctgt ggatgtgaagacgcaatctaggctgactcctccaacaatg ccacctcccccaactactcaaggagctccaagaaccagtt catttacaccgacaacgttaactaatggcacgagccattc tcctacagccttgaatggcgccccctcaccacccaatggc
[0076] Partial primary sequence of fusion AML1-ETO mRNA (GenBank: S78158.1); AML1black, ETOgrey; target sequences are underlined.
TABLE-US-00004 linkingmoiety(17ntgap) 3 TAGTGTCACCTACCCG----------------GCATGACTCTTCGTGAGG5
[0077] Example of the construct designed for selective and specific recognition of AML1-ETO mRNA. The complementary oligonucleotide to AML1 (16 nt) and ETO (18nt) are shown in black and grey, respectively.
Example 3
[0078] Selective and specific recognition of the CBFB-MYH11 fusion mRNA in acute myeloid leukemia M4 or other neoplasia where CBFB-MYH11 fusion mRNA is present, using the present invention.
TABLE-US-00005 5 tttgaagatagagacaggtctcatcgggaggaaatgg agaatgaagttgagagcgtcacagggatgcttaacgaggc cgaggggaaggccattaagctggccaaggacgtggcgtcc ctcagttcccagctccaggacacccaggagtt
[0079] Partial primary sequence of fusion CBFB-MYH11 mRNA (GenBank: AF249897.1); CBFBblack, MYH11grey; target sequences are underlined.
TABLE-US-00006 linkingmoiety(12ntgap) 3 TATCTCTGTCCAGAGTAGCC----------------TTACTTCAACTCTCG5
[0080] Example of the construct designed for selective and specific recognition of CBFB-MYH11 mRNA. The complementary oligonucleotide to CBFB (20 nt) and MYH11 (15nt) are shown in black and grey, respectively.
Example 4
[0081] Selective and specific recognition of the RBM15-MKL1 fusion mRNA in acute myeloid leukemia or other neoplasia where RBM15-MKL1 fusion mRNA is present, using the present invention.
TABLE-US-00007 5 tccctgtggggggcaacaaagacaaggaaaacaccgg ggtccttcatgccttcccaccttgtgagttctcccagcag ttcctggattcccctgccaaggcactggccaaatctgaag aagattacctggtcatgatcattgtccgtgctttgaaaag tccagccgcatttcatgagcagagaaggagcttggagcqg gccaagacagaggactatctcaaacggaagattcgttccc gaccggagagatcagagctggtcagaatgcacattttgga agagacctcggctgagccat
[0082] Partial primary sequence of fusion RBM15-MKL1 mRNA (GenBank: AF364035.1); RBM15black, MKL1grey; target sequences are underlined.
TABLE-US-00008 linkingmoiety(8ntgap)linkingmoiety(12ntgap) 3 CGGTTTAGACTTCT---------ACCAGTACTAGTAACAG---------TCAGGTCGGCGTAAAG5
[0083] Example of the construct designed for selective and specific recognition of RBM15-MKL1 mRNA. The complementary oligonucleotide to RBM15 (14 nt, 17 nt) and MKL1 (17 nt) are shown in black and grey, respectively.
Example 5
[0084] Selective and specific recognition of the MOZ-CBP fusion mRNA in acute myeloid leukemia or other neoplasia where MOZ-CBP fusion mRNA is present, using the present invention.
TABLE-US-00009 5 aaatgaacttttccctagagaatacttccgtcgtttg tcttcgcaggatgtactcaggtgtcagtcctcttctaaga ggaagtctaaagatgaagaagaagatgaagagtcagatga tgctgatgatgggaataactgggaacacaagtccatttgg acagccctttagtcaagctggagggcagccaatgggagcc actggagtgaacccccagttagccagcaaacagagcatgg tcaacagtttgcccaccttccctacagatatcaagaatac ttcagtcaccaacgtgccaa
[0085] Partial primary sequence of fusion MOZ-CBP mRNA (GenBank: AJ251844.1); MOZblack, CBPgrey; target sequences are underlined.
TABLE-US-00010 linkingmoiety(15ntgap)linkingmoiety(13ntgap) 3 TACTTCTCAGTCTACTAC------TGACCCTTGTGTTCAGGTA------ATCAGTTCGACCTCC5
[0086] Example of the construct designed for selective and specific recognition of MOZ-CBP mRNA. The complementary oligonucleotide to MOZ (18 nt, 19 nt) and CBP (15 nt) are shown in black and grey, respectively.
Example 6
[0087] Selective and specific recognition of the TAF2N-TEC fusion mRNA in myxoid chondrosarcoma or other neoplasia where TAF2N-TEC fusion mRNA is present, using the present invention.
TABLE-US-00011 5 ttatgatcagcagcatgattcctatagtcaaaaccag cagtcctatcattcacaaagggaaaactacagccaccaca cacaagatatgccctgcatccaagcccaatatagcccttc ccctccaggttccagttatacggcgcagacatacagctcg gaatacaccacggagatcatgaaccccgactacaccaagc tgaccatggaccttggcagcactgagatcacggctacagc
[0088] Partial primary sequence of fusion TAF2N-TEC mRNA (GenBank: AJ245932.1); TAF2Nblack, TECgrey; target sequences are underlined.
TABLE-US-00012 linkingmoiety(9ntgap)linkingmoiety(13ntgap) 3 TCGGTGGTGTGTGTTC------CGCAGGTTCGGGTTATA------GTCCAAGGTCAATACG5
[0089] Example of the construct designed for selective and specific recognition of TAF2N-TEC mRNA. The complementary oligonucleotides to TAF2N (16 nt) and TEC (17 nt, 16 nt) are shown in black and grey, respectively.
Example 7
[0090] Selective and specific recognition of the BRD4-NUT fusion mRNA in mediastinal carcinoma or other neoplasia where BRD4-NUT fusion mRNA is present, using the present invention.
TABLE-US-00013 5 gagcgctatgtcacctcctgtttgcggaagaaaagga aacctcaagctgagaaagttgatgtgattgccggctcctc caagatgaagggcttctcgtcctcagagtcggagagctcc agtgagtccagctcctctgacagcgaagactccgaaacag catctgcattgccgggaccggatatgagcatgaaacctag tgccgccctgtctccatcccctgcacttccctttctccca ccaacttctgacccaccagaccacccacccagggagccac ctccacagcccatcatgcct
[0091] Partial primary sequence of fusion BRD4-NUT mRNA (GenBank: AY166680.1); BRD4black, NUTgrey; target sequences are underlined.
TABLE-US-00014 linkingmoiety(7ntgap)linkingmoiety(7ntgap)linkingmoiety(8ntgap) 3 TCTCGAGGTCACTCAGGT----ACTGTCGCTTCTGAGGCT----AGACGTAACGGCCCTGGC----GTACTTTGGATCACGGCG5
[0092] Example of the construct designed for selective and specific recognition of BRD4-NUT mRNA. The complementary oligonucleotides to BRD4 (18 nt, 18 nt) and NUT (18 nt, 18 nt) are shown in black and grey, respectively.
[0093] In analogy, it is possible to selectively and specifically recognize the following fusion mRNAs:
TABLE-US-00015 fusion PML-RARA mRNA fusion BCM-IL2 mRNA fusion TEL-AML1 mRNA fusion CEV14-PDGFRB mRNA fusion TCR-RBTN2 mRNA fusion RBM15-MKL mRNA fusion TMP RSS2-ETS mRNA fusion ETV6-NTRK3 mRNA fusion NPM-ALK mRNA fusion TFE3-PRCC mRNA fusion PLZF-RARA mRNA fusion TFE3-ASPSCR1 mRNA fusion MLL-AF9 mRNA fusion PAX8-PPARG mRNA fusion DEK-CAN mRNA fusion TET1-TP53 mRNA fusion FUS-ERG mRNA fusion TFEB-ALPHA mRNA fusion AML1-MTG mRNA fusion TFE3-PSF mRNA fusion AML1-EAP mRNA fusion CHOP-EWS mRNA fusion NUP98-PMX1 mRNA fusion PAX3-FKHR mRNA fusion MLL-AFP1 mRNA fusion JAZF1-JJAZ1 mRNA fusion EA2-HLF mRNA fusion FUS-CREB312 mRNA fusion MOZ-P300 mRNA fusion TMP3-ALK mRNA fusion TEL-PDGFRB mRNA fusion CLTC-ALK mRNA fusion MLL-AFX1 mRNA fusion RPN1-EVI1 mRNA fusion E2A-PBX1 mRNA fusion EWS-FLI1 mRNA fusion MLL-AF6 mRNA fusion AML1-EVI-1 mRNA fusion NUP98-HOXA9 mRNA fusion ETV6-MN1 mRNA fusion MLL-AF4 mRNA fusion MLL-ENL mRNA fusion NUP98-RAP1GDS1 mRNA fusion CALM-AF10 mRNA fusion FUS-CHOP mRNA fusion PAX7-FKHR mRNA fusion SYT-SSX mRNA fusion EWS-CHN mRNA fusion TCF12-TEC mRNA fusion EWS-WT1 mRNA fusion ASPL-TFE3 mRNA fusion COL1A1-PDGFB mRNA fusion TPM4-ALK mRNA
[0094] Other applications of the present invention are demonstrated via Examples 8-11.
Example 8
[0095] Selective and specific therapeutic intervention to the natural biological function of any mRNA, when after application of the present invention and alteration of the functional state of the recognized mRNA the transfer of genetic information coded by this mRNA is prevented. Thereby, the mechanism of translation of the genetic information from mRNA to protein is interrupted which in case of a fusion mRNA, such as in Examples 1-7, results in direct suppression of the expression of causal fusion oncoproteins.
Example 9
[0096] Selective and specific detection of any mRNAs and subsequent quantification thereof, when sequence-specific oligonucleotides contain an incorporated detectable label, such as FITC, RITC, P.sup.32 isotope, which after application of the present invention and alteration of the functional state of the recognized mRNA emits a detectable signal corresponding to the stable heteroduplex.
Example 10
[0097] Purification and sorting of selectively and specifically recognized mRNA from other nucleic acids present in the analyzed sample, when the application of the present invention results in the alteration of the functional state of the recognized mRNA, i.e. a stable heteroduplex with different electrophoretic mobility is formed. Consequently, it is possible to separate the recognized mRNAs from other nucleic acids by applying of an external electric field. Analogously, via purposeful modification of sequence-specific oligonucleotides with primary antibodies, it is possible to sort the recognized mRNA after application of the present invention on the basis of its interaction with secondary antibodies.
Example 11
[0098] Functional analysis of individual genes, when a primary structure of sequence-specific oligonucleotides contain incorporated photo-labile functional groups enabling reversible change of the functional state of recognized mRNA. After application of the present invention and alteration of the functional state of the recognized mRNA it is possible to reverse this effect by application of radiation of a required wavelength. In this way it is possible to selectively and specifically study effects of suppression of gene expression under in situ and in vivo conditions.