CAR-EXPRESSING NK-92 CELLS AS CELL THERAPEUTIC AGENTS

20180282427 ยท 2018-10-04

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to an ErbB2-specific NK-92 cell or cell line containing a lentiviral vector encoding a chimeric antigen receptor and preferably two vector integration loci in its cellular genome. The present invention further relates to the use of the ErbB2-specific NK-92 cell or cell line in the prevention and/or treatment of cancer, preferably ErhB2-expressing cancers. The present invention further relates to the use of the ErbB2-specific NK-92 cell or cell line as targeted cell therapeutic agent and/or for adoptive cancer immunotherapy. The present invention further relates to a method for generating an ErbB2-specific NK-92 cell or cell line as well as to a method for identifying au ErbB2-specific NK-92 cell or cell line and to the ErbB2-specific NK-92 cell or cell line obtained or identified by the methods as well as their uses.

Claims

1.-15. (canceled)

16. A method of treating cancer in a subject comprising administering to the subject a therapeutically effective amount of ErbB2-specific NK-92 cells, the cells containing a lentiviral vector encoding a chimeric antigen receptor comprising an ErbB2-specific scFv antibody fragment, a hinge region, transmembrane and intracellular domains of CD28, and intracellular domain of CD3 zeta, and wherein said vector is genomically integrated, wherein administration treats the cancer in the subject.

17. The method of claim 16, wherein said vector is genomically integrated (i) in an intergenic region on chromosome 2, and (ii) in the TRAF2 gene on chromosome 9.

18. The method of claim 16, wherein the cell or cell line is characterized in that by PCR analysis of the genomic DNA of said cell or cell line at least one of the following amplification products is obtained: PCR with primers of SEQ ID NOs. 1 and 2 yields an amplification product with the nucleotide sequence of SEQ ID NO. 9; PCR with primers of SEQ ID NOs. 3 and 4 yields an amplification product with the nucleotide sequence of SEQ ID NO. 10; PCR with primers of SEQ ID NOs. 5 and 6 yields an amplification product with the nucleotide sequence of SEQ ID NO. 11; PCR with primers of SEQ ID NOs. 7 and 8 yields an amplification product with the nucleotide sequence of SEQ ID NO. 12.

19. The method of claim 16, wherein the cells show reduced or no natural cytotoxicity to ErbB2-negative cells.

20. The method of claim 16, wherein the cells show increased cytotoxicity to ErbB2-expressing tumor cells compared to unmodified NK-92 cells.

21. The method of claim 16, wherein the ErbB2-specific scFv antibody fragment comprises the amino acid sequence of SEQ ID NO. 13 (scFv FRP5).

22. The method of claim 16, wherein the ErbB2-specific scFv antibody fragment is encoded by the nucleotide sequence of SEQ ID NO. 14.

23. The method of claim 16, wherein the chimeric antigen receptor comprises the amino acid sequence of SEQ ID NO. 15 (full-length CAR).

24. The method of claim 16, wherein the chimeric antigen receptor is encoded by the nucleotide sequence of SEQ ID NO. 16.

25. The method of claim 16, wherein the cancer is an ErbB2-expressing cancer.

26. The method of claim 16, wherein the cancer is selected from the group consisting of breast cancer, ovarian cancer, gastric cancer, prostate cancer, squamous cell carcinoma, head and neck cancer, colon cancer, pancreatic cancer, uterine cancer, renal cell cancer, glioblastoma, medulloblastoma, sarcoma, and lung cancer.

27. The method of claim 16, wherein the method comprises pre-treatment of the cells by irradiation, preferably ?-irradiation.

28. The method of claim 16, wherein 1?10.sup.5 to 1?10.sup.7 cells are administered to the subject.

29. The method of claim 16, wherein the cells are administered intravenously.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0180] FIGS. 1A and 1B show chimeric antigen receptor expression and selective cytotoxicity of clonal NK-92/5.28.z cells.

[0181] FIG. 1A) is a schematic representation of lentiviral transfer plasmid pS-5.28.z-W encoding under the transcriptional control of the Spleen Focus Forming Virus promoter (SFFV) the chimeric antigen receptor (CAR) 5.28.z. CAR 5.28.z consists of an immunoglobulin heavy chain signal peptide (SP), the ErbB2-specific scFv (FRP5) antibody fragment (scFv), a hinge region (CD8a), followed by transmembrane and intracellular domains of CD28 and the intracellular domain of CD3?. The CAR-encoding sequence is flanked by 5 and 3 long terminal repeats (LTR) of the vector (not shown).

[0182] FIG. 1B) is a graph showing CAR-expression by the clonal NK-92/5.28.z cell line generated under GMP conditions by transduction with lentiviral vector S-5.28.z-W determined by flow cytometry with ErbB2-Fc fusion protein (open area). Unmodified NK-92 cells served as control (gray area).

[0183] FIG. 1C) are graphs showing specific cell killing by NK-92/5.28.z cells (filled circles) in FACS-based cytotoxicity assays at different effector to target ratios (E/T) using murine renal cell carcinoma cells as targets that stably express human ErbB2 (Renca-lacZ/ErbB2) or human EGFR (Renca-lacZ/EGFR) as a control. Unmodified NK-92 cells were included for comparison (open circles).

[0184] FIG. 1D) is a graph showing natural cytotoxicity of NK-92/5.28.z cells against NK-sensitive but ErbB2-negative targets compared to unmodified NK-92 cells using human K562 erythroleukemia cells as targets.

[0185] FIGS. 2A, 2B and 2C are graphs showing molecular characterization of clonal NK-92/5.28.z cells.

[0186] FIG. 2A) is a schematic representation of the integration sites of the lentiviral CAR vector S-5.28.z-W (shaded box) flanked by 5 and 3 long terminal repeat (LTR) sequences (filled boxes) in genomic DNA (open boxes). The PCR strategy to map the integration sites in the TRAF2 gene on chromosome 9 and in an intergenic region on chromosome 2 is indicated.

[0187] FIGS. 2B and 2C are images showing PCR analysis of vector integrations.

[0188] FIG. 2B) shows specific DNA sequences encompassing the junctions between the TRAF2 gene and the 5 end of the integrated CAR vector (TRAF2-CAR), and between the 3 end of the integrated CAR vector and the TRAF2 gene (CAR-TRAF2) amplified by PCR with genomic DNA from 3 different passages of NK-92/5.28.z cells as template and the indicated oligonucleotide primer pairs, yielding characteristic 587 and 503 bp amplification products. Genomic DNA of unmodified NK-92 cells as well as samples without template DNA (H.sub.2O) were included as controls.

[0189] For FIG. 2C), likewise, specific DNA sequences encompassing the junctions between the intergenic region in chromosome 2 and 5 (IGCHR2-CAR) and 3 ends (CAR-IGCHR2) of the integrated CAR vector were amplified, yielding characteristic 679 and 376 bp amplification products.

[0190] M: DNA marker (GeneRuler 100 bp Plus DNA Ladder, Thermo Scientific).

[0191] FIGS. 3A and 3B are graphs showing growth and cytotoxic activity of NK-92/5.28.z cells upon ?-irradiation.

[0192] For FIG. 3A), to investigate the effect on viability, NK-92/5.28.z cells were irradiated with 5 or 10 Gy and cultured for up to 72 hours. Proliferation was analyzed by counting viable cells at the indicated time points using trypan blue exclusion.

[0193] FIG. 3B) shows cytotoxic activity of NK-92/5.28.z cells 24 hours after irradiation with 10 Gy against ErbB2-positive MDA-MB453 and ErbB2-negative MDA-MB468 breast carcinoma cells determined in FACS-based cytotoxicity assays at different effector to target ratios (E/T) as indicated (filled circles). Unmodified NK-92 cells 24 hours after irradiation were included for comparison (open circles).

[0194] FIG. 4. Homing of NK-92/5.28.z cells to ErbB2-positive breast carcinomas in vivo.

[0195] Unmodified NK-92 (upper panel) or ErbB2-specific NK-92/5.28.z cells (lower panel) were labeled with fluorescent DiD labeling reagent and intravenously injected into NSG mice carrying established orthotopic MDA-MB453/EGFP breast carcinoma xenografts. Twenty-four hours after injection, tumors were excised, single cell suspensions were prepared, and analyzed for the presence of EGFP-expressing and DiD-labeled cells. DiD-positive NK cells are indicated in dark grey (lower right quadrants). EGFP-positive breast carcinoma cells (upper left quadrants) and double-negative murine stromal cells (lower left quadrants) are indicated in light grey. Double-positive events (upper right quadrant) represent conjugates of CAR-expressing NK-92/5.28.z and MDA-MB453/EGFP target cells. Representative flow cytometric data from one animal of each group are shown (n=3).

[0196] FIGS. 5A and 5B are graphs showing in vivo antitumor activity of NK-92/5.28.z cells.

[0197] For FIG. 5A), to investigate antitumor activity, NSG mice were intravenously injected with Renca-lacZ/ErbB2 renal cell carcinoma cells. Then animals were treated twice by i.v. injection of unmodified NK-92 or clonal NK-92/5.28.z cells at days 1 and 3 after tumor cell injection. Control mice received PBS. Four weeks after tumor challenge, lungs were excised and tumor nodules on the lung surface were counted.

[0198] For FIG. 5B), in a separate experiment, NSG mice injected with Renca-lacZ/ErbB2 cells were treated as described above with non-irradiated NK-92 or NK-92/5.28.z cells, or NK-92/5.28.z cells irradiated with 10 Gy as indicated. Mean values?SEM are shown; n=5. ns, p>0.05; *, p<0.05; **, p<0.01.

EXAMPLES

Example 1

1.1 Methods

Cells and Culture Conditions

[0199] Human K562 erythroleukemia cells (ATCC, Manassas, Va.) were maintained in RPMI 1640 medium (Lonza, K?ln, Germany). Human MDA-MB453 and MDA-MB468 breast carcinoma cells, and HEK 293T cells (all ATCC) were cultured in DMEM (Lonza). All media were supplemented with 10% heat-inactivated FBS, 2 mM L-glutamine, 100 U/ml penicillin, 100 ?g/ml streptomycin. Human NK-92 cells (ATCC) were propagated in X-VIVO 10 medium (Lonza) supplemented with 5% heat-inactivated human plasma (German Red Cross Blood Service Baden-W?rttembergHessen, Frankfurt, Germany) and 100 IU/ml IL-2 (Proleukin; Novartis Pharma, N?rnberg, Germany). Murine Renca-lacZ/ErbB2 and Renca-lacZ/EGFR renal cell carcinoma cells expressing human ErbB2 or EGFR were cultured in RPMI-1640 medium supplemented with 10% FBS, 2 mM L-glutamine, 100 U/ml penicillin, 100 ?g/ml streptomycin, 0.25 mg/ml zeocin and 0.48 mg/ml G418 (Maurer-Gebhard et al., 1998).

Generation of CAR-Expressing NK-92/5.28.z Cells

[0200] The CAR sequence 5.28.z was designed by in silico assembly of an immunoglobulin heavy chain signal peptide, ErbB2-specific scFv(FRP5) antibody fragment and a modified CD8? hinge region (wherein an unpaired cysteine within the hinge region was replaced by serine), followed by CD28 transmembrane and intracellular domains and CD3? intracellular domain. A codon-optimized fusion gene was synthesized (GeneArt, Regensburg, Germany) and inserted into lentiviral transfer plasmid pHRSIN-cPPT-WPREmut vector (Schambach et al., 2006), resulting in lentiviral transfer plasmid pS-5.28.z-W. VSV-G pseudotyped vector particles were generated and NK-92 cells were transduced as described previously (Sahm et al., 2012), and for cell clone NK-92/.5.28.z confirmed by PCR analysis of genomic DNA with oligonucleotide primers that yielded characteristic PCR products spanning the junctions between chromosomal DNA and integrated vector sequences.

Cytotoxicity Assays

[0201] Cytotoxicity of NK-92 cells towards target cells was analyzed in FACS-based assays as described (Sahm et al., 2012). Briefly, target cells were labeled with calcein violet AM (Molecular Probes, Invitrogen, Karlsruhe, Germany) and co-cultured with effector cells at various effector to target (E/T) ratios for 2 h at 37? C. After co-culture, 250 ?l of a 1 ?g/ml propidium iodide (PI) solution were added to each sample 5 min before flow cytometric analysis in a FACSCanto II flow cytometer (BD Biosciences, Heidelberg, Germany). Data were analyzed using FACSDiva software (BD Biosciences). To calculate specific cytotoxicity, the number of spontaneously lysed target cells in the absence of effector cells was subtracted from the number of dead target cells determined as calcein violet AM and PI double positive in the measured sample.

Irradiation of NK-92 Cells

[0202] NK-92/5.28.z and unmodified NK-92 cells were collected by centrifugation, counted, washed, resuspended in fresh growth medium and irradiated with 5 or 10 Gy using a Biobeam 2000 device (Gamma Service Medical, Leipzig, Germany). For in vitro proliferation and cytotoxicity assays, irradiated cells were washed, resuspended in fresh growth medium and cultured for up to 72 h. Proliferation was analyzed by counting viable cells at different time points using trypan blue exclusion. For in vivo experiments, cells were irradiated with 10 Gy and applied directly.

Tumor Homing of NK-92 Cells

[0203] EGFP-expressing MDA-MB453 breast carcinoma cells were derived by transduction of MDA-MB453 cells with an EGFP-encoding lentiviral vector and enrichment by flow cytometric cell sorting. Orthotopic breast carcinoma xenografts were induced in 4 to 6 weeks old female NOD-SCID IL2R ?.sup.null (NSG) mice (Charles River, Sulzfeld, Germany) by injection of 5?10.sup.6 MDA-MB453/EGFP cells suspended in Matrigel (BD Biosciences) into the mammary fat pad. When tumors were palpable, NK-92/5.28.z or unmodified NK-92 cells were labeled with DiD (1,1-dioctadecyl-3,3,3,3 tetramethylindodicarbocyanine) labeling reagent (Molecular Probes/Life Technologies, Darmstadt, Germany) as described (Tavri et al., 2009), and injected into the lateral tail vein of the tumor bearing mice (1?10.sup.7 cells/animal; 3 animals per group). Twenty-four hours after injection, mice were sacrificed, tumors were excised, single cell suspensions were prepared, and analyzed for the presence of EGFP-expressing and DiD-labeled cells in a FACSCanto II flow cytometer.

In Vivo Antitumor Activity

[0204] Four to 6 weeks old female NSG mice were injected with 1?10.sup.5 Renca-lacZ/ErbB2 cells into the lateral tail vein at day 0. Then animals were treated by i.v. injection of 1?10.sup.7 NK-92/5.28.z or unmodified NK-92 cells at days 1 and 3 after tumor cell injection (5 mice/group). Control mice received PBS. In separate experiments, NSG mice injected with Renca-lacZ/ErbB2 cells were also treated with irradiated NK-92/5.28.z cells (10 Gy), or non-irradiated NK-92/5.28.z and unmodified NK-92 cells as controls (5 mice/group). Four weeks after tumor challenge, all animals were sacrificed, lungs were excised, and tumor nodules on the lung surface were counted as described (Maurer-Gebhard et al., 1998).

Statistical Analysis

[0205] Differences between values were evaluated using the two-tailed unpaired Student's t test. P values <0.05 were considered significant. Statistical calculations were performed using Prism 5 software (GraphPad Software, La Jolla, Calif.).

1.2 Results

Generation of an ErbB2-Specific NK-92/5.28.z Single Cell Clone

[0206] The chimeric antigen receptor 5.28.z was used to generate a clinically applicable ErbB2-specific NK-92 cell line (FIG. 1A). VSV-G pseudotyped lentiviral CAR vector particles were produced and NK-92 cells from a certified NK-92 master cell bank (Arai et al., 2008) were transduced. Single cell clones were derived by limiting dilution, and CAR-expressing cells were identified by flow cytometric analysis with ErbB2-Fc fusion protein. A total of 15 CAR-expressing single cell clones were functionally and molecularly characterized, which harbored between one and four vector copies. One cell clone termed NK-92/5.28.z which displayed high and stable CAR-expression during continuous culture in a setting reflecting large-scale expansion under GMP conditions was selected for further analysis (FIG. 1B). Selective cytotoxic activity of the retargeted cells was evaluated using Renca-lacZ/ErbB2 murine renal cell carcinoma cells stably expressing human ErbB2. Clonal NK-92/5.28.z cells displayed high cytotoxicity towards these ErbB2-expressing target cells, which were resistant to unmodified NK-92 (FIG. 1C, left panel). In contrast, ErbB2-negative negative but otherwise isogenic Renca-lacZ/EGFR cells expressing epidermal growth factor receptor displayed no enhanced sensitivity to the effector cells (FIG. 1C, right panel). This indicates that cell killing was indeed mediated by interaction of CAR 5.28.z with its target antigen ErbB2.

[0207] Endogenous, CAR-independent cytotoxicity of NK-92/5.28.z cells was investigated using ErbB2-negative but NK-sensitive K562 human erythroleukemia cells as targets. While K562 cells were highly sensitive to CAR-negative unmodified NK-92 cells, they were killed to a much lower extent by ErbB2-specific NK-92/5.28.z cells (FIG. 1D).

[0208] Taken together, these data demonstrate that NK-92/5.28.z cells are highly selective and efficiently kill ErbB2-expressing tumor cells, while their endogenous cytotoxicity to ErbB2-negative targets is markedly reduced when compared to unmodified NK-92 cells.

Molecular Characterization of ErbB2-Specific NK-92/5.28.z Cells

[0209] Linear amplification-mediated PCR (LAM-PCR) and DNA sequencing revealed one vector integration each in an intergenic region on chromosome 2, and in the TRAF2 gene on chromosome 9 of clonal NK-92/5.28.z cells (FIG. 2A). The integration sites were confirmed by PCR analysis of genomic DNA of NK-92/5.28.z cells from three different passages during continuous culture over several months, thereby amplifying specific DNA sequences that encompass the junctions between the TRAF2 gene and the 5 end of the integrated CAR vector, and between the 3 end of the integrated CAR vector and the TRAF2 gene (FIG. 2B, upper panels), as well as specific DNA sequences that encompass the junctions between the intergenic region in chromosome 2 and 5 and 3 ends of the integrated CAR vector (FIG. 2B, lower panels). In each case, genomic DNA of the different passages of NK-92/5.28.z cells yielded the same characteristic amplification products of defined length and sequence, demonstrating long-term stability of the vector integrations. No amplification products were obtained with the same oligonucleotide primers upon PCR analysis of genomic DNA from unmodified NK-92 cells, indicating that specific PCR analysis of the CAR vector integrations also represents a powerful diagnostic tool to molecularly identify the NK-92/5.28.z cell clone.

a) Amplification product TRAF2-CAR (5)
CAR vector integration in TRAF2 gene
5 part of vector integration
PCR product TRAF2-CAR (5) from genomic DNA of NK-92/5-28.z cells

Primers:

[0210]

TABLE-US-00014 [SEQIDNO.1] TRAF2-F1: CTTCAGCAGGGACCAGAAACAA [SEQIDNO.2] CAR-R1: CCGCTTAATACTGACGCTCTCG
lower case letters: TRAF2 gene
upper case letters: vector sequence
Length: 587 nucleotides

TABLE-US-00015 SEQIDNO.9 cttcagcagggaccagaaacaaaactcacactctttcttctctgagttga 50 gactggaaaaatgaaagattgttttaggggaaacttgagggaacagtctg 100 ggcagcctgcagggcatggccctgttcctccagggctgggaaagtcagca 150 ctgctttctggtggcgaACTGGAAGGGCTAATTCACTCCCAACGAAGACA 200 AGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAG 250 CCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAA 300 AGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTC 350 TGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTA 400 GCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGC 450 TCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAG 500 GGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAA 550 GGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGG 587
b) Amplification product CAR-TRAF2 (3)
CAR vector integration in TRAF2 gene
3 part of vector integration
PCR product CAR-TRAF2 (3) from genomic DNA of NK-92/5-28.z cells

Primers:

[0211]

TABLE-US-00016 [SEQIDNO.3] CAR-F1: ATCGCCACGGCAGAACTCA [SEQIDNO.4] TRAF2-R1: GACCCTTCACCCAACGCTTAG
lower case letters: TRAF2 gene
upper case letters: vector sequence
Length: 503 nucleotides

TABLE-US-00017 SEQIDNO.10 ATCGCCACGGCAGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGG 50 GGCTAGGTTGCTGGGCACTGATAATTCCGTGGTGTTGTCGAATTCGATAC 100 TCGAGGTCGAGGCAATTCGAGCTCGGTACCTTTAAGACCAATGACTTACA 150 AGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAA 200 GGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGG 250 GTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAG 300 GGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTA 350 GTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACC 400 CTTTTAGTCAGTGTGGAAAATCTCTAGCAccttccctctgcagctgctgg 450 ctcagccgattgtatatgctgggagctctgcactaagcgttgggtgaagg 500 gtc 503
c) Amplification product IGCHR2-CAR (5)
CAR vector integration in intergenic region of chromosome 2
5 part of vector integration
PCR product IGCHR2-CAR (5) from genomic DNA of NK-92/5-28.z cells

Primers:

[0212]

TABLE-US-00018 [SEQIDNO.5] IGCHR2-F1: TCAGTGGAATGGGCAGCTTCAAGT [SEQIDNO.6] CAR-R2: TTCAGCAAGCCGAGTCCTGCGT
lower case letters: intergenic region chromosome 2
upper case letters: vector sequence
Length: 679 nucleotides

TABLE-US-00019 SEQIDNO.11 tcagtggaatgggcagcttcaagttgatgtcatttcaatagtaacttatt 50 tcagtctacatacttcccaagaatgcaccatctcttttttatgtatttat 100 tattttgagaaagagtctcactctgtcgcccaggctggagtgcaatggca 150 tgatcttggctcactgtaacctccgtctcctgggttcaagccattctcct 200 gtctcagcctcccgggtagtggggttataggcacacaccaccacgcccgg 250 ctaatttttgtatttttagtaaagatggggtttcaccatgttggccaggc 300 tgggctcaaactcttgacttcaggtgatccgcccaccttggcctcccaaa 350 gtgctgggatgacaggcACTGGAAGGGCTAATTCACTCCCAACGAAGACA 400 AGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAG 450 CCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAA 500 AGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTC 550 TGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTA 600 GCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGC 650 TCTCTCGACGCAGGACTCGGCTTGCTGAA 679
d) Amplification product CAR-IGCHR2 (3)
CAR vector integration in intergenic region of chromosome 2
3 part of vector integration
PCR product CAR-IGCHR2 (3) from genomic DNA of NK-92/5-28.z cells

Primers:

[0213]

TABLE-US-00020 [SEQIDNO.7] CAR-F2: ACTGATAATTCCGTGGTGTTGT [SEQIDNO.8] IGCHR2_CAR-R1: CACTGTGGCTCACTGCTAGA
lower case letters: intergenic region chromosome 2
upper case letters: vector sequence
Length: 376 nucleotides

TABLE-US-00021 SEQIDNO.12 ACTGATAATTCCGTGGTGTTGTCGAATTCGATACTCGAGGTCGAGGCAAT 50 TCGAGCTCGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCT 100 TAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCC 150 AACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGAC 200 CAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAA 250 GCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGT 300 TGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGG 350 AAAATCTCTAGCAgtgagccacagtg 376

Target Cell Killing by Irradiated NK-92/5.28.z Cells

[0214] In phase I clinical trials with unmodified NK-92, irradiation of cells with 10 Gy prior to infusion had been included as a safety measure to prevent permanent engraftment (Arai et al., 2008; Tonn et al., 2013). Similar safety measures may be important for clinical use of retargeted NK-92 cells. Hence, we tested the effects of ?-irradiation on growth and cytotoxic activity of clonal NK-92/5.28.z cells. Irradiation with 5 Gy was sufficient to prevent further replication, while the number of viable NK-92/5.28.z cells remained almost constant for 24 hours after exposure to 5 or 10 Gy before declining gradually (FIG. 3A). To assess effects on cytotoxic activity, NK-92/5.28.z cells irradiated with 10 Gy were cultured for 24 hours and then co-incubated for two hours with ErbB2-expressing human MDA-MB453 breast carcinoma cells as targets. Irradiated NK-92/5.28.z displayed high and specific cytotoxicity towards MDA-MB453 cells (65% specific lysis at an E/T ratio of 10:1), while they did not lyse ErbB2-negative human MDA-MB468 breast carcinoma cells (FIG. 3B). Neither MDA-MB453 nor MDA-MB468 cells were killed by irradiated unmodified NK-92 cells.

Homing of NK-92/5.28.z Cells to ErbB2-Positive Breast Carcinomas

[0215] The potential of NK-92/5.28.z cells to home to established tumors was investigated in an orthotopic breast carcinoma model. MDA-MB453 cells transduced with an EGFP-encoding lentiviral vector were implanted into the mammary fat pad of female NSG mice, and allowed to grow until tumors were palpable. Then NK-92/5.28.z and unmodified unmodified NK-92 cells were labeled with fluorescent DiD labeling reagent, and intravenously injected into the tumor-bearing animals. Twenty-four hours later, tumors were excised, single cell suspensions were prepared, and analyzed for the presence of EGFP-expressing tumor cells and DiD-labeled NK cells. In mice injected with unmodified NK-92, only a few of the NK cells were found in the tumors (FIG. 4, upper panel). In contrast, NK-92/5.28.z cells were strongly enriched in MDA-MB453/EGFP xenografts (FIG. 4, lower panel). Importantly, we also found conjugates of NK-92/5.28.z and MDA-MB453/EGFP cells in the cell suspensions prepared from the tumors. These data demonstrate that NK-92/5.28.z cells retain target cell specificity in vivo, and are capable of penetrating tissues and homing to distant tumor sites.

In Vivo Antitumor Activity of NK-92/5.28.z Cells

[0216] For evaluation of in vivo antitumor activity we chose an experimental lung metastasis model. NSG mice received intravenous injections of Renca-lacZ/ErbB2 cells, followed by i.v. injections of unmodified NK-92 or retargeted NK-92/5.28.z cells at days 1 and 3 after tumor cell inoculation. Control mice received PBS. Four weeks after tumor challenge, lungs were excised and tumor nodules on the lung surface were counted. While treatment with unmodified NK-92 cells did not affect metastasis formation in comparison to PBS-treated controls, retargeted NK-92/5.28.z cells reduced the number of pulmonary tumor nodules in this experiment by approximately 50% (mean number of lung surface metastases: PBS: 37.7?5.4; NK-92: 36?5.1; NK-92/5.28.z: 19?2.6; p<0.05) (FIG. 5A). To assess whether NK-92/5.28.z cells retain in vivo antitumor activity after ?-irradiation, a similar experiment was performed employing NK-92/5.28.z cells that were irradiated with 10 Gy prior to injection. Control animals were treated with non-irradiated NK-92/5.28.z or non-irradiated unmodified NK-92 cells. In comparison to treatment with unmodified NK-92 cells, both, non-irradiated and irradiated NK-92/5.28.z cells markedly reduced the number of pulmonary tumor nodules (mean number of lung surface metastases: NK-92: 68.3?9.1; NK-92/5.28.z: 21?4.9; irradiated NK-92/5.28.z: 14.4?5.5; p<0.01) (FIG. 5B). These data demonstrate specific antitumor activity of systemically applied NK-92/5.28.z cells against ErbB2-expressing tumor cells in a model reflecting disseminated disease. Importantly, viability and functionality of NK-92/5.28.z cells were transiently preserved after ?-irradiation at a dose that prevents further effector cell replication, permitting target cell recognition and killing in vivo.

REFERENCES

[0217] Arai S, Meagher R, Swearingen M, et al. Infusion of the allogeneic cell line NK-92 in patients with advanced renal cell cancer or melanoma: a phase I trial. Cytotherapy. 2008; 10(6):625-632. [0218] Boissel L, Betancur M, Wels W S, et al. Transfection with mRNA for CD19 specific chimeric antigen receptor restores NK cell mediated killing of CLL cells. Leuk Res. 2009; 33(9):1255-1259. [0219] Geller M A, Miller J S. Use of allogeneic NK cells for cancer immunotherapy. Immunotherapy 2011; 3:1445-1459. [0220] Gong et al., Characterization of a human cell line (NK-92) with phenotypical and functional characteristics of activated natural killer cells. Leukemia. 1994 April; 8(4):652-8. [0221] Grupp S A, Kalos M, Barrett D, et al. Chimeric antigen receptor-modified T cells for acute lymphoid leukemia. N Engl J Med. 2013; 368(16):1509-1518. [0222] Hynes N E, Lane H A. ERBB receptors and cancer: the complexity of targeted inhibitors. Nat Rev Cancer. 2005; 5(5):341-354. [0223] Kalos M, June C H. Adoptive T cell transfer for cancer immunotherapy in the era of synthetic biology. Immunity. 2013; 39(1):49-60. [0224] Koch J, Steinle A, Watzl C, et al. Activating natural cytotoxicity receptors of natural killer cells in cancer and infection. Trends Immunol. 2013; 34(4):182-191. [0225] Maurer-Gebhard M, Schmidt M, Azemar M, et al. Systemic treatment with a recombinant erbB-2 receptor-specific tumor toxin efficiently reduces pulmonary metastases in mice injected with genetically modified carcinoma cells. Cancer Res. 1998; 58(12):2661-2666. [0226] M?ller T, Uherek C, Maki G, et al. Expression of a CD20-specific chimeric antigen receptor enhances cytotoxic activity of NK cells and overcomes NK-resistance of lymphoma and leukemia cells. Cancer Immunol Immunother. 2008; 57(3): 411-423.

[0227] Sahm C, Sch?nfeld K, Wels W S. Expression of IL-15 in NK cells results in rapid enrichment and selective cytotoxicity of gene-modified effectors that carry a tumor-specific antigen receptor. Cancer Immunol Immunother. 2012; 61(9): 1451-1461. [0228] Schambach A, Bohne J, Baum C, et al. Woodchuck hepatitis virus post-transcriptional regulatory element deleted from X protein and promoter sequences enhances retroviral vector titer and expression. Gene Ther. 2006; 13 (7): 641-645. [0229] Schmidt M, Carbonaro D A, Speckmann C, et al. Clonality analysis after retroviral-mediated gene transfer to CD34+ cells from the cord blood of ADA-deficient SCID neonates. Nat Med. 2003; 9(4): 463-468. [0230] Tavri S, Jha P, Meier R, et al. Optical imaging of cellular immunotherapy against prostate cancer. Mol Imaging. 2009; 8(1):15-26.

[0231] Tonn T, Schwabe D, Klingemann H G, et al. Treatment of patients with advanced cancer with the natural killer cell line NK-92. Cytotherapy. 2013; 15(12):1563-1570.