Nitrile hydratase
10093912 ยท 2018-10-09
Assignee
Inventors
- Aya KITAHARA (Tokyo, JP)
- Takanori AKIYAMA (Kanagawa, JP)
- Miki WAKAMATSU (Kanagawa, JP)
- Fumiaki WATANABE (Kanagawa, JP)
Cpc classification
C12P13/02
CHEMISTRY; METALLURGY
International classification
C12P13/02
CHEMISTRY; METALLURGY
C07K1/00
CHEMISTRY; METALLURGY
C12N1/00
CHEMISTRY; METALLURGY
C12N15/00
CHEMISTRY; METALLURGY
C12P21/06
CHEMISTRY; METALLURGY
Abstract
Provided is a novel improved nitrile hydratase with improved resistance to amide compounds under high temperatures. Specifically provided is a nitrile hydratase having at least one amino acid mutation selected from (a) to (d) below, in the amino acid sequence expressed in SEQ ID NO:50 (X.sub.1 to X.sub.27 represent independent arbitrarily-defined amino acid residuals). (a) X.sub.1 is valine or glycine (b) X.sub.9 is valine or threonine (c) X.sub.23 is an amino acid selected from a group consisting of isoleucine, leucine, methionine and threonine, (d) X.sub.24 is leucine.
Claims
1. An isolated modified nitrile hydratase comprising an ? subunit, wherein the ? subunit comprises at least one amino acid sequence selected from the group consisting of SEQ ID NO: 46, 47, 48, and 49, wherein: (a) SEQ ID NO: 46: X.sub.1X.sub.2X.sub.3X.sub.4X.sub.5X.sub.6RX.sub.7KAX.sub.8E, wherein X.sub.1 is an amino acid other than tyrosine; X.sub.2, X.sub.3, X.sub.5, X.sub.6, X.sub.7 and X.sub.8 each independently are any amino acid residue; and X.sub.4 is tyrosine, and SEQ ID NO: 46 corresponds to amino acids in positions from 8 to 19 of SEQ ID NO:50; (b) SEQ ID NO: 47: X.sub.9X.sub.10X.sub.11 X.sub.12NX.sub.13X.sub.14X.sub.15X.sub.16X.sub.17X.sub.18X.sub.19X.sub.20X.sub.21CX.sub.22LC, wherein X.sub.9 is an amino acid other than serine; X.sub.10, X.sub.11, X.sub.12, X.sub.13, X.sub.14, X.sub.15, X.sub.16, X.sub.17, X.sub.19, X.sub.20, X.sub.21 and X.sub.22 each independently are any amino acid residue; and X.sub.18 is histidine, and SEQ ID NO: 47 corresponds to amino acids in positions from 88 to 105 of SEQ ID NO:50; (c) SEQ ID NO: 48: X.sub.23WDSX.sub.25X.sub.26EX.sub.27RX.sub.28X.sub.29V, wherein X.sub.23 indicates an amino acid other than valine; X.sub.25, X.sub.27, X.sub.28 and X.sub.29 each independently are any amino acid residue; and X.sub.26 is serine; and SEQ ID NO: 48 corresponds to amino acids in positions from 153 to 165 of SEQ ID NO:50; (d) SEQ ID NO: 49: VX.sub.24DSX.sub.25X.sub.26EX.sub.27RX.sub.28X.sub.29V, wherein X.sub.24 is an amino acid other than tryptophan; X.sub.25, X.sub.27, X.sub.28 and X.sub.29 each independently are any amino acid residue; and X.sub.26 is serine; and SEQ ID NO: 49 corresponds to amino acids in positions from 153 to 165 of SEQ ID NO:50.
2. The isolated modified nitrile hydratase of claim 1 comprising an ? subunit in which from 1 to 10 amino-acid residues are deleted, substituted, or added at positions other than X1, X9, X23, and X24 in the amino acid sequence of SEQ ID NO: 50 and has an enhanced resistance to amide compounds.
3. The nitrile hydratase according to claim 1, comprising at least the amino acid sequence of SEQ ID NO: 47 in the ? subunit: (b) SEQ ID NO: 47: X.sub.9X.sub.10X.sub.11X.sub.12NX.sub.13X.sub.14X.sub.15X.sub.16X.sub.17X.sub.18X.sub.19X.sub.20X.sub.21CX.sub.22 LC, wherein X.sub.9 is an amino acid other than serine; X.sub.10, X.sub.11, X.sub.12, X.sub.13, X.sub.14, X.sub.15, X.sub.16, X.sub.17, X.sub.19 and X.sub.20 each independently are any amino acid residue; X.sub.18 is histidine; X.sub.21 is valine; and X.sub.22 is threonine.
4. The nitrile hydratase according to claim 1, comprising at least one amino acid sequence selected from the group consisting of SEQ ID NO: 46, 47, 48, and 49: (a) SEQ ID NO: 46: X.sub.1X.sub.2X.sub.3X.sub.4X.sub.5X.sub.6RX.sub.7KAX.sub.8E, wherein X.sub.1 is glycine or valine; X.sub.2, X.sub.3, X.sub.5, X.sub.6, X.sub.7and X.sub.8 each independently are any amino acid residue; and X.sub.4 is tyrosine; (b) SEQ ID NO: 47: X.sub.9X.sub.10X.sub.11X.sub.12NX.sub.13X.sub.14X.sub.15X.sub.16X.sub.17X.sub.18X.sub.19X.sub.20X.sub.21CX.sub.22LC, wherein X.sub.9 is valine or threonine; X.sub.10, X.sub.11, X.sub.12, X.sub.13, X.sub.14, X.sub.15, X.sub.16, X.sub.17, X.sub.19 and X.sub.20 each independently are any amino acid residue; X.sub.18 is histidine; X.sub.21 is valine; and X.sub.22 is threonine; (c) SEQ ID NO: 48: X.sub.23WDSX.sub.25X.sub.26EX.sub.27RX.sub.28X.sub.29V, wherein X.sub.23 is selected from the group consisting of isoleucine, leucine, methionine, and threonine; X.sub.25, X.sub.27, X.sub.28 and X.sub.29 each independently are any amino acid residue; and X.sub.26 is serine; and (d) SEQ ID NO: 49: VX.sub.24DSX.sub.25X.sub.26EX.sub.27RX.sub.28X.sub.29V, wherein X.sub.24 is leucine X.sub.25, X.sub.27, X.sub.28 and X.sub.29 each independently are any amino acid residue; and X.sub.26 is serine.
5. The nitrile hydratase according to claim 1, wherein in SEQ ID NO: 46, X.sub.2 is threonine, X.sub.3 is glutamic acid, X.sub.5 is glutamic acid, X.sub.6 is alanine, X.sub.7 is threonine, and X.sub.8 is isoleucine, in SEQ ID NO: 47, X.sub.10 is alanine, X.sub.11 is valine, X.sub.12 is phenylalanine, X.sub.13 is aspartic acid, X.sub.14 is serine, X.sub.15 is glutamine, X.sub.16 is threonine, X.sub.17 is histidine, X.sub.19 is valine and X.sub.20 is valine, and in SEQ ID NO: 48 and 49, X.sub.25 is serine, X.sub.27 is isoleucine, X.sub.28 is tyrosine and X.sub.29 is isoleucine.
6. The isolated modified nitrile hydratase of claim 1, comprising at least one amino acid mutation in SEQ ID NO:50 selected from the group consisting of (i), (ii), (iii), and (iv): (i) X.sub.1 is glycine or valine, (ii) X.sub.9 is valine or threonine, (iii) X.sub.23 is an amino acid selected from the group consisting of isoleucine, leucine, methionine, and threonine, and (iv) X.sub.24 is leucine.
7. The nitrile hydratase according claim 6, wherein X.sub.2 is threonine, X.sub.3 is glutamic acid, X.sub.4 is tyrosine, X.sub.5 is glutamic acid, X.sub.6 is alanine, X.sub.7 is threonine, X.sub.8 is isoleucine, X.sub.10 is alanine, X.sub.11 is valine, X.sub.12 is phenylalanine, X.sub.13 is aspartic acid, X.sub.14 is serine, X.sub.15 is glutamine, X.sub.16 is threonine, X.sub.17 is histidine, X.sub.18 is histidine, X.sub.19 is valine, X.sub.20 is valine, X.sub.25 is serine, X.sub.26 is serine, X.sub.27 is isoleucine, X.sub.28 is tyrosine, and X.sub.29 is isoleucine.
8. The nitrile hydratase according to claim 1, wherein the nitrile hydratase is from Rhodococcus bacterium or Nocardia bacterium that has been modified so that its ? subunit comprises the amino acid sequence of SEQ ID NO:50.
9. An isolated polynucleotide encoding the nitrile hydratase of claim 1, or a polynucleotide which hybridizes under stringent conditions of a salt concentration of 300 to 2000 mM and a temperature of 40 to 75? C., with a polynucleotide having a polynucleotide sequence complementary to the the polynucleotide encoding the nitrile hydratase and encodes a protein having a nitrile hydratase activity with enhanced resistance to amide compounds under high temperatures.
10. A recombinant vector comprising the isolated polynucleotide according to claim 9.
11. An isolated transformed host cell comprising the recombinant vector according to claim 10.
12. A method for producing a nitrile hydratase, the method comprising culturing the isolated transformed host cell according to claim 11 and collecting the nitrile hydratase from the obtained culture.
13. A method for producing an amide compound, the method comprising bringing a nitrile compound into contact with the nitrile hydratase according to claim 1.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5) The present application claims the benefit of priority to Japanese Patent Application No. 2014-118041 (filed on Jun. 6, 2014) and the disclosure of which is incorporated herein by reference in its entirety.
MODE(S) FOR CARRYING OUT THE INVENTION
(6) 1. Nitrile Hydratase
(7) 1.1 Known Nitrile Hydratase
(8) A nitrile hydratase has a high dimensional structure which consists of a group of ? and ? subunit domains, and contains a non-heme iron atom or a non-corrin cobalt atom as a prosthetic molecule. Those nitrile hydratases are identified and referred to as an iron-containing nitrile hydratase and a cobalt-containing nitrile hydratase, respectively.
(9) A representative example of the iron-containing nitrile hydratase includes a hydratase derived from Rhodococcus N-771 strain. The three dimensional structure of such an iron-containing nitrile hydratase has been clearly identified by X-ray crystal structural analysis. The enzyme is bonded with non-heme iron via four amino acid residues in a cysteine cluster (Cys-Ser-Leu-Cys-Ser-Cys) (SEQ ID NO: 56) forming the active site of the ? subunit
(10) As for the cobalt-containing nitrile hydratase, examples are those derived from Rhodococcus rhodochrous J1 strain (hereinafter may be referred to as J1 strain) or derived from Pseudonocardia thermophila.
(11) A cobalt-containing nitrile hydratase derived from the J1 strain is bound with a cobalt atom via a region identified as a cysteine cluster (Cys-Thr-Leu-Cys-Ser-Cys) (SEQ ID NO: 57 that forms the active site of the ? subunit. In the cysteine cluster of a cobalt-containing nitrile hydratase derived from Pseudonocardia thermophila, cysteine (Cys) at position 4 from the upstream side (N-terminal side) of the cysteine cluster derived from the J1 strain is cysteine sulfinic acid (Csi), and cysteine (Cys) at position 6 from the furthermost downstream side (C-terminal side) of the cysteine cluster derived from the J1 strain is cysteine sulfenic acid (Cse).
(12) As described above, a prosthetic molecule is bonded with a region identified as cysteine clusters C(S/T)LCSC (SEO ID NO: 55) in the ? subunit. Examples of a nitrile hydratase containing a binding region with such a prosthetic molecule are those that have amino acid sequences and are encoded by gene sequences derived from the following: Rhodococcus rhodochrous J1 (FERM BP-1478), Rhodococcus rhodochrous M8 (Old Soviet Union Patent No. 1731814 (SU 1731814), Rhodococcus rhodochrous M33 (VKM Ac-1515D), Rhodococcus rhodochrous ATCC 39484 (JP 2001- 292772 A), Bacillus smithii (JP 9-248188 A), Pseudonocardia thermophila (JP 9- 275978 A) or Geobacillus thermoglucosidasius. On the other hand, the ? subunit is thought to be attributed to structural stability.
(13) The nitrile hydratase derived from Rhodococcus rhodochrous J1 strain (FERM BP-1478) has the GenBank accession number of P21220. Furthermore, the GenBank accession number of the ? subunit derived from Rhodococcus rhodochrous M8 (SU 1731814) is ATT79340 and the GenBank accession number of the ? subunit is AAT 79339. The GenBank accession number of the nitrile hydratase gene derived from Rhodococcus pyridinivorans MW3 is AJ582605, and the GenBank accession number of the nitrile hydratase gene derived from Rhodococcus pyridinivorans S85-2 is AJ582605. The nitrile hydratase gene of Rhodococcus ruber RH (CGMCC No. 2380) is described in Chinese Patent No. 101463358 (CN1463358). Moreover, the GenBank accession number of the nitrile hydratase gene derived from Nocardia YS-2002 is X86737, and the GenBank accession number of the nitrile hydratase gene derived from Nocardia sp. JBRs is AY141130.
(14) In SEQ ID NOs: 1 to 19 of Sequence Listing, amino acid sequence and base sequence of known nitrile hydratase are described. SEQ ID NO: 1: base sequence of the ? subunit derived from Rhodococcus rhodochrous J1 SEQ ID NO: 2: amino sequence of the ? subunit derived from Rhodococcus rhodochrous J1 SEQ ID NO: 3: base sequence of the ? subunit derived from Rhodococcus rhodochrous J1 SEQ ID NO: 4: amino sequence of the ? subunit derived from Rhodococcus rhodochrous J1 SEQ ID NO: 5: amino sequence of the ? subunit of Rhodococcus rhodochrous M8 SEQ ID NO: 6: amino sequence of the ? subunit of Rhodococcus ruber TH SEQ ID NO: 7: amino sequence of the ? subunit of Rhodococcus pyridinivorans MW33 SEQ ID NO: 8: amino sequence of the ? subunit of Rhodococcus pyridinivorans S85-2 SEQ ID NO: 9: amino sequence of the ? subunit of Rhodococcus pyridinivorans MS-38 SEQ ID NO: 10: amino sequence of the ? subunit of Nocardia sp. JBRs SEQ ID NO: 11: amino sequence of the ? subunit of Nocardia sp. YS-2002 SEQ ID NO: 12: amino sequence of the ? subunit of Uncultured bacterium SP1 SEQ ID NO: 13: amino sequence of the ? subunit of Uncultured bacterium BD2 SEQ ID NO: 14: amino sequence of the ? subunit of Rhodococcus rhodochrous ATCC39484 SEQ ID NO: 15: amino sequence of the ? subunit of Sinorhizobium medicae WSM419 SEQ ID NO: 16: amino sequence of the ? subunit of Sinorhizobium medicae Q6 SEQ ID NO: 17: amino sequence of the ? subunit of Pseudonocardia thermophila JCM3095 SEQ ID NO: 18: amino sequence of the ? subunit of Rhodococcus rhodochrous Cr4 SEQ ID NO: 19: amino sequence of the ? subunit of Comamonas testosterone.
(15) Furthermore,
(16) The nitrile hydratase according to the invention is not limited to one with the above sequence, but includes a protein having an amino acid sequence that is homologous or identical to the amino acid sequence described in any one of SEQ ID NOs: 1 to 19 at approximately 60% or higher, preferably at approximately 70% or higher, more preferably at approximately 80% or higher, even more preferably at approximately 90% or higher, particularly preferably at approximately 95% or higher, and most preferably at approximately 98% or higher, while also possessing the nitrile hydratase activity.
(17) In addition, regarding the nitrile hydratase of the invention, a protein which has the amino acid sequence described in any one of SEQ ID NOs: 1 to 19 in which 1 to several amino acids, specifically, 1 to 20, preferably 1 to 10, more preferably 1 to 5, and even more preferably 1 to 2 amino acids are deleted, substituted, or added, and also has the nitrile hydratase activity is also included in the nitrile hydratase of the invention.
(18) 1.2 Improved Nitrile Hydratase
(19) The improved nitrile hydratase of the invention is a novel improved nitrile hydratase with enhanced resistance to amide compounds under high temperatures.
(20) The improved nitrile hydratase of the invention is not limited to being derived from any specific type. For example, those registered as nitrile hydratase in the GenBank database Hypertext Transfer Protocol://World Wide Web.ncbi.nlm.nih.gov/entrez/query.fcgi?CMD=search&DB=protein provided by the U.S. National Center for Biotechnology Information (NCBI), or those described as nitrile hydratase in publications, may be referred to for a use.
(21) Specific examples include nitrile hydratases that are described in WO 2005/116206 A, JP 2007-143409 A, JP 2007-43910 A, JP 2008-253182 A, or JP 2010-172295 A (incorporated in the present specification by reference). Those nitrile hydratases have heat resistance or resistance of acrylamide. By further adding an amino acid substitution according to the invention, a property for enhancing the resistance to amide compounds under high temperatures can be obtained.
(22) Examples of the improved nitrile hydratase of the invention include a nitrile hydratase of which ? subunit has the amino acid sequence (SEQ ID NO: 50) shown in
(23) Regarding the amino acid sequence represented by SEQ ID NO: 50, one having at least one amino acid mutation selected from (a) to (d) can be mentioned as one embodiment of the invention (X.sub.1 to X.sub.29 represent an independent arbitrary amino acid residue). (a) X.sub.1 is glycine or valine (b) X.sub.9 is valine or threonine (c) X.sub.23 is an amino acid selected from a group consisting of isoleucine, leucine, methionine, and threonine (d) X.sub.24 is leucine
(24) As another embodiment, an improved nitrile hydratase having the amino acid sequence represented by SEQ ID NO: 50 in which X.sub.2 is T (threonine), X.sub.3 is E (glutamic acid), X.sub.4 is Y (tyrosine), X.sub.5 is E (glutamic acid), X.sub.6 is A (alanine), X.sub.7 is T (threonine), X.sub.8 is I (isoleucine), X.sub.10 is A (alanine), X.sub.11 is V (valine), X.sub.12 is F (phenylalanine), X.sub.13 is D (asparaginic acid), X.sub.14 is S (serine), X.sub.15 is Q (glutamine), X.sub.16 is T (threonine), X.sub.17 is H (histidine), X.sub.18 is H (histidine), X.sub.19 is V (valine), X.sub.20 is V (valine), X.sub.25 is S (serine), X.sub.26 is S (serine), X.sub.27 is I (isoleucine), X.sub.28 is Y (tyrosine), X.sub.29 is I (isoleucine) and also has at least one characteristic selected from the above (a) to (d) can be mentioned.
(25) Meanwhile, also included in the improved nitrile hydratase of the invention is a nitrile hydratase that is homologous or identical to, at a position other than the aforementioned substitution portions, the amino acid sequence described in SEQ ID NO: 50 at approximately 70% or higher, preferably at approximately 80% or higher, more preferably at approximately 90% or higher, even more preferably at approximately 95% or higher, and particularly preferably at approximately 98% or higher, while also possessing the same heat resistance and/or resistance to amide compounds.
(26) Also included in the improved nitrile hydratase of the invention is a nitrile hydratase which has the amino acid sequence described in SEQ ID NO: 50 in which 1 to 10, preferably 1 to 5, and more preferably 1 to 2 amino acids are deleted, substituted, or added at a position other than the aforementioned substitution portions and has the same heat resistance and/or resistance to amide compounds.
(27) As another example of the improved nitrile hydratase of the invention, regarding the amino acid sequence represented by SEQ ID NO: 4 of a known nitrile hydratase, one having at least one characteristic selected from (e) to (h) can be mentioned. (e) the 8.sup.th amino acid residue (tyrosine) of the ? subunit is substituted with glycine or valine (f) the 88.sup.th amino acid residue (serine) of the ? subunit is substituted with valine or threonine (g) the 153.sup.th amino acid residue (valine) of the ? subunit is substituted with an amino acid selected from isoleucine, leucine, methionine and threonine (h) the 154.sup.th amino acid residue (tryptophane) of the ? subunit is substituted with leucine
(28) Meanwhile, also included in the improved nitrile hydratase of the invention is a nitrile hydratase that is homologous or identical to the amino acid sequence described in SEQ ID NO: 4 at approximately 70% or higher, preferably at approximately 80% or higher, more preferably at approximately 90% or higher, even more preferably at approximately 95% or higher, and particularly preferably at approximately 98% or higher, at a position other than the aforementioned substitution portions, and also has the same heat resistance and/or resistance to amide compounds.
(29) Furthermore, regarding the amino acid sequence identified as SEQ ID NO: 4, a nitrile hydratase having, at a substation position other than those described above, an amino acid sequence in which 1 to 10, preferred to be approximately 1 to 5, and even more preferably 1 to 2 amino acid residues are deleted, substituted, or added and having the same heat resistance and/or resistance to amide compounds is also included in the improved nitrile hydratase of the invention.
(30) The above amino acid substitutions of (e) to (h) are described as Y ? 8G, S ? 88V, V ? 153I, W ? 154L. Standard amino acids are identified by a single-letter alphabetic code. The letter to the left of the numeral showing the substituted position (i.e., number of amino acid residues to the substituted site) represents the amino acid in a one-letter code before substitution, and the letter to the right represents the amino acid in a one-letter code after substitution.
(31) In particular, regarding the amino acid sequence of the ? subunit as shown in SEQ ID NO: 4, if there is a description of Y ? 8G, it means an embodiment of having amino acid substitution in the improved nitrile hydratase in which tyrosine (Y) at position 8 counted from the N-terminal amino acid residue (including the N-terminal amino acid residue itself) of the amino acid sequence of the ? subunit (SEQ ID NO: 4) is substituted with glycine (G).
(32) Modes of amino acid substitutions in more preferred embodiments of the improved nitrile hydratase according to the invention are shown as the following 1 to 8: 1. Y ? 8G 2. Y ? 8V 3. S ? 88V 4. S ? 88T 5. V ? 153I 6. V ? 153L 7. V ? 153M 8. V ? 153T 9. W ? 154L
(33) Preferred embodiments of base substitutions to cause the above amino acid substitutions are shown below.
(34) TABLE-US-00001 TABLE 1 Y?8G Codon TAC (at positions 22~24 in SEQ ID NO: 3) is preferred to be substituted with GGT, GGC, GGA, GGG. Especially preferred to be substituted is T at position 22 with G, and A at position 23 with G (TAC.fwdarw.GGC). Y?8V Codon TAC (at positions 22~24 in SEQ ID NO: 3) is preferred to be substituted with GTT, GTC, GTA, GTG. Especially preferred to be substituted is T at position 22 with G, and A at position 23 with T (TAC.fwdarw.GTC). Y?8T Codon TAC (at positions 22~24 in SEQ ID NO: 3) is preferred to be substituted with ACA, ACC, AACG, ACT. Especially preferred to be substituted is T at position 22 with A, and A at position 23 with C (TAC.fwdarw.ACC). S?88V Codon TCG (at positions 262~264 in SEQ ID NO: 3) is preferred to be substituted with GTT, GTC, GTA, GTG. Especially preferred to be substituted is T at position 262 with T, C at position 263 with T, G at position 263 with C (GTT.fwdarw.GTC). S?88T Codon TCG (at positions 262~264 in SEQ ID NO: 3) is preferred to be substituted with ACA, ACC, ACG, ACT. Especially preferred to be substituted is T at position 262 with A (TCG.fwdarw.ACG). V?153I Codon GTT (at positions 457~459 in SEQ ID NO: 3) is preferred to be substituted with ATT, ATC, ATA. Especially preferred to be substituted is G at position 457 with A, and T at position 459 with C (GTT.fwdarw.ATC). V?153L Codon GTT (at positions 457~459 in SEQ ID NO: 3) is preferred to be substituted with TTA, TTG, CTT, CTC, CTA, CTG. Especially preferred to be substituted is G at position 457 with C (GTT.fwdarw.CTC). V?153T Codon GTT (at positions 457~459 in SEQ ID NO: 3) is preferred to be substituted with ACT, ACC, ACA, ACG. Especially preferred to be substituted is G at position 457 with A, T at position 458 with C, T at position 459 with C (GTT.fwdarw.ACC). V?153M Codon GTT (at positions 457~459 in SEQ ID NO: 3) is preferred to be substituted with ATG. W?154L Codon TGG (at positions 460~462 in SEQ ID NO: 3) is preferred to be substituted with TTA, TTG, CTT, CTC, CTA, CTG. Especially preferred to be substituted is G at position 461 with T (TGG.fwdarw.TTG).
(35) With regard to the activity of the improved nitrile hydratase of the invention, resistance to amide compounds under high temperatures is improved relative to the activity of the wild type nitrile hydratase while naturally derived characteristics are maintained.
(36) Here, nitrile hydratase activity means an enzyme activity to catalyze the hydration for converting a nitrile compound to a corresponding amide compound (RCN+H.sub.2O.fwdarw.RCONH.sub.2). Determining the activity is conducted by bringing a nitrile compound as a substrate into contact with a nitrile hydratase for conversion to a corresponding amide compound and by quantifying the resultant amide compound. Any nitrile compound may be used as a substrate as long as nitrile hydratase reacts with such a compound, but acrylonitrile is preferred.
(37) Reaction conditions include a substrate concentration of 2.5%, reaction temperature of 10? C. to 30? C. and reaction time of 10 to 30 minutes. The enzymatic reactions are terminated by adding phosphoric acid. Then, using HPLC (high-performance liquid chromatography) or gas chromatography, the produced acrylamide is analyzed to measure the amount of the amide compound.
(38) The expression resistance to amide compounds under high temperatures means that, even in the presence of amide compounds, the nitrile hydratase activity is maintained under high temperatures. The expression high temperatures indicate specifically 40? C. to 60? C., and more preferably 45? C. to 55? C.
(39) The resistance to amide compounds under high temperatures can be evaluated by analyzing a culture of transformant containing an improved nitrile hydratase, or an improved nitrile hydratase isolated from the transformant in the presence of an amide compound such as acrylamide (at a high concentration of 30 to 50%, for example) under high temperatures based on the consumption amount or consumption rate of a nitrile compound such as acrylonitrile as substrate. For example, when the improved nitrile hydratase is brought into contact with an amide compound in the range of 40? C. to 60? C. and the nitrile hydratase shows the consumption amount or consumption rate of 1.1 times or more, preferably 1.15 times or more, and more preferably 1.2 times or more that of the comparative example (i.e., nitrile hydratase with no mutation), it can be evaluated that to be resistant to amide compounds under high temperatures.
(40) As for the amide compounds, an amide compound represented by the general formula (1) below, for example, can be mentioned.
RCONH.sub.2(1)
(in the formula R is an optionally substituted linear or branched alkyl or alkenyl group having 1 to 10 carbon atoms, an optionally substituted cycloalkyl or aryl group having 3 to 18 carbon atoms, or an optionally substituted saturated or unsaturated heterocyclic group). Particularly preferred is an acrylamide in which R in the formula is CH.sub.2?CH.
(41) The above improved nitrile hydratase is obtained by performing amino acid substitution on a known nitrile hydratase. For example, such an improved nitrile hydratase is obtained by introducing the aforementioned mutation to the amino acid sequence (SEQ ID NO: 4) of a nitrile hydratase derived from Rhodococcus rhodochrous J1 strain, and by screening a nitrile hydratase with an improved resistance to amide compound at high temperatures.
(42) Even for a nitrile hydratase derived from those other than J1 strain, resistance to amide compounds under high temperatures can be enhanced by introducing the same mutation to a corresponding site for modification. Examples of the bacteria for producing a nitrile hydratase include Rhodococcus rhodochrous M8 (SEQ ID NO: 5), Rhodococcus ruber TH (SEQ ID NO: 6), Rhodococcus rhodochrous M33 (VKM Ac-1515D), Rhodococcus pyridinivorans MW3 (SEQ ID NO: 7), Rhodococcus pyridinivorans S85-2 (SEQ ID NO: 8), Nocardia sp. JBRs (SEQ ID NO: 10), and Nocardia YS-2002 (SEQ ID NO: 11). Meanwhile, Rhodococcus rhodochrous M33 (VKM Ac-1515D) was selected because it is capable of constitutive expression of a nitrile hydratase based on natural mutation of the above M8 bacteria and the amino acid or gene sequence of the nitrile hydratase itself is not mutated (U.S. Pat. No. 5,827,699).
(43) The improved nitrile hydratase of the invention can be obtained by introducing a mutation, either randomly or site-specifically, to a gene encoding a known nitrile hydratase according to a known method, and selecting the enzyme with desired function, i.e., resistance to amide compounds under high temperatures.
(44) Examples of a method for introduction a mutation include a random mutation introduction method like error prone PCR and site-directed mutagenesis like Kunkel method or Gapped Duplex method.
(45) [Error Prone PCR]
(46) As a method for studying functions and characteristics of proteins using a mutant, random mutagenesis is known. Random mutagenesis is a method to introduce a random mutation to the gene encoding a specific protein so that a mutant is produced. In random mutagenesis by PCR, stringency conditions are set low for the DNA amplification period so that a mutant base can be introduced (error-prone PCR).
(47) In such an error-prone PCR method, a mutation is introduced randomly into any position of the entire DNA site to be amplified. Then, by examining the function of the obtained mutant, in which the mutation is introduced at a random site, information of the amino acid or domain important for a specific function of a protein is obtained. As a nitrile hydratase used for the template of error-prone PCR, the nitrile hydratase gene derived from a wild-type strain or DNA obtained as an amplified product by error-prone PCR can be used.
(48) As reaction conditions for error-prone PCR, for example, a composition ratio of any one, two or three among dNTP (dGTP, dCTP, dATP or dTTP) in the reaction mix is reduced relative to another dNTP. Accordingly, during the DNA synthesis, at a position that requires a dNTP whose ratio is reduced, another dNTP is more likely to be used by error and that may lead to mutation. In addition, other preferred reaction conditions are a composition in which the amount of MgCl.sub.2 and/or MnCl.sub.2 in the reaction mix is increased.
(49) [Site-Directed Mutagenesis (Site-Specific Introduction of Mutation)]
(50) As for the method for introducing a mutation to a specific site, a general method is as follows: the DNA chain containing a target gene is dissociated into a single strand, and annealed to an oligonucleotide chain containing a target gene, which is then prepared as a double strand by elongating the single stand using a DNA polymerase, the double strand is combined in E. coli for replication, and, after replication by fusion in E. coli, a clone including the desired mutation is selected (see, Molecular Cloning, A Laboratory Manual 2nd ed., Cold Spring Harbor Laboratory Press (1989), Current Protocols in Molecular Biology, John Wiley & Sons (1987-1997) or the like). Other than Kunkel method, various methods such as Gapped Duplex method are known, and the method can be conveniently carried out by using a commercially available mutagenesis kit such as QuickChange? XL Site-Directed Mutagenesis Kit (manufactured by Stratagene), GeneTailor? Site-Directed Mutagenesis System (manufactured by Invitrogen Corporation), TaKaRa Site-Directed Mutagenesis System (Mutan-K, Mutan-Super Express Km and the like, manufactured by Takara Bio Inc.), or the like.
(51) Other than the method including introduction of a mutation to a gene of known nitrile hydratase as described above, the improved nitrile hydratase of the invention can be also obtained by metagenome screening from environmental DNA.
(52) 1.3 DNA Encoding Improved Nitrile Hydratase
(53) The invention also provides DNA encoding the improved nitrile hydratase of the invention.
(54) The DNA encoding the improved nitrile hydratase of the invention also includes DNA which is hybridized under stringent conditions with a DNA having a base sequence complementary to the base sequence of the DNA encoding the improved nitrile hydratase of the invention, and also encodes a protein with nitrile hydratase activity which has resistance to amide compounds under high temperatures.
(55) Stringent conditions are those for washing after hybridization; a salt concentration of 300 to 2000 mM and a temperature of 40 to 75? C., preferably a salt concentration of 600 to 900 mM and a temperature of 65? C. For example, conditions 2?SSC at 50? C. may be employed. In addition to such a salt concentration of the buffer, temperature and the like, a person skilled in the art may set conditions for obtaining DNA that encodes a nitrile hydratase of the invention by adding various conditions such as probe concentration, probe length, reaction time, and the like.
(56) For detailed order of hybridization, Molecular Cloning, A Laboratory Manual, 2nd edition (Cold Spring Harbor Laboratory Press (1989)) or the like may be referred to. DNA to be hybridized includes DNA or its partial fragment, containing a base sequence which has 40% or greater, preferably 60% or greater, and more preferably 90% or greater sequence homology to the gene DNA of the invention.
(57) 1.4 Recombinant Vector, Transformant
(58) It is necessary for the DNA encoding the improved nitrile hydratase gene to be implanted into a vector so that nitrile hydratase is expressed in the host organism to be transformed. Examples of such vectors to be used include plasmid DNA, bacteriophage DNA, retrotransposon DNA, artificial chromosome DNA and the like.
(59) In addition to a nitrile hydratase gene, a vector may be coupled with a promoter, terminator, enhancer, splicing signal, poly A addition signal, selection marker, ribosome binding sequence (SD sequence) or the like. Examples of the selection markers include kanamycin resistance gene, dihydrofolate reductase gene, ampicillin resistance gene, neomycin resistance gene and the like.
(60) A host to be used in the invention is not limited to any specific type as long as it can express the target nitrile hydratase after the recombinant vector is introduced into the host. Examples include bacteria such as E. coli and Bacillus subtilis, yeasts, animal cells, insect cells, plant cells and the like.
(61) When E. coli is used as a host, an expression vector with high expression efficiency, such as expression vector pkk 233-2 with a trc promoter (manufactured by Amersham Biosciences Corp.), pTrc 99A (manufactured by Amersham Biosciences Corp.) or the like, is preferred.
(62) When a bacterium is used as a host, Escherichia coli may be used, for example, and a Rhodococcus strain such as Rhodococcus rhodochrous ATCC 12674, Rhodococcus rhodochrous ATCC 17895 and Rhodococcus rhodochrous ATCC 19140 may also be used. Those ATCC strains can be obtained from the American type culture collection. Method for introducing a recombinant vector into a bacterium is not limited to any specific method as long as DNA is introduced into the bacterium. For example, a method using calcium ions, electroporation or the like may be employed.
(63) When yeast is used as a host, examples are Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris and the like. As a method for introducing a recombinant vector into yeast, it is not limited specifically as long as DNA can be introduced into the yeast. For example, an electroporation method, spheroplast method, lithium acetate method or the like may be employed.
(64) When animal cells are used as a host, monkey cells COS-7, Vero, CHO cells, mouse L cells, rat GH3 cells, human FL cells or the like may be employed. As a method for introducing a recombinant vector into animal cells, for example, an electroporation method, calcium phosphate method, lipofection method or the like may be used.
(65) When insect cells are used as a host, Sf9 cells, Sf21 cells or the like may be used. A method for introducing a recombinant vector into insect cells, for example, a calcium phosphate method, lipofection method, electroporation method or the like may be used.
(66) When plant cells are used as a host, tobacco BY-2 cells or the like may be used, but not limited to them. A method for introducing a recombinant vector into plant cells, for example, an Agrobacterium method, particle gun method, PEG method, electroporation method or the like may be used.
(67) When E. coli is used as a host, since most of the expressed nitrile hydratase is formed as an inclusion body and is insoluble, a transformant with low catalytic activity is obtained. On the other hand, if a Rhodococcus strain is used as a host, nitrile hydratase is present in the soluble fraction, and thus a transformant with high activity is obtained. The host may be selected based on purposes. However, when an improved enzyme is selected under stringent conditions, a transformant with high activity derived from a Rhodococcus strain is preferred.
(68) 1.5 Method for Producing Improved Nitrile Hydratase
(69) The improved nitrile hydratase can be produced by culturing the above transformant and collecting a protein with nitrile hydratase activity from the obtained culture. The invention also provides such a method for producing an improved nitrile hydratase.
(70) In the invention, culture means any of culture supernatant, cultured cell, cultured bacterial-cell, and cell homogenates or bacterial-cell homogenates.
(71) Culture of a transformant is carried out according to a method which is generally used for culture of a host. As for a medium to culture a transformant of the invention, a natural or synthetic culture medium is used as long as it contains a carbon source, a nitrogen source, inorganic salts or the like for the host bacteria to assimilate, and culture of a transformant is performed efficiently. Examples of a carbon source include carbohydrates such as glucose, galactose, fructose, sucrose, raffinose and starch; organic acids such as acetic acid and propionic acid; alcohols such as ethanol and propanol; and the like. Examples of a nitrogen source include inorganic acids such as ammonia, ammonium chloride, ammonium sulfate, ammonium acetate and ammonium phosphate; ammonium salts of organic acids; and other nitrogen-containing compounds.
(72) In addition, peptone, yeast extract, meat extract, corn steep liquor, various amino acids or the like may also be used. Examples of an inorganic substance include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, zinc sulfate, copper sulfate, calcium carbonate and the like. Also, if necessary, a defoaming agent may be used to prevent foaming during the culture process. Moreover, cobalt ions or iron ions as prosthetic molecules of a nitrile hydratase, or nitriles and amides as an inducer of the enzyme, may also be added to the culture.
(73) Culture may be conducted by adding selective pressure to prevent the vector and the target gene from being eliminated. Namely, if a selection marker is a drug-resistant gene, a corresponding drug may be added; or if a selection marker is an auxotrophic complementary gene, corresponding nutrition factors may be removed.
(74) Also, if a selection marker is an assimilation adding gene, an equivalent assimilation factor may be added as a sole factor, if necessary. For example, when E. coli transformed by a vector containing an ampicillin-resistant gene is cultured, ampicillin may be added as needed during the culture process.
(75) When culturing a transformant transformed by a recombinant vector containing, as a promoter, an inducible promoter, such an inducer may be added to the medium, if necessary. For example, when culturing a transformant transformed by an expression vector with a promoter inducible with isopropyl-?-D-thiogalactopyranoside (IPTG), IPTG or the like may be added to the medium. Likewise, when culturing a transformant transformed by an expression vector with a trp promoter inducible with indoleacetic acid (IAA), IAA or the like may be added to the medium.
(76) Culture conditions of a transformant are not limited specifically as long as the productivity of the target improved nitrile hydratase and growth of the host are not prohibited. Generally, conditions are preferred to be 10? C. to 40? C., more preferably 20? C. to 37? C., for 5 to 100 hours. The pH value is adjusted using inorganic or organic acid, alkaline solution or the like. If it is Rhodococcus, the pH is adjusted to be 6 to 9.
(77) As for culture methods, solid-state culture, static culture, shaking culture, aeration-agitation culture and the like may be used. When a Rhodococcus transformant is cultured, in particular, it is preferred to use shaking culture or aeration-agitation culture (jar fermentation) under aerobic conditions.
(78) When cultured in culture conditions above, the improved nitrile hydratase of the invention is accumulated at a high yield in the above culture product namely, at least in any of culture supernatant, cultured cell, cultured bacterial-cell, cell homogenates or bacterial-cell homogenates.
(79) After culture, when an improved nitrile hydratase is produced in a cell or bacterial cell, the target nitrile hydratase can be collected by homogenizing the cells or bacterial cells. Cells or bacterial cells are homogenized by high-pressure treatment using a French press or homogenizer, supersonic treatment, grinding treatment using glass beads or the like, enzyme treatment using lysozyme, cellulase, pectinase and the like, freezing and thawing treatment, hypotonic solution treatment, bacteriolysis induction treatment by phage, and so on.
(80) After homogenization, residues of cell homogenates or bacterial-cell homogenates (including insoluble fractions of the cell extract) are removed, if necessary. To remove residues, centrifugal or filtration methods are employed, if necessary. To increase the efficiency of removing residues, a coagulant or filter aid may be used. The supernatant obtained after the removal of residues is soluble fractions of the cell extract, which can be used as a crudely purified improved nitrile hydratase solution.
(81) Also, when an improved nitrile hydratase is produced in a bacterial cells or in cells, it is also possible that the bacterial cells or the cells themselves are collected by a centrifuge or membrane filtration and to be used without homogenizing them.
(82) When an improved nitrile hydratase is produced outside cells or bacterial cells, the culture may be used as is, or the cells or bacterial cells are removed using a centrifugal or filtration method. Then, the improved nitrile hydratase is collected from the culture by being extracted through ammonium sulfate precipitation, if necessary. Furthermore, dialysis or various chromatography techniques (gel filtration, ion exchange chromatography, affinity chromatography, etc.) may be used to isolate and purify the nitrile hydratase.
(83) The efficiency for producing a nitrile hydratase, which is obtained by culturing a transformant, can be confirmed in a unit per culture solution, wet weight or dry weight of bacterial cells, protein of a crude enzyme solution or the like by SD S-PAGE (polyacrylamide gel electrophoresis), nitrile hydratase activity measurements or the like, but not particularly limited thereto. SDS-PAGE may be conducted by a method well known by a person skilled in the art. Also, as for the nitrile hydratase activity, the activity described above may be used.
(84) Other than the methods described above, an improved nitrile hydratase may be produced using a cell-free protein synthesis system. In a cell-free protein synthesis system, a protein is synthesized in an artificial vessel such as a test tube using a cell extract. A cell-free protein synthesis system used in the present invention includes a cell-free transcription system that synthesizes RNA using DNA as a template.
(85) In such a case, an organism corresponding to the above host corresponds to the organism from which the cell extract is derived. Here, for the cell extract, extracts of eukaryotic or prokaryotic origin, such as the extract from wheat germ, E. coli and the like, may be used. Such cell extracts may be concentrated or not.
(86) The cell extract can be obtained by ultrafiltration, dialysis, polyethylene glycol (PEG) precipitation or the like, for example. In the invention, a commercially available kit may also be used for cell-free protein synthesis. Examples of such a kit include a reagent kit PROTEIOS? (TOYOBO CO., LTD.), TNT? system (Promega Corporation), a synthesizer PG-Mate? (TOYOBO CO., LTD.), RTS (Roche Diagnostics K.K.) and the like.
(87) An improved nitrile hydratase obtained by cell-free protein synthesis as described above can be also purified by properly selecting a chromatography type.
(88) 2. Method for Producing Amide Compound
(89) The improved nitrile hydratase of the invention can be used as an enzyme catalyst for material production. For example, an amide compound is produced by bringing a nitrile compound into contact with the improved nitrile hydratase. Then, the amide compound produced upon contact is collected. Accordingly, an amide compound is produced.
(90) As an enzyme catalyst, in addition to the isolated and purified nitrile hydratase as described above, a culture after culturing the transformant of the invention or a processed product of the culture may also be used. Examples of the processed product include the cells after culture (i.e., transformant) immobilized with acrylamide gel or the like, those processed by glutaraldehyde, those supported by inorganic carriers such as alumina, silica, zeolite, diatomaceous earth and the like.
(91) Here, contact means that an improved nitrile hydratase and a nitrile compound are present in the same reaction system or culture system: for example, an isolated and purified improved nitrile hydratase and a nitrile compound are mixed; a nitrile compound is added into a culture vessel of a cell (transformant) to express an improved nitrile hydratase gene; the cells are cultured in the presence of a nitrile compound; an extract of the cells is mixed with a nitrile compound; and so on.
(92) A nitrile compound to be used as a substrate is selected by considering the substrate specificity of the enzyme, stability of the enzyme for the substrate and the like. As for the nitrile compound, acrylonitrile is preferred. The reaction method and the method for collecting an amide compound after the completion of reactions are properly selected depending on the characteristics of the substrate and the enzyme catalyst.
(93) The enzyme catalyst is preferred to be recycled as long as its activity is not lost. From the viewpoint of preventing the loss of activity and easy recycling, the enzyme catalyst is preferred to be used as a processed product.
EXAMPLES
(94) Hereinbelow, the invention is more specifically explained in view of the examples. However, the invention is not limited to them. Meanwhile, % described herein indicates % by mass.
Example 1
Preparation of Plasmid for Expressing Improved Nitrile Hydratase
(95) A plasmid to be a template for introducing the amino acid substitution of the invention was prepared as follows.
(96) As a template having the nitrile hydratase gene of the J1 strain, pSJ034 was used (
(97) Here, Rhodococcus rhodochrous J-1 strain has been registered under accession number FERM BP-1478 at the International Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology (Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki, (presently, NITE Patent Microorganisms Depositary Center: 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba, Room No. 120)), (original deposition date of Sep. 18, 1987).
(98) In addition, pSJ023 is a transformant R. rhodochrous ATCC 12674/pSJ023, and is internationally registered under accession number FERM BP-6232 at the International Patent Organism Depositary, National Institute of Advanced Industrial Science (Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki, (presently, NITE Patent Microorganisms Depositary Center: 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba, Room No. 120)), (original deposition date of Mar. 4, 1997).
Example 2
Production of Improved Nitrile Hydratase
(99) By using the plasmid pSJ034 prepared in Example 1, the amino acid substitution was performed. PCR was performed by using the composition of a reaction solution, reaction condition, and primers described below.
(100) <Composition of PCR Reaction Solution>
(101) TABLE-US-00002 Sterile water 20 ?l pSJ034 (1 ng/ml) 1 ?l Forward Primer (10 mM) 2 ?l Reverse Primer (10 mM) 2 ?l PrimeSTAR MAX (2x) 25 ?l Total 50 ?l
(102) <Reaction Conditions for PCR>
(103) (98? C. for 10 seconds, 55? C. for 5 seconds, and 72? C. for 90 seconds)?30 cycles
(104) TABLE-US-00003 TABLE2 <Primer> Nameof SEQ Primer Sequence(5-3) IDNO ?8G-F AATAAGGGCACGGAGTACGAGGCACGT 20 ?8G-R CTCCGTGCCCTTATTGACGTGCTCGCT 21 ?8V-F AATAAGGTCACGGAGTACGAGGCACGT 22 ?8V-R CTCCGTGACCTTATTGACGTGCTCGCT 23 ?88V-F CCAAATTGTCGCGGTCTTCAACGACTC 24 ?88V-R GACCGCGACAATTTGGTGTGCCTGCTC 25 ?88T-F CCAAATTACCGCGGTCTTCAACGACTC 53 ?88T-R GACCGCGGTAATTTGGTGTGCCTGCTC 54 ?153I-F GTCAGGATCTGGGACAGCAGCTCCGAA 26 ?153I-R GTCCCAGATCCTGACCTCCACCTCATC 27 ?153L-F GTCAGGCTCTGGGACAGCAGCTCCGAA 28 ?153L-R GTCAGGGAGTGGGACAGCAGCTCCGAA 29 ?153M-F GTCAGGATGTGGGACAGCAGCTCCGAA 30 ?153M-R GTCAGGCATTGGGACAGCAGCTCCGAA 31 ?153T-F GTCAGGACCTGGGACAGCAGCTCCGAA 32 ?153T-R GTCAGGGGTTGGGACAGCAGCTCCGAA 33 ?154L-F AGGGTTCTCGACAGCAGCTCCGAAATC 34 ?154L-R GCTGTCGAGAACCCTGACCTCCACCTC 35 ?153I GTCAGGATCCTCGACAGCAGCTCCGAA 36 ?154L-F ?153I GCTGTCGAGGATCCTGACCTCCACCTC 37 ?154L-R ?153L GTCAGGCTCCTCGACAGCAGCTCCGAA 38 ?154L-F ?153L GCTGTCGAGGAGCCTGACCTCCACCTC 39 ?154L-R ?153M GTCAGGATGCTCGACAGCAGCTCCGAA 40 ?154L-F ?153M GCTGTCGAGCATCCTGACCTCCACCTC 41 ?154L-R ?153T GTCAGGACCCTCGACAGCAGCTCCGAA 42 ?154L-F ?153T GCTGTCGAGGAGCCTGACCTCCACCTC 43 ?154L-R
(105) After the completion of PCR, 5 ?L of the reaction mixture was provided for 0.7% agarose gel electrophoresis, an amplified fragment of 11 kb was confirmed, and 1 ?L DpnI (provided with the kit) was added to the PCR reaction mixture, which was then reacted at 37? C. for an hour. Accordingly, the template plasmid was removed. After that, the reaction mixture was purified using Wizard SV Gel and PCR Clean-Up System (Promega Corporation), and transformation was introduced into JM109 using the purified PCR reaction product. From the obtained culture product, plasmid DNA was extracted using QIAprep Spin Miniprep Kit (Qiagen), and the base sequence of the nitrile hydratase was confirmed using automated sequencer CEQ 8000 (manufactured by Beckman Coulter, Inc.). Obtained plasmids were named as shown in Table 3.
(106) TABLE-US-00004 TABLE 3 Name of Plasmid Amino acid substitutions pSJ034 (Comparative example) pSJH001 Y?8G pSJH002 S?88V pSJH064 S?88T pSJH004 V?153M pSJH005 W?154L pSJH022 S?88V, V?153M pSJH023 S?88V, V?153M, W?154L pSJH024 Y?8G, S?88V pSJH025 Y?8G, V?153M pSJH026 Y?8V, W?154L pSJH027 Y?8V, V?153I pSJH028 Y?8G, S?88V, V?153I pSJH030 Y?8V, V?153T, W?154L pSJH032 Y?8G, S?88V, V?153M, W?154L
Example 3
Preparation of Rhodococcus Transformant
(107) Cells of Rhodococcus rhodochrous strain ATCC 12674 in a logarithmic growth phase were collected using a centrifuge, washed three times with ice-cold sterile water, and suspended in the sterile water. Then, 1 ?L of plasmid prepared in Example 2 and 10 ?L of the bacterial-cell suspension were mixed and ice-cooled. The DNA and the bacterial-cell suspension were supplied in a cuvette, and electric pulse treatment was conducted using an electroporation device, Gene Pulser (Bio-Rad Laboratories), under conditions of 2.0 kV and 200?. The electric-pulse processed mixture was let stand in an ice-cold condition for 10 minutes, and subjected to heat shock at 37? C. for 10 minutes. After 500 ?L of an MYK culture medium (0.5% polypeptone, 0.3% Bacto yeast extract, 0.3% Bacto malt extract, 0.2% K.sub.2HPO.sub.4, 0.2% KH.sub.2PO.sub.4) was added and let stand at 30? C. for 5 hours, the strain was applied onto an MYK agar culture medium containing 50 ?g/mL kanamycin and cultured at 30? C. for 3 days. The obtained colony after culturing at 30? C. for 3 days was used as a transformant.
(108) Each transformant obtained above process was inoculated into an MYK culture medium (50 ?g/mL kanamycin), and subjected to shaking culture at 30? C. for 2 days. Then, 1% culture was inoculated into a GGPK culture medium (1.5% glucose, 1% sodium glutamate, 0.1% yeast extract, 0.05% K.sub.2HPO.sub.4, 0.05% KH.sub.2PO.sub.4, 0.05% Mg.sub.2O.sub.4.7H.sub.2O, 1% CoCl.sub.2, 0.1% urea, 50 ?g/mL kanamycin, pH 7.2), and subjected to shaking culture at 30? C. for 3 days. Bacterial cells were collected by using a centrifuge, and were washed with a 100 mM phosphate buffer (pH 7.0) to prepare a bacterial-cell suspension.
Example 4
Evaluation of Resistance to Amide Compounds Under High Temperatures
(109) Resistance to amide compounds of the improved nitrile hydratase obtained in Example 3 was measured according to the following method.
(110) 0.2 mL of the bacterial-cell mixture and 4.8 mL of a 50 mM phosphate buffer (pH 7.0) were mixed, to which 5 mL of a 50 mM phosphate buffer (pH 7.0) containing 5.0% (w/v) acrylonitrile was further added. Next, the mixture was reacted while being shaken at 10? C. for 10 minutes. Then, bacterial cells were filtered and the amount of produced acrylamide was quantified by using gas chromatography.
(111) <Analysis Conditions> Analysis instrument: gas chromatograph GC2014 (manufactured by Shimadzu Corporation) Detector: FID (detection at 200? C.) Column: 1 m glass column filled with PoraPak PS (column filler manufactured by Waters Corporation) Column temperature: 190? C.
(112) Nitrile hydratase activity was determined by conversion from the amount of acrylamide. Here, regarding nitrile hydratase activity, the amount of enzyme to produce 1 ?mol of acrylamide per 1 minute is set as 1 U.
(113) Next, the test was carried out with the following composition for reaction solution and reactions conditions. Meanwhile, the each cell suspension used for the reaction was suitably diluted in with 100 mM phosphate buffer solution (pH 7.0) such that it has the same enzyme activity amount from the previously measured enzyme activity. As a comparative control, the comparative strain ATCC12674/pSJ034 was used.
(114) <Composition of Reaction Solution> 50% Acrylamide solution 94 g Acrylonitrile 3 g 1 M Phosphate buffer solution 1 g Cell solution (with same enzyme activity unit (U) amount) 2 g
(115) <Reaction Conditions> Reaction temperature 45? C. Reaction time 3 hours
(116) 1 ml of each reaction solution was sampled either before the start of the reaction (0 hour) or 3 hours after the reaction. After filtering it using 0.45 ?m filter, the obtained filter solution was subjected to gas chromatography. Result of analyzing the ratio of the remaining acrylonitrile (%) was shown in Table 4.
(117) TABLE-US-00005 TABLE 4 Acrylonitrile consumption Name of Plasmid amount (%) relative ratio (%) pSJ034 0.8 100% (Comparative example) pSJH001 1.0 125% pSJH002 1.4 163% pSJH064 0.88 110% pSJH004 1.8 225% pSJH005 1.1 138% pSJH022 2.3 288% pSJH023 2.6 325% pSJH024 1.3 163% pSJH025 2.3 288% pSJH026 1.7 213% pSJH027 1.5 188% pSJH028 1.6 200% pSJH030 2.4 300% pSJH032 2.6 325%
(118) From the above results, it was found that the acrylonitrile consumption rate of every improved nitrile hydratase is 110% or more than pSJ034 as a comparative example. In a reaction for synthesizing amide compounds using a nitrile hydratase, a loss of the activity due to exposure to high temperature and high concentration of product, and an reaction inhibition caused by the amide compounds as a reaction product are the problems. In this regard, as the improved nitrile hydratase of the invention maintains the nitrile hydratase activity even at high temperature and even in the presence of acrylamide at high concentration, it is believed to have improved acrylamide resistance under high temperatures.
Example 5
Production of Improved Nitrile Hydratase
(119) The amino acid substitution was performed in the same manner as Example 2 by using the nitrile hydratase described in WO 2012/164933 A (pSJ306A). The prepared plasmids are shown in Table 5.
(120) TABLE-US-00006 TABLE 5 Name of Plasmid Amino acid substitutions pSJ306A P?17G, S?57M, T?107K, K?114Y, N?167S, C?218H, (Comparative V?219A, G?174L example) pSJA006 Y?8G, P?17G, S?57M, T?107K, K?114Y, N?167S, C?218II, V?219A, G?174L pSJA018 Y?8V, P?17G, S?57M, T?107K, K?114Y, N?167S, C?218H, V?219A, G?174L pSJB018 S?88V, P?17G, S?57M, T?107K, K?114Y, N?167S, C?218H, V?219A, G?174L pSJC008 V?153I, P?17G, S?57M, T?107K, K?114Y, N?167S, C?218H, V?219A, G?174L pSJC010 V?153L, P?17G, S?57M, T?107K, K?114Y, N?167S, C?218H, V?219A, G?174L pSJC017 V?153T, P?17G, S?57M, T?107K, K?114Y, N?167S, C?218H, V?219A, G?174L pSJC011 V?153M, P?17G, S?57M, T?107K, K?114Y, N?167S, C?218H, V?219A, G?174L pSJD010 W?154L, P?17G, S?57M, T?107K, K?114Y, N?167S, C?218H, V?219A, G?174L pSJG001 S?88V, V?153M, P?17G, S?57M, T?107K, K?114Y, N?167S, C?218H, V?219A, G?174L pSJG002 S?88V, V?153M, W?154L, P?17G, S?57M, T?107K, K?114Y, N?167S, C?218H, V?219A, G?174L pSJG003 S?88V, V?153L, W?154L, P?17G, S?57M, T?107K, K?114Y, N?167S, C?218H, V?219A, G?174L pSJG004 V?153M, W?154L, P?17G, S?57M, T?107K, K?114Y, N?167S, C?218H, V?219A, G?174L pSJG005 V?153L, W?154L, P?17G, S?57M, T?107K, K?114Y, N?167S, C?218H, V?219A, G?174L
(121) By using the plasmids described in Table 5, Rhodococcus rhodochrous ATCC12674 transformant was obtained in the same manner as Example 3, and cultured in a MYK medium. By using the obtained culture cells, evaluation of the resistance to amide compounds under high temperatures was carried out according to the following conditions.
(122) <Composition of Reaction Solution> 50% Acrylamide solution 94 g Acrylonitrile 3 g 1 M Phosphate buffer solution 1 g Cell solution (with same enzyme activity unit (U) amount) 1 g
(123) <Reaction Conditions> Reaction temperature 45? C. Reaction time 5 hours
(124) TABLE-US-00007 TABLE 6 Acrylonitrile Acrylonitrile consumption consumption Name of Plasmid amount (%) rate (%) pSJ306A 1.63 100% (Comparative example) pSJA006 2.16 133% pSJA018 1.99 122% pSJB018 1.79 110% pSJC008 2.20 135% pSJC010 2.41 148% pSJC011 2.26 139% pSJC017 2.42 148% pSJD010 2.31 142% pSJG001 2.26 139% pSJG002 2.63 161% pSJG003 2.68 164% pSJG004 2.57 158% pSJG005 2.38 146%
(125) From the above results, it was found that the acrylonitrile consumption rate of every improved nitrile hydratase is 110% or more than pSJ306A as a comparative example. Accordingly, as the improved nitrile hydratase of the invention maintains the nitrile hydratase activity even at high temperature, and even in the presence of high concentration of acrylamide, it is believed to have improved acrylamide resistance under high temperatures.
Example 6
Production of Improved Nitrile Hydratase (JBRs)
(126) A plasmid for expressing the nitrile hydratase gene derived from Nocardia sp. JBRs (GenBank accession number: AY141130) was produced according to the following method.
(127) By carrying out PCR in which pSJ034 is used as a template, the vector fragment was prepared using Wizard SV Gel and PCR Clean-Up System (Promega Corporation).
(128) <Composition of PCR Reaction Solution>
(129) TABLE-US-00008 Sterile water 20 ?l pSJ034 (1 ng/ml) 1 ?l Forward Primer (10 mM) 2 ?l Reverse Primer (10 mM) 2 ?l PrimeSTAR MAX (2x) 25 ?l Total 50 ?l
(130) <PCR Reaction Conditions> (98? C. for 10 seconds, 55? C. for 5 seconds, and 72? C. for 90 seconds)?30 cycles
(131) TABLE-US-00009 (SEQIDNO:51) NH-F:GAAGTGATCGTATGAGTGAAGACACACTCACTG (SEQIDNO:52) NH-R:GTGGATACCATCCATTTCCTCATTCCTTTCATC
(132) The vector fragment produced in the above and the artificially synthesized nitrile hydratase gene derived from Nocardia sp. JBRs (SEQ ID NO: 44) were cloned by using In-Fusion Cloning Kit (Takara Bio Inc.) and transformed into E. coli HST08 (Takara Bio Inc.). From the obtained colonies, the plasmid was collected and the DNA sequence was confirmed. Accordingly, the plasmid for expressing the nitrile hydratase derived from Nocardia sp. JBRs was obtained (pSJ-JBRs).
(133) Furthermore, by using the pSJ-JBRs as a template, the amino acid substitution was performed in the same manner as Example 2. The produced plasmids are shown in Table 7.
(134) TABLE-US-00010 TABLE 7 Name of Plasmid Amino acid substitutions from wild strain pSJ-JBRs (Comparative example) pSJH006 Y?8G pSJH007 Y?8V pSJH061 S?88T pSJH008 V?153L pSJH009 V?153T pSJH033 V?153L, W?154L pSJH034 S?88V, V?153M, W?154L pSJH035 S?88V, V?153T, W?154L pSJH036 Y?8G, S?88V pSJH037 Y?8V, W?154L pSJH038 Y?8G, S?88V, V?153I pSJH039 Y?8G, S?88V, V?153L, W?154L pSJH040 Y?8G, S?88V, V?153M, W?154L
(135) By using the plasmids described in Table 7, Rhodococcus rhodochrous ATCC12674 transformant was obtained in the same manner as Example 3, and cultured in a MYK medium. By using the obtained culture cells, evaluation of the resistance to amide compounds under high temperatures was carried out according to the conditions of Example 4. The results are shown in Table 8.
(136) TABLE-US-00011 TABLE 8 Acrylonitrile Acrylonitrile consumption consumption rate Name of Plasmid amount (%) (%) pSJ-JBRs 1.3 100% (Comparative example) pSJH006 1.45 112% pSJH007 1.45 112% pSJH061 1.6 125% pSJH008 2.6 200% pSJH009 1.9 146% pSJH033 2.7 208% pSJH034 2.7 208% pSJH035 2.4 185% pSJH036 1.4 108% pSJH037 2.4 208% pSJH038 1.5 123% pSJH039 2.7 208% pSJH040 2.7 208%
(137) From the above results, it was found that the acrylonitrile consumption rate of every improved nitrile hydratase is 108% or more than pSJ-JBRs as a comparative example. In this regard, as the improved nitrile hydratase of the invention maintains the nitrile hydratase activity even at high temperature, and even in the presence of high concentration of acrylamide, it is believed to have improved acrylamide resistance under high temperatures.
Example 7
Production of Improved Nitrile Hydratase (S85-2)
(138) The plasmid for expressing the nitrile hydratase gene derived from Rhodococcus pyridinivorans S85-2 (GenBank accession number: AJ582605) was produced in the same manner as Example 6 by using an artificially synthesized nitrile hydratase gene (SEQ ID NO: 45). The obtained plasmid was named pSJ-S85-2.
(139) Furthermore, by using the pSJ-S85-2 as a template, the amino acid substitution was performed in the same manner as Example 2. The produced plasmids are shown in Table 9.
(140) TABLE-US-00012 TABLE 9 Amino acid substitutions Name of Plasmid from wild strain pSJ-S85-2 (Comparative example) pSJH013 Y?8V pSJH014 V?153L pSJH048 V?153L, W?154L pSJH049 S?88V, V?153L, W?154L pSJH051 Y?8G, V?153M pSJH052 Y?8V, W?154L pSJH053 Y?8V, V?153L
(141) By using the plasmids described in Table 9, Rhodococcus rhodochrous ATCC12674 transformant was obtained in the same manner as Example 3, and cultured in a MYK medium. By using the obtained culture cells, evaluation of the resistance to amide compounds under high temperatures was carried out according to the conditions of Example 4. The results are shown in Table 10.
(142) TABLE-US-00013 TABLE 10 Name of Acrylonitrile consumption Acrylonitrile Plasmid amount (%) consumption rate (%) pSJ-S85-2 1.19 100% (Comparative example) pSJH013 1.70 143% pSJH014 1.77 148% pSJH048 2.59 218% pSJH049 2.58 217% pSJH051 2.59 218% pSJH052 1.65 139% pSJH053 1.87 158%
(143) From the above results, it was found that the acrylonitrile consumption rate of every improved nitrile hydratase is 130% or more than pSJ-S85-2 as a comparative example. In this regard, as the improved nitrile hydratase of the invention maintains the nitrile hydratase activity even at high temperature, and even in the presence of high concentration of acrylamide, it is believed to have improved acrylamide resistance under high temperatures.
Example 8
Production of Improved Nitrile Hydratase (M8)
(144) As for the plasmid for expressing the nitrile hydratase gene derived from Rhodococcus rhodochrous M8 (GenBank accession number: AAT79340, AAT79339), plasmid pSJ-NO1A described in JP 2011-200132 A was used and the amino acid substitution was carried out in the same manner as Example 2. The prepared plasmids are shown in Table 11.
(145) TABLE-US-00014 TABLE 11 Amino acid substitutions Name of Plasmid from wild strain pSJ-NO1A None (Comparative example) pSJH010 S?88V pSJH062 S?88T pSJH011 V?153M pSJH012 W?154L pSJH041 S?88V, V?153M pSJH042 V?153M, W?154L pSJH044 Y?8V, V?153M pSJH045 Y?8V, V?153I pSJH046 Y?8V, V?153T, W?154L pSJH047 Y?8V, S?88V, V?153T, W?154L
(146) By using the plasmids described in Table 11, Rhodococcus rhodochrous ATCC12674 transformant was obtained in the same manner as Example 3, and cultured in a MYK medium. By using the obtained culture cells, evaluation of the resistance to amide compounds under high temperatures was carried out according to the conditions of Example 4. The results are shown in Table 12.
(147) TABLE-US-00015 TABLE 12 Acrylonitrile Acrylonitrile consumption consumption Name of Plasmid amount (%) rate (%) pSJ-NO1A 1.39 100% (Comparative example) pSJH010 1.60 115% pSJH062 2.08 150% pSJH011 2.57 185% pSJH012 2.29 165% pSJH041 1.91 137% pSJH042 2.64 190% pSIH044 2.57 185% pSJH045 2.00 144% pSJH046 2.40 173% pSJH047 2.63 189%
(148) From the above results, it was found that the acrylonitrile consumption rate of every improved nitrile hydratase is 110% or more than pSJ-NO1A as a comparative example. In this regard, as the improved nitrile hydratase of the invention maintains the nitrile hydratase activity even at high temperatures, and even in the presence of high concentration of acrylamide, it is believed to have improved acrylamide resistance under.
Example 9
Rhodococcus Rhodochrous (Mitsui Bacterium)
(149) As for the plasmid for expressing the nitrile hydratase gene derived from Pseudonocardia thermophila JCM 3095 (GenBank accession number: DD028560, DD028561), plasmid pSJ-NO2A described in JP 2011-200132 A was used and the amino acid substitution was carried out in the same manner as Example 2. The prepared plasmids are shown in Table 10.
(150) TABLE-US-00016 TABLE 13 Amino acid substitutions Name of Plasmid from wild strain pSJ-NO2A (Comparative example) pSJH021 W?160L (Corresponding to X.sub.22 in SEQ ID NO: 49)
(151) By using the plasmids described in Table 13, Rhodococcus rhodochrous ATCC12674 transformant was obtained in the same manner as Example 3, and cultured in a MYK medium. By using the obtained culture cells, evaluation of the resistance to amide compounds under high temperatures was carried out according to the conditions of Example 4. The results are shown in Table 14.
(152) TABLE-US-00017 TABLE 14 Acrylonitrile Acrylonitrile consumption consumption Name of Plasmid amount (%) rate (%) pSJ-NO2A 0.50 100% (Comparative example) pSJH021 1.20 240%
(153) From the above results, it was found that the acrylonitrile consumption rate of every improved nitrile hydratase is 240% than pSJ-NO2A as a comparative example. In this regard, as the improved nitrile hydratase of the invention maintains the nitrile hydratase activity even at high temperature, and even in the presence of high concentration acrylamide, it is believed to have improved acrylamide resistance under high temperatures.
INDUSTRIAL APPLICABILITY
(154) Because the improved nitrile hydratase of the invention has enhanced resistance to acrylamide under high temperatures, a corresponding amide compound can be effectively produced from a nitrile compound, and thus the nitrile hydratase is useful for industrial production of amide compounds.
(155) All the publications, patents, and patent applications cited in the invention are incorporated in this application by reference.
DEPOSITION NUMBER
(156) Rhodococcus rhodochrous J1 STRAIN: FERM BP-1478
(157) R. rhodochrous ATCC12674/pSJ023: FERM BP-6232
SEQUENCE LISTING FREE TEXT
(158) SEQ ID NO: 20: ?8G-F primer
(159) SEQ ID NO: 21: ?8G-R primer
(160) SEQ ID NO: 22: ?8V-F primer
(161) SEQ ID NO: 23: ?8V-R primer
(162) SEQ ID NO: 24: ?88V-F primer
(163) SEQ ID NO: 25: ?88V-R primer
(164) SEQ ID NO: 26: ?153I-F primer
(165) SEQ ID NO: 27: ?153I-R primer
(166) SEQ ID NO: 28: ?153L-F primer
(167) SEQ ID NO: 29: ?153L-R primer
(168) SEQ ID NO: 30: ?153M-F primer
(169) SEQ ID NO: 31: ?153M-R primer
(170) SEQ ID NO: 32: ?153T-F primer
(171) SEQ ID NO: 33: ?153T-R primer
(172) SEQ ID NO: 34: ?154L-F primer
(173) SEQ ID NO: 35: ?154L-R primer
(174) SEQ ID NO: 36: ?153I??154L-F primer
(175) SEQ ID NO: 37: ?153I??154L-R primer
(176) SEQ ID NO: 38: ?153L??154L-F primer
(177) SEQ ID NO: 39: ?153L??154L-R primer
(178) SEQ ID NO: 40: ?153M??154L-F primer
(179) SEQ ID NO: 41: ?153M??154L-R primer
(180) SEQ ID NO: 42: ?153T??154L-F primer
(181) SEQ ID NO: 43: ?153T??154L-R primer
(182) SEQ ID NO: 46: Specific amino acid according to the invention
(183) SEQ ID NO: 47: Specific amino acid according to the invention
(184) SEQ ID NO: 48: Specific amino acid according to the invention
(185) SEQ ID NO: 49: Specific amino acid according to the invention
(186) SEQ ID NO: 50: Amino acid of the ? subunit according to the invention
(187) SEQ ID NO: 51: NH-F primer
(188) SEQ ID NO: 52: NH-R primer
(189) SEQ ID NO: 53: ?88T-F primer
(190) SEQ ID NO: 54: ?88T-R primer