Compositions and methods for identifying depressive disorders

10093981 ยท 2018-10-09

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided herein are compositions, kits, and methods for the identification of depressive disorders. In particular, provided herein are compositions, kits, and methods for the detection or diagnosis of major depressive disorder.

Claims

1. A panel of biomarkers consisting of an isolated set of 100 or fewer full-length cDNA biomarkers, wherein said isolated set includes ADCY3, DGKA, FAM46A, IGSF4A/CADM1, KIAA1539, MARCKS, PSME1, RAPH1, and TLR7 full-length cDNA biomarkers.

Description

DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows scatter plots of delta CT values for each transcript measured at baseline in MDD subjects and their matched controls. A reference line is presented along the diagonal, hence if data is below the line, control levels are higher (concentration=2-delta CT) than MDD levels, or if the points trend above the line, control levels are lower. Bolded transcript names differed significantly between MDD and control subjects as indicated in Table 3.

DEFINITIONS

(2) As used herein, the term subject refers to any animal (e.g., a mammal), including, but not limited to, humans, non-human primates, rodents, and the like. Typically, the terms subject and patient are used interchangeably herein in reference to a human subject.

(3) As used herein, the term adult refers to an individual who has attained physical and/or psychological maturity (e.g., >16 years old, >18 years old, >20 years old, etc.).

(4) As used herein, the terms subject suspected of having depression or subject suspected of having MDD refer to a subject that presents one or more symptoms indicative of depression or MDD, has one or more risk factors for depression or MDD, or is being screened for depression or MDD (e.g., during a routine physical). A subject suspected of having depression or MDD may not have been tested for depression or MDD (e.g., by the methods described herein or by other methods), or may not have had a recent test, which indicated the subject suffers from depression or MDD. However, a subject suspected of having depression or MDD encompasses an individual who has received a preliminary diagnosis but for whom a confirmatory test has not been done. A subject suspected of having depression or MDD is sometimes diagnosed with depression or MDD and is sometimes found to not have depression or MDD.

(5) As used herein, the terms subject diagnosed with depression and subject diagnosed with MDD refers to a subject who has been tested and found to have depression or MDD. Subject may be diagnosed using any suitable method, including those described herein.

(6) As used herein, the terms subject suffering from depression and subject suffering with MDD refers to a subject who has depression or MDD and exhibits one or more symptoms thereof (whether or not symptoms are apparent). A subject suffering from depression or MDD may or may not have received a diagnosis, and may or may not be aware of the condition.

(7) As used herein, the term subject at risk for depression or MDD refers to a subject with one or more risk factors for developing depression or MDD (e.g., genetics).

(8) As used herein, the term providing a prognosis refers to providing information regarding the impact of depression or MDD on a subject's future health.

(9) As used herein, the term sample is used in its broadest sense. In one sense, it is meant to include a specimen or culture obtained from any source. Biological samples may be obtained from animals (including humans) and encompass fluids, solids, tissues, and gases. Biological samples include urine, saliva, tissues, lacrimal fluid, blood, and blood products, such as plasma, serum and the like.

(10) As used herein, the term reagent(s) capable of specifically detecting biomarker expression refers to reagents used to detect the expression of biomarkers (e.g., RAPH1, KIAA1539, etc. (e.g., in the blood (e.g., above/below a threshold))). Examples of suitable reagents include but are not limited to, nucleic acid probes capable of specifically hybridizing to mRNA or cDNA, and antibodies (e.g., monoclonal antibodies).

(11) As used here, the term antibody includes monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), humanized antibodies, and antibody fragments so long as they exhibit the desired biological activity. Antibodies can be conjugated to other molecules (e.g., toxins). As used herein, the term antibody fragments refers to a portion of an intact antibody. Examples of antibody fragments include, but are not limited to, linear antibodies; single-chain antibody molecules; Fc or Fc peptides, Fab and Fab fragments, and multispecific antibodies formed from antibody fragments.

(12) The terms specific binding or specifically binding when used in reference to the interaction of capture or detection reagent (e.g., antibody, probe, etc.) and a target or biomarker (e.g., protein, DNA, RNA, etc.) means that the interaction is dependent upon the presence of a particular structure (i.e., the antigenic determinant or epitope; the nucleic acid sequence) and that targets or markers lacking such structures are not bound to a substantial degree by the reagent.

(13) As used herein, the terms non-specific binding and background binding when used in reference to the interaction capture or detection reagent (e.g., antibody probe etc.) and a target or biomarker (e.g., protein, DNA, RNA, etc.) refer to an interaction that is not dependent on the presence of a particular structure or sequence.

(14) As used herein, a reagent that specifically detects expression levels refers to reagents used to detect the expression of one or more genes (e.g., including but not limited to, the biomarkers herein). Examples of suitable reagents include but are not limited to, nucleic acid probes capable of specifically hybridizing to the gene of interest, aptamers, PCR primers capable of specifically amplifying the gene of interest, and antibodies capable of specifically binding to proteins expressed by the gene of interest.

(15) As used herein, the term nucleic acid detection assay refers to any method of determining the nucleotide composition of a nucleic acid of interest. Nucleic acid detection assay include but are not limited to, DNA sequencing methods, probe hybridization methods, enzyme mismatch cleavage methods (e.g., Variagenics, U.S. Pat. Nos. 6,110,684, 5,958,692, 5,851,770, herein incorporated by reference in their entireties); polymerase chain reaction; branched hybridization methods (e.g., Chiron, U.S. Pat. Nos. 5,849,481, 5,710,264, 5,124,246, and 5,624,802, herein incorporated by reference in their entireties); rolling circle replication (e.g., U.S. Pat. Nos. 6,210,884, 6,183,960 and 6,235,502, herein incorporated by reference in their entireties); NASBA (e.g., U.S. Pat. No. 5,409,818, herein incorporated by reference in its entirety); molecular beacon technology (e.g., U.S. Pat. No. 6,150,097, herein incorporated by reference in its entirety); E-sensor technology (Motorola, U.S. Pat. Nos. 6,248,229, 6,221,583, 6,013,170, and 6,063,573, herein incorporated by reference in their entireties); cycling probe technology (e.g., U.S. Pat. Nos. 5,403,711, 5,011,769, and 5,660,988, herein incorporated by reference in their entireties); Dade Behring signal amplification methods (e.g., U.S. Pat. Nos. 6,121,001, 6,110,677, 5,914,230, 5,882,867, and 5,792,614, herein incorporated by reference in their entireties); ligase chain reaction (e.g., Barnay Proc. Natl. Acad. Sci USA 88, 189-93 (1991)); and sandwich hybridization methods (e.g., U.S. Pat. No. 5,288,609, herein incorporated by reference in its entirety).

(16) The term primer refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, that is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product that is complementary to a nucleic acid strand is induced, (e.g., in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH). The primer is preferably single stranded for maximum efficiency in amplification, but may alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent. The exact lengths of the primers will depend on many factors, including temperature, source of primer, and the use of the method.

(17) The term probe refers to an oligonucleotide (e.g., a sequence of nucleotides), whether occurring naturally as in a purified restriction digest or produced synthetically, recombinantly, or by PCR amplification, that is capable of hybridizing to another oligonucleotide of interest. A probe may be single-stranded or double-stranded. Probes are useful in the detection, identification, and isolation of particular gene sequences (e.g., a capture probe). It is contemplated that any probe used in the present invention may, in some embodiments, be labeled with any reporter molecule, so that is detectable in any detection system, including, but not limited to enzyme (e.g., ELISA, as well as enzyme-based histochemical assays), fluorescent, radioactive, and luminescent systems. It is not intended that the present invention be limited to any particular detection system or label.

(18) As used herein, a diagnostic test application includes the detection or identification of a disease state or condition of a subject, determining the likelihood that a subject will contract a given disease or condition, determining the likelihood that a subject with a disease or condition will respond to therapy, determining the prognosis of a subject with a disease or condition (or its likely progression or regression), and determining the effect of a treatment on a subject with a disease or condition.

DETAILED DESCRIPTION OF THE INVENTION

(19) Provided herein are compositions, kits, and methods for the identification of depressive disorders. In particular, provided herein are compositions, kits, and methods for the detection or diagnosis of major depressive disorder.

(20) Major depressive disorder (MDD) is a complex psychiatric disease, affecting 6.7% of the U.S. adult population in a year (Kessler et al. Arch Gen Psychiatry 2005; 62: 593-602.; herein incorporated by reference in its entirety), with a steadily increasing prevalence (Hidaka. J Affect Disord 2012; 140: 205-14.; Lepine & Briley. Neuropsychiatr Dis Treat 2011; 7: 3-7.; herein incorporated by reference in their entireties). The World Health Organization has determined that depressive disorders are the leading cause of disability worldwide (Ferrari et al. PLoS Med 2013; 10: e1001547.; herein incorporated by reference in its entirety). The recurrent and chronic forms of depression account for the bulk of the high burden associated with the disorder (Hardeveld et al. Acta psychiatrica Scandinavica 2010; 122: 184-91.; herein incorporated by reference in its entirety). Successful treatment of depression relies first upon accurate diagnosis. Currently, depression is diagnosed based on the patients' self-report of their symptoms, and the evaluation of the structured psychiatric interview(s) with the patient by a psychiatrist, psychologist or primary care physician. The severity of self-reported and clinician rated depression symptoms are sometimes in conflict as depressed patients frequently underreport depression symptoms or inadequately characterize them (Carter et al. J Affect Disord 2010; 124: 202-6.; herein incorporated by reference in its entirety). Similarly, there is no perfect harmony between the different depression scoring systems (Riedel et al. J Psychiatr Res 2010; 44: 1063-8.; herein incorporated by reference in its entirety). There are no reliable objective biological diagnostic tests for major depression either (Belmaker & Agam. The New England Journal of Medicine 2008; 358: 55-68.; herein incorporated by reference in its entirety). The diagnostic delay is 2-40 months and the longer this period is the more difficult it is to treat depression (Altamura et al. Int Clin Psychopharmacol 2010; 25: 172-9.; Huerta-Ramirez et al. J Affect Disord 2013; 150: 1247-50.; herein incorporated by reference in their entireties). Most depression is treated in primary care: it is estimated that 12.5% of primary care patients have had MDD in any given year, but only 47% of those cases are recognized clinically (Pence et al. Curr Psychiatry Rep 2012; 14: 328-35.; herein incorporated by reference in its entirety).

(21) Provided herein are objective diagnostic tools that, for example, increase accuracy of diagnosis for depressive disorders (e.g., major depressive disorder (MDD)), and promote individualized therapy. Experiments were conducted during development of embodiments described herein to identify blood-based biomarkers (e.g., a biomarker panel). A group of adult primary care patients with MDD and age, gender and race-matched non-depressed (ND) controls were studied. Blood transcript levels of nine markers, of ADCY3, DGKA, FAM46A, IGSF4A/CADM1, KIAA1539, MARCKS, PSME1, RAPH1 and TLR7, differed significantly between participants with MDD (N=32) and ND controls (N=32) at baseline (q<0.05). Thus, blood levels of transcript panel, or a portion of the biomarkers therein (e.g., RAPH1 and/or KIAA1539), discriminated between depressed and non-depressed subjects.

(22) In some embodiments, a subject to be tested by the methods and reagents described herein exhibits one or more symptoms of depression and/or has one or more risk factors for depression. Symptoms of depression include, for example: feelings of sadness, emptiness or unhappiness; angry outbursts, irritability or frustration, even over small matters; loss of interest or pleasure in normal activities, such as sex; sleep disturbances, including insomnia or sleeping too much; tiredness and lack of energy, so that even small tasks take extra effort; changes in appetiteoften reduced appetite and weight loss, but increased cravings for food and weight gain in some people; anxiety, agitation or restlessnessfor example, excessive worrying, pacing, hand-wringing or an inability to sit still; slowed thinking, speaking or body movements; feelings of worthlessness or guilt, fixating on past failures or blaming yourself for things that are not your responsibility; trouble thinking, concentrating, making decisions and remembering things; frequent thoughts of death, suicidal thoughts, suicide attempts or suicide; Unexplained physical problems, such as back pain or headaches; etc. Risk factors of depression include, for example: depression that started when you were a teen or child; history of anxiety disorder, borderline personality disorder or post-traumatic stress disorder; abuse of alcohol or illegal drugs; certain personality traits, such as having low self-esteem and being overly dependent, self-critical or pessimistic; serious or chronic illness, such as cancer, diabetes or heart disease; certain medications, such as some high blood pressure medications or sleeping pills (talk to your doctor before stopping any medication); traumatic or stressful events, such as physical or sexual abuse, the loss of a loved one, a difficult relationship or financial problems; blood relatives with a history of depression, bipolar disorder, alcoholism or suicide; etc. In some embodiments, prior to, concurrent with, and/or following testing a subject for the biomarkers of vulnerability to recurrent depression described herein, a subject is evaluated for symptoms and/or risk factors.

(23) The level of biomarker(s) present in a sample may be assessed on an absolute basis or a relative basis. When assessed on a relative basis, comparison may be made to controls including but not limited to a historical sample from the same patient (e.g., serial samples, longitudinal samples); level(s) found in a patient or population of patients absent of disease or disorder; a threshold value; an acceptable range; etc.

(24) In some embodiments, provided herein are DNA-, RNA- and protein-based diagnostic methods that either directly or indirectly detect the biomarkers described herein. The present invention also provides compositions, reagents, and kits for such diagnostic purposes. The diagnostic methods described herein may be qualitative or quantitative. Quantitative diagnostic methods may be used, for example, to compare a detected biomarker level to a cutoff or threshold level. Where applicable, qualitative or quantitative diagnostic methods may also include amplification of target, signal or intermediary.

(25) In some embodiments, biomarkers are detected at the nucleic acid (e.g., RNA) level. For example, the amount of biomarker RNA (e.g., mRNA) present in a sample is determined (e.g., to determine the level of biomarker expression). Biomarker nucleic acid (e.g., RNA, amplified cDNA, etc.) may be detected/quantified using a variety of nucleic acid techniques known to those of ordinary skill in the art, including but not limited to nucleic acid sequencing, nucleic acid hybridization, and nucleic acid amplification.

(26) A variety of biological assays may be used to assess expression levels of depression markers. For example, in some embodiments, a microarray is used. Different kinds of biological assays are called microarrays including, but not limited to: DNA microarrays (e.g., cDNA microarrays and oligonucleotide microarrays); protein microarrays; tissue microarrays; transfection or cell microarrays; chemical compound microarrays; and, antibody microarrays. A DNA microarray, commonly known as gene chip, DNA chip, or biochip, is typically a collection of microscopic DNA spots attached to a solid surface (e.g., glass, plastic or silicon chip) forming an array for the purpose of expression profiling or monitoring expression levels for thousands of genes simultaneously. The affixed DNA segments are known as probes, thousands of which can be used in a single DNA microarray. Microarrays can be used to identify disease genes by comparing gene expression in disease and normal cells. Microarrays can be fabricated using a variety of technologies, including but not limiting: printing with fine-pointed pins onto glass slides; photolithography using pre-made masks; photolithography using dynamic micromirror devices; ink-jet printing; or, electrochemistry on microelectrode arrays.

(27) Southern and Northern blotting is used to detect specific DNA or RNA sequences, respectively. DNA or RNA extracted from a sample is fragmented, electrophoretically separated on a matrix gel, and transferred to a membrane filter. The filter bound DNA or RNA is subject to hybridization with a labeled probe complementary to the sequence of interest. Hybridized probe bound to the filter is detected. A variant of the procedure is the reverse Northern blot, in which the substrate nucleic acid that is affixed to the membrane is a collection of isolated DNA fragments and the probe is RNA extracted from a tissue and labeled.

(28) Genomic DNA and mRNA may be amplified prior to or simultaneous with detection. Illustrative non-limiting examples of nucleic acid amplification techniques include, but are not limited to, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), transcription-mediated amplification (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA), and nucleic acid sequence based amplification (NASBA). Those of ordinary skill in the art will recognize that certain amplification techniques (e.g., PCR) require that RNA be reversed transcribed to DNA prior to amplification (e.g., RT-PCR), whereas other amplification techniques directly amplify RNA (e.g., TMA and NASBA).

(29) The polymerase chain reaction, commonly referred to as PCR, uses multiple cycles of denaturation, annealing of primer pairs to opposite strands, and primer extension to exponentially increase copy numbers of a target nucleic acid sequence. In a variation called RT-PCR, reverse transcriptase (RT) is used to make a complementary DNA (cDNA) from mRNA, and the cDNA is then amplified by PCR to produce multiple copies of DNA.

(30) Transcription mediated amplification (U.S. Pat. Nos. 5,480,784 and 5,399,491, each of which is herein incorporated by reference in its entirety), commonly referred to as TMA, synthesizes multiple copies of a target nucleic acid sequence autocatalytically under conditions of substantially constant temperature, ionic strength, and pH in which multiple RNA copies of the target sequence autocatalytically generate additional copies. See, e.g., U.S. Pat. Nos. 5,399,491 and 5,824,518, each of which is herein incorporated by reference in its entirety. In a variation described in U.S. Publ. No. 20060046265 (herein incorporated by reference in its entirety), TMA optionally incorporates the use of blocking moieties, terminating moieties, and other modifying moieties to improve TMA process sensitivity and accuracy.

(31) The ligase chain reaction (Weiss, R., Science 254: 1292 (1991), herein incorporated by reference in its entirety), commonly referred to as LCR, uses two sets of complementary DNA oligonucleotides that hybridize to adjacent regions of the target nucleic acid. The DNA oligonucleotides are covalently linked by a DNA ligase in repeated cycles of thermal denaturation, hybridization and ligation to produce a detectable double-stranded ligated oligonucleotide product.

(32) Strand displacement amplification (Walker, G. et al., Proc. Natl. Acad. Sci. USA 89: 392-396 (1992); U.S. Pat. Nos. 5,270,184 and 5,455,166, each of which is herein incorporated by reference in its entirety), commonly referred to as SDA, uses cycles of annealing pairs of primer sequences to opposite strands of a target sequence, primer extension in the presence of a dNTPaS to produce a duplex hemiphosphorothioated primer extension product, endonuclease-mediated nicking of a hemimodified restriction endonuclease recognition site, and polymerase-mediated primer extension from the 3 end of the nick to displace an existing strand and produce a strand for the next round of primer annealing, nicking and strand displacement, resulting in geometric amplification of product. Thermophilic SDA (tSDA) uses thermophilic endonucleases and polymerases at higher temperatures in essentially the same method (EP Pat. No. 0 684 315).

(33) Other amplification methods include, for example: nucleic acid sequence based amplification (U.S. Pat. No. 5,130,238, herein incorporated by reference in its entirety), commonly referred to as NASBA; one that uses an RNA replicase to amplify the probe molecule itself (Lizardi et al., BioTechnol. 6: 1197 (1988), herein incorporated by reference in its entirety), commonly referred to as Q? replicase; a transcription based amplification method (Kwoh et al., Proc. Natl. Acad. Sci. USA 86:1173 (1989)); and, self-sustained sequence replication (Guatelli et al., Proc. Natl. Acad. Sci. USA 87: 1874 (1990), each of which is herein incorporated by reference in its entirety). For further discussion of known amplification methods see Persing, David H., In Vitro Nucleic Acid Amplification Techniques in Diagnostic Medical Microbiology: Principles and Applications (Persing et al., Eds.), pp. 51-87 (American Society for Microbiology, Washington, D.C. (1993)).

(34) Non-amplified or amplified nucleic acids can be detected by any conventional means. For example, in some embodiments, nucleic acids are detected by hybridization with a detectably labeled probe and measurement of the resulting hybrids. Illustrative non-limiting examples of detection methods are described below.

(35) One illustrative detection method, the Hybridization Protection Assay (HPA) involves hybridizing a chemiluminescent oligonucleotide probe (e.g., an acridinium ester-labeled (AE) probe) to the target sequence, selectively hydrolyzing the chemiluminescent label present on unhybridized probe, and measuring the chemiluminescence produced from the remaining probe in a luminometer. See, e.g., U.S. Pat. No. 5,283,174 and Norman C. Nelson et al., Nonisotopic Probing, Blotting, and Sequencing, ch. 17 (Larry J. Kricka ed., 2d ed. 1995, each of which is herein incorporated by reference in its entirety).

(36) Another illustrative detection method provides for quantitative evaluation of the amplification process in real-time. Evaluation of an amplification process in real-time involves determining the amount of amplicon in the reaction mixture either continuously or periodically during the amplification reaction, and using the determined values to calculate the amount of target sequence initially present in the sample. A variety of methods for determining the amount of initial target sequence present in a sample based on real-time amplification are well known in the art. These include methods disclosed in U.S. Pat. Nos. 6,303,305 and 6,541,205, each of which is herein incorporated by reference in its entirety. Another method for determining the quantity of target sequence initially present in a sample, but which is not based on a real-time amplification, is disclosed in U.S. Pat. No. 5,710,029, herein incorporated by reference in its entirety.

(37) Amplification products may be detected in real-time through the use of various self-hybridizing probes, most of which have a stem-loop structure. Such self-hybridizing probes are labeled so that they emit differently detectable signals, depending on whether the probes are in a self-hybridized state or an altered state through hybridization to a target sequence. By way of non-limiting example, molecular torches are a type of self-hybridizing probe that includes distinct regions of self-complementarity (referred to as the target binding domain and the target closing domain) which are connected by a joining region (e.g., non-nucleotide linker) and which hybridize to each other under predetermined hybridization assay conditions. In a preferred embodiment, molecular torches contain single-stranded base regions in the target binding domain that are from 1 to about 20 bases in length and are accessible for hybridization to a target sequence present in an amplification reaction under strand displacement conditions. Under strand displacement conditions, hybridization of the two complementary regions, which may be fully or partially complementary, of the molecular torch is favored, except in the presence of the target sequence, which will bind to the single-stranded region present in the target binding domain and displace all or a portion of the target closing domain. The target binding domain and the target closing domain of a molecular torch include a detectable label or a pair of interacting labels (e.g., luminescent/quencher) positioned so that a different signal is produced when the molecular torch is self-hybridized than when the molecular torch is hybridized to the target sequence, thereby permitting detection of probe:target duplexes in a test sample in the presence of unhybridized molecular torches. Molecular torches and a variety of types of interacting label pairs are disclosed in U.S. Pat. No. 6,534,274, herein incorporated by reference in its entirety.

(38) Another example of a detection probe having self-complementarity is a molecular beacon. Molecular beacons include nucleic acid molecules having a target complementary sequence, an affinity pair (or nucleic acid arms) holding the probe in a closed conformation in the absence of a target sequence present in an amplification reaction, and a label pair that interacts when the probe is in a closed conformation. Hybridization of the target sequence and the target complementary sequence separates the members of the affinity pair, thereby shifting the probe to an open conformation. The shift to the open conformation is detectable due to reduced interaction of the label pair, which may be, for example, a fluorophore and a quencher (e.g., DABCYL and EDANS). Molecular beacons are disclosed in U.S. Pat. Nos. 5,925,517 and 6,150,097, herein incorporated by reference in its entirety.

(39) Other self-hybridizing probes are well known to those of ordinary skill in the art. By way of non-limiting example, probe binding pairs having interacting labels, such as those disclosed in U.S. Pat. No. 5,928,862 (herein incorporated by reference in its entirety) might be adapted for use in the present invention. Probe systems used to detect single nucleotide polymorphisms (SNPs) might also be utilized in the present invention. Additional detection systems include molecular switches, as disclosed in U.S. Publ. No. 20050042638, herein incorporated by reference in its entirety. Other probes, such as those comprising intercalating dyes and/or fluorochromes, are also useful for detection of amplification products in the present invention. See, e.g., U.S. Pat. No. 5,814,447 (herein incorporated by reference in its entirety).

(40) In some embodiments, quantitative PCR (qPCR) is utilized, e.g., using SYBR Green dye on an Applied Biosystems 7300 Real Time PCR system essentially as described (Chinnaiyan et al., Cancer Res 65, 3328 (2005); Rubin et al., Cancer Res 64, 3814 (2004); herein incorporated by reference in its entirety).

(41) In some embodiments, nucleic acid from a sample is sequenced (e.g., in order to detect biomarkers). Nucleic acid molecules may be sequence analyzed by any number of techniques. The analysis may identify the sequence of all or a part of a nucleic acid. Illustrative non-limiting examples of nucleic acid sequencing techniques include, but are not limited to, chain terminator (Sanger) sequencing and dye terminator sequencing, as well as next generation sequencing techniques. Those of ordinary skill in the art will recognize that because RNA is less stable in the cell and more prone to nuclease attack, experimentally RNA is usually, although not necessarily, reverse transcribed to DNA before sequencing.

(42) A number of DNA sequencing techniques are known in the art, including fluorescence-based sequencing methodologies (See, e.g., Birren et al., Genome Analysis: Analyzing DNA, 1, Cold Spring Harbor, N.Y.; herein incorporated by reference in its entirety). In some embodiments, automated sequencing techniques understood in that art are utilized. In some embodiments, the systems, devices, and methods employ parallel sequencing of partitioned amplicons (PCT Publication No: WO2006084132 to Kevin McKernan et al., herein incorporated by reference in its entirety). In some embodiments, DNA sequencing is achieved by parallel oligonucleotide extension (See, e.g., U.S. Pat. No. 5,750,341 to Macevicz et al., and U.S. Pat. No. 6,306,597 to Macevicz et al., both of which are herein incorporated by reference in their entireties). Additional examples of sequencing techniques include the Church polony technology (Mitra et al., 2003, Analytical Biochemistry 320, 55-65; Shendure et al., 2005 Science 309, 1728-1732; U.S. Pat. Nos. 6,432,360, 6,485,944, 6,511,803; herein incorporated by reference in their entireties) the 454 picotiter pyrosequencing technology (Margulies et al., 2005 Nature 437, 376-380; US 20050130173; herein incorporated by reference in their entireties), the Solexa single base addition technology (Bennett et al., 2005, Pharmacogenomics, 6, 373-382; U.S. Pat. Nos. 6,787,308; 6,833,246; herein incorporated by reference in their entireties), the Lynx massively parallel signature sequencing technology (Brenner et al. (2000). Nat. Biotechnol. 18:630-634; U.S. Pat. Nos. 5,695,934; 5,714,330; herein incorporated by reference in their entireties) and the Adessi PCR colony technology (Adessi et al. (2000). Nucleic Acid Res. 28, E87; WO 00018957; herein incorporated by reference in its entirety).

(43) A set of methods referred to as next-generation sequencing techniques have emerged as alternatives to Sanger and dye-terminator sequencing methods (Voelkerding et al., Clinical Chem., 55: 641-658, 2009; MacLean et al., Nature Rev. Microbiol., 7: 287-296; each herein incorporated by reference in their entirety). Next-generation sequencing (NGS) methods share the common feature of massively parallel, high-throughput strategies, with the goal of lower costs in comparison to older sequencing methods. NGS methods can be broadly divided into those that require template amplification and those that do not. Amplification-requiring methods include pyrosequencing commercialized by Roche as the 454 technology platforms (e.g., GS 20 and GS FLX), the Solexa platform commercialized by Illumina, and the Supported Oligonucleotide Ligation and Detection (SOLiD) platform commercialized by Applied Biosystems. Non-amplification approaches, also known as single-molecule sequencing, are exemplified by the HeliScope platform commercialized by Helicos BioSciences, Pacific Biosciences (PAC BIO RS II) and other platforms commercialized.***

(44) In some embodiments, a sample is processed prior to biomarker detection. For example, nucleic acid and/or proteins may be extracted, isolated, and/or purified from a sample prior to analysis. Various DNA, mRNA, and/or protein extraction techniques are well known to those skilled in the art. Processing may include centrifugation, ultracentrifugation, ethanol precipitation, filtration, fractionation, resuspension, dilution, concentration, etc. In some embodiments, methods and systems provide analysis (e.g., quantification of RNA or protein biomarkers) from raw sample (e.g., biological fluid (e.g., blood, serum, etc.) without or with limited processing.

(45) Methods may comprise steps of homogenizing a sample in a suitable buffer, removal of contaminants and/or assay inhibitors, adding a target capture reagent (e.g., a magnetic bead to which is linked an oligonucleotide complementary to the target), incubated under conditions that promote the association (e.g., by hybridization) of the target with the capture reagent to produce a target:capture reagent complex, incubating the target:capture complex under target-release conditions. In some embodiments, multiple biomarker targets are isolated in each round of isolation by adding multiple target capture reagents (e.g., specific to the desired biomarkers) to the solution. For example, multiple target capture reagents, each comprising an oligonucleotide specific for a different biomarker target can be added to the sample for isolation of multiple targets. It is contemplated that the methods encompass multiple experimental designs that vary both in the number of capture steps and in the number of targets captured in each capture step. In some embodiments, capture reagents are molecules, moieties, substances, or compositions that preferentially (e.g., specifically and selectively) interact with a particular biomarker sought to be isolated, purified, detected, and/or quantified. Any capture reagent having desired binding affinity and/or specificity to the analyte target can be used in the present technology. For example, the capture reagent can be a macromolecule such as a peptide, a protein (e.g., an antibody or receptor), an oligonucleotide, a nucleic acid, (e.g., nucleic acids capable of hybridizing with the target nucleic acids), vitamins, oligosaccharides, carbohydrates, lipids, or small molecules, or a complex thereof. As illustrative and non-limiting examples, an avidin target capture reagent may be used to isolate and purify targets comprising a biotin moiety, an antibody may be used to isolate and purify targets comprising the appropriate antigen or epitope, and an oligonucleotide may be used to isolate and purify a complementary oligonucleotide.

(46) Any nucleic acids, including single-stranded and double-stranded nucleic acids, that are capable of binding, or specifically binding, to the target can be used as the capture reagent. Examples of such nucleic acids include DNA, RNA, aptamers, peptide nucleic acids, and other modifications to the sugar, phosphate, or nucleoside base. Thus, there are many strategies for capturing a target and accordingly many types of capture reagents are known to those in the art.

(47) In addition, target capture reagents comprise a functionality to localize, concentrate, aggregate, etc. the capture reagent and thus provide a way to isolate and purify the target biomarker when captured (e.g., bound, hybridized, etc.) to the capture reagent (e.g., when a target:capture reagent complex is formed). For example, in some embodiments the portion of the target capture reagent that interacts with the target (e.g., the oligonucleotide) is linked to a solid support (e.g., a bead, surface, resin, column, and the like) that allows manipulation by the user on a macroscopic scale. Often, the solid support allows the use of a mechanical means to isolate and purify the target:capture reagent complex from a heterogeneous solution. For example, when linked to a bead, separation is achieved by removing the bead from the heterogeneous solution, e.g., by physical movement. In embodiments in which the bead is magnetic or paramagnetic, a magnetic field is used to achieve physical separation of the capture reagent (and thus the target) from the heterogeneous solution. Magnetic beads used to isolate targets are described in the art, e.g., as described in European Patent Application No. 87309308, incorporated herein in its entirety for all purposes.

(48) In some embodiments, a computer-based analysis program is used to translate the raw data generated by the detection assay (e.g., the presence, absence, or amount of expression a panel of genes) into data of predictive value for a clinician (e.g., a risk score, a qualitative description, etc.). In some embodiments, computer analysis combines the data from numerous biomarkers into a single score or value that is predictive and/or diagnostic for depression. The clinician can access the predictive data using any suitable means. Thus, in some preferred embodiments, the present invention provides the further benefit that the clinician, who is not likely to be trained in genetics or molecular biology, need not understand the raw data. The data is presented directly to the clinician in its most useful form. The clinician is then able to immediately utilize the information in order to optimize the care of the subject.

(49) The present invention contemplates any method capable of receiving, processing, and transmitting the information to and from laboratories conducting the assays, information providers, medical personal, and subjects. For example, in some embodiments of the present invention, a sample (e.g., a biopsy or a blood or serum sample) is obtained from a subject and submitted to a profiling service (e.g., clinical lab at a medical facility, third-party testing service, genomic profiling business, etc.), located in any part of the world (e.g., in a country different than the country where the subject resides or where the information is ultimately used) to generate raw data. Where the sample comprises a tissue or other biological sample, the subject may visit a medical center to have the sample obtained and sent to the profiling center, or subjects may collect the sample themselves (e.g., a urine sample) and directly send it to a profiling center. Where the sample comprises previously determined biological information, the information may be directly sent to the profiling service by the subject (e.g., an information card containing the information may be scanned by a computer and the data transmitted to a computer of the profiling center using an electronic communication systems). Once received by the profiling service, the sample is processed and a profile is produced (i.e., expression data), specific for the diagnostic or prognostic information desired for the subject.

(50) In some embodiments, profile data is prepared in a format suitable for interpretation by a treating clinician. For example, rather than providing raw expression data, the prepared format may represent a diagnosis or risk assessment (e.g., likelihood of depression being present) for the subject, along with recommendations for particular treatment options. The data may be displayed to the clinician by any suitable method. For example, in some embodiments, the profiling service generates a report that can be printed for the clinician (e.g., at the point of care) or displayed to the clinician on a computer monitor.

(51) In some embodiments, a report is generated (e.g., by a clinician, by a testing center, by a computer or other automated analysis system, etc.). A report may contain test results, diagnoses, and/or treatment recommendations (e.g., psychoanalysis, psychotherapy, pharmaceutical treatment, observation, etc.).

(52) In some embodiments, the information is first analyzed at the point of care or at a regional facility. The raw data is then sent to a central processing facility for further analysis and/or to convert the raw data to information useful for a clinician or patient. The central processing facility provides the advantage of privacy (all data is stored in a central facility with uniform security protocols), speed, and uniformity of data analysis. The central processing facility can then control the fate of the data following treatment of the subject. For example, using an electronic communication system, the central facility can provide data to the clinician, the subject, or researchers.

(53) In some embodiments, the subject is able to directly access the data using the electronic communication system. The subject may chose further intervention or counseling based on the results. In some embodiments, the data is used for research use. For example, the data may be used to further optimize the inclusion or elimination of markers as useful indicators of a particular condition or stage of disease.

(54) In some embodiments, all or a portion of the methods described herein are provided as a service. In some embodiments, a user (e.g., subject (e.g., patient), clinician, researcher, etc.) arranges, contracts, pays, etc. to have a sample (e.g., biological sample (e.g., blood product, etc.), nucleic acid sample, etc.) and/or data (e.g., raw data) analyzed. In some embodiments, a sample is submitted (e.g., in-person, via mail or courier, etc.) and analysis of the sample for specific biomarkers described herein (alone or with other biomarkers is performed by the service (e.g., at a diagnostic testing facility, etc.). In some embodiments, data collected by a user (e.g., a clinician, researcher, etc.) are submitted to a testing facility for analysis. Embodiments described herein include any suitable combination of user-performed (e.g., subject-performed, clinician-performed, etc.) and service-performed steps. In some embodiments, methods described herein comprise of consist of only the steps performed by either the user (e.g., subject, clinician, etc.) of the service (e.g., sample collection, sending a sample, sample analysis, data collection, data analysis, receiving a report, etc.), or the service (e.g., sample collection, receiving a sample, sample analysis, data analysis, generating a report, sending a report, etc.). In some embodiments, any combination of steps may be performed by a user and/or service.

(55) In some embodiments, analysis results are reported (e.g., to a health care professional, to a subject, etc.). In some embodiments, a result is provided on a peripheral, device, or component of an apparatus. For example, sometimes an outcome is provided by a printer or display. In some embodiments, an outcome is reported in the form of a report, and in certain embodiments the report comprises biomarker levels, risk assessment, a compiled score (e.g., based on a plurality of markers), etc. An outcome can be translated into and displayed in a suitable format that facilitates downstream use of the reported information. Non-limiting examples of formats suitable for use for reporting and/or displaying data, characteristics, etc. include text, outline, digital data, a graph, graphs, a picture, a pictograph, a chart, a bar graph, a pie graph, a diagram, a flow chart, a scatter plot, a map, a histogram, a density chart, a function graph, a circuit diagram, a block diagram, a bubble map, a constellation diagram, a contour diagram, a cartogram, spider chart, Venn diagram, nomogram, and the like, and combination of the foregoing.

(56) In some embodiments, generating and reporting results from the raw biomarker data comprises transformation of the data reads into a representation that reflects information not determinable in the absence of the method steps described herein. Converting biomarker levels into useful information allows actions to be taken (e.g., in response to identifying a subject at risk of depression or depressed). As such, the methods provided herein address the problem of identifying depressed subjects or those at risk of depression, a problem that confronts the fields of medicine, public health, public safety, mental health, etc.

(57) In some embodiments, a user or a downstream individual, upon receiving or reviewing a report comprising one or more results determined from the analyses provided herein, will take specific steps or actions in response. For example, a health care professional or qualified individual may provide further testing of a subject. A public health official may take steps provide assistance to the subject. The present invention is not limited by the number of ways or fields in which the technology herein may find use.

(58) The term receiving a report as used herein refers to obtaining, by a communication means, a written and/or graphical representation comprising results or outcomes of the biomarker analysis described herein. The report may be generated by a computer or by human data entry, and can be communicated using electronic means (e.g., over the internet, via computer, via fax, from one network location to another location at the same or different physical sites), or by another method of sending or receiving data (e.g., mail service, courier service and the like). In some embodiments, the outcome is transmitted in a suitable medium, including, without limitation, in verbal, document, or file form. The file may be, for example, but not limited to, an auditory file, a computer readable file, a paper file, a laboratory file or a medical record file. A report may be encrypted to prevent unauthorized viewing.

(59) As noted above, in some embodiments, systems and method described herein transform data from one form into another form (e.g., from physical biomarkers in a sample to actual diagnosis, etc.). In some embodiments, the terms transformed, transformation, and grammatical derivations or equivalents thereof, refer to an alteration of data from a physical starting material (e.g., nucleic acid or protein in a biological sample, etc.) into a digital representation of the physical starting material (e.g., read data), a representation of the amount of that starting material (e.g., biomarker level), a condensation of the sequential representation (e.g., a combined signature based on multiple biomarkers), or a diagnosis, prognosis, or risk assessment, etc. In some embodiments, transformation involves conversion of data between any of the above.

(60) Certain processes and methods described herein (e.g., data acquisition, data analysis, communication, etc.) are performed by (or cannot be performed without) a computer, processor, software, module and/or other device. Methods described herein typically are computer-implemented methods, and one or more portions of a method sometimes are performed by one or more processors. In some embodiments, an automated method is embodied in software, processors, peripherals and/or an apparatus comprising the like. As used herein, software refers to computer readable program instructions that, when executed by a processor, perform computer operations, as described herein.

(61) The terms obtaining, transferring, receiving, etc. refer to movement of data (e.g., raw data, biomarker levels, combined biomarker data, risk profile, signature, diagnosis, etc.) between modules, devices, apparatuses, etc. within a system. These terms may also refer to the handling of samples and purified versions thereof (e.g., with respect to amplification, purification, analysis, etc.). Input information may be generated in the same location at which it is received, or it may be generated in a different location and transmitted to the receiving location. In some embodiments, input information is modified before it is processed (e.g., placed into a format amenable to processing (e.g., tabulated)). In some embodiments, provided are computer program products, such as, for example, a computer program product comprising a computer usable medium having a computer readable program code embodied therein, the computer readable program code adapted to be executed to implement a method.

(62) Software may include one or more algorithms in certain embodiments. An algorithm may be used for processing biomarker data, analyzing data, and/or providing an outcome or report according to a sequence of instructions. An algorithm often is a list of defined instructions for completing a task. Starting from an initial state, the instructions may describe a computation that proceeds through a defined series of successive states, eventually terminating in a final ending state. By way of example, and without limitation, an algorithm may be a search algorithm, sorting algorithm, merge algorithm, numerical algorithm, graph algorithm, string algorithm, modeling algorithm, computational genometric algorithm, combinatorial algorithm, machine learning algorithm, cryptography algorithm, data compression algorithm, parsing algorithm and the like. In some embodiments, an algorithm or set of algorithms transform data (e.g., biomarker) into information useful for solving a problem (e.g., identifying a subject as depressed or at-risk of depression). Algorithms utilized in embodiments herein make improvements in the fields of mental health, public health, medicine, diagnostic applications, diagnostic development, etc. In certain embodiments, algorithms may be implemented by software.

(63) In some embodiments, the present invention contemplates screening arrays of compounds (e.g., pharmaceuticals, drugs, peptides, or other test compounds) for their ability to treat depression (e.g., MDD). In some embodiments, compounds (e.g., pharmaceuticals, drugs, peptides, or other test compounds) identified using screening assays of the present invention find use in the diagnosis or treatment of depression (e.g., MDD).

(64) In some embodiments, the present invention provides screening assays for assessing cellular behavior or function. For example, the response of cells, tissues, or organisms to interventions (e.g., psychoanalysis (e.g., CBT, etc.), pharmaceutical treatment, etc.) may be monitored by assessing, for example, cellular functions using animal or cell culture models as described herein. Such assays find particular use for characterizing, identifying, validating, selecting, optimizing, or monitoring the effects of agents (e.g., small molecule-, peptide-, antibody-, nucleic acid-based drugs, etc.) that find use in treating or preventing depression, MDD, or related diseases or conditions.

(65) Compositions for use in the diagnostic methods of the present invention include, but are not limited to, probes, amplification oligonucleotides, and antibodies. Particularly preferred compositions detect the level of expression of a panel of genes. Systems and kits are provided that are useful, necessary, and/or sufficient for detecting expression of one or more genes.

(66) Any of these compositions, alone or in combination with other compositions of the present invention, may be provided in the form of a kit. For example, the single labeled probe and pair of amplification oligonucleotides may be provided in a kit for the amplification and detection and/or quantification of a panel of genes. The kit may include any and all components necessary or sufficient for assays including, but not limited to, the reagents themselves, buffers, control reagents (e.g., tissue samples, positive and negative control sample, etc.), solid supports, labels, written and/or pictorial instructions and product information, inhibitors, labeling and/or detection reagents, package environmental controls (e.g., ice, desiccants, etc.), and the like. In some embodiments, the kits provide a sub-set of the required components, wherein it is expected that the user will supply the remaining components. In some embodiments, the kits comprise two or more separate containers wherein each container houses a subset of the components to be delivered.

(67) In some embodiments, the present invention provides therapies for diseases characterized by altered expression of disease markers identified using the methods of the present invention. In particular, the present invention provides methods and compositions for monitoring the effects of a candidate therapy and for selecting therapies for patients.

(68) In some embodiments, methods of treating depression are provided (e.g., following detection/quantification of one or more of the biomarkers and/or panels described herein). Suitable treatments include psychotherapy; medication (e.g., selective serotonin reuptake inhibitors (SSRIs) (e.g., fluoxetine (Prozac), paroxetine (Paxil), sertraline (Zoloft), citalopram (Celexa) and escitalopram (Lexapro), etc.), serotonin and norepinephrine reuptake inhibitors (SNRIs) (e.g., duloxetine (Cymbalta), venlafaxine (Effexor XR) and desvenlafaxine (Pristiq), etc.), norepinephrine and dopamine reuptake inhibitors (NDRIs) (e.g., Bupropion (Wellbutrin), etc.), atypical antidepressants (e.g., trazodone, mirtazapine (Remeron), vilazodone (Viibryd), etc.), tricyclic antidepressants (e.g., imipramine (Tofranil) and nortriptyline (Pamelor), etc.), monoamine oxidase inhibitors (MAOIs) (e.g., tranylcypromine (Parnate), phenelzine (Nardil), etc.), mood stabilizers, antipsychotics, anti-anxiety medications, stimulant medications, etc.); hospitalization or residential treatment; electroconvulsive therapy (ECT); transcranial magnetic stimulation (TMS); etc.

(69) In some embodiments, systems and devices are provided for implementing the diagnostic methods described herein (e.g., data analysis, communication, result reporting, etc.). In some embodiments, a software or hardware component receives the results of multiple assays, factors, and/or biomarkers and determines a single value result to report to a user that indicates a conclusion related to depression status. Related embodiments calculate a risk factor based on a mathematical combination (e.g., a weighted combination, a linear combination) of the results from multiple assays, factors, and/or biomarkers.

EXPERIMENTAL

Example 1

Identification of MDD Biomarkers

(70) Experiments were conducted during the development of embodiments of the invention to identify biomarkers of MDD through genome-wide expression analysis in the blood and relevant brain regions of animal models of MDD developed from a well-accepted genetic animal model of depression, the Wistar Kyoto (WKY) rat strain. Two sub-strains were developed from the WKY strain that show opposite behavior in behavioral tests used to measure depression. The WKY More Immobile (WMI) line is more depressed while the WKY Less Immobile (WLI) line is less depressed. Since these sub-strains were developed from an inbred line, their genetic variability is very small, thereby indicating that expression differences in their brain and blood are related to the behavioral differences between them.

(71) AFFYMETRIX microarray profiling of gene expression patterns, using the Rat 230v2 AFFYMETRIX GENECHIP arrays, were carried out in the frontal cortex, amygdale, hippocampus, and striatum in both WMI and WLI males. Microarray analysis was repeated from the same brain regions using different generation animals. Microarray profiling of gene expression patterns was also carried out in the blood of WMI and WLI males. Blood microarray analysis was repeated from the 20TH generation WMI-WLIs using ILLUMINA SENTRIX Rat (Ref-12) Expression BEADCHIP, version 1.0, release 1. Based on the analyses of these microarray data, a biomarker list was created using the data of blood and brain expression (Table 1).

(72) Additional markers were identified from the chronic stress model of depression. The model employed young adult males of four phylogenetically, physiologically, and behaviorally different strains of rats: Fisher-344 (F344), Brown Norway (BN-SS), Lewis (Lew), and Wistar Kyoto (WKY) male rats. Half of the animals from each strain were exposed to chronic restraint stress, the other half were not. The chronically stressed animals were restrained in a breathable decapicone for two hours per day for a two-week period. For the determination of peripheral chronic stress markers, whole blood was collected into PAXgene tubes. Blood RNA from non-stressed and chronically stressed animals was isolated using the PAXgene Blood RNA Kit (Qiagen Inc.) according to the manufacturer's instruction, then reverse transcribed followed by second strand cDNA synthesis. For each sample, an in-vitro transcription reaction was carried out incorporating biotinylated nucleotides according to the manufacturer's protocol for Illumina? Totalprep RNA amplification kit (Ambion). Then, 1.5 ?g biotin-labelled cRNA was hybridized onto RatRef-12 Expression BeadChips (Illumina, San Diego Calif.) for 16 hours at 55? C. Based on the analyses of these expression data, a biomarker list was created that comprised all the transcripts showing significant differences between the non-stressed and the stress blood of all strain of rats (Table 2).

(73) TABLE-US-00001 TABLE 1 Candidate markers for endogenous MDD Gene Gene Symbol Gene name (number of transcripts) Symbol Gene name (number of transcripts) FAM46A family with sequence similarity 46, NRP1 neuropilin 1 (18) member A (7) MARCKS myristoylated alanine-rich protein PDE6D phosphodiesterase 6D, cGMP-specific, kinase C substrate (1) rod, delta (6) ATP2C1 ATPase Ca++ transporting, type 2C, PPP1R3B protein phosphatase 1, regulatory member 1 (6) subunit 3B (1) ATP11C ATPase, class VI, type 11C PRPF18 PRP18 pre-mRNA processing factor 18 homolog (5) NAGA N-acetyl-galactosaminidase, alpha RAPH1 Ras association (RalGDS/AF-6) and (5) pleckstrin homology domains 1 TLR7 toll-like receptor 7 (2) RNASEL ribonuclease L (2) ADCY3 adenylate cyclase 3 (15) SEMA4A semaphorin 4A (16) ANXA4 annexin A4 (13) SERPINB1 serpin peptidase inhibitor, clade B, member 1 (5) APP amyloid beta(A4) precursor SLFN12 schlafen family member 12 (8) protein (20) ASAH1 N-acylsphingosine amidohydrolase SMPDL3A sphingomyelin phosphodiesterase, 1 (4) acid-like 3A (2) ATP6AP2 ATPase, H+ transporting, lysosomal SNX10 sorting nexin 10 (8) accessory protein 2 (7) BCAT1 branched chain aminotransferase SOAT1 sterol O-acyltransferase 1 (2) 1, cytosolic (2) CAST calpastatin (13) SYNJ1 synaptojanin 1 (19) CD59 CD59 molecule, complement TCF7L2 transcription factor 7-like 2 (16) regulatory protein (7) CEBPA CCAAT/enhancer binding protein, ZNF291/ S-phase cyclin A-associated protein (2) alpha (1) SCAPER CITED2 Cbp/p300-interacting trans- FUCA2 fucosidase, alpha-L-2, plasma (6) activator, with Glu/Asp-rich carboxy-terminal domain, 2 (2) FOS FBJ murine osteosarcoma viral DAG1 dystrophin-associated glycoprotein 1 oncogene homolog (1) IDH1 isocitrate dehydrogenase 1 MAF v-maf oncogene homolog (2) (NADP+), soluble (13) IGSF4AA/ cell adhesion molecule 1 (3) GNAQ guanine nucleotide binding protein CADM1 alpha stimulating activity polypeptide 1 (2) IL13RA1 interleukin 13 receptor, alpha 1 (4) MAST4 microtubule associated serine/threonine kinase family member 4 (30) KLF4 Kruppel-like factor 4 (8) FMR1 fragile X mental retardation 1 (13) LRRC40 leucine rich repeat containing 40 PTPRM protein tyrosine phosphatase, receptor (1) type, mu polypeptide (4)

(74) TABLE-US-00002 TABLE 2 Chronic stress blood markers Gene symbol Gene name Gene symbol Gene name ADD2 adducin 2 KIAA1539 KIAA1539 ADIPOR1 adiponectin receptor 1 LEPROTL1 leptin receptor overlap transcript- like 1 ARF5 ADP-ribosylation LAPTM5 lysosomal-associated protein factor 5 transmembrane 5 AHSP alpha hemoglobin MTVR2 mammary tumor virus receptor 2 stabilizing protein (ERAF) ANK1 ankyrin 1, erythroid MXD1 max dimerization protein 1 APOL3 apolipoprotein L, 3 MEMO1 mediator of cell motility 1 ARIH1 ariadne ubiquitin- MIIP migration and invasion inhibitory conjugating enzyme E2 protein binding protein homolog 1 AMFR autocrine motility MAP2K3 mitogen activated protein kinase factor receptor kinase 3 BOLA3 bolA homolog 3 NAT9 N-acetyltransferase 9 CHP calcium binding NBEAL2-PS1 neurobeachin-like 2, pseudogene 1 protein p22 CA2 carbonic anhydrase 2 NXT1 NTF2-related export protein 1 CA1 carbonic anhydrase I NOP56 nucleolar protein 56 CSNK1G2 casein kinase 1, PCYT2 phosphate cytidylyltransferase 2, gamma 2 ethanolamine CAT catalase PLCG2 phospholipase C, gamma 2 CTSB cathepsin B PARP10 poly (ADP-ribose) polymerase family, member 10 CD3D CD3 antigen delta KTCD20 potassium channel tetramerisation polypeptide domain containing 20 CD37 CD37 antigen PAQR9 progestin and adipoQ receptor family member IX CD82 CD82 antigen PSME1 protease 28 subunit, alpha CREG1 cellular repressor of PSMB10 proteasome subunit, beta type 10 E1A-stimulated genes CDR2 cerebellar PSMB3 proteasome subunit, beta type 3 degeneration-related 2 C7orf70 chromosome 7 open PSMB8 proteasome subunit, beta type 8 reading frame 70 C2 complement PPP1R10 protein phosphatase 1, subunit 10 component 2 CXXC1 CXXC finger 1 PTP4A3 protein tyrosine phosphatase 4a3 CMAS cytidine RAB10 member RAS oncogene family monophospho-N- acetylneuraminic acid synthetase DDX24 DEAD box polypeptide RTP4 receptor (chemosensory) transporter 24 protein 4 DENND5A DENN/MADD domain MAF1 Repressor of RNA polymerase III containing 5A transcription MAF1 homolog DGKA diacylglycerol kinase, SELO selenoprotein O alpha DNAJB6 DnaJ homolog, SEPT1 septin 1 subfamily B, member 6 DYRK3 dual-specificity SERBP1 SERPINE1 mRNA binding protein 1 tyrosine-- phosphorylation regulated kinase 3 DYNC1H1 dynein, cytoplasmic, SHARPIN shank-interacting protein heavy chain 1 DYNLL1 dynein, cytoplasmic, SMAP2 small ArfGAP2 light chain 1 EMB embigin SLC16A10 solute carrier family 16, member 10 EPB42 erythrocyte membrane SLC4A1 solute carrier family 4, member 1 protein band 4.2 FBXO7 F-box only protein 7 SPTAN1 spectrin, alpha, non-erythrocytic 1 FAM117A family with sequence SYK spleen tyrosine kinase similarity 117, member A FAM125A family with sequence ST3GAL2 ST3 beta-galactoside alpha-2,3- similarity 125, sialyltransferase 2 member A FECH ferrochelatase STRADB STE20-related kinase adaptor beta FLNA Filamin A STRA8 stimulated by retinoic acid gene 8 FMNL1 formin-like 1 TSPAN8 tetraspanin 8 FN3K fructosamine-3-kinase TREX1 3-5 exonuclease TREX1 FUS fusion in malignant ATP5G1 ATP synthase, H+ transporting, liposarcoma) mitochondrial F0 complex, subunit c, isoform 1 FYN fyn proto-oncogene TMCC2 transmembrane and coiled-coil domain family 2 GATA1 GATA binding protein 1 TMEM183A transmembrane protein 183A GCLM glutamate cysteine TRIM10 tripartite motif-containing 10 ligase, modifier subunit ERICH1 glutamate-rich 1 TMOD1 tropomodulin 1 GLRX5 glutaredoxin 5 TINAGL1 tubulointerstitial nephritis antigen- like 1 GPX4 glutathione peroxidase 4 TIE1 tyrosine kinase receptor 1 GLTP Glycolipid transfer UBAC1 ubiquitin associated domain protein containing 1 GLG1 golgi apparatus protein 1 USP8 ubiquitin specific protease 8 GGA3 golgi associated, UBE2C ubiquitin-conjugating enzyme E2C gamma adaptin ear containing, ARF binding protein 3 GCH1 GTP cyclohydrolase 1 UBE2O ubiquitin-conjugating enzyme E2O HPS1 Hermansky-Pudlak UBE2R2 ubiquitin-conjugating enzyme E2R 2 syndrome 1 homolog SUV420H2 histone-lysine N- UROD uroporphyrinogen decarboxylase methyltransferase HAGH hydroxyacyl VAMP3 vesicle-associated membrane protein 3 glutathione hydrolase INSL3 insulin-like 3 VKORC1L1 vitamin K epoxide reductase complex, subunit 1-like 1 IRF3 interferon regulatory WDR26 WD repeat domain 26 factor 3 IFRD2 interferon-related WDR45 WD repeat domain 45 developmental regulator 2 ISG12 interferon, alpha- ZAP70 zeta-chain associated protein kinase inducible protein 27- 70 kDa like ISCU iron-sulfur cluster scaffold homolog

Example 2

(75) Experiments using human subjects were conducted to identify human biomarkers of MDD.

(76) Recruitment and Procedures

(77) Participants were recruited from Northwestern General Internal Medicine clinics and were included if they were ?18 years old, could speak and read English and provided informed consent. MDD subjects met criteria for MDD based on the Mini International Neuropsychiatry Interview (MINI), had a Hamilton Depression Rating Scale (Ham-D)(Hamilton. Journal of Neurology, Neurosurgery, and Psychiatry 1960; 23: 56-62.; herein incorporated by reference in its entirety) score ?16 and were able to participate in face-to-face or telephone therapy. Non-depressed controls matched by age, race and sex, were recruited with the help of NUgene (Northwestern Medicine, Northwestern University) and included if they did not meet criteria for depression and scored <four on Patient Health Questionnaire-9 (PHQ-9).

(78) Participants were excluded if they: 1) had visual or hearing impairments; 2) met diagnostic criteria for other psychiatric disorder (e.g. bipolar disorder, psychotic disorders, etc.) or depression of organic etiology (e.g. hypothyroidism); 3) reported alcohol or substance abuse severe enough that two psychologists agreed psychotherapy would be inappropriate, 4) met criteria for dementia by scoring <25 on the Telephone Interview for Cognitive Status (Desmond et al. International journal of geriatric psychiatry 1994; 9: 803-7.; herein incorporated by reference in its entirety); 5) exhibited severe suicidality, including a plan and intent, or a suicide attempt in the past 5 years; 6) were receiving or planning to receive individual psychotherapy; or 7) had initiated antidepressant pharmacotherapy in the previous 10 days. This trial was approved by the Northwestern University IRB and was monitored by an independent data safety monitoring board.

(79) MDD diagnosis was evaluated at baseline using the MINI. Depression severity was evaluated by self-report using the PHQ-9. The PHQ-9 was selected because the items map onto diagnostic criteria for MDD and are, therefore, specific to depression. Venous blood (2.5 ml) was collected into PAXgene? Blood RNA tubes (Qiagen, Germantown, Md.) for RNA analysis both at baseline and post-treatment from subject with MDD and at baseline from ND controls.

(80) Determination of Blood Transcript Levels of Candidate Markers

(81) Blood RNA was extracted using the PAXgene? Blood RNA Kit (Qiagen, Germantown, Md.), according to the manufacturer's protocol. The yield and quality of extracted RNA were assessed using the NanoDrop? 1000 spectrophotometer (NanoDrop Technologies, Wilmington, Del.). cDNA was prepared using random primers and the TaqMan RT reagents (ABI). Specific primers are listed in Table 3, some of which were reported previously.

(82) TABLE-US-00003 TABLE3 PrimersequencesforqPCR Amplicon Gene Forward Reverse Length symbol PrimerSequence5.fwdarw.3 PrimerSequence5.fwdarw.3 (bp) ADCY3 CGAGAACGTCAGCATCCTCTTT GGCACTGCAGGCAGAAGAC 66 (SEQIDNO.1) (SEQIDNO.2) AMFR CCTACACAGCGGTCAGATAGCAT TCACTGCTTGGCCTTTCCA 65 (SEQIDNO.3) (SEQIDNO.4) ASAH1 TCAACAAGCTGACCGTATACACA CCCGCAGGTAAGTTTCGAATT 68 (SEQIDNO.5) (SEQIDNO.6) ATP11C TCCATCAGTGGTGCAAGATG TTGAAAATGCAAAGCGAGTG 125 (SEQIDNO.7) (SEQIDNO.8) CD59 CCAAAGCTGGGTTACAAGTGTATAAC GTGACGTCGTTGAAATTGCAA 67 (SEQIDNO.9) (SEQIDNO.10) CDR2 CCGCCAACACTTCGTGTATG TCAGGGCTTGGCTGACCTT 72 (SEQIDNO.11) (SEQIDNO.12) CMAS ATCTTGGAAATGAAGTGTCTGATGAA GCAGGAGCGCCACTTAGG 64 (SEQIDNO.13) (SEQIDNO.14) DGKA ACCCTTCCCATGCAAATTGA CTTGTGGGTGATCTTGATTGTAC 69 (SEQIDNO.15) AG(SEQIDNO.16) FAM46A CTCACGCTCAAGGAAGCTTATGT GGATATAAGACTCCATCGGTCAG 75 (SEQIDNO.17) AGT(SEQIDNO.18) IGSF4A AGCAAGCCAGCCACGACTAT CGATTTGCCTTTTAGCTCTGTGT 60 (SEQIDNO.19) (SEQIDNO.20) KIAA1539 CCGTCCAAGTGACCTTATTTAACC AGAAGTCAAAGGTCACAAGGAA 69 (SEQIDNO.21) CAT(SEQIDNO.22) MAF CAGCGGCTTCCGAGAAAAC GAGTGGGCTCAGTTATGAAAAAC 74 (SEQIDNO.23) TC(SEQIDNO.24) MARCKS CCTCTTGGATCTGTTGAGTTTCTTT ATTCTCCTGTCCGTTCGCTTT 148 (SEQIDNO.25) (SEQIDNO.26) NAGA AGCTGAGACCAAAGTTCCCA ATCCTGAATTGGTTCGTGGA 106 (SEQIDNO.27) (SEQIDNO.28) PSME1 CCGCAATGCTTATGCTGTGT GGGCTTCTTGAGCTTCTCGAA 64 (SEQIDNO.29) (SEQIDNO.30) PTP4A3 CCCTTATTGAGAGCGGGATGA CGCTTCTGGCGGATGAAC 58 (SEQIDNO.31) (SEQIDNO.32) RAPH1 AGCAAGGCCAGAATGGAGTCTAT GTGGTGAAGGCTGTGAAGCA 109 (SEQIDNO.33) (SEQIDNO.34) SLC4A1 GGAGCTTCAGTGTCTGGATGCT CGTATTCATCCCGACCTTCCT 71 (SEQIDNO.35) (SEQIDNO.36) TLR7 GCTCTCTTCAACCAGACCTCTACAT GTCCACATTGGAAACACCATTTT 68 (SEQIDNO.37) (SEQIDNO.38) ZNF291 GCACTCATAAAACTACTAAACAGCAGA TGTTTATCTCCAGTCGTAGACGA 76 GT(SEQIDNO.39) TGT(SEQIDNO.40)
Quantitative real time PCR (qPCR) was carried out using SYBR Green and the ABI 7900 (Applied Biosystems, Foster City, Calif.), with 18s rRNA as the internal control. 18s was chosen as the normalizing gene after an extensive comparative pilot study using several housekeeping genes (data not shown). Each sample for each transcript was measured in triplicate using 5 ng of template.

(83) Baseline samples, collected from 32 patients with current MDD episode and 32 ND subjects, were analyzed in parallel. ACT values from qPCR characterized transcript abundance, where ?CT is the cycle threshold difference between the target gene and the housekeeping gene. Then, to avoid inter-assay variations, the triads we re-assayed: baseline MDD, post CBT MDD and ND samples. In the statistical analyses of these results, either MDD and ND transcript levels were compared using the ?CT values, or the control matching design and this relative quantification number (RQ) was used.

(84) Statistical Analyses

(85) Baseline PHQ-9 and ?CT transcript levels were compared between MDD and ND using paired t-tests, and presented with mean and standard deviation. To avoid inflated type I errors, false discovery rates (Benjamini & Hochberg. J Roy Stat Soc B Met 1995; 57: 289-300.; herein incorporated by reference in its entirety) were estimated by q-values using the q-value package in R (Storey & Tibshirani. Proceedings of the National Academy of Sciences 2003; 100: 9440-5.; Team RC. R: A language and environment for statistical computing. ISBN 3-900051-07-0. R Foundation for Statistical Computing. Vienna, Austria, 2013. url: http://www.R-project.org; 2005.; herein incorporated by reference in their entireties). An a priori decision was made to interpret significant q values and an effect size of >0.45 as clinically significant, which corresponds to Cohen's medium effect size (Cohen J. Statistical Power Analysis for the Behavioral Sciences. 2nd ed. Hillsdale: L Erlbaum Associates; 1988.; herein incorporated by reference in its entirety).

(86) Transcript Level Differences at Baseline

(87) Levels of twenty transcripts were measured at baseline (Tables 4). Blood transcript levels differed between subjects with MDD from their age-, sex- and race-matched ND controls for adenylate cyclase 3 (ADCY3), diacylglycerol kinase, alpha (DGKA), family with sequence similarity 46, member A (FAM46A), immunoglobulin superfamily, member 4 (IGSF4A/CADM1) also known as cell adhesion molecule 1 (CADM1), KIAA1539, which either have no brain-related functions to date or no known function, myristoylated alanine-rich protein kinase C substrate (MARCKS), proteasome activator subunit 1 (PSME1), Ras association and pleckstrin homology domains 1 also known as LPD (RAPH1) and intracellular toll-like receptor 7 (TLR7).

(88) TABLE-US-00004 TABLE 4 Baseline transcript levels (?CT) for subjects with MDD (N = 32) and sex, age, race matched ND controls (N = 32). MDD CONTROL Gene Mean (SD) Mean (SD) p-value q Cohen's D ADCY3 20.95 (2.07) 21.31 (2.18) 0.012 0.026 0.473 AMFR 19.28 (0.87) 19.27 (0.42) 0.995 0.995 0.001 ASAH1 16.74 (2.45) 16.88 (2.25) 0.352 0.503 0.167 ATP11C 19.22 (1.83) 19.20 (2.17) 0.902 0.949 0.022 CD59 19.98 (0.65) 19.89 (0.66) 0.550 0.651 0.107 CDR2 20.60 (1.13) 20.49 (0.65) 0.554 0.652 0.106 CMAS 22.41 (1.36) 22.98 (0.69) 0.046 0.084 0.367 DGKA 16.69 (0.80) 17.41 (0.75) 0.000 0.003 0.730 FAM46A 19.65 (2.27) 19.96 (2.40) 0.005 0.017 0.532 IGSF4A/ 22.22 (3.07) 23.05 (2.57) 0.002 0.010 0.597 CADM1 KIAA1539 18.22 (0.61) 18.64 (0.45) 0.001 0.009 0.625 MAF 22.00 (2.31) 22.08 (2.47) 0.637 0.708 0.084 MARCKS 16.85 (2.31) 17.41 (2.22) 0.005 0.017 0.533 NAGA 17.63 (2.22) 17.85 (2.30) 0.041 0.083 0.376 PSME1 17.17 (0.75) 17.55 (0.52) 0.008 0.023 0.501 PTP4A3 20.79 (0.82) 21.03 (0.62) 0.154 0.257 0.258 RAPH1 21.73 (1.47) 22.80 (0.54) <0.001 0.003 0.737 SLC4A1 17.08 (0.85) 17.22 (0.85) 0.454 0.606 0.134 TLR7 19.53 (2.36) 19.89 (2.35) 0.009 0.023 0.493 ZNF291 23.55 (3.18) 23.20 (3.20) 0.176 0.270 0.253

(89) Scatter plots of delta CT values for each transcript measured at baseline in MDD subjects and their matched controls are presented in FIG. 1.

(90) All publications and patents listed below and/or provided herein incorporated by reference in their entireties. Various modifications and variations of the described compositions and methods of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the relevant fields are intended to be within the scope of the present invention.

REFERENCES

(91) 1. Kessler R C, Berglund P, Demler O, Jin R, Merikangas K R, Walters E E. Lifetime prevalence and age-of-onset distributions of DSM-IV disorders in the National Comorbidity Survey Replication. Arch Gen Psychiatry 2005; 62: 593-602. 2. Hidaka B H. Depression as a disease of modernity: explanations for increasing prevalence. J Affect Disord 2012; 140: 205-14. 3. Lepine J P, Briley M. The increasing burden of depression. Neuropsychiatr Dis Treat 2011; 7: 3-7. 4. Ferrari A J, Charlson F J, Norman R E, Patten S B, Freedman G, Murray C J, et al. Burden of depressive disorders by country, sex, age, and year: findings from the global burden of disease study 2010. PLoS Med 2013; 10: e1001547. 5. Hardeveld F, Spijker J, De Graaf R, Nolen W A, Beekman A T. Prevalence and predictors of recurrence of major depressive disorder in the adult population. Acta psychiatrica Scandinavica 2010; 122: 184-91. 6. ten Doesschate M C, Bockting C L, Koeter M W, Schene A H. Prediction of recurrence in recurrent depression: a 5.5-year prospective study. J Clin Psychiatry 2010; 71: 984-91. 7. Carter J D, Frampton C M, Mulder R T, Luty S E, Joyce P R. The relationship of demographic, clinical, cognitive and personality variables to the discrepancy between self and clinician rated depression. J Affect Disord 2010; 124: 202-6. 8. Riedel M, Moller H J, Obermeier M, Schennach-Wolff R, Bauer M, Adli M, et al. Response and remission criteria in major depressiona validation of current practice. J Psychiatr Res 2010; 44: 1063-8. 9. Belmaker R H, Agam G. Major depressive disorder. The New England journal of medicine 2008; 358: 55-68. 10. Altamura A C, Buoli M, Albano A, Dell'Osso B. Age at onset and latency to treatment (duration of untreated illness) in patients with mood and anxiety disorders: a naturalistic study. Int Clin Psychopharmacol 2010; 25: 172-9. 11. Huerta-Ramirez R, Bertsch J, Cabello M, Roca M, Haro J M, Ayuso-Mateos J L. Diagnosis delay in first episodes of major depression: a study of primary care patients in Spain. J Affect Disord 2013; 150: 1247-50. 12. Pence B W, O'Donnell J K, Gaynes B N. The depression treatment cascade in primary care: a public health perspective. Curr Psychiatry Rep 2012; 14: 328-35. 13. Andrus B M, Blizinsky K, Vedell P T, Dennis K, Shukla P K, Schaffer D J, et al. Gene expression patterns in the hippocampus and amygdala of endogenous depression and chronic stress models. Molecular psychiatry 2012; 17: 49-61. 14. Pajer K, Andrus B M, Gardner W, Lourie A, Strange B, Campo J, et al. Discovery of blood transcriptomic markers for depression in animal models and pilot validation in subjects with early-onset major depression. Transl Psychiatry 2012; 2: e101. 15. Mohr D C, Ho J, Duffecy J, Reifler D, Sokol L, Burns M N, et al. Effect of telephone-administered vs face-to-face cognitive behavioral therapy on adherence to therapy and depression outcomes among primary care patients: a randomized trial. JAMA: the journal of the American Medical Association 2012; 307: 2278-85. 16. Mohr D C, Vella, L., Hart, S. L., Heckman, T., Simon, G. E. The effect of telephone-administered psychotherapy on depression and attrition: A meta-analysis. Clin Psych Sci & Pract 2012; 307: 2278-85. 17. Sheehan D V, Lecrubier Y, Sheehan K H, Amorim P, Janays J, Weiller E, et al. The Mini-International Neuropsychiatric Interview (M.I.N.I.): the development and validation of a structured diagnostic psychiatric interview for DSM-IV and ICD-10. J Clin Psychiatry 1998; 59 Suppl 20: 22-33; quiz 4-57. 18. Hamilton M. A rating scale for depression. Journal of Neurology, Neurosurgery, and Psychiatry 1960; 23: 56-62. 19. Desmond D W, Tatemichi T K, Hanzawa L. The Telephone Interview for Cognitive Status (TICS): Reliability and validity in a stroke sample. International journal of geriatric psychiatry 1994; 9: 803-7. 20. MacArthur Foundation's Initiative on Depression and Primary Care. The MacArthur Initiative on Depression and Primary Care at Dartmouth and Duke: Depression Management Toolkit. Hanover, N H: Dartmouth; 2004. 21. Benjamini Y, Hochberg Y. Controlling the False Discovery Ratea Practical and Powerful Approach to Multiple Testing. J Roy Stat Soc B Met 1995; 57: 289-300. 22. Storey J D, Tibshirani R. Statistical significance for genomewide studies. Proceedings of the National Academy of Sciences 2003; 100: 9440-5. 23. Team R C. R: A language and environment for statistical computing. ISBN 3-900051-07-0. R Foundation for Statistical Computing. Vienna, Austria, 2013. url:http://www.R-project.org; 2005. 24. Cohen J. Statistical Power Analysis for the Behavioral Sciences. 2nd ed. Hillsdale: L Erlbaum Associates; 1988. 25. Pepe M, Longton G, Janes H. Estimation and Comparison of Receiver Operating Characteristic Curves. Stata J 2009; 9: 1. 26. Mehta D, Menke A, Binder E B. Gene expression studies in major depression. Curr Psychiatry Rep 2010; 12: 135-44. 27. Liew C C, Ma J, Tang H C, Zheng R, Dempsey A A. The peripheral blood transcriptome dynamically reflects system wide biology: a potential diagnostic tool. J Lab Clin Med 2006; 147: 126-32. 28. Rollins B, Martin M V, Morgan L, Vawter M P. Analysis of whole genome biomarker expression in blood and brain. Am J Med Genet B Neuropsychiatr Genet 2010; 153B: 919-36. 29. Sullivan P F, Fan C, Perou C M. Evaluating the comparability of gene expression in blood and brain. Am J Med Genet B Neuropsychiatr Genet 2006; 141B: 261-8. 30. Kurian S M, Le-Niculescu H, Patel S D, Bertram D, Davis J, Dike C, et al. Identification of blood biomarkers for psychosis using convergent functional genomics. Molecular psychiatry 2011; 16: 37-58. 31. Le-Niculescu H, Kurian S M, Yehyawi N, Dike C, Patel S D, Edenberg H J, et al. Identifying blood biomarkers for mood disorders using convergent functional genomics. Molecular psychiatry 2009; 14: 156-74. 32. Padmos R C, Hillegers M H, Knijff E M, Vonk R, Bouvy A, Staal F J, et al. A discriminating messenger RNA signature for bipolar disorder formed by an aberrant expression of inflammatory genes in monocytes. Arch Gen Psychiatry 2008; 65: 395-407. 33. Menke A, Arloth J, Putz B, Weber P, Klengel T, Mehta D, et al. Dexamethasone stimulated gene expression in peripheral blood is a sensitive marker for glucocorticoid receptor resistance in depressed patients. Neuropsychopharmacology: official publication of the American College of Neuropsychopharmacology 2012; 37: 1455-64. 34. Segman R H, Goltser-Dubner T, Weiner I, Canetti L, Galili-Weisstub E, Milwidsky A, et al. Blood mononuclear cell gene expression signature of postpartum depression. Molecular psychiatry 2010; 15: 93-100, 2. 35. Spijker S, Van Zanten J S, De Jong S, Penninx B W, van Dyck R, Zitman F G, et al. Stimulated gene expression profiles as a blood marker of major depressive disorder. Biological psychiatry 2010; 68: 179-86. 36. Papakostas G I, Shelton R C, Kinrys G, Henry M E, Bakow B R, Lipkin S H, et al. Assessment of a multi-assay, serum-based biological diagnostic test for major depressive disorder: a pilot and replication study. Molecular psychiatry 2013; 18: 332-9. 37. Shyn S I, Shi J, Kraft J B, Potash J B, Knowles J A, Weissman M M, et al. Novel loci for major depression identified by genome-wide association study of Sequenced Treatment Alternatives to Relieve Depression and meta-analysis of three studies. Molecular psychiatry 2011; 16: 202-15. 38. Cross-Disorder Group of the Psychiatric Genomics Consortium. Identification of risk loci with shared effects on five major psychiatric disorders: a genome-wide analysis. Lancet 2013; 381: 1371-9. 39. Wray N R, Pergadia M L, Blackwood D H R, Penninx B W J H, Gordon S D, Nyholt D R, et al. Genome-wide association study of major depressive disorder: new results, meta-analysis, and lessons learned. Molecular psychiatry 2012; 17: 36-48. 40. Liotti M, Mayberg H S, McGinnis S, Brannan S L, Jerabek P. Unmasking disease-specific cerebral blood flow abnormalities: mood challenge in patients with remitted unipolar depression. Am J Psychiatry 2002; 159: 1830-40. 41. Segal Z V, Bieling P, Young T, MacQueen G, Cooke R, Martin L, et al. Antidepressant monotherapy vs sequential pharmacotherapy and mindfulness-based cognitive therapy, or placebo, for relapse prophylaxis in recurrent depression. Arch Gen Psychiatry 2010; 67: 1256-64. 42. Belzeaux R, Bergon A, Jeanjean V, Loriod B, Formisano-Treziny C, Verrier L, et al. Responder and nonresponder patients exhibit different peripheral transcriptional signatures during major depressive episode. Transl Psychiat 2012; 2. 43. Gaiteri C, Ding Y, French B, Tseng G C, Sibille E. Beyond modules and hubs: the potential of gene coexpression networks for investigating molecular mechanisms of complex brain disorders. Genes, brain, and behavior 2014; 13: 13-24. 44. Menke A. Gene expression: biomarker of antidepressant therapy? Int Rev Psychiatry 2013; 25: 579-91. 45. Gunther E C, Stone D J, Gerwien R W, Bento P, Heyes M P. Prediction of clinical drug efficacy by classification of drug-induced genomic expression profiles in vitro. Proceedings of the National Academy of Sciences of the United States of America 2003; 100: 9608-13. 46. Leuchter A F, Cook I A, Marangell L B, Gilmer W S, Burgoyne K S, Howland R H, et al. Comparative effectiveness of biomarkers and clinical indicators for predicting outcomes of SSRI treatment in Major Depressive Disorder: results of the BRITE-M D study. Psychiatry Res 2009; 169: 124-31. 47. Cuijpers P, Karyotaki E, Weitz E, Andersson G, Hollon S D, van Straten A. The effects of psychotherapies for major depression in adults on remission, recovery and improvement: A meta-analysis. J Affect Disorders. 48. Licinio J, Wong M L. Pharmacogenomics of antidepressant treatment effects. Dialogues Clin Neurosci 2011; 13: 63-71. 49. Licinio J, Wong M L. Launching the war on mental illness. Molecular psychiatry 2014; 19: 1-5. 50. Radich J P, Mao M, Stepaniants S, Biery M, Castle J, Ward T, et al. Individual-specific variation of gene expression in peripheral blood leukocytes. Genomics 2004; 83: 980-8. 51. Eady J J, Wortley G M, Wormstone Y M, Hughes J C, Astley S B, Foxall R J, et al. Variation in gene expression profiles of peripheral blood mononuclear cells from healthy volunteers. Physiological genomics 2005; 22: 402-11. 52. Mohr S, Liew C-C. The peripheral-blood transcriptome: new insights into disease and risk assessment. Trends in Molecular Medicine 2007; 13: 422-32.