Intrathecal delivery of recombinant adeno-associated virus encoding Methyl-CpG binding protein 2
11583564 · 2023-02-21
Assignee
Inventors
Cpc classification
A61K9/0019
HUMAN NECESSITIES
C12N7/00
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
C12N2750/14141
CHEMISTRY; METALLURGY
C12N2750/14132
CHEMISTRY; METALLURGY
International classification
C12N15/86
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
C12N7/00
CHEMISTRY; METALLURGY
A61K9/00
HUMAN NECESSITIES
Abstract
Methods and materials for intrathecal delivery of recombinant Adeno-associated virus 9 (rAAV9) encoding Methyl-CpG binding protein 2 (MECP2) are provided. Use of the methods and materials is contemplated, for example, for the treatment of Rett syndrome.
Claims
1. A method of treating Rett syndrome in a patient comprising the step of intrathecal administration of a recombinant adeno-associated virus 9 (rAAV9) encoding Methyl-CpG binding protein 2 (MECP2) to a patient in need thereof, wherein the rAAV9 comprises a self-complementary genome encoding MECP2B and wherein the sequence of the self-complementary genome is set out in SEQ ID NO: 1.
2. The method of claim 1 further comprising the intrathecal administration of iohexol, iobitridol, iomeprol, iopamidol, iopentol, iopromide, ioversol or ioxilan, or mixtures of two or more thereof.
3. The method of claim 1, further comprising putting the patient in the Trendelenberg position.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
DETAILED DESCRIPTION
(22) In one aspect, the invention provides methods for the intrathecal administration (i.e., administration into the space under the arachnoid membrane of the brain or spinal cord) of a polynucleotide encoding MECP2 to a patient comprising administering a rAAV9 with a genome including the polynucleotide. In some embodiments, the rAAV9 genome is a self-complementary genome. In other embodiments, the rAAV9 genome is a single-stranded genome.
(23) The methods deliver the polynucleotide encoding MECP2 to the brain and spinal cord of the patient (i.e., the central nervous system of the patient). Some target areas of the brain contemplated for delivery include, but are not limited to, the motor cortex and the brain stem. Some target cells of the central nervous system contemplated for delivery include, but are not limited to, nerve cells and glial cells. Examples of glial cells are microglial cells, oligodendrocytes and astrocytes.
(24) Delivery of polynucleotides encoding MECP2 is indicated, for example, for treatment of Rett Syndrome.
(25) “Treatment” comprises the step of administering via the intrathecal route an effective dose, or effective multiple doses, of a composition comprising a rAAV of the invention to a subject animal (including a human patient) in need thereof. If the dose is administered prior to development of a disorder/disease, the administration is prophylactic. If the dose is administered after the development of a disorder/disease, the administration is therapeutic. In embodiments of the invention, an effective dose is a dose that alleviates (either eliminates or reduces) at least one symptom associated with the disorder/disease state being treated, improves at least one symptom associated with the disorder/disease state being treated, that slows or prevents progression to a disorder/disease state, that diminishes the extent of disease, that results in remission (partial or total) of disease, and/or that prolongs survival.
(26) In treatment of Rett syndrome, the methods result in an effect in the subject including, but not limited to, regaining purposeful hand movements, improvement in speech, reduction in apneas, reduction in seizures, reduction in anxiety, increased socialization, increase in IQ, normalization of sleep patterns and/or increased mobility.
(27) Combination treatments are also contemplated by the invention. Combination as used herein includes both simultaneous treatment or sequential treatment. Combinations of methods of the invention with standard medical treatments for Rett syndrome are specifically contemplated, as are combinations with novel therapies.
(28) While delivery to an individual in need thereof after birth is contemplated, intrauteral delivery to a fetus is also contemplated.
(29) In another aspect, the invention provides rAAV genomes. The rAAV genomes comprise one or more AAV ITRs flanking a polynucleotide encoding MECP2. The polynucleotide is operatively linked to transcriptional control DNAs, specifically promoter DNA and polyadenylation signal sequence DNA that are functional in target cells to form a “gene cassette.” The gene cassette may include promoters that allow expression specifically within neurons or specifically within glial cells. Examples include neuron specific enolase and glial fibrillary acidic protein promoters. Inducible promoters under the control of an ingested drug may also be used. Examples include, but are not limited to, systems such as the tetracycline (TET on/off) system [Urlinger et al., Proc. Natl. Acad. Sci. USA 97(14):7963-7968 (2000)] and the Ecdysone receptor regulatable system [Palli et al., Eur J. Biochem 270: 1308-1315 (2003]. The gene cassette may further include intron sequences to facilitate processing of an RNA transcript when the polynucleotide is expressed in mammalian cells.
(30) The rAAV genomes of the invention lack AAV rep and cap DNA. AAV DNA in the rAAV genomes (e.g., ITRs) may be from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13 and AAVrh74. The nucleotide sequences of the genomes of the AAV serotypes are known in the art. For example, the AAV9 genome is provided in Gao et al., J. Virol., 78: 6381-6388 (2004).
(31) In another aspect, the invention provides DNA plasmids comprising rAAV genomes of the invention. The DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV (e.g., adenovirus, E1-deleted adenovirus or herpesvirus) for assembly of the rAAV genome into infectious viral particles with AAV9 capsid proteins. Techniques to produce rAAV particles, in which an AAV genome to be packaged, rep and cap genes, and helper virus functions are provided to a cell, are standard in the art. Production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. Production of pseudotyped rAAV is disclosed in, for example, WO 01/83692 which is incorporated by reference herein in its entirety. In various embodiments, AAV capsid proteins may be modified to enhance delivery of the recombinant vector. Modifications to capsid proteins are generally known in the art. See, for example, US 2005/0053922 and US 2009/0202490, the disclosures of which are incorporated by reference herein in their entirety.
(32) A method of generating a packaging cell is to create a cell line that stably expresses all the necessary components for AAV particle production. For example, a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell. AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-2081), addition of synthetic linkers containing restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23:65-73) or by direct, blunt-end ligation (Senapathy & Carter, 1984, J. Biol. Chem., 259:4661-4666). The packaging cell line is then infected with a helper virus such as adenovirus. The advantages of this method are that the cells are selectable and are suitable for large-scale production of rAAV. Other examples of suitable methods employ adenovirus or baculovirus rather than plasmids to introduce rAAV genomes and/or rep and cap genes into packaging cells.
(33) General principles of rAAV production are reviewed in, for example, Carter, 1992, Current Opinions in Biotechnology, 1533-539; and Muzyczka, 1992, Curr. Topics in Microbial. and Immunol., 158:97-129). Various approaches are described in Ratschin et al., Mol. Cell. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81:6466 (1984); Tratschin et al., Mol. Cell. Biol. 5:3251 (1985); McLaughlin et al., J. Virol., 62:1963 (1988); and Lebkowski et al., 1988 Mol. Cell. Biol., 7:349 (1988). Samulski et al. (1989, J. Virol., 63:3822-3828); U.S. Pat. No. 5,173,414; WO 95/13365 and corresponding U.S. Pat. No. 5,658,776; WO 95/13392; WO 96/17947; PCT/US98/18600; WO 97/09441 (PCT/US96/14423); WO 97/08298 (PCT/US96/13872); WO 97/21825 (PCT/US96/20777); WO 97/06243 (PCT/FR96/01064); WO 99/11764; Perrin et al. (1995) Vaccine 13:1244-1250; Paul et al. (1993) Human Gene Therapy 4:609-615; Clark et al. (1996) Gene Therapy 3:1124-1132; U.S. Pat. Nos. 5,786,211; 5,871,982; and 6,258,595. The foregoing documents are hereby incorporated by reference in their entirety herein, with particular emphasis on those sections of the documents relating to rAAV production.
(34) The invention thus provides packaging cells that produce replication-deficient, infectious rAAV. In one embodiment packaging cells may be stably transformed cancer cells such as HeLa cells, 293 cells and PerC.6 cells (a cognate 293 line). In another embodiment, packaging cells are cells that are not transformed cancer cells such as low passage 293 cells (human fetal kidney cells transformed with E1 of adenovirus), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells) and FRhL-2 cells (rhesus fetal lung cells).
(35) Thus, in another aspect, the invention provides rAAV such as rAAV9 (i.e., replication-deficient, infectious encapsidated rAAV9 particles) comprising a rAAV genome of the invention. The genomes of the rAAV lack AAV rep and cap DNA, that is, there is no AAV rep or cap DNA between the ITRs of the genomes. In some embodiments, the rAAV genome is a self-complementary genome. In some embodiments, the rAAV genome is a single-stranded genome.
(36) rAAV are provided such as a self-complementary AAV9 (scAAV9) named “AVXS-201.” Its gene cassette (nucleotides 151-2558 of the AVXS-201 genome set out in SEQ ID NO: 1) has, in sequence, a 546 bp promoter fragment (SEQ ID NO: 2) (nucleotides 74085586-74086323 of NC_000086.7 in the reverse orientation) from the mouse MECP2 gene, an SV40 intron, a human MECP2B cDNA (SEQ ID NO: 3) (CODS Database #CCDS48193.1), and a synthetic polyadenylation signal sequence (SEQ ID NO: 4). The gene cassette is flanked by a mutant AAV2 inverted terminal repeat (ITR) and a wild type AAV2 inverted terminal repeat that together enable packaging of self-complementary AAV genomes. The genome lacks AAV rep and cap DNA, that is, there is no AAV rep or cap DNA between the ITRs of the genome.
(37) rAAV are provided such as a scAAV9 named “scAAV9.738.Mecp2.” Its gene cassette (nucleotides 198-2890 of the scAAV9.738.Mecp2 genome set out in SEQ ID NO: 5) has, in sequence, a 738 bp promoter fragment (SEQ ID NO: 6) (nucleotides 74085586-74086323 of NC_000086.7 in the reverse orientation) from the mouse MECP2 gene, an SV40 intron, a mouse MECP2a cDNA (SEQ ID NO: 7) (CODS Database #CCDS41016.1), and a polyadenylation signal sequence from the bovine growth hormone gene. The gene cassette is flanked by a mutant AAV2 inverted terminal repeat (ITR) and a wild type AAV2 inverted terminal repeat that together enable packaging of self-complementary AAV genomes. The genome lacks AAV rep and cap DNA, that is, there is no AAV rep or cap DNA between the ITRs of the genome.
(38) Conservative nucleotide substitutions in the rAAV9 genome including, but not limited to, in the gene cassette in the rAAV9 genome, are contemplated. For example, a MECP2 cDNA in a gene cassette may have 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the MECP2a cDNA in scAAV9.738.Mecp2 or the MECP2B cDNA in AVXS-201.
(39) In some embodiments, the MECP2 polypeptide encoded by a rAAV9 of the invention may be a variant MECP2 polypeptide. A variant polypeptide retains MECP2 activity and has an amino acid sequence at least about 60, 70, 80, 85, 90, 95, 97, 98, 99 or 99.5% identical to the amino acid sequence of the MECP2 polypeptide encoded by the MECP2a cDNA in scAAV9.738.Mecp2 or the MECP2B cDNA in AVXS-201.
(40) The rAAV may be purified by methods standard in the art such as by column chromatography or cesium chloride gradients. Methods for purifying rAAV vectors from helper virus are known in the art and include methods disclosed in, for example, Clark et al., Hum. Gene Ther., 10(6): 1031-1039 (1999); Schenpp and Clark, Methods Mol. Med., 69: 427-443 (2002); U.S. Pat. No. 6,566,118 and WO 98/09657.
(41) In another aspect, the invention contemplates compositions comprising a rAAV, such as a rAAV9, encoding a MECP2 polypeptide.
(42) Compositions of the invention comprise rAAV in a pharmaceutically acceptable carrier. The compositions may also comprise other ingredients such as diluents and adjuvants. Acceptable carriers, diluents and adjuvants are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphate, citrate, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as Tween, pluronics or polyethylene glycol (PEG).
(43) Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.
(44) Titers and dosages of rAAV to be administered in methods of the invention will vary depending, for example, on the particular rAAV, the mode of administration, the treatment goal, the individual, the timing of administration, and the cell type(s) being targeted, and may be determined by methods standard in the art. Titers of rAAV may range from about 1×10.sup.6, about 1×10.sup.7, about 1×10.sup.8, about 1×10.sup.9, about 1×10.sup.10, about 1×10.sup.11, about 1×10.sup.12, about 1×10.sup.13 to about 1×10.sup.14 or more DNase resistant particles (DRP) per ml. Dosages may also be expressed in units of viral genomes (vg). These dosages of rAAV may range from about 1×10.sup.9 vg or more, about 1×10.sup.10 vg or more, about 1×10.sup.11 vg or more, about 1×10.sup.12 vg or more, about 6×10.sup.12 or more, about 1×10.sup.13 vg or more, about 1.3×10.sup.13 vg or more, about 1.4×10.sup.13 vg or more, about 2×10.sup.13 vg or more, about 3×10.sup.13 vg or more, about 6×10.sup.13 vg or more, about 1×10.sup.14 vg or more, about 3×10.sup.14 or more, about 6×10.sup.14 or more, about 1×10.sup.10 vg or more, about 3×10.sup.10 or more, about 6×10.sup.10 or more, about 1×10.sup.16 or more, about 3×10.sup.16 or more, or about 6×10.sup.16 or more. For a neonate, the dosages of rAAV may range from about 1×10.sup.9 vg or more, about 1×10.sup.10 vg or more, about 1×10.sup.11 vg or more, about 1×10.sup.12 vg or more, about 6×10.sup.12 or more, about 1×10.sup.13 vg or more, about 1.3×10.sup.13 vg or more, about 1.4×10.sup.13 vg or more, about 2×10.sup.13 vg or more, about 3×10.sup.13 vg or more, about 6×10.sup.13 vg or more, about 1×10.sup.14 vg or more, about 3×10.sup.14 or more, about 6×10.sup.14 or more, about 1×10.sup.15 vg or more, about 3×10.sup.15 or more, about 6×10.sup.15 or more, about 1×10.sup.16 or more, about 3×10.sup.16 or more, or about 6×10.sup.16 or more.
(45) The methods of the invention result in the transduction of target cells (including, but not limited to, nerve or glial cells). The term “transduction” is used to refer to the administration/delivery of a polynucleotide to a target cell either in vivo or in vitro, via a replication-deficient infectious rAAV of the invention resulting in expression of a functional MECP2 polypeptide by the recipient cell.
(46) Transduction of cells using rAAV of the invention results in sustained expression of the MECP2 polypeptide encoded by the rAAV. In some embodiments, the target expression level is contemplated to be about 75% to about 125% of the normal (or wild type) physiological expression level in a subject who does not have Rett syndrome. The target expression level may be about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 105%, about 110%, about 115%, about 120% or about 125% of the normal expression level.
(47) In some embodiments of treatment methods of the invention, a non-ionic, low-osmolar contrast agent is also administered to the patient. Such contrast agents include, but are not limited to, iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, ioxilan, and mixtures of two or more of the contrast agents. In some embodiments, the treatment methods thus further comprise administration of iohexol to the patient. The non-ionic, low-osmolar contrast agent is contemplated to increase transduction of target cells in the central nervous system of the patient. It is contemplated that the transduction of cells is increased when a rAAV of the disclosure is used in combination with a contrast agent as described herein relative to the transduction of cells when a rAAV of the disclosure is used alone. In various embodiments, the transduction of cells is increased by at least about 1%, or at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 120%, at least about 150%, at least about 180%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 450%, at least about 500% or more when a vector of the disclosure is used in combination with a contrast agent as described herein, relative to the transduction of a vector of the disclosure when not used in combination with a contrast agent. In further embodiments, the transduction of cells is increased by about 10% to about 50%, or by about 10% to about 100%, or by about 5% to about 10%, or by about 5% to about 50%, or by about 1% to about 500%, or by about 10% to about 200%, or by about 10% to about 300%, or by about 10% to about 400%, or by about 100% to about 500%, or by about 150% to about 300%, or by about 200% to about 500% when a vector of the disclosure is used in combination with a contrast agent as described herein, relative to the transduction of a vector of the disclosure when not used in combination with a contrast agent.
(48) In some embodiments, it is contemplated that the transduction of cells is increased when the patient is put in the Trendelenberg position (head down position). In some embodiments, for example, the patients is tilted in the head down position at about 1 degree to about 30 degrees, about 15 to about 30 degrees, about 30 to about 60 degrees, about 60 to about 90 degrees, or about 90 up to about 180 degrees) during or after intrathecal vector infusion. In various embodiments, the transduction of cells is increased by at least about 1%, or at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 120%, at least about 150%, at least about 180%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 450%, at least about 500% or more when a the Trendelenberg position is used as described herein, relative to when the Trendelenberg position is not used.
(49) In further embodiments, the transduction of cells is increased by about 10% to about 50%, or by about 10% to about 100%, or by about 5% to about 10%, or by about 5% to about 50%, or by about 1% to about 500%, or by about 10% to about 200%, or by about 10% to about 300%, or by about 10% to about 400%, or by about 100% to about 500%, or by about 150% to about 300%, or by about 200% to about 500% when a vector of the disclosure is used in combination with a contrast agent and the Trendelenberg position as described herein, relative to the transduction of a vector of the disclosure when not used in combination with a contrast agent and Trendelenberg position.
(50) The disclosure also provides treatment method embodiments wherein the intrathecal administration of a vector of the disclosure and a contrast agent to the central nervous system of a patient in need thereof results in an increase in survival of the patient relative to survival of the patient when a vector of the disclosure is administered in the absence of the contrast agent. In various embodiments, administration of a vector of the disclosure and a contrast agent to the central nervous system of a patient in need thereof results in an increase of survival of the patient of at least about 1%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200% or more relative to survival of the patient when a vector of the disclosure is administered in the absence of the contrast agent.
(51) The disclosure also provides treatment method embodiments wherein the intrathecal administration of a vector of the disclosure and a contrast agent to the central nervous system of a patient in need thereof who is put in the Trendelenberg position results in a further increase in survival of the patient relative to survival of the patient when a vector of the disclosure is administered in the absence of the contrast agent and the Trendelenberg position. In various embodiments, administration of a vector of the disclosure and a contrast agent to the central nervous system of a patient in need thereof put in the Trendelberg position results in an increase of survival of the patient of at least about 1%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200% or more relative to survival of the patient when a vector of the disclosure is administered in the absence of the contrast agent and the Trendelenberg position.
EXAMPLES
(52) The present invention is illustrated by the following. Proof of concept studies in female and male Rett mouse models show therapeutic efficacy following intravenous injection of scAAV9.738.Mecp2. (Example 1) A second generation gene therapy vector, AVXS-201, shows extension of survival over a wide range of doses following intracerebroventricular (ICV) treatment of Mecp2.sup.−/y mice. The maximal increase in median survival was 477% following AVXS-201 treatment.
Example 2
(53) Male Mecp2.sup.−/y mice treated with AVXS-201 show a durable improvement in behavior as measured by a composite rating developed for Rett mice. (Example 3) Phenotypic benefit in Mecp2.sup.−/y mice treated with AVXS-201 is obtained with moderate levels of protein expression. (Example 4) Treatment of wild type mice with AVXS-201 was well tolerated across all doses tested with consistent changes in behavioral scoring only noted in the high dose group. (Example 5 and Example 6) Intrathecal dosing in non-human primates indicates AVXS-201 is safe and well tolerated through 18 months post injection. (Example 7) AVXS-201 expresses transgene at physiological levels broadly in non-human primate brain and spinal cord following a one-time intrathecal injection. (Example 8)
Example 1
(54) Gene Therapy for Rett Syndrome Proof of Concept Studies in Female Rett Mice
(55) As proof of concept, symptomatic male and female Rett mice were intravenously treated with scAAV9.738.Mecp2 [Garg et al., The Journal of Neuroscience: The Official Journal of the Society for Neuroscience, 33: 13612-13620 (2013)]. The recombinant viral genome of scAAV9.738.Mecp2 (SEQ ID NO: 5) includes a 738 bp promoter fragment from the mouse Mecp2 gene [Adachi et al., Human Molecular Genetics, 14: 3709-3722 (2005)] driving expression of a mouse Mecp2a cDNA (CCDS Database # CCDS41016.1) and a bovine growth hormone polyadenylation signal. The gene cassette (nucleotides 198-2890 of SEQ ID NO: 5) is flanked by a mutant AAV2 inverted terminal repeat (ITR) and a wild type AAV2 ITR that enable packaging of self-complementary AAV genomes.
(56) Self-complementary AAV9 (scAAV9) was produced by transient transfection procedures using a double-stranded AAV2-ITR-based vector, with a plasmid encoding Rep2Cap9 sequence as previously described [Gao et al., J. Virol., 78: 6381-6388 (2004)] along with an adenoviral helper plasmid pHelper (Stratagene, Santa Clara, Calif.) in 293 cells. Virus was produced in three separate batches for the experiments and purified by two cesium chloride density gradient purification steps, dialyzed against PBS and formulated with 0.001% Pluronic-F68 to prevent virus aggregation and stored at 4° C. All vector preparations were titered by quantitative PCR using Taq-Man technology. Purity of vectors was assessed by 4-12% sodium dodecyl sulfate-acrylamide gel electrophoresis and silver staining (Invitrogen, Carlsbad, Calif.).
(57) Male mice with an Mecp2 null allele were treated intravenously with 3×10.sup.12 vg of either scAAV9.738.Mecp2 or an scAAV9 control vector between 4-6 weeks of age. The animals were followed for survival and assessed weekly for a phenotypic score [Guy et al., Science, 315: 1143-1147 (2007)].
(58) Components of the phenotypic scoring from Guy et al. 2007.
(59) A. Mobility: The mouse is observed when placed on bench, then when handled gently. 0=as wild-type. 1=reduced movement when compared to wild-type: extended freezing period when first placed on bench and longer periods spent immobile. 2=no spontaneous movement when placed on the bench; mouse can move in response to a gentle prod or a food pellet placed nearby. (Note: mice may become more active when in their own cage environment.)
B. Gait: 0=as wild-type. 1=hind legs are spread wider than wild-type when walking or running with reduced pelvic elevation, resulting in a “waddling” gait. 2=more severe abnormalities: tremor when feet are lifted, walks backwards or ‘bunny hops’ by lifting both rear feet at once.
C. Hindlimb clasping: Mouse observed when suspended by holding base of the tail. 0=legs splayed outwards. 1=hindlimbs are drawn towards each other (without touching) or one leg is drawn in to the body. 2=both legs are pulled in tightly, either touching each other or touching the body.
D. Tremor: Mouse observed while standing on the flat palm of the hand. 0=no tremor. 1=intermittent mild tremor. 2*=continuous tremor or intermittent violent tremor
E. Breathing: Movement of flanks observed while animal is standing still. 0=normal breathing. 1=periods of regular breathing interspersed with short periods of more rapid breathing or with pauses in breathing. 2*=very irregular breathing—gasping or panting.
F. General condition: Mouse observed for indicators of general well-being such as coat condition, eyes, body stance. 0=clean shiny coat, clear eyes, normal stance. 1=eyes dull, coat dull/ungroomed, somewhat hunched stance. 2*=eyes crusted or narrowed, piloerection, hunched posture.
(60)
Example 2
(61) AVXS-201 Preclinical Efficacy Studies
(62) To improve packaging efficiency and to incorporate a clinically relevant human MECP2 cDNA while maintaining physiological levels of gene expression, scAAV9.738.Mecp2 was re-engineered with a shorter promoter, a human MECP2B cDNA, and a synthetic polyadenylation signal. The re-engineered genome was packaged into AAV9 capsids as described below and the resulting scAAV was subsequently named “AVXS-201” (
(63) TABLE-US-00002 (SEQ ID NO: 2) GTGAACAACGCCAGGCTCCTCAACAGGCAACTTTGCTACTTCTACAGA AAATGATAATAAAGAAATGCTGGTGAAGTCAAATGCTTATCACAATGG TGAACTACTCAGCAGGGAGGCTCTAATAGGCGCCAAGAGCCTAGACTT CCTTAAGCGCCAGAGTCCACAAGGGCCCAGTTAATCCTCAACATTCAA ATGCTGCCCACAAAACCAGCCCCTCTGTGCCCTAGCCGCCTCTTTTTT CCAAGTGACAGTAGAACTCCACCAATCCGCAGCTGAATGGGGTCCGCC TCTTTTCCCTGCCTAAACAGACAGGAACTCCTGCCAATTGAGGGCGTC ACCGCTAAGGCTCCGCCCCAGCCTGGGCTCCACAACCAATGAAGGGTA ATCTCGACAAAGAGCAAGGGGTGGGGCGCGGGCGCGCAGGTGCAGCAG CACACAGGCTGGTCGGGAGGGCGGGGCGCGACGTCTGCCGTGCGGGGT CCCGGCATCGGTTGCGCGCGCGCTCCCTCCTCTCGGAGAGAGGGCTGT GGTAAAACCCGTCCGGAAAAC
Coding region sequence (human MeCP2B cds)
(64) TABLE-US-00003 (SEQ ID NO: 3) ATGGCCGCCGCCGCCGCCGCCGCGCCGAGCGGAGGAGGAGGAGGAGGC GAGGAGGAGAGACTGGAAGAAAAGTCAGAAGACCAGGACCTCCAGGGC CTCAAGGACAAACCCCTCAAGTTTAAAAAGGTGAAGAAAGATAAGAAA GAAGAGAAAGAGGGCAAGCATGAGCCCGTGCAGCCATCAGCCCACCAC TCTGCTGAGCCCGCAGAGGCAGGCAAAGCAGAGACATCAGAAGGGTCA GGCTCCGCCCCGGCTGTGCCGGAAGCTTCTGCCTCCCCCAAACAGCGG CGCTCCATCATCCGTGACCGGGGACCCATGTATGATGACCCCACCCTG CCTGAAGGCTGGACACGGAAGCTTAAGCAAAGGAAATCTGGCCGCTCT GCTGGGAAGTATGATGTGTATTTGATCAATCCCCAGGGAAAAGCCTTT CGCTCTAAAGTGGAGTTGATTGCGTACTTCGAAAAGGTAGGCGACACA TCCCTGGACCCTAATGATTTTGACTTCACGGTAACTGGGAGAGGGAGC CCCTCCCGGCGAGAGCAGAAACCACCTAAGAAGCCCAAATCTCCCAAA GCTCCAGGAACTGGCAGAGGCCGGGGACGCCCCAAAGGGAGCGGCACC ACGAGACCCAAGGCGGCCACGTCAGAGGGTGTGCAGGTGAAAAGGGTC CTGGAGAAAAGTCCTGGGAAGCTCCTTGTCAAGATGCCTTTTCAAACT TCGCCAGGGGGCAAGGCTGAGGGGGGTGGGGCCACCACATCCACCCAG GTCATGGTGATCAAACGCCCCGGCAGGAAGCGAAAAGCTGAGGCCGAC CCTCAGGCCATTCCCAAGAAACGGGGCCGAAAGCCGGGGAGTGTGGTG GCAGCCGCTGCCGCCGAGGCCAAAAAGAAAGCCGTGAAGGAGTCTTCT ATCCGATCTGTGCAGGAGACCGTACTCCCCATCAAGAAGCGCAAGACC CGGGAGACGGTCAGCATCGAGGTCAAGGAAGTGGTGAAGCCCCTGCTG GTGTCCACCCTCGGTGAGAAGAGCGGGAAAGGACTGAAGACCTGTAAG AGCCCTGGGCGGAAAAGCAAGGAGAGCAGCCCCAAGGGGCGCAGCAGC AGCGCCTCCTCACCCCCCAAGAAGGAGCACCACCACCATCACCACCAC TCAGAGTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCA CCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTGAG CCCCAGGACTTGAGCAGCAGCGTCTGCAAAGAGGAGAAGATGCCCAGA GGAGGCTCACTGGAGAGCGACGGCTGCCCCAAGGAGCCAGCTAAGACT CAGCCCGCGGTTGCCACCGCCGCCACGGCCGCAGAAAAGTACAAACAC CGAGGGGAGGGAGAGCGCAAAGACATTGTTTCATCCTCCATGCCAAGG CCAAACAGAGAGGAGCCTGTGGACAGCCGGACGCCCGTGACCGAGAGA GTTAGCTGA
PolyA sequence (synthetic)
(65) TABLE-US-00004 (SEQ ID NO: 4) AATAAAAGATCTTTATTTTCATTAGATCTGTGTGTTGGTTTTTTGTGT G
(66) scAAV9 was produced by transient transfection procedures using a double-stranded AAV2-ITR-based vector, with a plasmid encoding Rep2Cap9 sequence as previously described [Gao et al., supra] along with an adenoviral helper plasmid pHelper (Stratagene, Santa Clara, Calif.) in 293 cells. Virus was produced in three separate batches for the experiments and purified by two cesium chloride density gradient purification steps, dialyzed against PBS and formulated with 0.001% Pluronic-F68 to prevent virus aggregation and stored at 4° C. All vector preparations were titered by quantitative PCR using Taq-Man technology. Purity of vectors was assessed by 4-12% sodium dodecyl sulfate-acrylamide gel electrophoresis and silver staining (Invitrogen, Carlsbad, Calif.).
(67) Efficacy and dosing studies were performed in the same strain of Rett mice as in
(68) In addition to survival, treated and control mice were scored weekly for Rett phenotypes (phenotypes set out in the previous Example). Untreated males progress rapidly from a score of 0 to an average peak of 5.25 by 10 weeks of age (
Example 3
(69) AVXS-201 Expression of MECP2 Protein in the Treated Rett Mouse Brain
(70) At 3 weeks post injection, PBS treated male wild type, untreated Rett and vector treated Rett animals were euthanized to examine MECP2 protein levels in the brain following postnatal day 1 ICV injection of AVXS-201. One brain hemisphere was homogenized and analyzed by western blot to monitor MECP2 expression. A representative blot and quantification are shown in
Example 4
(71) Treatment of Wild Type Mice with AVXS-201 is Safe and Well Tolerated
(72) An important concern for an MECP2 replacement therapy is to assess the impact on the cells expressing an intact copy of MECP2. AVXS-201 was designed with this consideration in mind by incorporating a fragment of the murine Mecp2 promoter to support physiological regulation of the MECP2 transgene. To test the safety of AVXS-201, survival and behavior analysis was performed on cohorts of wild type mice that received P1 ICV injections of AVXS-201 just as in the male Rett mice.
(73) A total of 131 wild type male mice were treated with various ICV doses of AVXS-201 and followed for survival (
Example 5
(74) Physiological Levels of MECP2 are Maintained in Brains of Wild Type Mice Treated with Therapeutic Doses of AVXS-201
(75) To further investigate the levels associated with symptomatic MECP2 overexpression, wild type male mice received P1 ICV injections of PBS or AVXS-201 at the therapeutic target of 1.44×10.sup.10 vg or the highest dose tested of 1.13×10.sup.11 vg. Animals were euthanized 3 weeks post injection, and brains were harvested for western blot. For comparison, tissues were blotted alongside brains from a mouse model of MECP2 overexpression called Tg3. Brains were dissected into separate regions (Cb=cerebellum, Med=medulla, Hipp=hippocampus, Ctx=cortex and Mid=midbrain;
Example 6
(76) Body Weight, Hematology and Serum Chemistry are Unremarkable in Non-Human Primates Through 18 Months after Intrathecal Injection of AVXS-201
(77) To investigate the safety and tolerability of AVXS-201 and the associated intrathecal injection procedure, three treated male cynomolgus macaques were followed for 18 months post injection. Dosing parameters are shown in Table 2.
(78) TABLE-US-00005 TABLE 2 Vector Total BodyWeight Genomes/ Viral at Body Animal Genomes Injection Weight Duration ID (vg) (kg) (vg/kg) post Tx Hematology 15C34 6.0 × 10.sup.12 1.23 4.9 × 10.sup.12 18 mo and Serum 15C40 1.4 × 10.sup.13 1.79 7.8 × 10.sup.12 18 mo Chemistry 15C48 1.4 × 10.sup.13 1.83 7.7 × 10.sup.12 18 mo MECP2 15C38 1.3 × 10.sup.13 1.68 7.7 × 10.sup.12 6 wk Expression 15C49 1.0 × 10.sup.13 1.30 7.7 × 10.sup.12 6 wk
(79) Two animals were treated at the intended therapeutic dose (˜1.44×10.sup.9 vg equivalent on a per kg of body weight basis), and one received a ˜2-fold lower dose (˜7.00×10.sup.8 vg equivalent on a per kg of body weight basis). The intrathecal injection procedure was previously described in Meyer et al., Molecular Therapy: The Journal of the American Society of Gene Therapy, 23: 477-487 (2015). Briefly, vector was mixed with contrast agent for verifying vector spread. The anesthetized subject was placed in the lateral decubitus position and the posterior midline injection site at ˜L4/5 level (below the conus of the spinal cord) was prepared. Under sterile conditions, a spinal needle with stylet was inserted and subarachnoid cannulation was confirmed with the flow of clear CSF from the needle. 0.8 ml of CSF was drained in order to decrease the pressure in the subarachnoid space and immediately after the vector solution was injected. Following injection, animals were kept in the Trendelenburg position and their body was tilted head-down for 10 minutes. Treated animals were dosed at 6 or 12 months of age, body weight, blood counts and serum chemistries were collected monthly for the first 6 months post injection, and every two months thereafter. Body weight is shown in
Example 7
(80) Histopathological Analysis of Tissues from Non-Human Primates Following Intrathecal Injection of AVXS-201
(81) In addition to the in vivo (Example 6) and post mortem analyses (Example 8) samples of visceral and nervous system tissues from animals 15C38, 15C49 and 15C34 (Table 1) were sent to GEMpath Inc. (Longmont, Colo.) for paraffin embedding, sectioning and hematoxylin and eosin staining. The remaining animals (Table 8.2) are still in life and will be sent for analysis at study conclusion. Slides were read and reports were prepared by a GEMpath Board Certified Veterinary Pathologist. The tissues sampled and examined are shown in Table 3. The pathology reports note that AVXS-201 treatment did not induce lesions in any protocol-specified tissues at the 6 week or 18 month time point.
(82) TABLE-US-00006 TABLE 3 Animal ID Tissues 15C38 Adrenal Gland, Brain (amygdala, striatum, hippocampus, occipital cortex, temporal cortex, mid brain, 15C49 brain stem, cerebellum), Eye and Optic Nerve, Heart, Kidney, Liver, Lung, Lymph Node (inguinal), Pancreas, Spinal Cord (sections from cervical, thoracic, lumbar and sacral regions; some sections had attached dorsal root ganglia), Small Intestine (jejunum and ileum), Skeletal Muscle (diaphragm, gastrocnemius, quadriceps femoris, triceps brachii, transverse abdominal, tibialis anterior), Spleen, Testis/Epididymis, Thymus, Urinary Bladder 15C34 Adrenal Gland, Brain (amygdala, striatum, hippocampus, hypothalamus, visual cortex, motor and somatosensory cortex, associative cortex, auditory cortex, superior and inferior colliculi, cerebellum, deep cerebellar nuclei, pons and medulla oblongata), Eye and Optic Nerve, Heart, Kidney, Liver, Lung, Lymph Node, Pancreas, Spinal Cord (sections from cervical, thoracic, lumbar and sacral regions), Small Intestine (jejunum and ileum), Skeletal Muscle (diaphragm, gastrocnemius, quadriceps femoris, triceps brachii, transverse abdominal, tibialis anterior), Spleen, Testis/Epididymis, Thymus, Urinary Bladder
Example 8
(83) Physiological Levels of MeCP2 in the Non-Human Primate Brain Following Intrathecal Injection of AVXS-201
(84) Two 12-month-old, male cynomolgus macaques received intrathecal injections of 7.7×10.sup.12 vg/kg of AVXS-201 as described above. Animals persisted for six weeks post injection and were euthanized for analysis of MeCP2 expression. Selected brain regions were analyzed for total MeCP2 expression by immunohistochemistry (
(85) Disclosure from Provisional Patent Application No. 62/423,618 which is incorporated by reference herein in its entirety.
Gene Therapy for Rhett Syndrome
(86) Gene therapy to restore the transcription factor MeCP2 appears to be a feasible strategy for treating Rett syndrome, a progressive neurodevelopmental disorder leading to apparent autistic behavior, loss of motor function, and early death. We have developed an adeno-associated virus serotype 9 (AAV9) expressing human MECP2 under the control of a truncated endogenous promoter. The purpose of this work is to assess the efficacy and safety of this vector in mice (MeCP2 null and wild type) and non-human primates. Through continued research, our goal is to bring this treatment from the bench to the bedside.
(87) AAV9-P545-MeCP2
(88) TABLE-US-00007 Promoter region sequence (mouse MeCP2 promoter fragment) GTGAACAACGCCAGGCTCCTCAACAGGCAACTTTGCTACTTCTACAGA AAATGATAATAAAGAAATGCTGGTGAAGTCAAATGCTTATCACAATGG TGAACTACTCAGCAGGGAGGCTCTAATAGGCGCCAAGAGCCTAGACTT CCTTAAGCGCCAGAGTCCACAAGGGCCCAGTTAATCCTCAACATTCAA ATGCTGCCCACAAAACCAGCCCCTCTGTGCCCTAGCCGCCTCTTTTTT CCAAGTGACAGTAGAACTCCACCAATCCGCAGCTGAATGGGGTCCGCC TCTTTTCCCTGCCTAAACAGACAGGAACTCCTGCCAATTGAGGGCGTC ACCGCTAAGGCTCCGCCCCAGCCTGGGCTCCACAACCAATGAAGGGTA ATCTCGACAAAGAGCAAGGGGTGGGGCGCGGGCGCGCAGGTGCAGCAG CACACAGGCTGGTCGGGAGGGCGGGGCGCGACGTCTGCCGTGCGGGGT CCCGGCATCGGTTGCGCGCGCGCTCCCTCCTCTCGGAGAGAGGGCTGT GGTAAAACCCGTCCGGAAAAC Coding region sequence (human MeCP2 cds) ATGGCCGCCGCCGCCGCCGCCGCGCCGAGCGGAGGAGGAGGAGGAGGC GAGGAGGAGAGACTGGAAGAAAAGTCAGAAGACCAGGACCTCCAGGGC CTCAAGGACAAACCCCTCAAGTTTAAAAAGGTGAAGAAAGATAAGAAA GAAGAGAAAGAGGGCAAGCATGAGCCCGTGCAGCCATCAGCCCACCAC TCTGCTGAGCCCGCAGAGGCAGGCAAAGCAGAGACATCAGAAGGGTCA GGCTCCGCCCCGGCTGTGCCGGAAGCTTCTGCCTCCCCCAAACAGCGG CGCTCCATCATCCGTGACCGGGGACCCATGTATGATGACCCCACCCTG CCTGAAGGCTGGACACGGAAGCTTAAGCAAAGGAAATCTGGCCGCTCT GCTGGGAAGTATGATGTGTATTTGATCAATCCCCAGGGAAAAGCCTTT CGCTCTAAAGTGGAGTTGATTGCGTACTTCGAAAAGGTAGGCGACACA TCCCTGGACCCTAATGATTTTGACTTCACGGTAACTGGGAGAGGGAGC CCCTCCCGGCGAGAGCAGAAACCACCTAAGAAGCCCAAATCTCCCAAA GCTCCAGGAACTGGCAGAGGCCGGGGACGCCCCAAAGGGAGCGGCACC ACGAGACCCAAGGCGGCCACGTCAGAGGGTGTGCAGGTGAAAAGGGTC CTGGAGAAAAGTCCTGGGAAGCTCCTTGTCAAGATGCCTTTTCAAACT TCGCCAGGGGGCAAGGCTGAGGGGGGTGGGGCCACCACATCCACCCAG GTCATGGTGATCAAACGCCCCGGCAGGAAGCGAAAAGCTGAGGCCGAC CCTCAGGCCATTCCCAAGAAACGGGGCCGAAAGCCGGGGAGTGTGGTG GCAGCCGCTGCCGCCGAGGCCAAAAAGAAAGCCGTGAAGGAGTCTTCT ATCCGATCTGTGCAGGAGACCGTACTCCCCATCAAGAAGCGCAAGACC CGGGAGACGGTCAGCATCGAGGTGGAACAAGGAAGTGGTGAAGCCCCT GCTGGTGTCCACCCTCGGTGAGAAGAGCGAGGACTGAAGACCTGTAAG AGCCCTGGGCGGAAAAGCAAGGAGAGCAGCCCCAAGGGGCGCAGCAGC AGCGCCTCCTCACCCCCCAAGAAGGAGCACCACCACCATCACCACCAC TCAGAGTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCTGCCCCCA CCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTGAG CCCCAGGACTTGAGCAGCAGCGTCTGCAAAGAGGAGAAGATGCCCAGA GGAGGCTCACTGGAGAGCGACGGCTGCCCCAAGGAGCCAGCTAAGACT CAGCCCGCGGTTGCCACCGCCGCCACGGCCGCAGAAAAGTACAAACAC CGAGGGGAGGGAGAGCGCAAAGACATTGTTTCATCCTCCATGCCAAGG CCAAACAGAGAGGAGCCTGTGGACAGCCGGACGCCCGTGACCGAGAGA GTTAGCTGA PolyA sequence (synthetic) AATAAAAGATCTTTATTTTCATTAGATCTGTGTGTTGGTTTTTTGTGT G
(89) While the present invention has been described in terms of various embodiments and examples, it is understood that variations and improvements will occur to those skilled in the art. Therefore, only such limitations as appear in the claims should be placed on the invention.
(90) All documents referred to herein are incorporated by reference in their entirety.