LACCASE VARIANTS AND POLYNUCLEOTIDES ENCODING SAME

20180282708 ยท 2018-10-04

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to laccase variants comprising a substitution at one or more positions corresponding to positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants.

Claims

1. A laccase variant, comprising a substitution at one or more positions corresponding to positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2, wherein the variant has laccase activity and wherein the variant has at least 60% sequence identity to the full-length polypeptide of a parent or the mature polypeptide thereof.

2. The variant of claim 1, wherein the parent laccase is selected from the group consisting of: (a) a polypeptide having at least 60% sequence identity to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95; or the mature polypeptide thereof; (b) a polypeptide encoded by a polynucleotide that hybridizes under at least low stringency conditions with (i) SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 92, or 94, or the mature polypeptide coding sequence thereof; or (ii) the full-length complement of (i); (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 92, or 94; or the mature polypeptide coding sequence thereof; and (d) a fragment of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95, or the mature polypeptide thereof, which has laccase activity.

3. The variant of claim 1, wherein the parent laccase comprises the full-length polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95; or the mature polypeptide thereof.

4. The variant of claim 1, which has at least 60% sequence identity to the full-length polypeptide of the parent laccase, or the mature polypeptide thereof.

5. The variant of claim 1, wherein the number of substitutions is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 substitutions.

6. The variant of claim 1, which comprises one or more substitutions selected from the group consisting of A9R; A21C; S37C; L79A,D,E,F,G,I,M,N,Q,S; F102A; V170A,M,Q,S,T; V175S,T; K178S; L179N; S200D; A262G; V275I; D276G; V289I,K,Q,R,T; T292D,F,G,H,K; A333S,E,K,R; N357D,A,E,F,G,M,Q,S,T,V,Y; I360V,A,H,M; Y393I; S397A; F418I,V,L,M; A485S; S506H; and S518A.

7. The variant of claim 6, which comprises substitutions A262G+I360V; F418I+S506H; A9R+L79D+L179N; A21C+K178S+F418V+S518A; S37C+A262G+Y393I+A485S; A262G+V289I+T292D+N357D; F102A+V175S+A262G+I360V+S397A; V175T+S200D+A262G+I360V+Y393I; F102A+V175T+S200D+A262G+N357D+S397A; V175T+S200D+A262G+D276G+I360V+Y393I+F418I+S506H; or V175T+S200D+A262G+V275I+D276G+A333S+I360V+Y393I+F418I+S506H.

8. The variant of claim 1, which further comprises a substitution at one or more positions corresponding to positions 89, 151, 286, 307, 313, 339, and 355 of the full-length polypeptide of SEQ ID NO: 2, wherein the variant has laccase activity.

9. The variant of claim 8, wherein the one or more substitutions are selected from the group consisting of F89A,V,L,I; N151D,E,R,K; F286R,H,V; A307P,H,G; T313N,T,S; V339W,T,S; and G355R.

10. The variant of claim 1, which has an increased expression yield, an increased specific activity, and/or increased dye bleaching activity compared to the parent, wherein the expression yield of the variant is increased at least 1.05-fold compared to the parent.

11. An isolated polynucleotide encoding the variant of claim 1.

12. A nucleic acid construct comprising the polynucleotide of claim 11.

13. A recombinant host cell comprising the polynucleotide of claim 11.

14. A method of producing a laccase variant, comprising: (a) cultivating the recombinant host cell of claim 13 under conditions suitable for expression of the variant; and optionally (b) recovering the variant.

15. A method for obtaining a laccase variant, comprising introducing into a parent laccase a substitution at one or more positions corresponding to positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the mature polypeptide of SEQ ID NO: 2, wherein the variant has laccase activity, and optionally recovering the variant.

16. The method of claim 15, wherein the one or more substitutions are selected from the group consisting of A9R; A21C; S37C; L79A,D,E,F,G,I,M,N,Q,S; F102A; V170A,M,Q,S,T; V175S,T; K178S; L179N; S200D; A262G; V275I; D276G; V289I,K,Q,R,T; T292D,F,G,H,K; A333S,E,K,R; N357D,A,E,F,G,M,Q,S,T,V,Y; I360V,A,H,M; Y393; S397A; F418I,V,L,M; A485S; S506H; and S518A.

17. The method of claim 15, which further comprises a substitution at one or more positions corresponding to positions 89, 151, 286, 307, 313, 339, and 355 of the full-length polypeptide of SEQ ID NO: 2, wherein the variant has laccase activity.

18. The method of claim 17, wherein the one or more substitutions are selected from the group consisting of F89A,V,L,I; N151D,E,R,K; F286R,H,V; A307P,H,G; T313N,T,S; V339W,T,S; and G355R.

19. An enzyme composition, whole broth formulation, or cell culture composition comprising the variant of claim 1.

20. (canceled)

Description

BRIEF DESCRIPTION OF THE FIGURES

[0012] FIG. 1 shows a restriction map of pMMar27.

[0013] FIG. 2 shows a restriction map of pEvFz1.

[0014] FIG. 3 shows a restriction map of pDLHD0006.

[0015] FIG. 4 shows a restriction map of pDLHD0140.

[0016] FIG. 5 shows a restriction map of pDAu571.

[0017] FIG. 6 shows a restriction map of pADl006.

[0018] FIG. 7 shows a restriction map of pTmmD014.

[0019] FIG. 8 shows a restriction map of pAMFS200.

[0020] FIG. 9 shows a restriction map of pAMFS201.

[0021] FIG. 10 shows a restriction map of pDLHD0199.

[0022] FIG. 11 shows a restriction map of pDLHD0201.

DEFINITIONS

[0023] Allelic variant: The term allelic variant means any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequences. An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.

[0024] cDNA: The term cDNA means a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA. The initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.

[0025] Coding sequence: The term coding sequence means a polynucleotide, which directly specifies the amino acid sequence of a variant. The boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon such as ATG, GTG or TTG and ends with a stop codon such as TAA, TAG, or TGA. The coding sequence may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof.

[0026] Control sequences: The term control sequences means nucleic acid sequences necessary for expression of a polynucleotide encoding a variant of the present invention. Each control sequence may be native (i.e., from the same gene) or foreign (i.e., from a different gene) to the polynucleotide encoding the variant or native or foreign to each other. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a variant.

[0027] Expression: The term expression includes any step involved in the production of a variant including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0028] Expression vector: The term expression vector means a linear or circular DNA molecule that comprises a polynucleotide encoding a variant and is operably linked to control sequences that provide for its expression.

[0029] Fragment: The term fragment means a polypeptide having one or more (e.g., several) amino acids absent from the amino and/or carboxyl terminus of a mature polypeptide, wherein the fragment has laccase activity. In one aspect, a fragment contains at least 85%, at least 90%, or at least 95% of the amino acid residues of the mature polypeptide.

[0030] Host cell: The term host cell means any cell type that is susceptible to transformation, transfection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term host cell encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.

[0031] Improved property: The term improved property means a characteristic associated with a variant that is improved compared to the parent. Such improved properties include, but are not limited to, catalytic efficiency, catalytic rate, chemical stability, dye bleaching activity, expression yield, oxidation stability, pH activity, pH stability, specific activity, stability under storage conditions, substrate binding, substrate cleavage, substrate specificity, substrate stability, surface properties, thermal activity, thermostability, and volumetric laccase activity.

[0032] In one aspect, the improved property is increased expression yield of a variant compared to the parent. In another aspect, the improved property is increased specific activity of a variant compared to the parent. In another aspect, the improved property is increased expression yield and increased specific activity of a variant compared to the parent. In another aspect, the improved property is increased dye bleaching. For example, dye bleaching is employed in various industrial applications such as lignin modification, paper strengthening, dye transfer inhibition in detergents, phenol polymerization, hair dyeing, bleaching of textiles (in particular bleaching of denim as described in WO 96/12845 and WO 96/12846), and waste water treatment.

[0033] Increased dye bleaching activity: The term increased dye bleaching activity means a higher ability of a variant compared to the parent to decolorize any dye that can be decolorized using a laccase enzyme. Examples of such dyes include, but are not limited to, azo, monoazo, disazo, nitro, xanthene, quinoline, anthroquinone, triarylmethane, paraazoanyline, azineoxazine, stilbene, aniline, and phtalocyanine dyes, or mixtures thereof. In some embodiments, the dye is an azo dye (e.g., Reactive Black 5 (2,7-naphthalenedisulfonic acid, 4-amino-5- hydroxy-3,6-bis((4-((2-(sulfooxy)ethyl)sulfonyl)phenyl)azo)-tetrasodium salt), Reactive Violet 5, methyl yellow, congo red). In some embodiments, the dye is an anthraquinone dye (e.g., remazol blue), indigo (indigo carmine), or a triarylmethane/paraazoanyline dye (e.g., crystal violet, malachite green). In various embodiments, the dye is a reactive, direct, disperse, or pigment dye. In another embodiment, the dye is contained within an ink. In another embodiment, the dye is contained within a textile. In another embodiment, the dye is indigo and/or a sulfur-based dye. In some embodiments, the textile is denim dyed with indigo and/or a sulfur-based dye. In a particular embodiment, the textile is dyed with indigo, and a laccase variant is used to oxidize the indigo to isatin.

[0034] In one aspect, the dye bleaching activity of the variant is increased at least 1.05-fold, at least 1.10-fold, at least 1.20-fold, at least 1.30-fold, at least 1.40-fold, at least 1.50-fold, at least 1.60-fold, at least 1.70-fold, at least 1.80-fold, at least 1.90-fold, at least 2-fold, at least 2.25-fold, at least 2.50-fold, at least 2.75-fold, at least 3.00-fold, at least 3.25-fold, at least 3.50-fold, at least 3.75-fold, at least 4-fold, at least 4.25-fold, at least 4.50-fold, at least 4.75-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, or at least 20-fold compared to the dye bleaching activity of the parent.

[0035] Increased expression yield: The term increased expression yield means a higher amount (g) of secreted active enzyme per liter of culture medium from cultivation of a host cell expressing the variant gene compared to the amount (g) of secreted active enzyme per liter produced under the same cultivation conditions by the same host cell expressing the parent gene.

[0036] In one aspect, the expression yield of the variant is increased at least 1.05-fold, at least 1.10-fold, at least 1.20-fold, at least 1.30-fold, at least 1.40-fold, at least 1.50-fold, at least 1.60-fold, at least 1.70-fold, at least 1.80-fold, at least 1.90-fold, at least 2-fold, at least 2.25-fold, at least 2.50-fold, at least 2.75-fold, at least 3.00-fold, at least 3.25-fold, at least 3.50-fold, at least 3.75-fold, at least 4-fold, at least 4.25-fold, at least 4.50-fold, at least 4.75-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 35-fold, or at least 40-fold compared to the expression yield of the parent.

[0037] Increased specific activity: The term increased specific activity means a higher enzyme activity per molecule or pmole of a variant compared to the enzyme activity per molecule or ?mole of the parent of the variant. The enzyme activity is measured in units per gram, wherein one unit is defined as the amount of laccase activity required to oxidize 1 nmole of substrate (e.g., 4,4-[azinobis(methanylylidene)]bis(2,6-dimethoxyphenol) (syringaldazine); 2,2-azinobis(3-ethylbenzthiazoline-6-sulfonate [ABTS]; 10-(2-hydroxyethyl)-phenoxazine (HEPO); 2,2,6,6-tetramethylpiperidin-1-yloxy [TEMPO], indigo carmine, Reactive Black 5) per second under conditions of an assay based on the ability of laccase enzyme to oxidize the substrate, e.g., ABTS, into its corresponding stable cation radical, e.g., ABTS+. For example, unlike the initial form of ABTS, the radical form is dark green in color with increased absorbance at 420 nm. The amount of green color formation is proportional to the amount of laccase activity, and can be compared to a laccase standard curve to determine the absolute amount of laccase activity.

[0038] The increased specific activity of the variant compared to the parent can be assessed, for example, under specific conditions of pH and/or temperature. For example, the pH can be any pH in the range of 3 to 7, e.g., 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, or 7.0 (or in between). Any suitable buffer for achieving the desired pH can be used. For example, the temperature can be any temperature in the range of 25? C. to 90? C., e.g., 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90? C. (or in between). In another aspect, a combination of two or more (e.g., several) of the above conditions are used to determine the increased specific activity of the variant compared to the parent, such as any temperature in the range of 25? C. to 90? C., e.g., 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90? C. (or in between) at a pH in the range of 3 to 7, e.g., 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, or 7.0 (or in between).

[0039] In one aspect, the specific activity of the variant is increased at least 1.05-fold, at least 1.10-fold, at least 1.20-fold, at least 1.30-fold, at least 1.40-fold, at least 1.50-fold, at least 1.60-fold, at least 1.70-fold, at least 1.80-fold, at least 1.90-fold, at least 2-fold, at least 2.25-fold, at least 2.50-fold, at least 2.75-fold, at least 3.00-fold, at least 3.25-fold, at least 3.50-fold, at least 3.75-fold, at least 4-fold, at least 4.25-fold, at least 4.50-fold, at least 4.75-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, or at least 20-fold compared to the specific activity of the parent.

[0040] Isolated: The term isolated means a substance in a form or environment that does not occur in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).

[0041] Laccase: The term laccase means a benzenediol:oxygen oxidoreductase (E.C. 1.10.3.2) that catalyzes the following reaction: 1,2- or 1,4-benzenediol+O.sub.2=1,2- or 1,4-benzosemiquinone+2H.sub.2O.

[0042] Laccase activity can be determined by measuring the oxidation of syringaldazine (4,4-[azinobis(methanylylidene)]bis(2,6-dimethoxyphenol)) to the corresponding quinone 4,4-[azobis(methanylylidene])bis(2,6-dimethoxycyclohexa-2,5-dien-1-one). The reaction (shown below) is detected by an increase in absorbance at 530 nm.

##STR00001##

The reaction is conducted in 23 mM 2-(N-morpholino)ethanesulfonic acid (MES) pH 5.5 at 30? C. with 19 ?M substrate (syringaldazine) and 1 g/L polyethylene glycol (PEG) 6000. The sample is placed in a spectrophotometer and the change in absorbance is measured at 530 nm every 15 seconds up to 90 seconds. One laccase unit is the amount of enzyme that catalyzes the conversion of 1 ?mole syringaldazine per minute under the specified analytical conditions.

[0043] Laccase activity can also be determined from the oxidation of syringaldazine under aerobic conditions. The violet color produced is photometered at 530 nm. The assay conditions are 19 mM syringaldazine, 23 mM Tris/maleate buffer, pH 7.5, 30? C., and 1 minute reaction time. One laccase unit (LAMU) is the amount of enzyme that catalyzes the conversion of 1.0 ?mole syringaldazine per minute under these conditions.

[0044] Laccase activity can also be measured using 10-(2-hydroxyethyl)-phenoxazine (HEPO) as substrate. HEPO is synthesized using the same procedure as described for 10-(2-hydroxyethyl)-phenothiazine, (Cauquil, 1960, Bulletin de la Society Chemique de France p. 1049). In the presence of oxygen, laccase oxidizea HEPO to a HEPO radical that can be monitored photometrically at 528 nm.

[0045] Laccase activity can also be measured using 2,2-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS, CAS number: 30931-67-0) as substrate in 100 mM sodium acetate pH 4 and measuring the absorbance at 405 nm.

[0046] Laccase activity can also be measured using other substrates such as indigo carmine or Reactive Black 5 using methods known in the art.

[0047] Mature polypeptide: The term mature polypeptide means a polypeptide in its final form following translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. In one aspect, the mature polypeptide is amino acids 22 to 520 of SEQ ID NO: 2 based on the SignalP 3.0 program (Bendtsen et al., 2004, J. Mol. Biol. 340: 783-795) that predicts amino acids 1 to 21 of SEQ ID NO: 2 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 520 of SEQ ID NO: 4 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 4 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 520 of SEQ ID NO: 6 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 6 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 520 of SEQ ID NO: 8 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 8 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 520 of SEQ ID NO: 10 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 10 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 520 of SEQ ID NO: 12 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 12 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 520 of SEQ ID NO: 14 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 14 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 520 of SEQ ID NO: 16 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 16 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 520 of SEQ ID NO: 18 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 18 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 520 of SEQ ID NO: 20 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 20 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 520 of SEQ ID NO: 22 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 22 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 519 of SEQ ID NO: 24 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 24 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 520 of SEQ ID NO: 26 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 26 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 520 of SEQ ID NO: 28 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 28 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 520 of SEQ ID NO: 30 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 30 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 520 of SEQ ID NO: 32 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 32 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 520 of SEQ ID NO: 34 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 34 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 518 of SEQ ID NO: 36 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 36 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 518 of SEQ ID NO: 38 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 38 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 515 of SEQ ID NO: 40 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 40 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 520 of SEQ ID NO: 42 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 42 are a signal peptide. In another aspect, the mature polypeptide is amino acids 64 to 518 of SEQ ID NO: 44 based on the SignalP 3.0 program that predicts amino acids 1 to 63 of SEQ ID NO: 44 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 518 of SEQ ID NO: 46 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 46 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 518 of SEQ ID NO: 48 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 48 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 518 of SEQ ID NO: 50 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 50 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 518 of SEQ ID NO: 52 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 52 are a signal peptide. In another aspect, the mature polypeptide is amino acids 26 to 524 of SEQ ID NO: 54 based on the SignalP 3.0 program that predicts amino acids 1 to 25 of SEQ ID NO: 54 are a signal peptide. In another aspect, the mature polypeptide is amino acids 26 to 524 of SEQ ID NO: 56 based on the SignalP 3.0 program that predicts amino acids 1 to 25 of SEQ ID NO: 56 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 521 of SEQ ID NO: 58 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 58 are a signal peptide. In another aspect, the mature polypeptide is amino acids 24 to 524 of SEQ ID NO: 60 based on the SignalP 3.0 program that predicts amino acids 1 to 23 of SEQ ID NO: 60 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 517 of SEQ ID NO: 62 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 62 are a signal peptide. In another aspect, the mature polypeptide is amino acids 19 to 539 of SEQ ID NO: 64 based on the SignalP 3.0 program that predicts amino acids 1 to 18 of SEQ ID NO: 64 are a signal peptide. In another aspect, the mature polypeptide is amino acids 24 to 533 of SEQ ID NO: 66 based on the SignalP 3.0 program that predicts amino acids 1 to 23 of SEQ ID NO: 66 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 531 of SEQ ID NO: 68 based on the SignalP 3.0 program that predicts amino acids 1 to 20 of SEQ ID NO: 68 are a signal peptide. In another aspect, the mature polypeptide is amino acids 25 to 518 of SEQ ID NO: 70 based on the SignalP 3.0 program that predicts amino acids 1 to 24 of SEQ ID NO: 70 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 518 of SEQ ID NO: 93 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 93 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 620 of SEQ ID NO: 95 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 95 are a signal peptide. It is known in the art that a host cell may produce a mixture of two of more different mature polypeptides (i.e., with a different C-terminal and/or N-terminal amino acid) expressed by the same polynucleotide. It is also known in the art that different host cells process polypeptides differently, and thus, one host cell expressing a polynucleotide may produce a different mature polypeptide (e.g., having a different C-terminal and/or N-terminal amino acid) as compared to another host cell expressing the same polynucleotide.

[0048] Mature polypeptide coding sequence: The term mature polypeptide coding sequence means a polynucleotide that encodes a mature polypeptide having laccase activity. In one aspect, the mature polypeptide coding sequence is nucleotides 64 to 1560 of SEQ ID NO: 1 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 1 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1560 of SEQ ID NO: 3 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 3 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1560 of SEQ ID NO: 5 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 5 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1560 of SEQ ID NO: 7 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 7 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1560 of SEQ ID NO: 9 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 9 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1560 of SEQ ID NO: 11 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 11 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1560 of SEQ ID NO: 13 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 13 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1560 of SEQ ID NO: 15 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 15 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1560 of SEQ ID NO: 17 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 17 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1560 of SEQ ID NO: 19 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 19 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1560 of SEQ ID NO: 21 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 21 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1557 of SEQ ID NO: 23 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 23 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1560 of SEQ ID NO: 25 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 25 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1560 of SEQ ID NO: 27 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 27 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1560 of SEQ ID NO: 29 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 29 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1560 of SEQ ID NO: 31 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 31 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1560 of SEQ ID NO: 33 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 33 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1554 of SEQ ID NO: 35 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 35 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1554 of SEQ ID NO: 37 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 37 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1545 of SEQ ID NO: 39 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 39 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1560 of SEQ ID NO: 41 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 41 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1554 of SEQ ID NO: 43 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 43 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1554 of SEQ ID NO: 45 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 45 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1554 of SEQ ID NO: 47 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 47 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1554 of SEQ ID NO: 49 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 49 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1554 of SEQ ID NO: 51 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 51 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 76 to 1572 of SEQ ID NO: 53 based on the SignalP 3.0 program that predicts nucleotides 1 to 75 of SEQ ID NO: 53 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 76 to 1572 of SEQ ID NO: 55 based on the SignalP 3.0 program that predicts nucleotides 1 to 75 of SEQ ID NO: 55 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1563 of SEQ ID NO: 57 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 57 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 70 to 1572 of SEQ ID NO: 59 based on the SignalP 3.0 program that predicts nucleotides 1 to 69 of SEQ ID NO: 59 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1551 of SEQ ID NO: 61 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 61 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 55 to 1617 of SEQ ID NO: 63 based on the SignalP 3.0 program that predicts nucleotides 1 to 54 of SEQ ID NO: 63 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 70 to 1599 of SEQ ID NO: 65 based on the SignalP 3.0 program that predicts nucleotides 1 to 69 of SEQ ID NO: 65 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 61 to 1593 of SEQ ID NO: 67 based on the SignalP 3.0 program that predicts nucleotides 1 to 60 of SEQ ID NO: 67 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 73 to 1554 of SEQ ID NO: 69 based on the SignalP 3.0 program that predicts nucleotides 1 to 72 of SEQ ID NO: 69 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1554 of SEQ ID NO: 92 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 92 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1860 of SEQ ID NO: 94 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 94 encode a signal peptide.

[0049] In each of the aspects above, the term mature polypeptide coding sequence shall be understood to include the cDNA sequence of the genomic DNA sequence or the genomic DNA sequence of the cDNA sequence.

[0050] Mediator: The term mediator (or chemical mediator may be used interchangeably herein) is defined herein as a chemical compound which acts as a redox mediator to effectively shuttle electrons between a laccase and a substrate. Chemical mediators are also known as enhancers and accelerators in the art.

[0051] Mutant: The term mutant means a polynucleotide encoding a variant.

[0052] Nucleic acid construct: The term nucleic acid construct means a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, which comprises one or more control sequences.

[0053] Operably linked: The term operably linked means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs expression of the coding sequence.

[0054] Parent or parent laccase: The term parent or parent laccase means a laccase to which an alteration, i.e., a substitution, insertion, and/or deletion, at one or more (e.g., several) positions, is made to produce the laccase variants of the present invention. The parent may be a naturally occurring (wild-type) polypeptide or a variant thereof, or fragment thereof.

[0055] Sequence identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter sequence identity.

[0056] For purposes of the present invention, the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later. The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needle labeled longest identity (obtained using thenobrief option) is used as the percent identity and is calculated as follows:


(Identical Residues?100)/(Length of Alignment?Total Number of Gaps in Alignment)

[0057] For purposes of the present invention, the sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 5.0.0 or later. The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle labeled longest identity (obtained using thenobrief option) is used as the percent identity and is calculated as follows:


(Identical Deoxyribonucleotides?100)/(Length of Alignment?Total Number of Gaps in Alignment)

[0058] Stringency conditions: The term very low stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42? C. in 5?SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2?SSC, 0.2% SDS at 45? C.

[0059] The term low stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42? C. in 5?SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2?SSC, 0.2% SDS at 50? C.

[0060] The term medium stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42? C. in 5?SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2?SSC, 0.2% SDS at 55? C.

[0061] The term medium-high stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42? C. in 5?SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2?SSC, 0.2% SDS at 60? C.

[0062] The term high stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42? C. in 5?SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2?SSC, 0.2% SDS at 65? C.

[0063] The term very high stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42? C. in 5?SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2?SSC, 0.2% SDS at 70? C.

[0064] Subsequence: The term subsequence means a polynucleotide having one or more (e.g., several) nucleotides absent from the 5 and/or 3 end of a mature polypeptide coding sequence; wherein the subsequence encodes a fragment having laccase activity. In one aspect, a subsequence contains at least 85%, at least 90%, or at least 95% of the nucleotides of the mature polypeptide coding sequence.

[0065] Variant: The term variant means a polypeptide having laccase activity comprising an alteration, i.e., a substitution, insertion, and/or deletion, at one or more (e.g., several) positions. A substitution means replacement of the amino acid occupying a position with a different amino acid; a deletion means removal of the amino acid occupying a position; and an insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position. The variants of the present invention have at least 20%, e.g., at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 100% of the laccase activity of the parent.

[0066] Volumetric activity: The term volumetric activity is the level of laccase activity produced per unit volume (e.g., ml or liter) of a culture broth. Laccase activity is determined as described herein.

[0067] Wild-type laccase: The term wild-type laccase means a laccase expressed by a naturally occurring microorganism, such as a bacterium, yeast, or filamentous fungus found in nature.

Conventions for Designation of Variants

[0068] For purposes of the present invention, the full-length polypeptide disclosed in SEQ ID NO: 2 is used for numbering to determine the corresponding amino acid residue in another laccase. The amino acid sequence of another laccase is aligned with the full-length polypeptide disclosed as SEQ ID NO: 2, and based on the alignment, the amino acid position number corresponding to any amino acid residue in the full-length polypeptide of SEQ ID NO: 2 is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later. The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. Numbering of the amino acid positions is based on the full-length polypeptide (e.g., including the signal peptide) of SEQ ID NO: 2 wherein position 1 is the first amino acid of the signal peptide (i.e., Met) and position 22 (i.e., Gly) is the first position of the mature polypeptide of SEQ ID NO: 2.

[0069] Identification of the corresponding amino acid residue in another laccase can be determined by alignment of multiple polypeptide sequences using several computer programs including, but not limited to, MUSCLE (multiple sequence comparison by log-expectation; version 3.5 or later; Edgar, 2004, Nucleic Acids Research 32: 1792-1797), MAFFT (version 6.857 or later; Katoh and Kuma, 2002, Nucleic Acids Research 30: 3059-3066; Katoh et al., 2005, Nucleic Acids Research 33: 511-518; Katoh and Toh, 2007, Bioinformatics 23: 372-374; Katoh et al., 2009, Methods in Molecular Biology 537: 39-64; Katoh and Toh, 2010, Bioinformatics 26: 1899-1900), and EMBOSS EMMA employing ClustalW (1.83 or later; Thompson et al., 1994, Nucleic Acids Research 22: 4673-4680), using their respective default parameters.

[0070] When another laccase has diverged from the full-length polypeptide of SEQ ID NO: 2 such that traditional sequence-based comparison fails to detect their relationship (Lindahl and Elofsson, 2000, J. Mol. Biol. 295: 613-615), other pairwise sequence comparison algorithms can be used. Greater sensitivity in sequence-based searching can be attained using search programs that utilize probabilistic representations of polypeptide families (profiles) to search databases. For example, the PSI-BLAST program generates profiles through an iterative database search process and is capable of detecting remote homologs (Atschul et al., 1997, Nucleic Acids Res. 25: 3389-3402). Even greater sensitivity can be achieved if the family or superfamily for the polypeptide has one or more representatives in the protein structure databases. Programs such as GenTHREADER (Jones, 1999, J. Mol. Biol. 287: 797-815; McGuffin and Jones, 2003, Bioinformatics 19: 874-881) utilize information from a variety of sources (PSI-BLAST, secondary structure prediction, structural alignment profiles, and solvation potentials) as input to a neural network that predicts the structural fold for a query sequence. Similarly, the method of Gough et al., 2000, J. Mol. Biol. 313: 903-919, can be used to align a sequence of unknown structure with the superfamily models present in the SCOP database. These alignments can in turn be used to generate homology models for the polypeptide, and such models can be assessed for accuracy using a variety of tools developed for that purpose.

[0071] For proteins of known structure, several tools and resources are available for retrieving and generating structural alignments. For example the SCOP superfamilies of proteins have been structurally aligned, and those alignments are accessible and downloadable. Two or more protein structures can be aligned using a variety of algorithms such as the distance alignment matrix (Holm and Sander, 1998, Proteins 33: 88-96) or combinatorial extension (Shindyalov and Bourne, 1998, Protein Engineering 11: 739-747), and implementation of these algorithms can additionally be utilized to query structure databases with a structure of interest in order to discover possible structural homologs (e.g., Holm and Park, 2000, Bioinformatics 16: 566-567).

[0072] In describing the variants of the present invention, the nomenclature described below is adapted for ease of reference. The accepted IUPAC single letter or three letter amino acid abbreviation is employed.

[0073] Substitutions. For an amino acid substitution, the following nomenclature is used: Original amino acid, position, substituted amino acid. Accordingly, the substitution of threonine at position 226 with alanine is designated as Thr226Ala or T226A. Multiple mutations are separated by addition marks (+), e.g., Gly205Arg+Ser411Phe or G205R+S411F, representing substitutions at positions 205 and 411 of glycine (G) with arginine (R) and serine (S) with phenylalanine (F), respectively.

[0074] Deletions. For an amino acid deletion, the following nomenclature is used: Original amino acid, position, *. Accordingly, the deletion of glycine at position 195 is designated as Gly195* or G195*. Multiple deletions are separated by addition marks (+), e.g., Gly195*+Ser411* or G195*+S411*.

[0075] Insertions. For an amino acid insertion, the following nomenclature is used: Original amino acid, position, original amino acid, inserted amino acid. Accordingly the insertion of lysine after glycine at position 195 is designated Gly195GlyLys or G195GK. An insertion of multiple amino acids is designated [Original amino acid, position, original amino acid, inserted amino acid #1, inserted amino acid #2; etc.]. For example, the insertion of lysine and alanine after glycine at position 195 is indicated as Gly195GlyLysAla or G195GKA.

[0076] In such cases the inserted amino acid residue(s) are numbered by the addition of lower case letters to the position number of the amino acid residue preceding the inserted amino acid residue(s). In the above example, the sequence would thus be:

TABLE-US-00001 Parent: Variant: 195 195 195a 195b G G - K - A

[0077] Different alterations. Where different alterations can be introduced at a position, the different alterations are separated by a comma, e.g., Arg170Tyr,Glu or R170Y,E represents a substitution of arginine at position 170 with tyrosine or glutamic acid. Thus, Tyr167Gly,Ala+Arg170Gly,Ala designates the following variants: Tyr167Gly+Arg170Gly, Tyr167Gly+Arg170Ala, Tyr167Ala+Arg170Gly, and Tyr167Ala+Arg170Ala.

DETAILED DESCRIPTION OF THE INVENTION

[0078] The present invention relates to isolated laccase variants, comprising a substitution at one or more (e.g., several) positions corresponding to positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2, wherein the variants have laccase activity.

Variants

[0079] In an embodiment, the variants have a sequence identity of at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, to the full-length polypeptide of the parent or the mature polypeptide thereof.

[0080] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95, or the mature polypeptide thereof.

[0081] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 2 or the mature polypeptide thereof.

[0082] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 4 or the mature polypeptide thereof.

[0083] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 6 or the mature polypeptide thereof.

[0084] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 8 or the mature polypeptide thereof.

[0085] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 10 or the mature polypeptide thereof.

[0086] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 12 or the mature polypeptide thereof.

[0087] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 14 or the mature polypeptide thereof.

[0088] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 16 or the mature polypeptide thereof.

[0089] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 18 or the mature polypeptide thereof.

[0090] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 20 or the mature polypeptide thereof.

[0091] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 22 or the mature polypeptide thereof.

[0092] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 24 or the mature polypeptide thereof.

[0093] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 26 or the mature polypeptide thereof.

[0094] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 28 or the mature polypeptide thereof.

[0095] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 30 or the mature polypeptide thereof.

[0096] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 32 or the mature polypeptide thereof.

[0097] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 34 or the mature polypeptide thereof.

[0098] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 36 or the mature polypeptide thereof.

[0099] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 38 or the mature polypeptide thereof.

[0100] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 40 or the mature polypeptide thereof.

[0101] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 42 or the mature polypeptide thereof.

[0102] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 44 or the mature polypeptide thereof.

[0103] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 46 or the mature polypeptide thereof.

[0104] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 48 or the mature polypeptide thereof.

[0105] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 50 or the mature polypeptide thereof.

[0106] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 52 or the mature polypeptide thereof.

[0107] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 54 or the mature polypeptide thereof.

[0108] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 56 or the mature polypeptide thereof.

[0109] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 58 or the mature polypeptide thereof.

[0110] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 60 or the mature polypeptide thereof.

[0111] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 62 or the mature polypeptide thereof.

[0112] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 64 or the mature polypeptide thereof.

[0113] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 66 or the mature polypeptide thereof.

[0114] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 68 or the mature polypeptide thereof.

[0115] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 70 or the mature polypeptide thereof.

[0116] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 93 or the mature polypeptide thereof.

[0117] In another embodiment, the variants have at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to SEQ ID NO: 95 or the mature polypeptide thereof.

[0118] In one aspect, the number of substitutions in the variants of the present invention is 1-24, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 substitutions.

[0119] In another aspect, a variant comprises a substitution at one or more (e.g., several) positions corresponding to positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at two positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at three positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at four positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at five positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at six positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at seven positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at eight positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at nine positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at ten positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at eleven positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at twelve positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at thirteen positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at fourteen positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at fifteen positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at sixteen positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at seventeen positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at eighteen positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at nineteen positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at twenty positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at twenty-one positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at twenty-two positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at twenty-three positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2. In another aspect, a variant comprises a substitution at each position corresponding to positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2.

[0120] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 9. In another aspect, the amino acid at a position corresponding to position 9 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg. In another aspect, the variant comprises or consists of the substitution A9R of the full-length polypeptide of SEQ ID NO: 2.

[0121] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 21. In another aspect, the amino acid at a position corresponding to position 21 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Cys. In another aspect, the variant comprises or consists of the substitution A21C of the full-length polypeptide of SEQ ID NO: 2.

[0122] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 37. In another aspect, the amino acid at a position corresponding to position 37 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Cys. In another aspect, the variant comprises or consists of the substitution S37C of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0123] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 79. In another aspect, the amino acid at a position corresponding to position 79 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala, Asp, Glu, Phe, Gly, Ile, Met, Asn, Gln, Ser. In another aspect, the variant comprises or consists of the substitution L79A,D,E,F,G,I,M,N,Q,S of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0124] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 102. In another aspect, the amino acid at a position corresponding to position 102 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises or consists of the substitution F102A of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0125] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 170. In another aspect, the amino acid at a position corresponding to position 170 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala, Met, Gln, Ser, or Thr. In another aspect, the variant comprises or consists of the substitution V170A,M,Q,S,T of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0126] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 175. In another aspect, the amino acid at a position corresponding to position 175 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ser or Thr. In another aspect, the variant comprises or consists of the substitution V175S,T of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0127] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 178. In another aspect, the amino acid at a position corresponding to position 178 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ser. In another aspect, the variant comprises or consists of the substitution K178S of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0128] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 179. In another aspect, the amino acid at a position corresponding to position 179 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asn. In another aspect, the variant comprises or consists of the substitution L179N of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0129] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 200. In another aspect, the amino acid at a position corresponding to position 200 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp. In another aspect, the variant comprises or consists of the substitution S200D of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0130] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 262. In another aspect, the amino acid at a position corresponding to position 262 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gly. In another aspect, the variant comprises or consists of the substitution A262G of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0131] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 275. In another aspect, the amino acid at a position corresponding to position 275 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ile. In another aspect, the variant comprises or consists of the substitution V275I of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0132] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 276. In another aspect, the amino acid at a position corresponding to position 276 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gly. In another aspect, the variant comprises or consists of the substitution D276G of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0133] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 289. In another aspect, the amino acid at a position corresponding to position 289 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ile, Lys, Gln, Arg, or Thr. In another aspect, the variant comprises or consists of the substitution V289I,K,Q,R,T of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0134] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 292. In another aspect, the amino acid at a position corresponding to position 292 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp, Phe, Gly, His, or Lys. In another aspect, the variant comprises or consists of the substitution T292D,F,G,H,K of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0135] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 333. In another aspect, the amino acid at a position corresponding to position 333 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ser, Glu, Lys, or Arg. In another aspect, the variant comprises or consists of the substitution A333S,E,K,R of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0136] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 357. In another aspect, the amino acid at a position corresponding to position 357 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp, Ala, Glu, Phe, Gly, Met, Gln, Ser, Thr, Val, or Tyr. In another aspect, the variant comprises or consists of the substitution N357D,A,E,F,G,M,Q,S,T,V,Y of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0137] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 360. In another aspect, the amino acid at a position corresponding to position 360 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Val, Ala, His, or Met. In another aspect, the variant comprises or consists of the substitution I360V,A,H,M of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0138] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 393. In another aspect, the amino acid at a position corresponding to position 393 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ile. In another aspect, the variant comprises or consists of the substitution Y393I of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0139] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 397. In another aspect, the amino acid at a position corresponding to position 397 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises or consists of the substitution S397A of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0140] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 418. In another aspect, the amino acid at a position corresponding to position 418 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ile, Val, Leu, or Met. In another aspect, the variant comprises or consists of the substitution F418I,V,L,M of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0141] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 485. In another aspect, the amino acid at a position corresponding to position 485 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ser. In another aspect, the variant comprises or consists of the substitution A485S of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0142] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 506. In another aspect, the amino acid at a position corresponding to position 506 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with His. In another aspect, the variant comprises or consists of the substitution S506H of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0143] In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 518. In another aspect, the amino acid at a position corresponding to position 518 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,

[0144] Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises or consists of the substitution S518A of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0145] In each of the aspects above, the variant comprises or consists of one or more substitutions described above at positions corresponding to the full-length polypeptide of SEQ ID NO: 2 in other laccases as parents.

[0146] In each of the aspects below, the variant comprises or consists of one or more substitutions described below at positions corresponding to the full-length polypeptide of SEQ ID NO: 2 in other laccases or at positions of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0147] In another aspect, the variant comprises or consists of one or more (e.g., several) substitutions selected from the group consisting of A9R; A21C; S37C; L79A,D,E,F,G,I,M,N,Q,S; F102A; V170A,M,Q,S,T; V175S,T; K178S; L179N; S200D; A262G; V275I; D276G; V289I,K,Q,R,T; T292D,F,G,H,K; A333S,E,K,R; N357D,A,E,F,G,M,Q,S,T,V,Y; I360V,A,H,M; Y393I; S397A; F418I,V,L,M; A485S; S506H; and S518A.

[0148] In another aspect, the variant comprises or consists of the substitutions A262G+I360V of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof. In another aspect, the variant comprises or consists of the substitutions F418I+S506H of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof. In another aspect, the variant comprises or consists of the substitutions A9R+L79D+L179N of the full-length polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises or consists of the substitutions A21C+K178S+F418V+S518A of the full-length polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises or consists of the substitutions A262G+V289I+T292D+N357D of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof. In another aspect, the variant comprises or consists of the substitutions S37C+A262G+Y393I+A485S of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof. In another aspect, the variant comprises or consists of the substitutions F102A+V175S+A262G+I360V+S397A of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof. In another aspect, the variant comprises or consists of the substitutions V175T+S200D+A262G+I360V+Y393I of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof. In another aspect, the variant comprises or consists of the substitutions F102A+V175T+S200D+A262G+N357D+S397A of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof. In another aspect, the variant comprises or consists of the substitutions V175T+S200D+A262G+D276G+I360V+Y393I+F418I+S506H of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof. In another aspect, the variant comprises or consists of the substitutions V175T+S200D+A262G+V275I+D276G+A333S+I360V+Y393I+F418I+S506H of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0149] In another aspect, the variant comprises or consists of the substitutions S37C+L79D+F102A+V175S,T+K178S+L179N+S200D+A262G+V275I+D276G+V289I+T292D+A333S+N357D+I360V+Y393I+S397A+F418I,V+A485S+S506H+ and S518A of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0150] In another aspect, the variant comprises or consists of the substitutions F418I+5506H of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof. In another aspect, the variant comprises or consists of the substitutions A9R+L79D+L179N of the full-length polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises or consists of the substitutions A21C+K178S+F418V+S518A of the full-length polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises or consists of the substitutions S37C+A262G+Y393I+A485S of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof. In another aspect, the variant comprises or consists of the substitutions A262G+V289I+T292D+N357D of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof. In another aspect, the variant comprises or consists of the substitutions F102A+V175S+A262G+I360V+S397A of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof. In another aspect, the variant comprises or consists of the substitutions V175T+S200D+A262G+I360V+Y393I of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof. In another aspect, the variant comprises or consists of the substitutions F102A+V175T+S200D+A262G+N357D+S397A of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof. In another aspect, the variant comprises or consists of the substitutions V175T+S200D+A262G+D276G+I360V+Y393I+F418I+S506H of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof. In another aspect, the variant comprises or consists of the substitutions V175T+S200D+A262G+V275I+D276G+A333S+I360V+Y393I+F418I+S506H of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0151] The variants may further comprise one or more additional alterations, e.g., substitutions, insertions, and/or deletions at one or more (e.g., several) other positions.

[0152] The amino acid changes may be of a minor nature, that is conservative amino acid substitutions or insertions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of 1-30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to 20-25 residues; or a small extension that facilitates purification by changing net charge or another function, such as a poly-histidine tract, an antigenic epitope or a binding domain.

[0153] Examples of conservative substitutions are within the groups of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions that do not generally alter specific activity are known in the art and are described, for example, by H. Neurath and R. L. Hill, 1979, In, The Proteins, Academic Press, New York. Common substitutions are Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, and Asp/Gly.

[0154] Alternatively, the amino acid changes are of such a nature that the physico-chemical properties of the polypeptides are altered. For example, amino acid changes may improve the thermal stability of the polypeptide, alter the substrate specificity, change the pH optimum, and the like.

[0155] For example, the variants may further comprise substitutions at one or more (e.g., several) positions corresponding to positions 89, 151, 286, 307, 313, 339, and 355 of SEQ ID NO: 2, which are described in WO 2012/138474.

[0156] In one aspect, the variant further comprises a substitution at a position corresponding to position 89. In another aspect, the amino acid at a position corresponding to position 89 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala, Val, Leu, or Ile. In another aspect, the variant further comprises the substitution F89A,V,L,I of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0157] In another aspect, the variant further comprises a substitution at a position corresponding to position 151. In another aspect, the amino acid at a position corresponding to position 151 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp, Glu, Arg, or Lys. In another aspect, the variant further comprises the substitution N151D,E,R,K of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0158] In another aspect, the variant further comprises a substitution at a position corresponding to position 286. In another aspect, the amino acid at a position corresponding to position 286 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg, His, or Val. In another aspect, the variant further comprises the substitution F286R,H,V of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0159] In another aspect, the variant further comprises a substitution at a position corresponding to position 307. In another aspect, the amino acid at a position corresponding to position 307 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Pro, His, or Gly. In another aspect, the variant further comprises the substitution A307P,H,G of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0160] In another aspect, the variant further comprises a substitution at a position corresponding to position 313. In another aspect, the amino acid at a position corresponding to position 313 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asn, Thr, or Ser. In another aspect, the variant further comprises the substitution T313N,T,S of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0161] In another aspect, the variant further comprises a substitution at a position corresponding to position 339. In another aspect, the amino acid at a position corresponding to position 339 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Trp, Thr, or Ser. In another aspect, the variant further comprises the substitution V339W,T,S of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0162] In another aspect, the variant further comprises a substitution at a position corresponding to position 355. In another aspect, the amino acid at a position corresponding to position 355 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg. In another aspect, the variant further comprises the substitution G355R of the full-length polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof.

[0163] In each of the aspects above, the variant further comprises one or more substitutions described above at positions corresponding to the full-length polypeptide of SEQ ID NO: 2 in other laccases as parents.

[0164] In another aspect, the variant further comprises one or more (e.g., several) substitutions selected from the group consisting of F89A,V,L,I; N151D,E,R,K; F286R,H,V; A307P,H,G; T313N,T,S; V339W,T,S; and G355R.

[0165] The variants may further comprise or even further comprise substitutions at one or more (e.g., several) positions as described in WO 98/27197, WO 98/27198, WO 98/27198, WO 98/38286, WO 01/83761, and WO 2013/038062, which are incorporated herein by reference in their entireties.

[0166] Essential amino acids in a polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for laccase activity to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., 1996, J. Biol. Chem. 271: 4699-4708. The active site of the enzyme or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver et al., 1992, FEBS Lett. 309: 59-64. The identity of essential amino acids can also be inferred from an alignment with a related polypeptide. Essential copper binding site amino acids (active site) are located at positions corresponding to positions H85, H87, H130, H132, H416, H419, H421, H473, C474, H475, I476, H479, and F484 of SEQ ID NO: 2.

[0167] In an embodiment, the variant has one or more improved properties selected from the group consisting of increased expression yield, increased specific activity, and increased dye bleaching activity compared to the parent enzyme.

[0168] In an embodiment, the expression yield of the variant is increased at least 1.05-fold, at least 1.10-fold, at least 1.20-fold, at least 1.30-fold, at least 1.40-fold, at least 1.50-fold, at least 1.60-fold, at least 1.70-fold, at least 1.80-fold, at least 1.90-fold, at least 2-fold, at least 2.25-fold, at least 2.50-fold, at least 2.75-fold, at least 3.00-fold, at least 3.25-fold, at least 3.50-fold, at least 3.75-fold, at least 4-fold, at least 4.25-fold, at least 4.50-fold, at least 4.75-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 35-fold, or at least 40-fold compared to the expression yield of the parent.

[0169] In another embodiment, the specific activity of the variant is increased at least 1.05-fold, at least 1.10-fold, at least 1.20-fold, at least 1.30-fold, at least 1.40-fold, at least 1.50-fold, at least 1.60-fold, at least 1.70-fold, at least 1.80-fold, at least 1.90-fold, at least 2-fold, at least 2.25-fold, at least 2.50-fold, at least 2.75-fold, at least 3.00-fold, at least 3.25-fold, at least 3.50-fold, at least 3.75-fold, at least 4-fold, at least 4.25-fold, at least 4.50-fold, at least 4.75-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, or at least 20-fold compared to the specific activity of the parent.

[0170] In another embodiment, the dye bleaching activity of the variant is increased at least 1.05-fold, at least 1.10-fold, at least 1.20-fold, at least 1.30-fold, at least 1.40-fold, at least 1.50-fold, at least 1.60-fold, at least 1.70-fold, at least 1.80-fold, at least 1.90-fold, at least 2-fold, at least 2.25-fold, at least 2.50-fold, at least 2.75-fold, at least 3.00-fold, at least 3.25-fold, at least 3.50-fold, at least 3.75-fold, at least 4-fold, at least 4.25-fold, at least 4.50-fold, at least 4.75-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, or at least 20-fold compared to the dye bleaching activity of the parent.

[0171] In another embodiment, a combination of mutations increasing expression yield and specific activity increases the volumetric activity of the laccase at least 1.05-fold, at least 1.10-fold, at least 1.20-fold, at least 1.30-fold, at least 1.40-fold, at least 1.50-fold, at least 1.60-fold, at least 1.70-fold, at least 1.80-fold, at least 1.90-fold, at least 2-fold, at least 2.25-fold, at least 2.50-fold, at least 2.75-fold, at least 3.00-fold, at least 3.25-fold, at least 3.50-fold, at least 3.75-fold, at least 4-fold, at least 4.25-fold, at least 4.50-fold, at least 4.75-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 35-fold, or at least 40-fold compared to the parent.

Parent Laccases

[0172] The parent laccase can be any laccase. The parent laccase may be (a) a polypeptide having at least 60% sequence identity to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95; or the mature polypeptide thereof; (b) a polypeptide encoded by a polynucleotide that hybridizes under at least low stringency conditions with (i) SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 92, or 94, or the mature polypeptide coding sequence thereof, or (ii) the full-length complement of (i); (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 92, or 94; or the mature polypeptide coding sequence thereof; and (d) a fragment of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95, or the mature polypeptide thereof, which has laccase activity.

[0173] In one embodiment, the parent has a sequence identity to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95, or the mature polypeptide thereof, of at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%, which have laccase activity. In one aspect, the amino acid sequence of the parent differs by up to 10 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, from SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95, or the mature polypeptide thereof.

[0174] In another embodiment, the parent comprises or consists of the amino acid sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95. In another aspect, the parent comprises or consists of the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95.

[0175] In another embodiment, the parent is a fragment of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95, or the mature polypeptide thereof, containing at least 85%, e.g., at least 90% and at least 95% of the amino acid residues of the parent.

[0176] In another embodiment, the parent is an allelic variant of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95, or the mature polypeptide thereof.

[0177] In another embodiment, the parent is encoded by a polynucleotide that hybridizes under very low stringency conditions, low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions, or very high stringency conditions with (i) SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 92, or 94, or the mature polypeptide coding sequence thereof; or (ii) the full-length complement of (i) (Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, N.Y.).

[0178] The polynucleotide of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 92, or 94, or a subsequence thereof, as well as the polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95, or a fragment thereof (e.g., mature polypeptide), may be used to design nucleic acid probes to identify and clone DNA encoding a parent from strains of different genera or species according to methods well known in the art. In particular, such probes can be used for hybridization with the genomic DNA or cDNA of a cell of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein. Such probes can be considerably shorter than the entire sequence, but should be at least 15, e.g., at least 25, at least 35, or at least 70 nucleotides in length. Preferably, the nucleic acid probe is at least 100 nucleotides in length, e.g., at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, or at least 900 nucleotides in length. Both DNA and RNA probes can be used. The probes are typically labeled for detecting the corresponding gene (for example, with .sup.32P, .sup.3H, .sup.35S, biotin, or avidin). Such probes are encompassed by the present invention.

[0179] A genomic DNA or cDNA library prepared from such other strains may be screened for DNA that hybridizes with the probes described above and encodes a parent. Genomic or other DNA from such other strains may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier material. In order to identify a clone or DNA that hybridizes with SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 92, or 94 or a subsequence thereof, the carrier material is used in a Southern blot.

[0180] For purposes of the present invention, hybridization indicates that the polynucleotide hybridizes to a labeled nucleic acid probe corresponding to (i) SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 92, or 94; or the mature polypeptide coding sequence thereof; (ii) the full-length complement of (i); or (iii) a subsequence thereof; under very low to very high stringency conditions. Molecules to which the nucleic acid probe hybridizes under these conditions can be detected using, for example, X-ray film or any other detection means known in the art.

[0181] In one aspect, the nucleic acid probe is the mature polypeptide coding sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 92, or 94. In another aspect, the nucleic acid probe is a polynucleotide that encodes the polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95; the mature polypeptide thereof; or a fragment thereof. In another aspect, the nucleic acid probe is SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 92, or 94.

[0182] In another embodiment, the parent is encoded by a polynucleotide having a sequence identity to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 92, or 94, or the mature polypeptide coding sequence thereof, of at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%.

[0183] The parent may be a hybrid polypeptide (chimera) in which a region of the parent is replaced with a region of another polypeptide.

[0184] The parent may be a fusion polypeptide or cleavable fusion polypeptide in which another polypeptide is fused at the N-terminus or the C-terminus of the parent. A fusion polypeptide is produced by fusing a polynucleotide encoding another polypeptide to a polynucleotide of the present invention. Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences encoding the polypeptides so that they are in frame and that expression of the fusion polypeptide is under control of the same promoter(s) and terminator. Fusion polypeptides may also be constructed using intein technology in which fusion polypeptides are created post-translationally (Cooper et al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994, Science 266: 776-779).

[0185] A fusion polypeptide can further comprise a cleavage site between the two polypeptides. Upon secretion of the fusion protein, the site is cleaved releasing the two polypeptides. Examples of cleavage sites include, but are not limited to, the sites disclosed in Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3: 568-576; Svetina et al., 2000, J. Biotechnol. 76: 245-251; Rasmussen-Wilson et al., 1997, Appl. Environ. Microbiol. 63: 3488-3493; Ward et al., 1995, Biotechnology 13: 498-503; and Contreras et al., 1991, Biotechnology 9: 378-381; Eaton et al., 1986, Biochemistry 25: 505-512; Collins-Racie et al., 1995, Biotechnology 13: 982-987; Carter et al., 1989, Proteins: Structure, Function, and Genetics 6: 240-248; and Stevens, 2003, Drug Discovery World 4: 35-48.

[0186] The parent may be obtained from microorganisms of any genus. For purposes of the present invention, the term obtained from as used herein in connection with a given source shall mean that the parent encoded by a polynucleotide is produced by the source or by a strain in which the polynucleotide from the source has been inserted. In one aspect, the parent is secreted extracellularly.

[0187] In one aspect, the parent is an Agaricus laccase. In another aspect, the parent is an Agaricus bisporus laccase.

[0188] In another aspect, the parent is a Ceriporiopsis laccase. In another aspect, the parent is a Ceriporiopsis subvermispora laccase.

[0189] In another aspect, the parent is a Cerrena laccase. In another aspect, the parent is a Cerrena unicolor laccase.

[0190] In another aspect, the parent is a Cinnabarina laccase. In another aspect, the parent is a Cinnabarina coccineus laccase.

[0191] In another aspect, the parent is a Coprinellus laccase. In another aspect, the parent is a Coprinellus congregatus laccase.

[0192] In another aspect, the parent is a Coprinopsis laccase. In another aspect, the parent is a Coprinopsis cinerea laccase.

[0193] In another aspect, the parent is a Coprinus laccase. In another aspect, the parent is a Coprinus comatus laccase.

[0194] In another aspect, the parent is a Coriolopsis laccase. In another aspect, the parent is a Coriolopsis gallica laccase. In another aspect, the parent is a Coriolopsis rigida laccase. In another aspect, the parent is a Coriolopsis trogii laccase.

[0195] In another aspect, the parent is a Cyathus laccase. In another aspect, the parent is a Cyathus bulleri laccase. In another aspect, the parent is a Flammulina laccase. In another aspect, the parent is a Flammulina velutipes laccase.

[0196] In another aspect, the parent is a Ganoderma laccase. In another aspect, the parent is a Ganoderma lucidum laccase. In another aspect, the parent is a Ganoderma tsugae laccase. In another aspect, the parent is a Ganoderma tsunodae laccase.

[0197] In another aspect, the parent is a Halocyphina laccase. In another aspect, the parent is a Halocyphina villosa laccase.

[0198] In another aspect, the parent is a Laccaria laccase. In another aspect, the parent is a Laccaria bicolor laccase.

[0199] In another aspect, the parent is a Lentinula laccase. In another aspect, the parent is a Lentinula edodes laccase.

[0200] In another aspect, the parent is a Lentinus laccase. In another aspect, the parent is a Lentinus sajor-caju laccase. In another aspect, the parent is a Lentinus similis laccase. In another aspect, the parent is a Lentinus tigrinus laccase.

[0201] In another aspect, the parent is a Lenzites laccase. In another aspect, the parent is a Lenzites gibbosa laccase.

[0202] In another aspect, the parent is a Meripilus laccase. In another aspect, the parent is a Meripilus giganteus laccase.

[0203] In another aspect, the parent is a Myceliophthora laccase. In another aspect, the parent is a Myceliophthora thermophila laccase.

[0204] In another aspect, the parent is a Moniliophthora laccase. In another aspect, the parent is a Moniliophthora perniciosa laccase.

[0205] In another aspect, the parent is a Panus laccase. In another aspect, the parent is a Panus rudis laccase.

[0206] In another aspect, the parent is a Phlebia laccase. In another aspect, the parent is a Phlebia radiata laccase. In another aspect, the parent is a Phlebia tremellosa laccase.

[0207] In another aspect, the parent is a Pholiota nameko laccase. In another aspect, the parent is a Pholiota nameko laccase.

[0208] In another aspect, the parent is a Pleurotus laccase. In another aspect, the parent is a Pleurotus ertngii laccase. In another aspect, the parent is a Pleurotus ostreatus laccase. In another aspect, the parent is a Pleurotus pulmonarius laccase. In another aspect, the parent is a Pleurotus salmoneostramineus laccase. In another aspect, the parent is a Pleurotus sapidus laccase.

[0209] In another aspect, the parent is a Polyporus laccase. In another aspect, the parent is a Polyporus brumalis laccase. In another aspect, the parent is a Polyporus ciliates laccase. In another aspect, the parent is a Polyporus grammocephalus laccase. In another aspect, the parent is a Polyporus pinsitus laccase.

[0210] In another aspect, the parent is a Postia laccase. In another aspect, the parent is a Postia placenta laccase.

[0211] In another aspect, the parent is a Pycnoporus laccase. In another aspect, the parent is a Pycnoporus coccineus laccase. In another aspect, the parent is a Pycnoporus cinnabarinus laccase.

[0212] In another aspect, the parent is a Rigidoporus laccase. In another aspect, the parent is a Rigidoporus microporus laccase.

[0213] In another aspect, the parent is a Schizophyllum laccase. In another aspect, the parent is a Schizophyllum commune laccase.

[0214] In another aspect, the parent is a Serpula laccase. In another aspect, the parent is a Serpula lacrymans laccase.

[0215] In another aspect, the parent is a Spongipellis laccase. In another aspect, the parent is a Spongipellis ochraceum laccase.

[0216] In another aspect, the parent is a Stropharia laccase. In another aspect, the parent is a Stropharia aeruginosa laccase.

[0217] In another aspect, the parent is a Thanatephorus laccase. In another aspect, the parent is a Thanatephorus cucumeris laccase.

[0218] In another aspect, the parent is a Trametes laccase. In another aspect, the parent is a Trametes cinnabarina laccase. In another aspect, the parent is a Trametes gibbosa laccase. In another aspect, the parent is a Trametes hirsuta laccase. In another aspect, the parent is a Trametes maxima laccase. In another aspect, the parent is a Trametes ochracea laccase. In another aspect, the parent is a Trametes pubescens laccase. In another aspect, the parent is a Trametes sanguinea laccase. In another aspect, the parent is a Trametes trogii laccase. In another aspect, the parent is a Trametes velutina laccase. In another aspect, the parent is a Trametes versicolor laccase. In another aspect, the parent is a Trametes villosa (Polyporus pinsitus) laccase. In another aspect, the parent is a Trametes sp. 420 laccase. In another aspect, the parent is a Trametes sp. 48424 laccase. In another aspect, the parent is a Trametes sp. AH28-2 laccase. In another aspect, the parent is a Trametes sp. C30 laccase. In another aspect, the parent is a Trametes sp. Ha1 laccase. In another aspect, the parent is a Trametes sp. I-62 laccase.

[0219] In another aspect, the parent is a Volvariella laccase. In another aspect, the parent is a Volvariella volvacea laccase.

[0220] In another aspect, the parent is a Yarrowia laccase. In another aspect, the parent is a Yarrowia lipolytica laccase.

[0221] In another aspect, the parent is a basidiomycete PM1 laccase.

[0222] Other parent laccases useful in the present invention are described in the Laccase and Multicopper Oxidase Engineering Database, which are incorporated herein by reference.

[0223] It will be understood that for the aforementioned species, the invention encompasses both the perfect and imperfect states, and other taxonomic equivalents, e.g., anamorphs, regardless of the species name by which they are known. Those skilled in the art will readily recognize the identity of appropriate equivalents.

[0224] Strains of these species are readily accessible to the public in a number of culture collections, such as the American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH (DSMZ), Centraalbureau Voor Schimmelcultures (CBS), and Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL).

[0225] The parent may be identified and obtained from other sources including microorganisms isolated from nature (e.g., soil, composts, water, etc.) or DNA samples obtained directly from natural materials (e.g., soil, composts, water, etc.) using the above-mentioned probes. Techniques for isolating microorganisms and DNA directly from natural habitats are well known in the art. A polynucleotide encoding a parent may then be obtained by similarly screening a genomic DNA or cDNA library of another microorganism or mixed DNA sample. Once a polynucleotide encoding a parent has been detected with the probe(s), the polynucleotide can be isolated or cloned by utilizing techniques that are known to those of ordinary skill in the art (see, e.g., Sambrook et al., 1989, supra).

Preparation of Variants

[0226] The present invention also relates to methods for obtaining a variant having laccase activity, comprising: (a) introducing into a parent laccase a substitution at one or more (e.g., several) positions corresponding to positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2, wherein the variant has laccase activity; and optionally (b) recovering the variant. In one embodiment, the methods further comprise introducing into a parent laccase a substitution at one or more (e.g., several) positions corresponding to positions 89, 151, 286, 307, 313, 339, and 355 of the full-length polypeptide of SEQ ID NO: 2, as described herein.

[0227] The variants can be prepared using any mutagenesis procedure known in the art, such as site-directed mutagenesis, synthetic gene construction, semi-synthetic gene construction, random mutagenesis, shuffling, etc.

[0228] Site-directed mutagenesis is a technique in which one or more (e.g., several) mutations are introduced at one or more defined sites in a polynucleotide encoding the parent. Any site-directed mutagenesis procedure can be used in the present invention. There are many commercial kits available that can be used to prepare variants.

[0229] Site-directed mutagenesis can be accomplished in vitro by PCR involving the use of oligonucleotide primers containing the desired mutation. Site-directed mutagenesis can also be performed in vitro by cassette mutagenesis involving the cleavage by a restriction enzyme at a site in the plasmid comprising a polynucleotide encoding the parent and subsequent ligation of an oligonucleotide containing the mutation in the polynucleotide. Usually the restriction enzyme that digests the plasmid and the oligonucleotide is the same, permitting sticky ends of the plasmid and the insert to ligate to one another. See, e.g., Scherer and Davis, 1979, Proc. Natl. Acad. Sci. USA 76: 4949-4955; and Barton et al., 1990, Nucleic Acids Res. 18: 7349-4966.

[0230] Site-directed mutagenesis can also be accomplished in vivo by methods known in the art. See, e.g., U.S. Patent Application Publication No. 2004/0171154; Storici et al., 2001, Nature Biotechnol. 19: 773-776; Kren et al., 1998, Nat. Med. 4: 285-290; and Calissano and Macino, 1996, Fungal Genet. Newslett. 43: 15-16.

[0231] Site-saturation mutagenesis systematically replaces a polypeptide coding sequence with sequences encoding all 19 amino acids at one or more (e.g., several) specific positions (Parikh and Matsumura, 2005, J. Mol. Biol. 352: 621-628).

[0232] Synthetic gene construction entails in vitro synthesis of a designed polynucleotide molecule to encode a polypeptide of interest. Gene synthesis can be performed utilizing a number of techniques, such as the multiplex microchip-based technology described by Tian et al. (2004, Nature 432: 1050-1054) and similar technologies wherein oligonucleotides are synthesized and assembled upon photo-programmable microfluidic chips.

[0233] Single or multiple amino acid substitutions, deletions, and/or insertions can be made and tested using known methods of mutagenesis, recombination, and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991, Biochemistry 30: 10832-10837; U.S. Pat. No. 5,223,409; WO 92/06204) and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145; Ner et al., 1988, DNA 7: 127).

[0234] Mutagenesis/shuffling methods can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides expressed by host cells (Ness et al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules that encode active polypeptides can be recovered from the host cells and rapidly sequenced using standard methods in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide.

[0235] Semi-synthetic gene construction is accomplished by combining aspects of synthetic gene construction, and/or site-directed mutagenesis, and/or random mutagenesis, and/or shuffling. Semi-synthetic construction is typified by a process utilizing polynucleotide fragments that are synthesized, in combination with PCR techniques. Defined regions of genes may thus be synthesized de novo, while other regions may be amplified using site-specific mutagenic primers, while yet other regions may be subjected to error-prone PCR or non-error prone PCR amplification. Polynucleotide subsequences may then be shuffled.

Polynucleotides

[0236] The present invention also relates to isolated polynucleotides encoding a variant of the present invention.

Nucleic Acid Constructs

[0237] The present invention also relates to nucleic acid constructs comprising a polynucleotide encoding a variant of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.

[0238] The polynucleotide may be manipulated in a variety of ways to provide for expression of a variant. Manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art.

[0239] The control sequence may be a promoter, a polynucleotide recognized by a host cell for expression of a polynucleotide encoding a variant of the present invention. The promoter contains transcriptional control sequences that mediate the expression of the variant. The promoter may be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.

[0240] Examples of suitable promoters for directing transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96/00787), Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Rhizomucor miehei lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase, and Trichoderma reesei translation elongation factor, as well as the NA2-tpi promoter (a modified promoter from an Aspergillus neutral alpha-amylase gene in which the untranslated leader has been replaced by an untranslated leader from an Aspergillus triose phosphate isomerase gene; non-limiting examples include modified promoters from an Aspergillus niger neutral alpha-amylase gene in which the untranslated leader has been replaced by an untranslated leader from an Aspergillus nidulans or Aspergillus oryzae triose phosphate isomerase gene); and mutant, truncated, and hybrid promoters thereof. Other promoters are described in U.S. Pat. No. 6,011,147.

[0241] In a yeast host, useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful promoters for yeast host cells are described by Romanos et al., 1992, Yeast 8: 423-488.

[0242] The control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription. The terminator is operably linked to the 3-terminus of the polynucleotide encoding the variant. Any terminator that is functional in the host cell may be used in the present invention.

[0243] Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, Fusarium oxysporum trypsin-like protease, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase, and Trichoderma reesei translation elongation factor.

[0244] Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.

[0245] The control sequence may also be a leader, a nontranslated region of an mRNA that is important for translation by the host cell. The leader is operably linked to the 5-terminus of the polynucleotide encoding the variant. Any leader that is functional in the host cell may be used.

[0246] Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.

[0247] Suitable leaders for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).

[0248] The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3-terminus of the polynucleotide and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used.

[0249] Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.

[0250] Useful polyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995, Mol. Cellular Biol. 15: 5983-5990.

[0251] The control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a variant and directs the variant into the cell's secretory pathway. The 5-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence that encodes the variant. Alternatively, the 5-end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence. A foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence. Alternatively, a foreign signal peptide coding sequence may simply replace the natural signal peptide coding sequence in order to enhance secretion of the variant. However, any signal peptide coding sequence that directs the expressed variant into the secretory pathway of a host cell may be used.

[0252] Effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes for Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.

[0253] Useful signal peptides for yeast host cells are obtained from the genes for Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding sequences are described by Romanos et al., 1992, supra.

[0254] The control sequence may also be a propeptide coding sequence that encodes a propeptide positioned at the N-terminus of a variant. The resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases). A propolypeptide is generally inactive and can be converted to an active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding sequence may be obtained from the genes for Myceliophthora thermophila laccase (WO 95/33836), Rhizomucor miehei aspartic proteinase, and Saccharomyces cerevisiae alpha-factor.

[0255] Where both signal peptide and propeptide sequences are present, the propeptide sequence is positioned next to the N-terminus of a variant and the signal peptide sequence is positioned next to the N-terminus of the propeptide sequence.

[0256] It may also be desirable to add regulatory sequences that regulate expression of the variant relative to the growth of the host cell. Examples of regulatory sequences are those that cause expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. In yeast, the ADH2 system or GAL1 system may be used. In filamentous fungi, the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter, and Trichoderma reesei cellobiohydrolase II promoter may be used. Other examples of regulatory sequences are those that allow for gene amplification. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate, and the metallothionein genes that are amplified with heavy metals. In these cases, the polynucleotide encoding the variant would be operably linked to the regulatory sequence.

Expression Vectors

[0257] The present invention also relates to recombinant expression vectors comprising a polynucleotide encoding a variant of the present invention, a promoter, and transcriptional and translational stop signals. The various nucleotide and control sequences may be joined together to produce a recombinant expression vector that may include one or more convenient restriction sites to allow for insertion or substitution of the polynucleotide encoding the variant at such sites. Alternatively, the polynucleotide may be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.

[0258] The recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can bring about expression of the polynucleotide. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be a linear or closed circular plasmid.

[0259] The vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one that, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell, or a transposon, may be used.

[0260] The vector preferably contains one or more selectable markers that permit easy selection of transformed, transfected, transduced, or the like cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.

[0261] Suitable markers for yeast host cells include, but are not limited to, ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. Selectable markers for use in a filamentous fungal host cell include, but are not limited to, adeA (phosphoribosylaminoimidazole-succinocarboxamide synthase), adeB (phosphoribosyl-aminoimidazole synthase), amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof. Preferred for use in an Aspergillus cell are Aspergillus nidulans or Aspergillus oryzae amdS and pyrG genes and a Streptomyces hygroscopicus bar gene. Preferred for use in a Trichoderma cell are adeA, adeB, amdS, hph, and pyrG genes.

[0262] The selectable marker may be a dual selectable marker system as described in WO 2010/039889. In one aspect, the dual selectable marker is a hph-tk dual selectable marker system.

[0263] The vector preferably contains an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.

[0264] For integration into the host cell genome, the vector may rely on the polynucleotide's sequence encoding the variant or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional polynucleotides for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrational elements should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high degree of sequence identity to the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding polynucleotides. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.

[0265] For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. The origin of replication may be any plasmid replicator mediating autonomous replication that functions in a cell. The term origin of replication or plasmid replicator means a polynucleotide that enables a plasmid or vector to replicate in vivo.

[0266] Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.

[0267] Examples of origins of replication useful in a filamentous fungal cell are AMA1 and ANS1 (Gems et al., 1991, Gene 98: 61-67; Cullen et al., 1987, Nucleic Acids Res. 15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene and construction of plasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.

[0268] More than one copy of a polynucleotide of the present invention may be inserted into a host cell to increase production of a variant. An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.

[0269] The procedures used to ligate the elements described above to construct the recombinant expression vectors are well known to one skilled in the art (see, e.g., Sambrook et al., 1989, supra).

Host Cells

[0270] The present invention also relates to recombinant host cells, comprising a polynucleotide encoding a variant of the present invention operably linked to one or more control sequences that direct the production of a variant of the present invention. A construct or vector comprising a polynucleotide is introduced into a host cell so that the construct or vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier. The term host cell encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the variant and its source.

[0271] The host cell may be any cell useful in the recombinant production of a variant of the present invention.

[0272] The host cell may be a eukaryote, such as a mammalian, insect, plant, or fungal cell.

[0273] The host cell may be a fungal cell. Fungi as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota as well as the Oomycota and all mitosporic fungi (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK).

[0274] The fungal host cell may be a yeast cell. Yeast as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, Passmore, and Davenport, editors, Soc. App. Bacteriol. Symposium Series No. 9, 1980).

[0275] The yeast host cell may be a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell such as a Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis, or Yarrowia lipolytica cell.

[0276] The fungal host cell may be a filamentous fungal cell. Filamentous fungi include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). The filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.

[0277] The filamentous fungal host cell may be an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.

[0278] For example, the filamentous fungal host cell may be an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Talaromyces emersonii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.

[0279] Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et al., 1984, Proc. Natl. Acad. Sci. USA 81: 1470-1474, and Christensen et al., 1988, Bio/Technology 6: 1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156, and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J. N. and Simon, M. I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp. 182-187, Academic Press, Inc., New York; Ito et al., 1983, J. Bacteriol. 153: 163; and Hinnen et al., 1978, Proc. Natl. Acad. Sci. USA 75: 1920.

Methods of Production

[0280] The present invention also relates to methods of producing a variant, comprising (a) cultivating a recombinant host cell of the present invention under conditions conducive for production of the variant; and optionally (b) recovering the variant.

[0281] The host cells are cultivated in a nutrient medium suitable for production of the variant using methods known in the art. For example, the cells may be cultivated by multi-well plates such as 24, 48, or 96 well plates, shake flask cultivation, or small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors in a suitable medium and under conditions allowing the variant to be expressed and/or isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the variant is secreted into the nutrient medium, the variant can be recovered directly from the medium. If the variant is not secreted, it can be recovered from cell lysates.

[0282] The variants may be detected using methods known in the art that are specific for laccases. These detection methods include, but are not limited to, use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the variant, as described herein.

[0283] The variant may be recovered using methods known in the art. For example, the variant may be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation. In one aspect, the whole fermentation broth comprising a variant of the present invention is recovered.

[0284] The variant may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, Janson and Ryden, editors, VCH Publishers, New York, 1989) to obtain substantially pure variants.

[0285] In an alternative aspect, the variant is not recovered, but rather a host cell of the present invention expressing the variant is used as a source of the variant.

Fermentation Broth Formulations or Cell Compositions

[0286] The present invention also relates to a fermentation broth formulation or a cell composition comprising a variant of the present invention. The fermentation broth product further comprises additional ingredients used in the fermentation process, such as, for example, cells (including, the host cells containing the gene encoding the variant which are used to produce the variant of interest), cell debris, biomass, fermentation media and/or fermentation products. In some embodiments, the composition is a cell-killed whole broths containing organic acid(s), killed cells and/or cell debris, and culture medium.

[0287] The term fermentation broth as used herein refers to a preparation produced by cellular fermentation that undergoes no or minimal recovery and/or purification. For example, fermentation broths are produced when microbial cultures are grown to saturation, incubated under carbon-limiting conditions to allow protein synthesis (e.g., expression of enzymes by host cells) and secretion into cell culture medium. The fermentation broth can contain unfractionated or fractionated contents of the fermentation materials derived at the end of the fermentation. Typically, the fermentation broth is unfractionated and comprises the spent culture medium and cell debris present after the microbial cells (e.g., filamentous fungal cells) are removed, e.g., by centrifugation. In some embodiments, the fermentation broth contains spent cell culture medium, extracellular enzymes, and viable and/or nonviable microbial cells.

[0288] In an embodiment, the fermentation broth formulation and cell composition comprise a first organic acid component comprising at least one 1-5 carbon organic acid and/or a salt thereof and a second organic acid component comprising at least one 6 or more carbon organic acid and/or a salt thereof. In a specific embodiment, the first organic acid component is acetic acid, formic acid, propionic acid, a salt thereof, or a mixture of two or more of the foregoing and the second organic acid component is benzoic acid, cyclohexanecarboxylic acid, 4-methylvaleric acid, phenylacetic acid, a salt thereof, or a mixture of two or more of the foregoing.

[0289] In one aspect, the composition contains an organic acid(s), and optionally further contains killed cells and/or cell debris. In one embodiment, the killed cells and/or cell debris are removed from a cell-killed whole broth to provide a composition that is free of these components.

[0290] The fermentation broth formulation or cell composition may further comprise a preservative and/or anti-microbial (e.g., bacteriostatic) agent, including, but not limited to, sorbitol, sodium chloride, potassium sorbate, and others known in the art.

[0291] The fermentation broth formulation or cell composition may further comprise multiple enzymatic activities, such as one or more (e.g., several) enzymes selected from the group consisting of a hydrolase, an isomerase, a ligase, a lyase, an oxidoreductase, and a transferase, e.g., an AA9 polypeptide, alpha-galactosidase, alpha-glucosidase, aminopeptidase, amylase, beta-galactosidase, beta-glucosidase, beta-xylosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, expansin, glucoamylase, invertase, laccase, ligninolytic enzyme, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, swollenin, transglutaminase, or xylanase.

[0292] The cell-killed whole broth or composition may contain the unfractionated contents of the fermentation materials derived at the end of the fermentation. Typically, the cell-killed whole broth or composition contains the spent culture medium and cell debris present after the microbial cells (e.g., filamentous fungal cells) are grown to saturation, incubated under carbon-limiting conditions to allow protein synthesis. In some embodiments, the cell-killed whole broth or composition contains the spent cell culture medium, extracellular enzymes, and killed cells. In some embodiments, the microbial cells present in the cell-killed whole broth or composition can be permeabilized and/or lysed using methods known in the art.

[0293] A whole broth or cell composition as described herein is typically a liquid, but may contain insoluble components, such as killed cells, cell debris, culture media components, and/or insoluble enzyme(s). In some embodiments, insoluble components may be removed to provide a clarified liquid composition.

[0294] The whole broth formulation and cell composition of the present invention may be produced by a method described in WO 90/15861 or WO 2010/096673.

Enzyme Compositions

[0295] The present invention also relates to a composition comprising a variant of the present invention. Preferably, the composition is enriched in such a variant. The term enriched indicates that the laccase activity of the composition has been increased, e.g., with an enrichment factor of at least 1.1.

[0296] The composition may comprise a variant of the present invention as the major enzymatic component, e.g., a mono-component composition. Alternatively, the composition may comprise multiple enzymatic activities, such as one or more (e.g., several) enzymes selected from the group consisting of a hydrolase, an isomerase, a ligase, a lyase, an oxidoreductase, and a transferase, e.g., an AA9 polypeptide, alpha-galactosidase, alpha-glucosidase, aminopeptidase, amylase, beta-galactosidase, beta-glucosidase, beta-xylosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, expansin, glucoamylase, invertase, laccase, ligninolytic enzyme, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, swollenin, transglutaminase, or xylanase.

[0297] The composition may be prepared in accordance with methods known in the art and may be in the form of a liquid or a dry composition. The composition may be stabilized in accordance with methods known in the art.

[0298] Examples are given below of preferred uses of the composition of the present invention. The dosage of the composition and other conditions under which the composition is used may be determined on the basis of methods known in the art.

Uses

[0299] The variants of the present invention can be used in various industrial applications, including, but not limited to, cellulose conversion (WO 2013/087027), lignin modification (WO 1995/033836 and WO 1996/000290), paper strengthening, dye transfer inhibition in detergents, phenol polymerization, hair dyeing, bleaching of textiles (in particular bleaching of denim as described in WO 1996/12845 and WO 1996/12846), textile dyeing (WO 2001/044563, WO 2000/031333, WO 1997/023684, WO 1997/023685), fabric abrasion (WO 1997/025468), waste water treatment, and detoxification of pretreated cellulosic material (WO 2008/134259), which are incorporated herein in their entireties. Any detergent composition normally used for enzymes may be used, e.g., the detergent compositions disclosed in WO 95/01426, which is incorporated herein in its entirety.

[0300] In one aspect, the present invention relates to a method of decolorizing a dye, comprising treating the dye with a laccase variant of the present invention. In an embodiment, the dye can be any dye that is a substrate for a laccase. For example the dye may be indigo carmine or Reactive Black 5.

[0301] The present invention is further described by the following examples that should not be construed as limiting the scope of the invention.

EXAMPLES

Media and Solutions

[0302] Cellulase Inducing Medium (CIM) was composed of 20 g of cellulose, 10 g of corn steep solids, 1.45 g of (NH.sub.4).sub.2SO.sub.4, 2.08 g of KH.sub.2PO.sub.4, 0.28 g of CaCl.sub.2, 0.42 g of MgSO.sub.4.7H.sub.2O, 0.42 ml of Trichoderma trace metals solution, 1-2 drops of antifoam, and deionized water to 1 liter; pH adjusted to 6.0.

[0303] COVE plates were composed of 342.3 g of sucrose, 20 ml of COVE salt solution, 10 ml of 1 M acetamide, 10 ml of 1.5 M CsCl, 25 g of Noble agar (Difco), and deionized water to 1 liter.

[0304] COVE2+10 mM Uridine plates were composed of 30 g of sucrose, 20 ml of COVE salt solution, 10 ml of 1 M acetamide, 10 ml of 1 M uridine, 25 g of Noble agar (Difco), and deionized water to 1 liter.

[0305] COVE-N-JP top agarose was composed of 342.3 g of sucrose, 3 g of NaNO.sub.3, 0.52 g of KCl, 0.52 g of MgSO.sub.4.7H.sub.20, 6 g of NaNO.sub.3, 1.52 g of KH.sub.2PO.sub.4, 0.04 mg of Na.sub.2B.sub.4O.sub.7.10H.sub.2O, 0.4 mg of CuSO.sub.4.5H.sub.2O, 1.2 mg of FeSO.sub.4.7H.sub.2O, 0.7 mg of MnSO.sub.4.2H.sub.2O, 0.8 mg of Na.sub.2MoO.sub.4.2H.sub.2O, 10 mg of ZnSO.sub.4.7H.sub.2O, 15 g of low melt agarose, and deionized water to 1 liter.

[0306] COVE-N-gly agar plates were composed of 218 g of sorbitol, 10 g of glycerol, 2.02 g of KNO.sub.3, 1.3 g of KCl, 1.3 g of MgSO.sub.4.7H.sub.20, 6 g of NaNO.sub.3, 3.8 g of KH.sub.2PO.sub.4, 0.1 mg of Na.sub.2B.sub.4O.sub.7.10H.sub.2O, 1 mg of CuSO.sub.4.5H.sub.2O, 3 mg of FeSO.sub.4.7H.sub.2O, 1.75 mg of MnSO.sub.4.2H.sub.2O, 2 mg of Na.sub.2MoO.sub.4.2H.sub.2O, 25 mg of ZnSO.sub.4.7H.sub.2O, 25 g of Noble agar, and deionized water to 1 liter.

[0307] COVE salt solution was composed of 26 g of KCl, 26 g of MgSO.sub.4.7H.sub.2O, 76 g of KH.sub.2PO.sub.4, 50 ml of COVE trace metals solution, and deionized water to 1 liter.

[0308] COVE trace metals solution was composed of 0.04 g of NaB.sub.4O.sub.7.10H.sub.2O, 0.4 g of CuSO.sub.4.5H.sub.2O, 1.2 g of FeSO.sub.4.7H.sub.2O, 0.7 g of MnSO.sub.4.H.sub.2O, 0.8 g of Na.sub.2MoO.sub.2.2H.sub.2O, 10 g of ZnSO.sub.4.7H.sub.2O, and deionized water to 1 liter.

[0309] LB plates were composed of 10 g of tryptone, 5 g of yeast extract, 5 g of NaCl, 15 g of bacteriological agar, and deionized water to 1 liter.

[0310] LB medium was composed of 10 g of tryptone, 5 g of yeast extract, 5 g of NaCl, and deionized water to 1 liter.

[0311] M410 medium was composed of 50 g of maltose, 50 g of glucose, 2 g of MgSO.sub.4.7H.sub.20, 2 g of KH.sub.2PO.sub.4, 4 g of citric acid anhydrous powder, 8 g of yeast extract, 2 g of urea, 0.5 g of CaCl.sub.2, 17 mg of MnSO.sub.4.H.sub.20, 0.1 mg of NiCl.sub.2.6H.sub.2O, 5 mg of CuSO.sub.4.5H.sub.2O, 27.6 mg of FeSO.sub.4.7H.sub.2O, 28.6 mg of ZnSO.sub.4.7H.sub.2O, and deionized water to 1 liter; the medium was pH-adjusted to 6.0 with 10-20 ml of 10 N NaOH. The final solution was filter-sterilized through a 0.22 ?m membrane.

[0312] Minimal medium agar plates were composed of 342.3 g of sucrose, 10 g of glucose, 4 g of MgSO.sub.4.7H.sub.20, 6 g of NaNO.sub.3, 0.52 g of KCl, 1.52 g of KH.sub.2PO.sub.4, 0.04 mg of Na.sub.2B.sub.4O.sub.7.10H.sub.2O, 0.4 mg of CuSO.sub.4.5H.sub.2O, 1.2 mg of FeSO.sub.4.7H.sub.2O, 0.7 mg of MnSO.sub.4.2H.sub.2O, 0.8 mg of Na.sub.2MoO.sub.4.2H.sub.2O, 10 mg of ZnSO.sub.4.7H.sub.2O, 500 mg of citric acid, 4 mg of d-biotin, 20 g of Noble agar, and deionized water to 1 liter.

[0313] PEG buffer was composed of 500 g of polyethylene glycol 4000 (PEG 4000), 10 mM CaCl.sub.2, 10 mM Tris-HCl pH 7.5, and deionized water to 1 liter; filter sterilized.

[0314] STC was composed of 1 M sorbitol, 10 mM CaCl.sub.2, and 10 mM Tris-HCl, pH 7.5; filter sterilized.

[0315] Synthetic Defined medium lacking uridine was composed of 18 mg of adenine hemisulfate, 76 mg of alanine, 76 mg of arginine hydrochloride, 76 mg of asparagine monohydrate, 76 mg of aspartic acid, 76 mg of cysteine hydrochloride monohydrate, 76 mg of glutamic acid monosodium salt, 76 mg of glutamine, 76 mg of glycine, 76 mg of histidine, 76 mg of myo-inositol, 76 mg of isoleucine, 380 mg of leucine, 76 mg of lysine monohydrochloride, 76 mg of methionine, 8 mg of p-aminobenzoic acid potassium salt, 76 mg of phenylalanine, 76 mg of proline, 76 mg of serine, 76 mg of threonine, 76 mg of tryptophan, 76 mg of tyrosine disodium salt, 76 mg of valine, and deionized water to 1 liter.

[0316] TAE buffer was composed of 4.84 g of Tris Base, 1.14 ml of Glacial acetic acid, 2 ml of 0.5 M EDTA pH 8.0, and deionized water to 1 liter.

[0317] TBE buffer was composed of 10.8 g of Tris Base, 5.5 g boric acid, 4 ml of 0.5 M EDTA pH 8.0, and deionized water to 1 liter.

[0318] Trichoderma trace metals solution was composed of 216 g of FeCl.sub.3.6H.sub.2O, 58 g of ZnSO.sub.4.7H.sub.2O, 27 g of MnSO.sub.4.H.sub.2O, 10 g of CuSO.sub.4.5H.sub.2O, 2.4 g of H.sub.3BO.sub.3, 336 g of citric acid, and deionized water to 1 liter.

[0319] YP medium was composed of 10 g of yeast extract, 20 g of Bacto peptone, and deionized water to 1 liter.

[0320] 2? YT+ampicillin plates were composed of 16 g of tryptone, 10 g of yeast extract, 5 g of sodium chloride, 15 g of Bacto agar, and deionized water to 1 liter. One ml of a 100 mg/ml solution of ampicillin was added after the autoclaved medium was tempered to 55? C.

TABLE-US-00002 TABLE1 PrimersusedintheExamplesbelow. SEQ Identifier IDNo. Sequence(5-3) 1204672 71 TCCTCTATATACACAACTGGGGATCC ACCATGTCGAGGTTTCACTCTCTTCT CGCTTTC 1204673 72 TCTAGATCTCGAGCTCGCTAGAGTCG ACCTACTGGTCGCTCGGGTCGAG 1204564 73 CATGGTGGATCCCCAGTTGTGTATAT AGAGG 614604 74 TAGGTCGACTCTAGCGAGCTCGAGAT C 999551 75 ACATGTCTTTGATAAgCTAGcGGGCC GCATCATGTA 999552 76 TACATGATGCGGCCCgCTAGcTTATC AAAGACATGT 613017 77 ttaatcgccttgcagcacaCCGCTTC CTCGCTCACTGACTC 613018 78 acaataaccctgataaatgcGGAACA ACACTCAACCCTATCTCGGTC 613019 79 agatagggttgagtgttgttccGCAT TTATCAGGGTTATTGTCTCATGAGCG G 613020 80 ttctacacgaaggaaagagGAGGAGA GAGTTGAACCTGGACG 613022 81 aggttcaactctctcctcCTCTTTCC TTCGTGTAGAAGACCAGACAG 613021 82 tcagtgagcgaggaagcggTGTGCTG CAAGGCGATTAAGTTGG 1209071 83 TCAACCGCGGACTGCGCACCATGTCG AGGTTTCACTCTCT 1209072 84 GGCTTTCGCCACGGAGCTTACTACTG GTCGCTCGGGTCGA 1206637 85 CTGGCCGTAGAGCTTAAAGTATGTCC C 1206638 86 CGGTCGATTACAATCACATGACTTGG CTTC 1217524 88 TCCTCTATATACACAACTGGGGATCC ACCATGTCGAGGTTCCAGTCTCTTTT CTTCTTCG 1217525 89 TCTAGATCTCGAGCTCGCTAGAGTCG ACCTAGAGGTCGCTCGGGTCGAGCGC G 1217528 90 TCCTCTATATACACAACTGGGGATCC ACCATGAGGTCCTTCATCAGCGCCGC GAC 1217529 91 TCTAGATCTCGAGCTCGCTAGAGTCG ACCTACGCCTTGACCAGCCACTCGCC C

Example 1

ABTS Agar Halo Screen for Laccase Activity in Primary Transformants

[0321] Primary transformants were screened for the production of laccase activity on Minimal medium agar plates overlayed with COVE-N-JP top agarose containing 1 mM 2,2-azinobis-(3-ethybenzthiazoline-6-sulfonic acid) (ABTS). Transformants producing green halos on the ABTS plates were picked to COVE-N-gly agar plates before further analysis.

Example 2

ABTS Liquid Assay for Laccase Activity

[0322] The assay was performed using a Beckman Coulter Biomek 3000 (Beckman Coulter, Inc.). Culture supernatants were diluted appropriately in 0.1 M sodium acetate, 0.01% TRITON? X-100 pH 5.0 buffer (sample buffer) followed with a series dilution from 0-fold to ?-fold to 1/9-fold of the diluted sample. A laccase standard was diluted using 2-fold steps starting with a 0.06 LAMU/ml concentration and ending with a 0.0075 LAMU/ml concentration in the sample buffer. A total of 20 ?l of each dilution including the laccase standard was transferred to a 96-well flat bottom plate. Two hundred micro-liters of an ABTS (2,2-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid)) substrate solution (0.1 M sodium acetate pH 5.0+0.275 mg/ml ABTS+0.01% TRITON? X-100) were added to each well and then incubated at ambient temperature for 30 minutes. During the incubation the rate of the reaction was measured at an optical density of 405 nm in a SPECTRAMAX? M5 spectrophotometer (Molecular Devices). Sample concentrations were determined by extrapolation from the generated standard curve.

Example 3

Syringaldazine Liquid Assay for Laccase Activity

[0323] The assay was performed using a Beckman Coulter Biomek 3000. Culture supernatants were diluted appropriately in 0.1 M sodium acetate, 0.01% TRITON? X-100 pH 5.0 buffer (sample buffer) followed by a series of dilutions from 0-fold to ?-fold to 1/9-fold of the diluted sample. A laccase standard was diluted using 2-fold steps starting with a 1.16 LAMU/ml concentration and ending with a 0.145 LAMU/ml concentration in the sample buffer. A total of 20 ?l of each dilution including the laccase standard was transferred to a 96-well flat bottom plate. Two hundred microliters of a 0.22 mM syringaldazine substrate solution (0.56 mM syringaldazine in 96% ethanol (Stock) diluted to 0.22 mM in sample buffer) was added to each well and then incubated at ambient temperature for 6 minutes. During the incubation the rate of the reaction was measured at an optical density of 540 nm in a SPECTRAMAX? M5 spectrophotometer. Sample concentrations were determined by extrapolation from the generated standard curve.

Example 4

HOBT-Indigo Carmine Liquid Assay for Laccase Activity

[0324] An additional laccase activity assay is employed to monitor the dye-bleaching (indigo carmine) activity of laccase variants relative to the parent laccase through oxidation by molecular oxygen, catalyzed by laccase in the presence of a mediator (hydroxybenzotriazole). For each reaction, 12 ?l of hydroxybenzotriazole (HOBT) mediator solution (Sigma-Aldrich) (37.5 mM in 10% DMSO) were combined with 12 ?l of indigo carmine solution (Sigma-Aldrich) (1.0 g/ml in water), 60 ?l of 100 mM sodium acetate pH 5.0, 1 mM CuSO.sub.4, and 60 ?l of water, and dispensed into 96 well plates. Reactions were initiated by the addition of 10 ?l of liquid culture broth to each well, and the plates were sealed with a PCR plate seal and incubated at 60? C. for 30 minutes. Dye-bleaching was assessed by measuring the absorbance at 610 nm in a SPECTRAMAX? M5 spectrophotometer.

Example 5

Construction of Plasmid pMMar27 as a Yeast Expression Vector

[0325] Plasmid pMMar27 was constructed for expression of the Thielavia terrestris Cel6A cellobiohydrolase II in yeast. The plasmid was generated from a lineage of yeast expression vectors: plasmid pMMar27 was constructed from plasmid pBM175b; plasmid pBM175b was constructed from plasmid pBM143b (WO 2008/008950) and plasmid pJLin201; and plasmid pJLin201 was constructed from pBM143b.

[0326] Plasmid pJLin201 is identical to pBM143b except an Xba I site immediately downstream of a Thermomyces lanuginosus lipase variant gene in pBM143b was mutated to a unique Nhe I site. A QUIKCHANGE? II XL Site-Directed Mutagenesis Kit (Stratagene) was used to change the Xba I sequence (TCTAGA) to a Nhe I sequence (gCTAGc) in pBM143b. The PCR was composed of 125 ng of primers 999551 and 999552, 20 ng of pBM143b, 1? QUIKCHANGE? Reaction Buffer (Stratagene), 3 ?l of QUIKSOLUTION? (Stratagene), 1 ?l of dNTP mix, and 1 ?l of a 2.5 units/ml Pfu Ultra HF DNA polymerase (Stratagene) in a final volume of 50 ?l. The PCR was performed using an EPPENDORF? MASTERCYCLER? thermocycler (Eppendorf AG) programmed for 1 cycle at 95? C. for 1 minute; 18 cycles each at 95? C. for 50 seconds, 60? C. for 50 seconds, and 68? C. for 6 minutes and 6 seconds; and 1 cycle at 68? C. for 7 minutes. After the PCR, the tube was placed on ice for 2 minutes. One microliter of Dpn I (Promega) was then directly added to the reaction mixture and incubated at 37? C. for 1 hour. A 2 ?l volume of the Dpn I digested reaction was used to transform E. coli XL10 GOLD? Ultracompetent Cells (Stratagene) according to the manufacturer's instructions. E. coli transformants were selected on 2? YT plus ampicillin plates. Plasmid DNA was isolated from several of the transformants using a BIOROBOT? 9600 (QIAGEN Inc.). One plasmid with the desired Nhe I change was confirmed by restriction digestion and sequencing analysis using a 3130XL Genetic Analyzer (Applied Biosystems) and designated plasmid pJLin201. To eliminate possible PCR errors introduced by site-directed-mutagenesis, plasmid pBM175b was constructed by cloning the Nhe I site containing fragment back into plasmid pBM143b. Briefly, plasmid pJLin201 was digested with Nde I and Mlu I and the resulting fragment was cloned into pBM143b, previously digested with the same enzymes, using a Rapid Ligation Kit (Roche Diagnostics Corp.). Briefly, 7 ?l of the Nde I/Mlu I digested pJLin201 fragment and 1 ?l of the digested pBM143b were mixed with 2 ?l of 5? DNA dilution buffer (Roche Diagnostics Corp.), 10 ?l of 2? T4 DNA Ligation buffer (Roche Diagnostics Corp.), and 1 ?l of T4 DNA ligase (Roche Diagnostics Corp.) and incubated for 15 minutes at room temperature. Two microliters of the ligation were transformed into XL1-Blue Subcloning-Grade Competent Cells (Stratagene) cells and spread onto 2? YT plus ampicillin plates. Plasmid DNA was purified from several transformants using a BIOROBOT? 9600 and analyzed by DNA sequencing using a 3130XL Genetic Analyzer to identify a plasmid containing the desired A. nidulans pyrG insert. One plasmid with the expected DNA sequence was designated pBM175b.

[0327] Plasmid pMMar27 was constructed from pBM175b and an amplified gene of the T. terrestris Cel6A cellobiohydrolase ll with overhangs designed for insertion into digested pBM175b. Plasmid pBM175b containing the Thermomyces lanuginosus lipase variant gene under control of the CUP I promoter contains unique Hind III and Nhe I sites to remove the lipase gene. Plasmid pBM175b was digested with these restriction enzymes to remove the lipase gene. After digestion, the empty vector was isolated by 1.0% agarose gel electrophoresis using TBE buffer where an approximately 5,215 bp fragment was excised from the gel and extracted using a QIAQUICK? Gel Extraction Kit (QIAGEN Inc.). The ligation reaction (20 ?l) was composed of 1? IN-FUSION? Buffer (BD Biosciences), 1? BSA (BD Biosciences), 1 ?l of IN-FUSION? enzyme (diluted 1:10) (BD Biosciences), 99 ng of pBM175b digested with Hind III and Nhe I, and 36 ng of the purified T. terrestris Cel6A cellobiohydrolase II PCR product. The reaction was incubated at room temperature for 30 minutes. A 2 ?l volume of the IN-FUSION? reaction was transformed into E. coli XL10-GOLD? Ultracompetent Cells (Stratagene). Transformants were selected on LB plates supplemented with 100 ?g of ampicillin per ml. A colony was picked that contained the T. terrestris Cel6A inserted into the pBM175b vector in place of the lipase gene, resulting in pMMar27 (FIG. 1). The plasmid chosen contained a PCR error at position 228 from the start codon, TCT instead of TCC, but resulted in a silent change in the T. terrestris Cel6A cellobiohydrolase II.

Example 6

Construction of pEvFz1 Expression Vector

[0328] Expression vector pEvFz1 was constructed by modifying pBM120a (U.S. Pat. No. 8,263,824) to comprise the NA2/NA2-tpi promoter, Aspergillus niger amyloglucosidase terminator sequence (AMG terminator), and Aspergillus nidulans orotidine-5-phosphate decarboxylase gene (pyrG) as a selectable marker.

[0329] Plasmid pEvFz1 was generated by cloning the A. nidulans pyrG gene from pAlLo2 (WO 2004/099228) into pBM120a. Plasmids pBM120a and pAlLo2 were digested with Nsi I overnight at 37? C. The resulting 4176 bp linearized pBM120a vector fragment and the 1479 bp pyrG gene insert from pAlLo2 were each purified by 0.7% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK? Gel Extraction Kit.

[0330] The 1479 bp pyrG gene insert was ligated to the Nsi I digested pBM120a fragment using a QUICK LIGATION? Kit (New England Biolabs). The ligation reaction was composed of 1? QUICK LIGATION? Reaction Buffer (New England Biolabs), 50 ng of Nsi I digested pBM120a vector, 54 ng of the 1479 bp Nsi I digested pyrG gene insert, and 1 ?l of T4 DNA ligase in a total volume of 20 ?l. The ligation mixture was incubated at 37? C. for 15 minutes followed at 50? C. for 15 minutes and then placed on ice.

[0331] One ?l of the ligation mixture was transformed into ONE SHOT? TOP10 chemically competent Escherichia coli cells (Invitrogen). Transformants were selected on 2? YT plus ampicillin plates. Plasmid DNA was purified from several transformants using a BIOROBOT? 9600 and analyzed by DNA sequencing using a 3130XL Genetic Analyzer to identify a plasmid containing the desired A. nidulans pyrG insert. One plasmid with the expected DNA sequence was designated pEvFz1 (FIG. 2).

Example 7

Construction of the Plasmid pDLHD0006 as a Yeast/E. coli/A. oryzae Shuttle Vector

[0332] Plasmid pDLHD0006 was constructed as a base vector to enable Aspergillus oryzae expression cassette library building using yeast recombinational cloning. Plasmid pDLHD0006 was constructed by combining three DNA fragments using yeast recombinational cloning: Fragment 1 containing the E. coli pUC origin of replication, E. coli beta-lactamase (ampR) selectable marker, URA3 yeast selectable marker, and yeast 2 micron origin of replication from pMMar27 (Example 5); Fragment 2 containing the NA2-tpi promoter (a hybrid of the promoters from the genes encoding Aspergillus niger neutral alpha-amylase and Aspergillus oryzae triose phosphate isomerase, Thermomyces lanuginosus lipase open reading frame (ORF), and Aspergillus niger glucoamylase terminator from pJaL1262 (WO 2013/178674); and Fragment 3 containing the Aspergillus nidulans pyrG selection marker from pEvFz1 (Example 5).

TABLE-US-00003 TABLE II pDLHD0006 PCR Contents PCR Template Fragment 1 E. coli ori/AmpR/URA/2 micron (4.1 kb) pMMar27 Fragment 2 NA2-tpi PR/lipase/Tamg (4.5 kb) pJaL1262 Fragment 3 pyrG gene from pEvFz1 (1.7 kb) pEvFz1

[0333] Fragment 1 was amplified using primers 613017 (sense) and 613018 (antisense) shown below. Primer 613017 was designed to contain a flanking region with sequence homology to Fragment 3 (lower case) and primer 613018 was designed to contain a flanking region with sequence homology to Fragment 2 (lower case) to enable yeast recombinational cloning between the three PCR fragments.

[0334] Fragment 1 was amplified by PCR in a reaction composed of 10 ng of plasmid pMMar27, 0.5 ?l of PHUSION? DNA Polymerase (New England Biolabs, Inc.), 20 pmol of primer 613017, 20 pmol of primer 613018, 1 ?l of 10 mM dNTPs, 10 ?l of 5? PHUSION? HF buffer (New England Biolabs, Inc.), and 35.5 ?l of water. The reaction was incubated in an EPPENDORF? MASTERCYCLER? thermocycler programmed for 1 cycle at 98? C. for 30 seconds; and 30 cycles each at 98? C. for 10 seconds, 60? C. for 10 seconds, and 72? C. for 1.5 minutes. The resulting 4.1 kb PCR product (Fragment 1) was used directly for yeast recombination with Fragments 2 and 3 below.

[0335] Fragment 2 was amplified using primers 613019 (sense) and 613020 (antisense). Primer 613019 was designed to contain a flanking region of sequence homology to Fragment 1 (lower case) and primer 613020 was designed to contain a flanking region of sequence homology to Fragment 3 (lower case) to enable yeast recombinational cloning between the three PCR fragments.

[0336] Fragment 2 was amplified by PCR in a reaction composed of 10 ng of plasmid pJaL1262, 0.5 ?l of PHUSION? DNA Polymerase, 20 pmol of primer 613019, 20 pmol of primer 613020, 1 ?l of 10 mM dNTPs, 10 ?l of 5? PHUSION? HF buffer, and 35.5 ?l of water. The reaction was incubated in an EPPENDORF? MASTERCYCLER? thermocycler programmed for 1 cycle at 98? C. for 30 seconds; 30 cycles each at 98? C. for 10 seconds, 60? C. for 10 seconds, and 72? C. for 2 minutes; and a 20? C. hold. The resulting 4.5 kb PCR product (Fragment 2) was used directly for yeast recombination with Fragment 1 above and Fragment 3 below.

[0337] Fragment 3 was amplified using primers 613022 (sense) and 613021 (antisense). Primer 613021 was designed to contain a flanking region of sequence homology to Fragment 2 (lower case) and primer 613022 was designed to contain a flanking region of sequence homology to Fragment 1 (lower case) to enable yeast recombinational cloning between the three PCR fragments.

[0338] Fragment 3 was amplified by PCR in a reaction composed of 10 ng of plasmid pEvFz1 (Example 5), 0.5 ?l of PHUSION? DNA Polymerase, 20 pmol of primer 613021, 20 pmol of primer 613022, 1 ?l of 10 mM dNTPs, 10 ?l of 5? PHUSION? HF buffer, and 35.5 ?l of water. The reaction was incubated in an EPPENDORF? MASTERCYCLER? thermocycler programmed for 1 cycle at 98? C. for 30 seconds; 30 cycles each at 98? C. for 10 seconds, 60? C. for 10 seconds, and 72? C. for 2 minutes; and a 20? C. hold. The resulting 1.7 kb PCR product (Fragment 3) was used directly for yeast recombination with Fragments 1 and 2 above.

[0339] The following procedure was used to combine the three PCR fragments using yeast homology-based recombinational cloning. A 20 ?l aliquot of each of the three PCR fragments was combined with 100 ?g of single-stranded deoxyribonucleic acid from salmon testes (Sigma-Aldrich), 100 ?l of competent yeast cells of strain YNG318 (Saccharomyces cerevisiae ATCC 208973), and 600 ?l of PLATE Buffer (Sigma-Aldrich), and mixed. The reaction was incubated at 30? C. for 30 minutes with shaking at 200 rpm. The reaction was then continued at 42? C. for 15 minutes with no shaking. The cells were pelleted by centrifugation at 5,000?g for 1 minute and the supernatant was discarded. The cell pellet was suspended in 200 ?l of autoclaved water and split over two agar plates containing Synthetic Defined medium lacking uridine and incubated at 30? C. for three days. The yeast colonies were isolated from the plate using 1 ml of autoclaved water. The cells were pelleted by centrifugation at 13,000?g for 30 seconds and a 100 ?l aliquot of glass beads were added to the tube. The cell and bead mixture was suspended in 250 ?l of P1 buffer (QIAGEN Inc.) and then vortexed for 1 minute to lyse the cells. The plasmid DNA was purified using a QIAPREP? Spin Miniprep Kit (QIAGEN Inc.). A 3 ?l aliquot of the plasmid DNA was then transformed into E. coli ONE SHOT? TOP10 electrocompetent cells (Invitrogen) according the manufacturer's instructions. Fifty ?l of transformed cells were spread onto LB plates supplemented with 100 ?g of ampicillin per ml and incubated at 37? C. overnight. Transformants were each picked into 3 ml of LB medium supplemented with 100 ?g of ampicillin per ml and grown overnight at 37? C. with shaking at 250 rpm. The plasmid DNA was purified from colonies using a QIAPREP? Spin Miniprep Kit. DNA sequencing with a 3130XL Genetic Analyzer confirmed the presence of each of the three fragments in a final plasmid designated pDLHD0006 (FIG. 3).

Example 8

Cloning of the Wild-Type Trametes villosa Laccase for Expression in an Aspergillus oryzae Screening Strain

[0340] The wild-type Trametes villosa laccase cDNA (SEQ ID NO; 1 for the cDNA sequence and SEQ ID NO: 2 for the deduced amino acid sequence) was cloned into a Saccharomyces cerevisiae/A. oryzae Flp/FRT shuttle vector by yeast recombinational cloning, resulting in vector pDLHD0140 (FIG. 4).

[0341] Expression vector pDLHD0140 was constructed to contain the E. coli pUC origin of replication, E. coli beta-lactamase (ampR) selectable marker, URA3 yeast selectable marker, yeast 2 micron origin of replication, NA2-tpi promoter, T. villosa laccase open reading frame, Aspergillus niger glucoamylase terminator, Aspergillus nidulans pyrG selection marker, Saccharomyces cerevisiae 2 ?m flippase ORF between the Aspergillus oryzae TEF1 promoter and Aspergillus oryzae NiaD terminator, and Saccharomyces cerevisiae 2 ?m flippase recognition targets FRT-F and FRT-F3.

[0342] Plasmid pDLHD0140 was constructed by combining two DNA fragments using yeast recombinational cloning: Fragment 1 contained the E. coli pUC origin of replication, E. coli beta-lactamase (ampR) selectable marker, URA3 yeast selectable marker, yeast 2 micron origin of replication, NA2-tpi promoter, Aspergillus niger glucoamylase terminator, Aspergillus nidulans pyrG selection marker, Saccharomyces cerevisiae 2 ?m flippase ORF between the Aspergillus oryzae TEF1 promoter and Aspergillus oryzae NiaD terminator, and Saccharomyces cerevisiae 2 ?m flippase recognition targets FRT-F and FRT-F3, and flanking sequences with homology to fragment 2. Fragment 2 contained the T. villosa laccase open reading frame, and flanking sequences with homology to fragment 1.

[0343] Fragment 1 was amplified using primer 614604 (sense) and primer 1204564 (antisense). These primers were designed to contain flanking regions of sequence homology to fragment 2 for ligation-free cloning between the PCR fragments. Fragment 1 was amplified by PCR in a reaction composed of 10 ng of pDAu571 (FIG. 5; SEQ ID NO: 87), 0.5 ?l of PHUSION? DNA Polymerase, 20 pmol of primer 614604, 20 pmol of primer 1204564, 1 ?l of 10 mM dNTPs, 10 ?l of 5? PHUSION? HF buffer, and 35.5 ?l of water. The reaction was incubated in an EPPENDORF? MASTERCYCLER? thermocycler programmed for 1 cycle at 98? C. for 30 seconds; and 30 cycles each at 98? C. for 10 seconds, 60? C. for 10 seconds, and 72? C. for 120 seconds. The resulting 9.7 kb PCR product (fragment 1) was treated with 1 ?l of Dpn I to remove plasmid template DNA. The Dpn I was added directly to the PCR tube, mixed well, and incubated at 37? C. for 60 minutes.

[0344] Fragment 2 was amplified using primer 1204672 (sense) and primer 1204673 (antisense). These primers were designed to contain flanking regions of sequence homology to fragment 1 for ligation-free cloning between the PCR fragments. Fragment 2 was amplified by PCR in a reaction composed of 10 ng of pADI006 (FIG. 6), 0.5 ?l of PHUSION? DNA Polymerase, 20 pmol of primer 1204672, 20 pmol of primer 1204673, 1 ?l of 10 mM dNTPs, 10 ?l of 5? PHUSION? HF buffer, and 35.5 ?l of water. The reaction was incubated in an EPPENDORF? MASTERCYCLER? thermocycler programmed for 1 cycle at 98? C. for 30 seconds; and 30 cycles each at 98? C. for 10 seconds, 60? C. for 10 seconds, and 72? C. for 120 seconds. The resulting 1.6 kb PCR product (fragment 2) was treated with 1 ?l of Dpn I to remove plasmid template DNA. The Dpn I was added directly to the PCR tube, mixed well, and incubated at 37? C. for 60 minutes.

[0345] The following procedure was used to combine the two PCR fragments using yeast homology-based recombinational cloning. A 10 ?l aliquot of each of the PCR fragments was combined with 100 ?g of single-stranded deoxyribonucleic acid from salmon testes (Sigma-Aldrich), 100 ?l of competent yeast cells of Saccharomyces cerevisiae strain YNG318 (ATCC 208973), and 600 ?l of PLATE Buffer (Sigma-Aldrich), and mixed. The reaction was incubated at 30? C. for 30 minutes with shaking at 200 rpm. The reaction was then continued at 42? C. for 15 minutes with no shaking. The cells were pelleted by centrifugation at 5,000?g for 1 minute and the supernatant was discarded. The cell pellet was suspended in 200 ?l of autoclaved water and split over two agar plates containing Synthetic Defined medium lacking uridine and incubated at 30? C. for three days. The yeast colonies were isolated from the plate using 1 ml of autoclaved water. The cells were pelleted by centrifugation at 13,000?g for 30 seconds and a 100 ?l aliquot of glass beads were added to the tube. The cell and bead mixture was suspended in 250 ?l of P1 buffer (QIAGEN Inc.) and then vortexed for 1 minute to lyse the cells. The plasmid DNA was purified using a QIAPREP? Spin Miniprep Kit. A 3 ?l aliquot of the plasmid DNA was then transformed into E. coli ONE SHOT? TOP10 electrocompetent cells according the manufacturer's instructions. Fifty ?l of transformed cells were spread onto 2? YT plates supplemented with 100 ?g of ampicillin per ml and incubated at 37? C. overnight. Transformants were each picked into 3 ml of LB medium supplemented with 100 ?g of ampicillin per ml and grown overnight at 37? C. with shaking at 250 rpm. The plasmid DNA was purified using a QIAPREP? Spin Miniprep Kit. DNA sequencing with a 3130XL Genetic Analyzer confirmed the presence of both of the three fragments in a final plasmid designated plasmid pDLHD0140 (FIG. 4).

Example 9

Confirmation of Wild-Type Trametes villosa Laccase Expression in Single-Copy in Aspergillus oryzae Screening Strain JaL1394

[0346] Aspergillus oryzae strain JaL1394 (WO 2012/160093) utilizing the Saccharomyces cerevisiae 2 ?m plasmid flippase recognition target (FRT) and recombinase (Flp) system to generate a high efficiency single-copy, targeted transformation system was used for screening gene variant libraries. The Flp-FRT system of Saccharomyces cerevisiae is a site-specific recombination system which can be used to insert a DNA of interest into a known location in the genome of a host organism of interest. The Aspergillus oryzae strain JaL1394 had been previously engineered to possess FRT-F and FRT-F3 flippase recognition target sequences in the amyB locus, where the AmyB ORF had been deleted.

[0347] Aspergillus oryzae JaL1394 was transformed with plasmid pDLHD0140 comprising the wild-type T. villosa laccase gene. Approximately 10.sup.7 spores from A. oryzae JaL1394 were inoculated into 100 ml of YP+2% glucose medium supplemented with 10 mM uridine in a 500 ml shake flask and incubated at 28? C. and 110 rpm overnight. Ten ml of the overnight culture were filtered in a 125 ml sterile vacuum filter, and the mycelia were washed twice with 50 ml of 0.7 M KCl-20 mM CaCl.sub.2. The remaining liquid was removed by vacuum filtration, leaving the mat on the filter. The mycelia were resuspended in 10 ml of 0.7 M KCl-20 mM CaCl.sub.2 and transferred to a sterile 125 ml shake flask containing 20 mg of GLUCANEX? 200 G (Novozymes Switzerland AG) per ml and 0.2 mg of chitinase (Sigma-Aldrich) per ml in 10 ml of 0.7 M KCl-20 mM CaCl.sub.2. The mixture was incubated at 37? C. and 100 rpm for 30-90 minutes until protoplasts were generated from the mycelia. The protoplast mixture was filtered through a sterile funnel lined with MIRACLOTH? (Calbiochem) into a sterile 50 ml plastic centrifuge tube to remove mycelial debris. The debris on the MIRACLOTH? was washed thoroughly with 10 ml of 0.7 M KCl-20 mM CaCl.sub.2, and centrifuged at 2500 rpm for 10 minutes at 20-23? C. The supernatant was removed and the protoplast pellet was resuspended in 20 ml of 1 M sorbitol-10 mM CaCl.sub.2-10 mM Tris-HCl (pH 6.5). This step was repeated twice, and the final protoplast pellet was resuspended in 1 M sorbitol-10 mM CaCl.sub.2-10 mM Tris-HCI (pH 6.5) to obtain a final protoplast concentration of 2?10.sup.7/ml.

[0348] Protoplasts were transformed by the addition of two pg of pDLHD0140 to the bottom of a sterile 50 ml plastic centrifuge tube. One hundred ?l of protoplasts were added to the tube followed by 300 ?l of 60% PEG-4000 in 10 mM CaCl.sub.2-10 mM Tris-HCl (pH 6.5). The tube was mixed gently by hand and incubated at 37? C. for 30 minutes. Thirty ml of COVE-N-JP top agarose containing 1 mM ABTS were added to the transformation and the mixture was transferred onto two 150 mm Minimal medium agar plates. Transformation plates were incubated at 34? C. until transformants appeared and green ABTS color was observed around each colony. The conversion of ABTS to a visible green color demonstrated that the transformants produced active T. villosa laccase.

[0349] Single transformants were picked to new COVE-N-gly agar plates and cultivated at 34? C. for four days until the transformants sporulated. Fresh spores were transferred to 48-well deep-well plates containing 2 ml of M410 medium containing 0.25 mM CuSO.sub.4, covered with a breathable seal, and grown for 4 days at 34? C. with no shaking. After 4 days growth the culture medium for each transformant was assayed for laccase activity according to Examples 2, 3, and 4, and for laccase expression by SDS-PAGE.

[0350] SDS-PAGE was performed using a 8-16% CRITERION? Stain Free SDS-PAGE gel (Bio-Rad Laboratories, Inc.), and imaging the gel with a Stain Free Imager (Bio-Rad Laboratories, Inc.) using the following settings: 5-minute activation, automatic imaging exposure (intense bands), highlight saturated pixels=ON, color=Coomassie, and band detection, molecular weight analysis and reporting disabled. SDS-PAGE revealed a protein band migrating at approximately 70 kDa for the wild-type T. villosa laccase.

Example 10

Construction and Identification of Increased Expression and Increased Specific Activity Variants of Trametes villosa Laccase

[0351] Trametes villosa laccase gene mutant libraries were constructed by site-saturation mutagenesis of the gene encoding the wild-type laccase as parent. The mutant libraries of the T. villosa laccase gene (each fragment of the library comprises a mutant T. villosa laccase gene plus Aspergillus nidulans orotidine 5-phosphate decarboxylase pyrG selection marker and the FRT-F and FRT-F3 flippase recognition target sequences) were transformed into protoplasts of Aspergillus oryzae JaL1394 as described in Example 9 along with one ?g of vector pDLHD0095 encoding the Saccharomyces cerevisiae 2 ?m flippase ORF between the Aspergillus oryzae TEF1 promoter and Aspergillus oryzae niaD gene terminator. After 4 days of protoplast recovery at 34? C. on Minimal medium agar plates overlayed with COVE-N-JP top agarose containing 1 mM ABTS, single colonies with green halos were picked into individual wells of 48-well deep-well plates containing 2 ml of M410 medium containing 0.25 mM CuSO.sub.4, covered with a breathable seal, and grown for 4 days at 34? C. with no shaking. After 4 days growth the liquid culture medium was assayed for laccase activity as described in Examples 2, 3, and 4, and higher activity variants were scored as expression hits.

[0352] Individual mutant strains were spore-purified and cultivated again in 125 ml shake flasks in 25 ml of M410 medium containing 0.25 mM CuSO.sub.4 for 4 days at 34? C. with shaking at 250 rpm to generate fresh broth for retesting for laccase activity as described in Examples 2, 3, and 4 relative to A. oryzae JaL1394 strain expressing the parent T. villosa laccase gene. Broths were also analyzed by SDS-PAGE as described in Example 9 for increased expression yield of the T. villosa laccase protein product.

[0353] Relative improvements in expression yield over the parent laccase in day 4 broths from 48-well deep-well plate and shake flask cultivations for all single site variants at positions L79, F102, V170, V175, S200, A262, V289, T292, Y302, N357, I360, Y393, S397, A485, and D507, are shown in Table III below, and combinatorial variants A262G+I360V, A262G+V289I+T292D+N357D; S37C+A262G+Y939I+A485S; V175T+S200D+A262G+I360V+Y393I; F102A+V175S+A262G+I360V+S397A; F102A+V175T+S200D+A262G+N357D+S397A; and A9R+L79D+L179N are shown in Table IV below. SDS-PAGE analysis of the same broths demonstrated a T. villosa laccase band of increased intensity over the parent T. villosa laccase for all variants, which correlated well with the relative improvements observed in the activity assays. The SDS-PAGE band for the parent T. villosa laccase and variants thereof was 70 kDa, with no obvious changes due to differential glycosylation.

TABLE-US-00004 TABLE III ABTS Trametes villosa laccase variant Assay Parent (Wild-Type) 1.0 L79A 1.3 L79C <1 L79D 1.3 L79E 2.1 L79F 1.3 L79G 1.6 L79H <1 L79I 1.4 L79K <1 L79M 1.2 L79N 1.2 L79P <1 L79Q 1.2 L79R <1 L79S 1.6 L79T <1 L79V <1 L79W 1.2 L79Y 1.2 F102A <1 F102C <1 F102D <1 F102E <1 F102G <1 F102H <1 F102I <1 F102K <1 F102L <1 F102M <1 F102N <1 F102P <1 F102Q <1 F102R <1 F102S <1 F102T <1 F102V <1 F102W <1 F102Y <1 V170A 1.5 V170C <1 V170D <1 V170E <1 V170F <1 V170G <1 V170H <1 V170I <1 V170K <1 V170L <1 V170M 1.4 V170N <1 V170P <1 V170Q 1.6 V170R <1 V170S 1.7 V170T 1.8 V170W <1 V170Y <1 V175A <1 V175C <1 V175D <1 V175E <1 V175F <1 V175G <1 V175H <1 V175I <1 V175K <1 V175L <1 V175M <1 V175N <1 V175P <1 V175Q <1 V175R <1 V175S <1 V175T <1 V175W <1 V175Y <1 S200A <1 S200C <1 S200D <1 S200E <1 S200F <1 S200G <1 S200H <1 S200I <1 S200K <1 S200L <1 S200M <1 S200N <1 S200P <1 S200Q <1 S200R <1 S200T <1 S200V <1 S200W <1 S200Y <1 A262C <1 A262D <1 A262E <1 A262F <1 A262G 3.8 A262H <1 A262I <1 A262K <1 A262L <1 A262M <1 A262N <1 A262P <1 A262Q <1 A262R <1 A262S <1 A262T <1 A262V <1 A262W <1 A262Y <1 V289A <1 V289C <1 V289D <1 V289E <1 V289F <1 V289G <1 V289H <1 V289I <1 V289K 1.9 V289L <1 V289M <1 V289N <1 V289P <1 V289Q 1.3 V289R 1.8 V289S <1 V289T 2.0 V289W <1 V289Y <1 T292A <1 T292C <1 T292D 9.0 T292E <1 T292F 7.1 T292G 8.3 T292H 7.3 T292I <1 T292K 9.0 T292L <1 T292M <1 T292N <1 T292P <1 T292Q <1 T292R <1 T292S <1 T292V <1 T292W <1 T292Y <1 Y302A <1 Y302C <1 Y302D <1 Y302E <1 Y302F <1 Y302G <1 Y302H <1 Y302I <1 Y302K <1 Y302L <1 Y302M <1 Y302N <1 Y302P <1 Y302Q <1 Y302R <1 Y302S <1 Y302T <1 Y302V <1 Y302W <1 N357A 1.2 N357C <1 N357D 2.6 N357E 1.9 N357F 1.2 N357G 2.1 N357H <1 N357I <1 N357K <1 N357L <1 N357M 1.6 N357P <1 N357Q 1.6 N357R <1 N357S 1.5 N357T 1.4 N357V 1.4 N357W <1 N357Y 1.4 I360A 3.6 I360C <1 I360D <1 I360E <1 I360F <1 I360G <1 I360H 2.7 I360K <1 I360L <1 I360M 8.3 I360N <1 I360P <1 I360Q <1 I360R <1 I360S <1 I360T <1 I360V 7.8 I360W <1 I360Y <1 Y393A <1 Y393C <1 Y393D <1 Y393E <1 Y393F <1 Y393G <1 Y393H <1 Y393I <1 Y393K <1 Y393L <1 Y393M <1 Y393N <1 Y393P <1 Y393Q <1 Y393R <1 Y393S <1 Y393T <1 Y393V <1 Y393W <1 S397A <1 S397C <1 S397E <1 S397E <1 S397F <1 S397G <1 S397H <1 S397I <1 S397K <1 S397L <1 S397M <1 S397N <1 S397P <1 S397Q <1 S397R <1 S397T <1 S397V <1 S397W <1 S397Y <1 A485C <1 A485D <1 A485E <1 A485F <1 A485G <1 A485H <1 A485I <1 A485K <1 A485L <1 A485M <1 A485N <1 A485P <1 A485Q <1 A485R <1 A485S <1 A485T <1 A485V <1 A485W <1 A485Y <1 D507A <1 D507C <1 D507E <1 D507F <1 D507G <1 D507H <1 D507I <1 D507K <1 D507L <1 D507M <1 D507N <1 D507P <1 D507Q <1 D507R <1 D507S <1 D507T <1 D507V <1 D507W <1 D507Y <1

TABLE-US-00005 TABLE IV ABTS Trametes villosa laccase variant Assay Parent (Wild-Type) 1.0 A262G + I360V 4.8 A262G + V289I + T292D + N357D 4.1 S37C + A262G + Y393I + A485S 3.3 V175T + S200D + A262G + I360V + Y393I 6.3 F102A + V175S + A262G + I360V + S397A 3.6 F102A + V175T + S200D + A262G + 2.2 N357D + S397A A9R + L79D + L179N 2.3

[0354] Relative improvements in specific activity over the parent laccase in day 4 broths from 48-well deep-well plate and shake flask cultivations for all single site variants at positions K178, D276, A333, F418, S506, and S518, are shown in Table V below, and combinatorial variants F418I+S506H and A21C+K178S+F418V+S518A are shown in Table VI below.

TABLE-US-00006 TABLE V Trametes villosa laccase ABTS variant Assay Parent (Wild-Type) 1.0 K178A <1 K178C <1 K178D <1 K178E <1 K178F <1 K178G <1 K178H <1 K178I <1 K178L <1 K178M <1 K178N <1 K178P <1 K178Q <1 K178R <1 K178S <1 K178T <1 K178V <1 K178W <1 K178Y <1 D276A <1 D276C <1 D276E <1 D276F <1 D276G <1 D276H <1 D276I <1 D276K <1 D276L <1 D276M <1 D276N <1 D276P <1 D276Q <1 D276R <1 D276S <1 D276T <1 D276V <1 D276W <1 D276Y <1 A333C <1 A333D <1 A333E 1.3 A333F <1 A333G <1 A333H <1 A333I <1 A333K 1.1 A333L <1 A333M <1 A333N <1 A333P <1 A333Q <1 A333R 1.1 A333S <1 A333T <1 A333V <1 A333W <1 A333Y <1 F418A <1 F418C <1 F418D <1 F418E <1 F418G <1 F418H <1 F418I 3.1 F418K <1 F418L 2.4 F418M 2.7 F418N <1 F418P <1 F418Q <1 F418R <1 F418S <1 F418T <1 F418V 2.6 F418W <1 F418Y <1 S506A <1 S506C <1 S506D <1 S506E <1 S506F <1 S506G <1 S506H <1 S506I <1 S506K <1 S506L <1 S506M <1 S506N <1 S506P <1 S506Q <1 S506R <1 S506T <1 S506V <1 S506W <1 S506Y <1 S518A <1 S518C <1 S518D <1 S518E <1 S518F <1 S518G <1 S518H <1 S518I <1 S518K <1 S518L <1 S518M <1 S518N <1 S518P <1 S518Q <1 S518R <1 S518T <1 S518V <1 S518W <1 S518Y <1

TABLE-US-00007 TABLE VI Relative Improvement of Specific Activity Over Parent Trametes villosa laccase variant ABTS Assay Parent (Wild-Type) 1.0 F418I + S506H 3.7 A21C + K178S + F418V + S518A 4.2

Example 11

Fermentation-Scale Confirmation of Improved Expression of Trametes villosa Laccase Variant Genes in Aspergillus oryzae

[0355] A fermentation process was used to express the Trametes villosa laccase variants A262G+I360V; A262G+V289I+T292D+N357D; S37C+A262G+Y939I+A485S; V175T+S200D+A262G+I360V+Y393I; F102A+V175S+A262G+I360V+S397A; F102A+V175T+S200D+A262G+N357D+S397A; A9R+L79D+L179N; and A262G relative to the parent T. villosa laccase.

[0356] Shake flask medium was composed of 50 g of sucrose, 10 g of KH.sub.2PO.sub.4, 0.5 g of CaCl.sub.2, 2 g of MgSO.sub.4.7H.sub.2O, 2 g of K.sub.2SO.sub.4, 2 g of urea, 10 g of yeast extract, 2 g of citric acid, 0.5 ml of trace metals solution, and deionized water to 1 liter. The trace metals solution was composed of 13.8 g of FeSO.sub.4.7H.sub.2O, 14.3 g of ZnSO.sub.4.7H.sub.2O, 8.5 g of MnSO.sub.4.H.sub.2O, 2.5 g of CuSO.sub.4.5H.sub.2O, 3 g of citric acid, and deionized water to 1 liter.

[0357] One hundred ml of shake flask medium were added to a 500 ml shake flask. The shake flask was inoculated with 7 ml of 0.01% TWEEN? 80 with spores scraped from a solid plate culture and incubated at 34? C. on an orbital shaker at 200 rpm for 24 hours. Fifty ml of the shake flask broth were used to inoculate a 3 liter fermentation vessel.

[0358] Fermentation batch medium was composed per liter of 10 g of yeast extract, 24 g of sucrose, 5 g of (NH.sub.4).sub.2SO.sub.4, 2 g of KH.sub.2PO.sub.4, 0.5 g of CaCl.sub.2.2H.sub.2O, 2 g of MgSO.sub.4.7H.sub.2O, 1 g of citric acid, 2 g of K.sub.2SO.sub.4, 0.25 g CuSO.sub.4.5H.sub.2O, 0.5 ml of anti-foam, and 0.5 ml of trace metals solution. The trace metals solution was composed per liter of 13.8 g of FeSO.sub.4.7H.sub.2O, 14.3 g of ZnSO.sub.4.7H.sub.2O, 8.5 g of MnSO.sub.4.H.sub.2O, 2.5 g of CuSO.sub.4.5H.sub.2O, and 3 g of citric acid. Fermentation feed medium was composed of maltose.

[0359] A total of 1.8 liters of the fermentation batch medium was added to a three liter glass jacketed fermentor. Fermentation feed medium was dosed at a rate of 0 to 8.0 g/l/hr. The fermentation vessel was maintained at a temperature of 34? C. and the pH was controlled to a set-point of 6.1+/?0.1. Air was added to the vessel at a rate of 1 vvm and the broth was agitated by Rushton impeller rotating at 1100 rpm. Samples were taken on days 2, 3, 4, 5, 6, and 7 of the fermentation run and centrifuged at 3000?g to remove the biomass. The supernatants were sterile filtered and stored at ?20? C.

[0360] T. villosa laccase variant expression levels were determined relative to the parent gene (cDNA sequence) by the ABTS liquid assay (Example 2) and by SDS-PAGE analysis (Example 9).

[0361] Relative improvements in expression yield for day 7 broths of several variants relative to the parent T. villosa laccase are shown in Table VII below. Variant A262G+I360V was produced in an amount that was 4.8? greater than the parent T. villosa laccase, variant A262G+V289I+T292D+N357D was produced in an amount that was 4.1? greater than the parent T. villosa laccase, variant A9R+L79D+L179N was produced in an amount that was 3.3? greater than the parent T. villosa laccase, variant V175T+S200D+A262G+I360V+Y393I1 was produced in an amount that was 6.2? greater than the parent T. villosa laccase, variant F102A+V175S+A262G+I360V+S397A was produced in an amount that was 3.6? greater than the parent T. villosa laccase, variant F102A+V175T+S200D+A262G+N357D+S397A was produced in an amount that was 2.1? greater than the parent T. villosa laccase, variant S37C+A262G+Y939I+A485S was produced in an amount that was 2.2? greater than the parent T. villosa laccase, and variant A262G was produced in an amount that was 4.8? greater than the parent T. villosa laccase. SDS-PAGE analysis of the same broths showed a T. villosa laccase band of increased intensity over the parent T. villosa laccase for these variants which correlated well with the relative improvements observed in the activity assay. SDS-PAGE analysis of the samples taken on days 3, 4, 5, 6, and 7 showed increased production of the parent T. villosa laccase and each variant day by day with day 7 the strongest.

TABLE-US-00008 TABLE VII Relative Improvement in Expression Over Parent Trametes villosa Laccase Variant ABTS Assay Parent (Wild-Type) 1.0 A262G + I360V 4.8 A262G + V289I + T292D + N357D 4.1 S37C + A262G + Y393I + A485S 3.3 V175T + S200D + A262G + I360V + Y393I 6.2 F102A + V175S + A262G + I360V + S397A 3.6 F102A + V175T + S200D + A262G + N357D + 2.1 S397A A9R + L79D + L179N 2.2 A262G 4.8

[0362] Relative improvements in specific activity for day 7 broths of two variants compared to the parent T. villosa laccase are shown in Table VIII below. The specific activity was measured by normalizing ABTS activity values (measured as in Example 2) to unit protein amounts by assessing relative laccase production per unit volume by band densitometry values from SDS-PAGE gels loaded with equal volumes of sample broth. The specific activity of variant F418I+S506H was 5.2? higher than the parent T. villosa laccase. The specific activity of variant A21C+K178S+F418V+S518A was 4.9? higher than the parent T. villosa laccase.

TABLE-US-00009 TABLE VIII Relative Improvement in Specific Activity Over Parent Trametes villosa Laccase Variant ABTS Assay Parent (Wild-Type) 1.0 F418I + S506H 5.2 A21C + K178S + F418V + S518A 4.9

Example 12

Construction and Identification of Increased Specific Activity Variants of Trametes villosa Laccase Variant V175T+S200D+A262G+I360V+Y393I

[0363] Trametes villosa laccase gene mutant libraries were constructed by multi-site directed mutagenesis on the improved expression variant V175T+S200D+A262G+I360V+Y393I backbone. Libraries were prepared using mutagenic oligos for positions including K178, D276, A333, F418, S506, and S518. Libraries were transformed into E. coli with subsequent isolation of plasmid DNA. PCR was used to lift the laccase ORF using oligos 1206637 and 1206638. Yeast Recombinational cloning was used to assemble plasmids containing a mutant T. villosa laccase gene plus Aspergillus nidulans orotidine 5-phosphate decarboxylase pyrG selection marker and the FRT-F and FRT-F3 flippase recognition target sequence. Libraries were transformed into protoplasts of Aspergillus oryzae JaL1394 as described in Example 9. After 4 days of protoplast recovery at 34? C. on Minimal medium agar plates overlaid with COVE-N-JP top agarose containing 1 mM ABTS, single colonies with green halos were picked onto individual COVE-N-gly plates and incubated for 3 days at 34? C. Spores from variants were inoculated into 48-well deep-well plates containing 2 ml of M410 medium containing 0.25 mM CuSO.sub.4, covered with a breathable seal, and grown for 4 days at 34? C. with no shaking. After 4 days growth the liquid culture medium was assayed for laccase activity as described in Examples 2 and 3 and higher activity variants were scored as hits.

[0364] Individual mutant strains were cultivated again in 125 ml shake flasks in 25 ml of M410 medium containing 0.25 mM CuSO.sub.4 for 4 days at 34? C. with shaking at 220 rpm to generate fresh broth for retesting relative to A. oryzae JaL1394 strain expressing the T. villosa laccase variant V175T+S200D+A262G+I360V+Y393I backbone gene.

[0365] Relative improvements in specific activity over the parent in day 4 broths from shake flask cultivations for 2 characterized variants are shown in Table IX below.

TABLE-US-00010 TABLE IX Relative Improvement of Specific Activity Over Parent ABTS Syringaldazine Trametes villosa laccase Variant Assay Assay V175T + S200D + A262G + I360V + Y393I 1.0 1.0 (Parent) V175T + S200D + A262G + D276G + 4.1 2.6 I360V + Y393I + F418I + S506H V175T + S200D + A262G + V275I + 3.7 3.1 D276G + A333S + I360V + Y393I + F418I + S506H

Example 13

Fermentation-Scale Confirmation of Improved Specific Activity of Trametes villosa Laccase Variant Genes in Aspergillus oryzae

[0366] A fermentation process was used to express the Trametes villosa laccase variants V175T+S200D+A262G+D276G+I360V+Y393I+F418I+S506H and V175T+S200D+A262G+V275I+D276G+A333S+I360V+Y393I+F418I+S506H for comparison to the T. villosa laccase variant V175T+S200D+A262G+I360V+Y393I, as described in Example 11.

[0367] The T. villosa laccase variant expression levels were determined relative to the T. villosa laccase variant V175T+S200D+A262G+I360V+Y393I by the ABTS liquid assay (Example 2) and by syringaldazine liquid assay (Example 3).

[0368] Relative improvements in specific activity for day 7 broths of the two variants relative to the V175T+S200D+A262G+I360V+Y393I improved expression laccase variant are shown in Table X below. Variant V175T+S200D+A262G+D276G+I360V+Y393I+F418I+S506H had a specific activity that was 2.7? greater than the T. villosa laccase variant V175T+S200D+A262G+I360V+Y393I, and variant V175T+S200D+A262G+V275I+D276G+A333S+I360V+Y393I+F418I+S506H was produced in an amount that was 2.1? greater than the T. villosa laccase variant V175T+S200D+A262G+I360V+Y393I.

[0369] The volumetric activity of laccase variant V175T+S200D+A262G+D276G+I360V+Y393I+F418I+S506H was increased 30-fold over the wild-type laccase.

TABLE-US-00011 TABLE X Relative Improvement Over Parent Trametes villosa Laccase Variant ABTS Assay V175T + S200D + A262G + I360V + Y393I (Parent) 1.0 V175T + S200D + A262G + D276G + I360V + Y393I + 2.7 F418I + S506H V175T + S200D + A262G + V275I + D276G + A333S + 2.1 I360V + Y393I + F418I + S506H

Example 14

Trichoderma reesei Protoplast Generation and Transformation

[0370] Protoplast preparation and transformation were performed using a modified protocol based on Penttila et al., 1987, Gene 61: 155-164. Briefly, Trichoderma reesei strain RutC30 (Montenecourt and Eveleigh, 1979, Adv. Chem. Ser. 181: 289-301) was cultivated in 25 ml of YP medium supplemented with 2% (w/v) glucose and 10 mM uridine at 27? C. for 17 hours with gentle agitation at 90 rpm. Mycelia were collected by filtration using a Vacuum Driven Disposable Filtration System (Millipore) and washed twice with deionized water and twice with 1.2 M sorbitol. Protoplasts were generated by suspending the washed mycelia in 20 ml of 1.2 M sorbitol containing 15 mg of GLUCANEX? 200 G (Novozymes A/S, Bagsvaerd, Denmark) per ml and 0.36 units of chitinase (Sigma Chemical Co.) per ml for 15-25 minutes at 34? C. with gentle shaking at 90 rpm. Protoplasts were collected by centrifuging for 7 minutes at 400?g and washed twice with cold 1.2 M sorbitol. The protoplasts were counted using a haemocytometer and re-suspended to a final concentration of 1?10.sup.8 protoplasts per ml in STC. Excess protoplasts were stored in a Cryo 1? C. Freezing Container (Nalgene) at ?80? C.

[0371] Approximately 100 ?g of a transforming plasmid described in the following examples were digested with Pme I. The digestion reaction was purified by 1% agarose gel electrophoresis using TAE buffer where a DNA band was excised from the gel and extracted using a QIAQUICK? Gel Extraction Kit. The resulting purified DNA was added to 100 ?l of the protoplast solution and mixed gently. PEG buffer (250 ?l) was added, mixed, and incubated at 34? C. for 30 minutes. STC (3 ml) was then added, mixed, and spread onto COVE plates. The plates were incubated at 28? C. for 4-7 days.

Example 15

Construction of pAMFS200 and pAMFS201 for Expression of Trametes villosa Laccase in Trichoderma reesei

[0372] The wild-type Trametes villosa laccase cDNA (SEQ ID NO; 1 for the cDNA sequence and SEQ ID NO: 2 for the deduced amino acid sequence) and variant V175T+S200D+A262G+I360V+Y393I were amplified by PCR from plasmids pDLHD0140 (Example 8) and pTmmD014 (FIG. 7), respectively, using the same gene-specific forward and reverse primers 1209071 and 1209072. The PCRs were composed of 1 ng of either pDLHD0140 or pTmmD014 DNA, 50 pmoles of each of the primers 1209071 and 1209072, 1 ?l of a 10 mM blend of dATP, dTTP, dGTP, and dCTP, 1? PHUSION? High-Fidelity Hot Start DNA Polymerase Buffer, and 1 unit of PHUSION? High-Fidelity Hot Start DNA Polymerase in a final volume of 50 ?l. The reaction was incubated in an EPPENDORF? MASTERCYCLER? 5333 epgradient S programmed for 1 cycle at 98? C. for 30 seconds; 35 cycles each at 98? C. for 10 seconds, 55? C. for 30 seconds, and 72? C. for 30 seconds; and 1 cycle at 72? C. for 10 minutes. The PCR products were separated by 1% agarose gel electrophoresis using TAE buffer where approximately 1.6 kb fragments were excised from the gel and extracted using a QIAQUICK? Gel Extraction Kit according to the manufacturer's protocol.

[0373] Plasmid pMJ09 (WO 2005/047499) was digested with Nco I and Pac I, isolated by 1.0% agarose gel electrophoresis in TBE buffer, excised from the gel, and extracted using a QIAQUICK? Gel Extraction Kit according to the manufacturer's instructions.

[0374] The 1.6 kb PCR products were independently inserted into the gel-purified Nco I/Pac I digested pMJ09 using an IN-FUSION? Advantage PCR Cloning Kit according to the manufacturer's protocol. Each IN-FUSION? reaction was composed of 1? IN-FUSION? Reaction Buffer, 200 ng of the gel-purified Nco I/Pac I digested pMJ09, 100 ng of the 1.6 kb PCR product, and 1 ?l of IN-FUSION? Enzyme in a 10 ?l reaction volume. The reactions were incubated for 15 minutes at 50? C. After the incubation period 40 ?l of TE were added to each reaction. A 2 ?l aliquot of each reaction was independently used to transform ONE SHOT? TOP10 competent cells according to the manufacturer's protocol. The E. coli transformation reactions were spread onto 2? YT plus ampicillin plates. The transformants were screened by sequencing and one clone containing the wild-type laccase insert with no PCR errors was identified and designated pAMFS200 (FIG. 8) and one clone containing the laccase variant V175T+S200D+A262G+I360V+Y393I with no PCR errors was identified and designated pAMFS201 (FIG. 9). Both plasmids pAMFS200 and pAMFS201 can be digested with Pme I for T. reesei transformation. The plasmids contain an expression cassette composed of the T. reesei Cel7A cellobiohydrolase I gene promoter, the Trametes villosa laccase polypeptide coding sequence, T. reesei Cel7A cellobiohydrolase I gene terminator and the Aspergillus nidulans acetamidase (amdS) gene.

Example 16

Transformation of pAMFS200 and pAMFS201 into Trichoderma reesei RutC30

[0375] Protoplast preparation and transformation of Trichoderma reesei strain RutC30 was performed as described in Example 14.

[0376] Approximately 100 ?g of pAMFS200 or pAMFS201 were digested with Pme I. Transformation was performed by adding 5-10 ?g of Pme I digested pAMFS200 or pAMFS201 to 100 ?l of the Trichoderma reesei RutC30 protoplast solution and mixed gently. PEG buffer (250 ?l ) was added, mixed, and incubated at 34? C. for 30 minutes. STC (3 ml) was then added, mixed, and spread onto two COVE plates. The plates were incubated at 28? C. for 7-10 days. A total of 46 transformants with pAMFS200 and 15 transformants with pAMFS201 were isolated onto COVE2+10 mM uridine plates and grown at 28? C. for 5 days. Fresh spores from these plates were transferred to 48-well deep-well plates containing 2 ml of ClM containing 0.25 mM CuSO.sub.4, covered with a breathable seal, and grown for 3 days at 30? C. shaking at 250 rpm. After 3 days of growth the culture medium for each transformant was assayed for laccase activity according to Example 2. A number of transformants showed laccase activity several-fold higher than that of Trichoderma reesei RutC30. The relative improvement in expression yield based on activity measurements for the variant V175T+S200D+A262G+I360V+Y393I over the parent laccase in day 3 broths from 48-well deep-well plate was 5-fold. The top three laccase producing strains were spore-purified once on COVE2+10 mM uridine agar plates and cultivated in liquid using the same conditions described above. Broths were again analyzed for laccase activity according to Example 2 and the top strains were then tested for laccase expression in 2 L fermentation tanks.

Example 17

Fermentation-Scale Confirmation of Improved Expression of Trametes villosa Laccase Variant Gene in Trichoderma reesei

[0377] A fermentation process was used to express the T. villosa laccase variant V175T+S200D+A262G+I360V+Y393I relative to the parent Trametes villosa laccase.

[0378] Shake flask medium was composed of 20 g of glucose, 10 g of corn steep solids, 2.08 g of KH.sub.2PO.sub.4, 0.36 g of CaCl.sub.2, 0.42 g of MgSO.sub.4.7H.sub.2O, 1.45 g of (NH.sub.4).sub.2SO.sub.4, 0.2 ml of T. reesei trace metals solution and deionized water to 1 liter.

[0379] One hundred ml of shake flask medium were added to a 500 ml shake flask. The shake flask was inoculated with two plugs from a solid plate culture and incubated at 28? C. on an orbital shaker at 200 rpm for 24 hours. Fifty ml of the shake flask broth were used to inoculate a 3 liter fermentation vessel.

[0380] Fermentation batch medium was composed per liter of 10 g of corn steep solids, 30 g of cellulose, 4 g of glucose, 2.6 g of CaCl.sub.2.2H.sub.2O, 7.4 g of (NH.sub.4).sub.2SO.sub.4, 2.8 g of KH.sub.2PO.sub.4, 1.8 g of MgSO.sub.4.7H.sub.2O, 2 g of K.sub.2SO.sub.4, 0.25 g of CuSO.sub.4.5H.sub.2O, 1.8 ml of anti-foam, and 0.75 ml of T. reesei trace metals solution. The T. reesei trace metals solution was composed of 216 g of FeSO.sub.4.6H.sub.2O, 58 g of ZnSO.sub.4.7H.sub.2O, 27 g of MnSO.sub.4.H.sub.2O, 10 g of CuSO.sub.4.5H.sub.2O, 2.4 g H.sub.3BO.sub.3, 336 g of citric acid, and deionized water to 1 liter. Fermentation feed medium was composed of glucose and phosphoric acid in water.

[0381] A total of 1.8 liters of the fermentation batch medium was added to a three liter glass jacketed fermentor. Fermentation feed medium was dosed at a rate of 0 to 6.4 g/l/hr. The fermentation vessel was maintained at a temperature of 28? C. and the pH was controlled to a set-point of 2.5+/?0.1. Air was added to the vessel at a rate of 1 vvm and the broth was agitated by Rushton impeller rotating at 1100 to 1300 rpm. Samples were taken on days 2, 3, 4, 5, 6, and 7 of the fermentation run and centrifuged at 3000?g to remove the biomass. The supernatants were sterile filtered and stored at ?20? C.

[0382] Trametes villosa laccase variant expression levels were determined relative to the parent laccase by the ABTS liquid assay (Example 2).

[0383] The relative improvement in expression yield based on activity measurements for the variant V175T+S200D+A262G+I360V+Y393I over the parent laccase in day 7 fermentation broths was 4-fold as shown in Table XI.

TABLE-US-00012 TABLE XI Relative Improvement Over Parent ABTS Assay (48 ABTS Assay Trametes villosa Laccase Variant well plates) (2 L Tanks) Parent (Wild-Type) 1.0 1.0 V175T + S200D + A262G + I360V + Y393I 5.5 4.4

Example 18

Purification of Polyporus pinsitus Laccase Variants

[0384] Polyporus pinsitus laccase variants were purified from fermentation broths using the methods previously described in WO 96/000290.

Example 19

Dye Bleaching Assay for Laccase Activity Screening

[0385] This assay is used for assessment of laccase activity in the presence or absence of a mediator. Britton-Robinson buffer (0.1 M H.sub.3BO.sub.3, 0.04 M H.sub.3PO.sub.4 and 0.04 M CH.sub.3COOH) was prepared at varied pHs (adjusted to 5.0, 7.0 and 9.0 with NaOH) to obtain an activity profile. Dye solutions were prepared by dissolving indigo carmine and reactive black dyes in water to 0.43 mM and 0.2 mM, respectively. Mediator solutions were prepared by dissolving each of the following mediators to 10 mM in water: syringaldehyde, methylsyringate, hydroxybenzotriazole, 10-phenothiazine-propionic acid, and 2,2,6,6-tetramethylpiperidin-1-yloxy. A laccase standard was diluted using 2-fold steps starting with a 0.06 LAMU/ml concentration and ending with a 0.0075 LAMU/ml concentration in the sample buffer. Reactions were assembled by adding to each well of a 96-well flat bottom plate 20 ?l of broth or enzyme standard solution, 100 ?l of Britton-Robinson buffer, and 20 ?l of mediator solution. Reactions were initiated by adding 100 ?l of the dye solution to each well. The plate was then quickly transferred to a SPECTRAMAX? M5 spectrophotometer (Molecular Devices), pre-mixed for 5 seconds, and the decrease in absorbance at the appropriate wavelength for the dye (610 nm for indigo carmine; 600 nm for Reactive black 5) was recorded for 15 minutes with 9 second intervals at 25? C.

[0386] Both purified enzyme solutions and crude fermentation broths can be used in this assay. The decolorization of both dyes is visible to the naked eye. The assay can be performed in the absence of mediator. Other mediators and dyes can potentially be used, following the same protocol.

Example 20

Cloning of the Wild-Type Pycnoporus cinnabarinus Laccase for Expression in an Aspergillus oryzae Screening Strain

[0387] The wild-type Pycnoporus cinnabarinus laccase cDNA (SEQ ID NO: 92 for the cDNA sequence and SEQ ID NO: 93 for the deduced amino acid sequence) was cloned into a Saccharomyces cerevisiae/A. oryzae Flp/FRT shuttle vector by yeast recombinational cloning, resulting in vector pDLHD0199 (FIG. 10).

[0388] Expression vector pDLHD0199 was constructed as described in Example 8 for vector pDLHD0140. Fragment 2 was amplified using primer 1217524 (sense) and primer 1217525 (antisense).

Example 21

Cloning of the Wild-Type Myceliophthora thermophila Laccase for Expression in an Aspergillus oryzae Screening Strain

[0389] The wild-type Myceliophthora thermophila laccase cDNA (SEQ ID NO: 94 for the cDNA sequence and SEQ ID NO: 95 for the deduced amino acid sequence) was cloned into a Saccharomyces cerevisiae/A. oryzae Flp/FRT shuttle vector by yeast recombinational cloning, resulting in vector pDLHD0201 (FIG. 11).

[0390] Expression vector pDLHD0201 was constructed as described in Example 8 for vector pDLHD0140. Fragment 2 was amplified using primer 1217528 (sense) and primer 1217529 (antisense).

Example 22

Confirmation of Wild-Type Pycnoporus cinnabarinus Laccase Expression in Single-Copy in Aspergillus oryzae Screening Strain JaL1394

[0391] As described in Example 9, Aspergillus oryzae JaL1394 was transformed with plasmid pDLHD0199 comprising the wild-type P. cinnabarinus laccase gene. Transformation plates containing ABTS were incubated at 34? C. until transformants appeared and green ABTS color was observed around each colony. The conversion of ABTS to a visible green color demonstrated that the transformants produced active P. cinnabarinus laccase.

[0392] Single transformants were subsequently cultivated and assayed for laccase activity according to Examples 2, 3, 4, and 9.

Example 23

Confirmation of Wild-Type Myceliophthora thermophila Laccase Expression in Single-Copy in Aspergillus oryzae Screening Strain JaL1394

[0393] As described in Example 9, Aspergillus oryzae JaL1394 was transformed with plasmid pDLHD0201 comprising the wild-type M. thermophila laccase gene. Transformation plates containing ABTS were incubated at 34? C. until transformants appeared and green ABTS color was observed around each colony. The conversion of ABTS to a visible green color demonstrated that the transformants produced active M. thermophila laccase.

[0394] Single transformants were subsequently cultivated and assayed for laccase activity according to Examples 2, 3, 4, and 9.

Example 24

Construction and Identification of Increased Expression and Increased Specific Activity Variants of Pycnoporus cinnabarinus Laccase

[0395] Pycnoporus cinnabarinus laccase gene variants were constructed by site-saturation mutagenesis. The variants of the P. cinnabarinus laccase gene were transformed into protoplasts of Aspergillus oryzae JaL1394 as described in Example 10. Transformants were cultivated and assayed for laccase activity and expression as described in Examples 2, 3, 4, 9, and 10, and higher activity variants were scored as expression hits.

[0396] Relative improvements in expression yield over the parent laccase in day 4 broths from 48-well deep-well plate and shake flask cultivations for variants at positions L79, A170, A262, V289, N292, N357, and I360 are shown in Table XII below. SDS-PAGE analysis of the same broths demonstrated a P. cinnabarinus laccase band of increased intensity over wild-type P. cinnabarinus laccase for all variants, which correlated well with the relative improvements observed in the activity assays.

TABLE-US-00013 TABLE XII Pycnoporus cinnabarinus laccase variant ABTS Assay Parent (Wild-Type) 1.0 L79E <1 L79F <1 L79G 2.6 L79S <1 A170T <1 A262G 1.4 T289K 1.7 A292K <1 N357D <1 N357G 1.3 N357M 1.1 N357S <1 I360M 1.8

[0397] Relative improvements in specific activity over the parent laccase in day 4 broths from 48-well deep-well plate and shake flask cultivations for variants at positions P333 and F418 are shown in Table XIII below.

TABLE-US-00014 TABLE XIII Relative Improvement of Specific Activity Over Parent Pycnoporus cinnabarinus laccase variant ABTS Assay Parent (Wild-Type) 1.0 P333E <1 F418I 6.5 F418V 5.9

Example 25

Construction and Identification of Increased Expression and Increased Specific Activity Variants of Myceliophthora thermophila Laccase

[0398] Myceliophthora thermophila laccase gene variants were constructed by site-saturation mutagenesis. The variants of the M. thermophila laccase gene were transformed into protoplasts of Aspergillus oryzae JaL1394 as described in Example 10. Transformants were cultivated and assayed for laccase activity and expression as described in Examples 2, 3, 4, 9, and 10, and higher activity variants were scored as expression hits.

[0399] Relative improvements in expression yield over the parent laccase in day 4 broths from 48-well deep-well plate and shake flask cultivations for variants at positions S220, G317, L344, R349, D437, and L440 are shown in Table XIV below. SDS-PAGE analysis of the same broths demonstrated a M. thermophila laccase band of increased intensity over wild-type M. thermophila laccase for all variants, which correlated well with the relative improvements observed in the activity assays.

TABLE-US-00015 TABLE XIV Myceliophthora thermophila laccase variant ABTS Assay Parent (Wild-Type) 1.0 S220T 1.3 G317A <1 L344K 1.9 L344T 1.1 R349K 1.1 D437G <1 D437M <1 D437S 1.0 L440M 1.6

[0400] Relative improvements in specific activity over the parent laccase in day 4 broths from 48-well deep-well plate and shake flask cultivations for variants at position M480 are shown in Table XV below.

TABLE-US-00016 TABLE XV Relative Improvement of Specific Activity Over Parent Myceliophthora thermophila laccase variant ABTS Assay Parent (Wild-Type) 1.0 M480I <1 M480V <1

[0401] The present invention is further described by the following numbered paragraphs:

[0402] [1] A laccase variant, comprising a substitution at one or more positions corresponding to positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the full-length polypeptide of SEQ ID NO: 2, wherein the variant has laccase activity and wherein the variant has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to the full-length polypeptide of a parent or the mature polypeptide thereof.

[0403] [2] The variant of paragraph 1, wherein the parent laccase is selected from the group consisting of: (a) a polypeptide having at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95; or the mature polypeptide thereof; (b) a polypeptide encoded by a polynucleotide that hybridizes under at least low stringency conditions with (i) SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 92, or 94, or the mature polypeptide coding sequence thereof; or (ii) the full-length complement of (i); (c) a polypeptide encoded by a polynucleotide having at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 92, or 94; or the mature polypeptide coding sequence thereof; and (d) a fragment of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95, or the mature polypeptide thereof, which has laccase activity.

[0404] [3] The variant of paragraph 1 or 2, wherein the parent laccase has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95; or the mature polypeptide thereof.

[0405] [4] The variant of any one of paragraphs 1-3, wherein the parent laccase is encoded by a polynucleotide that hybridizes under low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions, or very high stringency conditions with (i) SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 92, or 94, or the mature polypeptide coding sequence thereof; or (ii) the full-length complement of (i).

[0406] [5] The variant of any one of paragraphs 1-4, wherein the parent laccase is encoded by a polynucleotide having at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 92, or 94; or the mature polypeptide coding sequence thereof.

[0407] [6] The variant of any one of paragraphs 1-5, wherein the parent laccase comprises or consists of the full-length polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95; or the mature polypeptide thereof.

[0408] [7] The variant of any one of paragraphs 1-6, wherein the parent laccase is a fragment of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 93, or 95, or the mature polypeptide thereof, wherein the fragment has endoglucanase activity.

[0409] [8] The variant of any one of paragraphs 1-7, which has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to the full-length polypeptide of the parent laccase, or the mature polypeptide thereof.

[0410] [9] The variant of any one of paragraphs 1-8, wherein the variant consists of at least 85%, at least 90%, or at least 95% of the amino acids of the parent.

[0411] [10] The variant of any one of paragraphs 1-9, wherein the number of substitutions is 1-24, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 substitutions.

[0412] [11] The variant of any one of paragraphs 1-10, which comprises a substitution at a position corresponding to position 9.

[0413] [12] The variant of paragraph 11, wherein the substitution is with Arg.

[0414] [13] The variant of any one of paragraphs 1-12, which comprises a substitution at a position corresponding to position 21.

[0415] [14] The variant of paragraph 13, wherein the substitution is with Cys.

[0416] [15] The variant of any one of paragraphs 1-14, which comprises a substitution at a position corresponding to position 37.

[0417] [16] The variant of paragraph 15, wherein the substitution is with Cys.

[0418] [17] The variant of any one of paragraphs 1-16, which comprises a substitution at a position corresponding to position 79.

[0419] [18] The variant of paragraph 17, wherein the substitution is with Ala, Asp, Glu, Phe, Gly, Ile, Met, Asn, Gln, or Ser.

[0420] [19] The variant of any one of paragraphs 1-18, which comprises a substitution at a position corresponding to position 102.

[0421] [20] The variant of paragraph 19, wherein the substitution is with Ala.

[0422] [21] The variant of any one of paragraphs 1-20, which comprises a substitution at a position corresponding to position 170.

[0423] [22] The variant of paragraph 21, wherein the substitution is with Ala, Met, Gln, Ser, or Thr.

[0424] [23] The variant of any one of paragraphs 1-22, which comprises a substitution at a position corresponding to position 175.

[0425] [24] The variant of paragraph 23, wherein the substitution is with Ser or Thr.

[0426] [25] The variant of any one of paragraphs 1-24, which comprises a substitution at a position corresponding to position 178.

[0427] [26] The variant of paragraph 25, wherein the substitution is with Ser.

[0428] [27] The variant of any one of paragraphs 1-26, which comprises a substitution at a position corresponding to position 179.

[0429] [28] The variant of paragraph 27, wherein the substitution is with Asn.

[0430] [29] The variant of any one of paragraphs 1-28, which comprises a substitution at a position corresponding to position 200.

[0431] [30] The variant of paragraph 29, wherein the substitution is with Asp.

[0432] [31] The variant of any one of paragraphs 1-30, which comprises a substitution at a position corresponding to position 262.

[0433] [32] The variant of paragraph 31, wherein the substitution is with Gly.

[0434] [33] The variant of any one of paragraphs 1-32, which comprises a substitution at a position corresponding to position 275.

[0435] [34] The variant of paragraph 33, wherein the substitution is with Ile.

[0436] [35] The variant of any one of paragraphs 1-34, which comprises a substitution at a position corresponding to position 276.

[0437] [36] The variant of paragraph 35, wherein the substitution is with Gly.

[0438] [37] The variant of any one of paragraphs 1-36, which comprises a substitution at a position corresponding to position 289.

[0439] [38] The variant of paragraph 37, wherein the substitution is with Ile, Lys, Gln, Arg, or Thr.

[0440] [39] The variant of any one of paragraphs 1-38, which comprises a substitution at a position corresponding to position 292.

[0441] [40] The variant of paragraph 39, wherein the substitution is with Asp, Phe, Gly, His, or Lys.

[0442] [41] The variant of any one of paragraphs 1-40, which comprises a substitution at a position corresponding to position 333.

[0443] [42] The variant of paragraph 41, wherein the substitution is with Ser, Glu, Lys, or Arg.

[0444] [43] The variant of any one of paragraphs 1-42, which comprises a substitution at a position corresponding to position 357.

[0445] [44] The variant of paragraph 43, wherein the substitution is with Asp, Ala, Glu, Phe, Gly, Met, Gln, Ser, Thr, Val, or Tyr.

[0446] [45] The variant of any one of paragraphs 1-44, which comprises a substitution at a position corresponding to position 360.

[0447] [46] The variant of paragraph 45, wherein the substitution is with Val, Ala, His, or Met.

[0448] [47] The variant of any one of paragraphs 1-46, which comprises a substitution at a position corresponding to position 393.

[0449] [48] The variant of paragraph 47, wherein the substitution is with Ile.

[0450] [49] The variant of any one of paragraphs 1-48, which comprises a substitution at a position corresponding to position 397.

[0451] [50] The variant of paragraph 49, wherein the substitution is with Ala.

[0452] [51] The variant of any one of paragraphs 1-50, which comprises a substitution at a position corresponding to position 418.

[0453] [52] The variant of paragraph 51, wherein the substitution is with Ile, Val, Leu, or Met.

[0454] [53] The variant of any one of paragraphs 1-52, which comprises a substitution at a position corresponding to position 485.

[0455] [54] The variant of paragraph 53, wherein the substitution is with Ser.

[0456] [55] The variant of any one of paragraphs 1-54, which comprises a substitution at a position corresponding to position 506.

[0457] [56] The variant of paragraph 55, wherein the substitution is with His.

[0458] [57] The variant of any one of paragraphs 1-56, which comprises a substitution at a position corresponding to position 518.

[0459] [58] The variant of paragraph 57, wherein the substitution is with Ala.

[0460] [59] The variant of any one of paragraphs 1-58, which comprises a substitution at two positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0461] [60] The variant of any one of paragraphs 1-58, which comprises a substitution at three positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0462] [61] The variant of any one of paragraphs 1-58, which comprises a substitution at four positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0463] [62] The variant of any one of paragraphs 1-58, which comprises a substitution at five positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0464] [63] The variant of any one of paragraphs 1-58, which comprises a substitution at six positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0465] [64] The variant of any one of paragraphs 1-58, which comprises a substitution at seven positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0466] [65] The variant of any one of paragraphs 1-58, which comprises a substitution at eight positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0467] [66] The variant of any one of paragraphs 1-58, which comprises a substitution at nine positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0468] [67] The variant of any one of paragraphs 1-58, which comprises a substitution at ten positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0469] [68] The variant of any one of paragraphs 1-58, which comprises a substitution at eleven positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0470] [69] The variant of any one of paragraphs 1-58, which comprises a substitution at twelve positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0471] [70] The variant of any one of paragraphs 1-58, which comprises a substitution at thirteen positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0472] [71] The variant of any one of paragraphs 1-58, which comprises a substitution at fourteen positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0473] [72] The variant of any one of paragraphs 1-58, which comprises a substitution at fifteen positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0474] [73] The variant of any one of paragraphs 1-58, which comprises a substitution at sixteen positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0475] [74] The variant of any one of paragraphs 1-58, which comprises a substitution at seventeen positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0476] [75] The variant of any one of paragraphs 1-58, which comprises a substitution at eighteen positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0477] [76] The variant of any one of paragraphs 1-58, which comprises a substitution at nineteen positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0478] [77] The variant of any one of paragraphs 1-58, which comprises a substitution at twenty positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0479] [78] The variant of any one of paragraphs 1-58, which comprises a substitution at twenty-one positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0480] [79] The variant of any one of paragraphs 1-58, which comprises a substitution at twenty-two positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0481] [80] The variant of any one of paragraphs 1-58, which comprises a substitution at twenty-three positions corresponding to any of positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0482] [81] The variant of any one of paragraphs 1-58, which comprises a substitution at each position corresponding to positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518.

[0483] [82] The variant of any one of paragraphs 1-81, which comprises one or more substitutions selected from the group consisting of A9R; A21C; S37C; L79A,D,E,F,G,I,M,N,Q,S; F102A; V170A,M,Q,S,T; V175S,T; K178S; L179N; S200D; A262G; V275I; D276G; V289I,K,Q,R,T; T292D,F,G,H,K; A333S,E,K,R; N357D,A,E,F,G,M,Q,S,T,V,Y; I360V,A,H,M; Y393I1; S397A; F418I,V,L,M; A485S; S506H; and S518A.

[0484] [83] The variant of paragraph 82, which comprises or consists of the substitutions A262G+I360V.

[0485] [84] The variant of paragraph 82, which comprises or consists of the substitutions F418I+S506H.

[0486] [85] The variant of paragraph 82, which comprises or consists of the substitutions A9R+L79D+L179N.

[0487] [86] The variant of paragraph 82, which comprises or consists of the substitutions A21C+K178S+F418V+S518A.

[0488] [87] The variant of paragraph 82, which comprises or consists of the substitutions S37C+A262G+Y393I+A485S.

[0489] [88] The variant of paragraph 82, which comprises or consists of the substitutions A262G+V289I+T292D+N357D.

[0490] [89] The variant of paragraph 82, which comprises or consists of the substitutions F102A+V175S+A262G+I360V+S397A.

[0491] [90] The variant of paragraph 82, which comprises or consists of the substitutions V175T+S200D+A262G+I360V+Y393I.

[0492] [91] The variant of paragraph 82, which comprises or consists of the substitutions F102A+V175T+S200D+A262G+N357D+S397A.

[0493] [92] The variant of paragraph 82, which comprises or consists of the substitutions V175T+S200D+A262G+D276G+I360V+Y393I+F418I+S506H.

[0494] [93] The variant of paragraph 82, which comprises or consists of the substitutions V175T+S200D+A262G+V275I+D276G+A333S+I360V+Y393I+F418I+S506H.

[0495] [94] The variant of any one of paragraphs 1-93, which further comprises a substitution at one or more positions corresponding to positions 89, 151, 286, 307, 313, 339, and 355 of the full-length polypeptide of SEQ ID NO: 2, wherein the variant has laccase activity.

[0496] [95] The variant of paragraph 94, which further comprises a substitution at a position corresponding to position 89.

[0497] [96] The variant of paragraph 95, wherein the substitution is with Ala, Val, Leu, or Ile.

[0498] [97] The variant of any one of paragraphs 94-96, which further comprises a substitution at a position corresponding to position 151.

[0499] [98] The variant of paragraph 97, wherein the substitution is with Asp, Glu, Arg, or Lys.

[0500] [99] The variant of any one of paragraphs 94-98, which further comprises a substitution at a position corresponding to position 286.

[0501] [100] The variant of paragraph 99, wherein the substitution is with Arg, His, or Val.

[0502] [101] The variant of any one of paragraphs 94-100, which further comprises a substitution at a position corresponding to position 307.

[0503] [102] The variant of paragraph 101, wherein the substitution is with Pro, His, or Gly.

[0504] [103] The variant of any one of paragraphs 94-102, which further comprises a substitution at a position corresponding to position 313.

[0505] [104] The variant of paragraph 103, wherein the substitution is with Asn, Thr, or Ser.

[0506] [105] The variant of any one of paragraphs 94-104, which further comprises a substitution at a position corresponding to position 339.

[0507] [106] The variant of paragraph 105, wherein the substitution is with Trp, Thr, or Ser.

[0508] [107] The variant of any one of paragraphs 94-106, which further comprises a substitution at a position corresponding to position 355.

[0509] [108] The variant of paragraph 107, wherein the substitution is with Arg.

[0510] [109] The variant of any one of paragraphs 94-108, wherein the one or more substitutions are selected from the group consisting of F89A,V,L,I; N151D,E,R,K; F286R,H,V; A307P,H,G; T313N,T,S; V339W,T,S; and G355R.

[0511] [110] The variant of any one of paragraphs 1-109, which has an increased expression yield compared to the parent.

[0512] [111] The variant of paragraph 110, wherein the expression yield of the variant is increased at least 1.05-fold, at least 1.10-fold, at least 1.20-fold, at least 1.30-fold, at least 1.40-fold, at least 1.50-fold, at least 1.60-fold, at least 1.70-fold, at least 1.80-fold, at least 1.90-fold, at least 2-fold, at least 2.25-fold, at least 2.50-fold, at least 2.75-fold, at least 3.00-fold, at least 3.25-fold, at least 3.50-fold, at least 3.75-fold, at least 4-fold, at least 4.25-fold, at least 4.50-fold, at least 4.75-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 35-fold, or at least 40-fold compared to the expression yield of the parent.

[0513] [112] The variant of any one of paragraphs 1-111, which has an increased specific activity compared to the parent.

[0514] [113] The variant of paragraph 112, wherein the specific activity of the variant is increased at least 1.05-fold, at least 1.10-fold, at least 1.20-fold, at least 1.30-fold, at least 1.40-fold, at least 1.50-fold, at least 1.60-fold, at least 1.70-fold, at least 1.80-fold, at least 1.90-fold, at least 2-fold, at least 2.25-fold, at least 2.50-fold, at least 2.75-fold, at least 3.00-fold, at least 3.25-fold, at least 3.50-fold, at least 3.75-fold, at least 4-fold, at least 4.25-fold, at least 4.50-fold, at least 4.75-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, or at least 20-fold compared to the specific activity of the parent.

[0515] [114] The variant of any one of paragraphs 1-113, which has increased dye bleaching activity compared to the parent.

[0516] [115] The variant of paragraph 114, wherein the dye bleaching activity of the variant is increased at least 1.05-fold, at least 1.10-fold, at least 1.20-fold, at least 1.30-fold, at least 1.40-fold, at least 1.50-fold, at least 1.60-fold, at least 1.70-fold, at least 1.80-fold, at least 1.90-fold, at least 2-fold, at least 2.25-fold, at least 2.50-fold, at least 2.75-fold, at least 3.00-fold, at least 3.25-fold, at least 3.50-fold, at least 3.75-fold, at least 4-fold, at least 4.25-fold, at least 4.50-fold, at least 4.75-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, or at least 20-fold compared to the dye bleaching activity of the parent.

[0517] [116] An isolated polynucleotide encoding the variant of any one of paragraphs 1-115.

[0518] [117] A nucleic acid construct comprising the polynucleotide of paragraph 116.

[0519] [118] An expression vector comprising the polynucleotide of paragraph 116.

[0520] [119] A recombinant host cell comprising the polynucleotide of paragraph 116.

[0521] [120] A method of producing a laccase variant, comprising: (a) cultivating the recombinant host cell of paragraph 119 under conditions suitable for expression of the variant; and optionally (b) recovering the variant.

[0522] [121] A method for obtaining a laccase variant, comprising introducing into a parent laccase a substitution at one or more positions corresponding to positions 9, 21, 37, 79, 102, 170, 175, 178, 179, 200, 262, 275, 276, 289, 292, 333, 357, 360, 393, 397, 418, 485, 506, and 518 of the mature polypeptide of SEQ ID NO: 2, wherein the variant has laccase activity.

[0523] [122] The method of paragraph 121, wherein the one or more substitutions are selected from the group consisting of A9R; A21C; S37C; L79A,D,E,F,G,I,M,N,Q,S; F102A; V170A,M,Q,S,T; V175S,T; K178S; L179N; S200D; A262G; V275I; D276G; V289I,K,Q,R,T; T292D,F,G,H,K; A333S,E,K,R; N357D,A,E,F,G,M,Q,S,T,V,Y; I360V,A,H,M; Y393I; S397A; F418I,V,L,M; A485S; S506H; and S518A.

[0524] [123] The method of paragraph 121 or 122, further comprising introducing into the parent laccase a substitution at one or more positions corresponding to positions 89, 151, 286, 307, 313, 339, and 355 of the mature polypeptide of SEQ ID NO: 2, wherein the variant has laccase activity.

[0525] [124] The method of paragraph 123, wherein the one or more substitutions are selected from the group consisting of F89A,V,L,I; N151D,E,R,K; F286R,H,V; A307P,H,G; T313N,T,S; V339W,T,S; and G355R.

[0526] [125] The method of any one of paragraphs 121-124, further comprising recovering the variant.

[0527] [126] An enzyme composition comprising the variant of any one of paragraphs 1-115.

[0528] [127] A whole broth formulation or cell culture composition comprising the variant of any one of paragraphs 1-115.

[0529] [128] A method of decolorizing a dye, comprising treating the dye with a laccase variant of any one of paragraphs 1-115.

[0530] [129] Use of the variant of any one of paragraphs 1-115.

[0531] The invention described and claimed herein is not to be limited in scope by the specific aspects herein disclosed, since these aspects are intended as illustrations of several aspects of the invention. Any equivalent aspects are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In the case of conflict, the present disclosure including definitions will control.