MUTANT-TYPE URICASE, PEG MODIFIED MUTANT-TYPE URICASE, AND APPLICATION THEREOF

20180282707 ยท 2018-10-04

    Inventors

    Cpc classification

    International classification

    Abstract

    A mutant-type uricase, PEG modified mutant-type uricase, and application thereof. The mutant-type uricase has a cysteine residue introduced by recombination, the cysteine residue is located at an inactive region of the uricase, and one or more PEGs are coupled to the mutant-type uricase. The resulting PEGylated mutant-type uricase has characteristics of a half-life extension, product uniformity, and stable enzyme activity. Therefore, the present invention has a wide future application range.

    Claims

    1. A mutant uricase, which has a recombinantly introduced cysteine residue, and the cysteine residue is located in an inactive region of the uricase.

    2. An isolated polynucleotide, which encodes the mutant uricase of claim 1.

    3. A vector, which comprises the polynucleotide of claim 2.

    4. A host cell, which comprises the vector of claim 3 or has the polynucleotide of claim 2 integrated into its genome.

    5. A method for producing the mutant uricase of claim 1, comprising the steps of: Cultivating a host cell of claim 4 under conditions suitable for expression, thereby expressing the mutant uricase of claim 1; and Isolating the mutant uricase.

    6. A PEGylated mutant uricase, wherein the mutant uricase is the mutant uricase of claim 1, and the PEGylation site is the position of the recombinantly introduced cysteine residue.

    7. A pharmaceutical composition, which comprises: the pegylated mutant uricase of claim 6; and a pharmaceutically acceptable carrier.

    8. Use of the mutant uricase of claim 1, the pegylated mutant uricase of claim 6 and the pharmaceutical composition of claim 7 for preparing a drug for the treatment of gout and/or reduction of uric acid levels.

    9. A method for preparing the pegylated mutant uricase of claim 6, comprising the steps of: (i) providing a mutant uricase of claim 1; (ii) the mutant uricase of step (i) is subjected to a PEGylation treatment, thereby forming the pegylated mutant uricase of claim 6.

    10. A non-therapeutic method for reducing the level of uric acid in a mammal's body fluid or tissue, comprising the steps of: administering to a subject the pegylated mutant uricase of claim 6; and detecting the level of uric acid in the body fluid or tissue of the subject.

    Description

    DESCRIPTION OF DRAWINGS

    [0077] FIG. 1 shows a site-directed mutated location diagram in a three-dimensional, stereo simulation structure of a wild-type uricase wherein, FIG. 1A is a lateral view; FIG. 1B is an apical view.

    [0078] FIG. 2 shows the results of a electrophoresis of the vector plasmid pET3d and the target fragment mutant PBC double enzyme digested by NcoI and BamHI (the plasmid pET24d is not shown and the results are the same), wherein PBC represents the wild-type uricase of the present invention.

    [0079] FIG. 3a shows a PCR identification chart of multiple mutants with mutation points within the sequence. Wherein: 1,2: K103C; 3,4: N148C; 5,6: Q177C; 7,8: G202C; 9,10: K228C; M: Marker (molecular weight standard); 11: negative control (NC); 13: G274C; 14,15: K291C.

    [0080] FIG. 3b shows a PCR identification chart of 2 mutants with the mutation points at the end of the sequence. Wherein, 1-3: N-ter-C; 4-6: C-ter-C; M: Marker (molecular weight standard).

    [0081] FIG. 4a shows that after the seven mutants with the mutation points within the sequence were induced by IPTG, the expression of the recombinant protein is identified by SDS-PAGE. Wherein, M: Marker (molecular weight standard); 1: precipitation of wild type PBC; 2: K103C supernatant; 3: K103C precipitation; 4: N148C supernatant; 5: N148C precipitation; 6: Q177C supernatant; 7: Q177C precipitation; 8: G202C supernatant; 9: G202C precipitate; 10: K228C supernatant; 11: K228C precipitation; 12: G274C supernatant; 13: G274C precipitation; 14: K291C supernatant; 15: K291C precipitation. Wherein, the molecular weight of the expressed uricase protein (monomer) is about 35 Kda.

    [0082] FIG. 4b shows that after the two mutants with the mutation points at the end of the sequence was induced by IPTG, the expression of the recombinant protein is identified by SDS-PAGE. Wherein, M: Marker (molecular weight standard); 1: precipitation of a wild-type PBC; 2,4,6: N-ter-C supernatant; 3,5,7: N-ter-C precipitation; 8,10,12: C-ter-C supernatant; 9,11,13: C-ter-C precipitation. Wherein the molecular weight of the expressed uricase protein (monomer) is about 35 Kda.

    [0083] FIG. 5a shows a SDS-PAGE identification result of multiple recombinant uricase and wild-type uricase proteins with mutation points within the sequence modified by PEG. Wherein, M: Marker (molecular weight standard); 1: mPEG-K103C; 2: mPEG-N148C; 3: mPEG-Q177C; 4: mPEG-G202C; 5: mPEG-G274C; 6: mPEG-K291C; 7: mPEG-K228C; 8: mPEG-PBC (a wild-type uricase protein).

    [0084] FIG. 5b shows a SDS-PAGE identification result of two recombinant uricase and wild-type uricase proteins with mutation points at the end of the sequence modified by PEG. Wherein, M: Marker (molecular weight standard); 1: mPEG-C-ter-C; 2: mPEG-N-ter-C; 3: mPEG-PBC (a wild-type uricase protein).

    [0085] FIG. 6 shows a comparison result of pH stability between a PEG-modified recombinant uricase PEG-K103C and an unmodified K103C.

    [0086] FIG. 7 shows a comparison result of thermal stability between a PEG-modified recombinant uricase PEG-K103C and an unmodified K103C.

    [0087] FIG. 8 shows a serum enzyme activity-time profile in mice after a single administration of a PEG-modified recombinant protein PEG-K103C and an unmodified K103C.

    DETAILED DESCRIPTION OF INVENTION

    [0088] After extensive and intensive researches, the inventors have unexpectedly found that although a wild-type uricase has multiple cysteine sites, it can not be effectively PEGylated, and if a cysteine is artificially introduced in a specific position (such as, an inactive region, a N-terminus and/or a C-terminus) of a recombinant uricase, the resulting uricase mutant can retain more than 70% of uricase activity (even with an increase in activity), and after the above uricase mutants are PEG site-directed modified, the resulting PEGylated uricase mutants have characteristics, such as longer half-life, homogenization of the product, and more stable enzyme activity. Based on the above findings, the present invention is completed.

    [0089] Terms

    [0090] As used herein, the terms mutant type uricase, mutant uricase and uricase mutant can be used interchangeably and all refer to a mutant protein of the first aspect of the present invention which incorporates a cysteine residue and retains the uricase activity. The recombination introduction of cysteine is a site-directed introduction, and in particular, a cysteine is introduced at the N-terminus, C-terminus of a uricase, or the inactive region of a uricase. Uricase, after introduction of cysteine (i.e., the mutant uricase) still retains at least 70% (e.g., 70-200%, preferably 80-150%, and more preferably 90-140%) of the activity of a wild-type uricase.

    [0091] The present invention also provides a derivative polypeptide of the mutant uricase as described above, which may further have a substitution, a deletion or an addition of one or several amino acid residues (preferably 1-20, more preferably 1-15, more preferably 1-3, most preferably 1) based on the mutant uricase as described above, and the derivative polypeptide possesses the uricase activity.

    [0092] As used herein, the PEG refers to polyethylene glycol, and specifically refers to a mixture of ethylene oxide polycondensate and water, represented by the general formula H(OCH.sub.2CH.sub.2)OH, wherein n4. Typically, the molecular weight of a PEG molecule is 5 KDa, preferably 10-40 KDa, more preferably 15-30 KDa.

    [0093] The Starting Uricase

    [0094] In the present invention, the uricase used as a starting uricase is not particularly limited and may be a uricase of any source. Representative examples include, but are not limited to, a mammalian uricase, a recombinant uricase. In addition, the starting uricase may be either a wild-type uricase or a mutant uricase containing a mutation.

    [0095] A preferred starting uricase is a chimeric protein comprising two or more mammalian amino acid sequences, such as a recombinant uricase comprising segments of a pig uricase and a baboon uricase.

    [0096] In another preferred embodiment, the N-terminus of the starting uricase is derived from a pig uricase and the C-terminus is derived from a baboon uricase. More preferably, the N-terminus of the starting uricase is derived from 225 amino acids of the pig uricase and the C-terminus is derived from 79 amino acids of the baboon uricase.

    [0097] The amino acid sequence of a typical starting uricase is shown in SEQ ID NO.: 1.

    [0098] Preparation of the Mutant Uricase

    [0099] A full length nucleotide sequence of the mutant uricase of the present invention or a fragment thereof can generally be obtained by a PCR amplification method, a recombinant method or an artificial synthetic method. For a PCR amplification method, primers can be designed according to the relevant nucleotide sequences disclosed in the present invention, particularly the open reading frame sequences, and the commercially available cDNA libraries or cDNA libraries prepared by the conventional methods known to the skilled in the art were used as a template, and amplified and the relevant sequences were obtained. When the sequence is relatively long, two or more PCR amplifications are usually needed, and then each of the amplified fragments are spliced together in the correct order.

    [0100] Once the relevant sequence is obtained, the relevant sequence can be obtained in bulk using a recombination method. Usually the sequence is cloned into a vector, and then transferred into a cell, and then the relevant sequence is seperated and obtained from the proliferation of host cells by a conventional method.

    [0101] In addition, the relevant sequence can also be synthesized using artificial synthesis methods, particularly when the fragment is relatively short. In general, a very long fragment can be obtained by firstly synthesizing multiple small fragments and then ligating them.

    [0102] At present, a DNA sequence encoding the protein of the present invention (or fragments thereof, or derivatives thereof) can completely be obtained by chemical synthesis. The DNA sequence can then be introduced into a variety of existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequences of the present invention by chemical synthesis.

    [0103] The present invention also relates to a vector containing a polynucleotide of the present invention, and a host cell produced by genetic engineering using a vector or a mutant uricase encoding sequence of the present invention, and a method for producing the polypeptide of the present invention by recombinant techniques.

    [0104] With the conventional recombinant DNA technique (Science, 1984; 224: 1431), the polynucleotide of the present invention can be used to express or produce the mutant uricase polypeptide. Generally, the method comprises the following steps:

    [0105] (1) Transforming or transfecting a suitable host cell with a polynucleotide (or variant) encoding the mutant uricase polypeptide of the present invention or a recombinant expression vector containing said polynucleotide;

    [0106] (2) Culturing the host cell in a suitable culture medium;

    [0107] (3) Isolating and purifying protein from the culture medium or cell.

    [0108] Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to the skilled in the art. When the host is a prokaryote such as E. coli (e.g., E. coli BL21(DE3)pLysS, BL21(DE3)), competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl.sub.2, the steps used are well known in the art. Another method is to use MgCl.sub.2. If necessary, the transformation can also be carried out by means of electroporation. When the host is an eukaryote, the following DNA transfection methods are available: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, and the like.

    [0109] The obtained transformants can be cultured by a conventional method to express a polypeptide encoded by a gene of the present invention. According to the host cell used, the medium used in the culture may be selected from a variety of conventional media. And the host cell can be cultured under conditions suitable for the growth of the host cell. After the host cell grows to the appropriate cell density, the selected promoter is induced with a suitable method, such as temperature conversion or chemical induction, and the cells are incubated for a further period of time.

    [0110] The recombinant polypeptide in the method above may be included in the cells, or expressed on the cell membrane, or secreted out of the cell. If desired, the physical, chemical and other properties can be utilized in various isolation methods to isolate and purify the recombinant protein. These methods are well-known to those skilled in the art. The examples of these methods include, but are not limited to, conventional renaturation treatment, treatment by protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, supercentrifugation, molecular sieve chromatography (gel chromatography), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC), and any other liquid chromatography, and the combinations thereof.

    [0111] The amino acid sequence of a typical mutant uricase is shown in SEQ ID NO.: 2.

    [0112] The nucleotide sequence of a typical mutant uricase is shown in SEQ ID NO.: 3.

    [0113] PEGylated Mutant Uricase

    [0114] Mutant uricases can be covalently bound to PEG via chemical bonds using methods known in the art. In general, PEG may bind to a mutant uricase through a linking group, wherein the linking group may be selected from a group consisting of: succinimidyl, acylamino, imide groups, carbamate, ester groups, epoxy groups, carboxyl groups, hydroxyl groups, carbohydrate groups, tyrosine groups, cysteine groups, histidine groups, and combinations thereof. In addition, mutant uricases can also be directly coupled to PEG via amino, sulfhydryl, hydroxyl, or carboxyl groups (i.e., no linking groups).

    [0115] In a preferred embodiment of the present invention, PEG is coupled via a chemical bond (e.g., a covalent bond) to a recombinantly introduced cysteine residue on a mutant uricase.

    [0116] In a preferred embodiment of the present invention, PEG is site-directed modified. Mutant uricases can be monomeric or tetrameric. The enzyme may be covalently bound to 1 to 4, preferably 1 to 3, more preferably 1 to 2 PEG (s). These PEGs can be linear or branched.

    [0117] The molecular weight of a preferred pegylated mutant uricase (tetramer) is 160,000-220,000 Da.

    [0118] Pharmaceutical Compositions

    [0119] The present invention also provides a pharmaceutical composition comprising an effective amount of a pegylated mutant uricase of the present invention and a pharmaceutically acceptable carrier. In general, the pegylated mutant uricase of the present invention can be formulated in a non-toxic, inert, and pharmaceutically acceptable aqueous carrier media, wherein the pH is generally about 5-8, preferably, about 6-8.

    [0120] As used herein, the term effective amount or effective dose refers to an amount that can produce a function or activity for humans and/or animals and that can be accepted by humans and/or animals, such as 0.001-99 wt %; preferably 0.01-95 wt %; more preferably, 0.1-90 wt %.

    [0121] As used herein, a pharmaceutically acceptable ingredient is a substance that is suitable for humans and/or mammals without undue adverse side effects (such as toxicity, irritation, and allergic reaction), i.e., which has a reasonable benefit/risk ratio. The term pharmaceutically acceptable carrier refers to a carrier for the administration of a therapeutic agent, including various excipients and diluents.

    [0122] The pharmaceutical composition of the present invention contains a safe and effective amount of the pegylated mutant uricase of the present invention and a pharmaceutically acceptable carrier. Such carriers include, but are not limited to, saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. In general, the pharmaceutical preparation should be matched with the administration method, and the pharmaceutical composition of the present invention can be prepared as an injection, for example, prepared by a conventional method using a physiological saline or an aqueous solution containing glucose and other adjuvants. The pharmaceutical composition is preferably manufactured under aseptic conditions. The administration dosage of active ingredient is a therapeutically effective amount. The pharmaceutical preparation of the present invention can also be made into a sustained-release preparation.

    [0123] The effective amount of the pegylated mutant uricase of the present invention may vary depending on the mode of administration and the severity of the disease to be treated. The choice of preferred effective amount can be determined by one of ordinary skill in the art based on various factors (e.g., by clinical trials). Such factors include, but are not limited to, the pharmacokinetic parameters of the pegylated mutant uricase of the present invention such as bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated by the patient, the weight of the patient, and the patient's immunity status, route of administration, etc. For patients with high uric acid levels, in general, when the PEGylated mutant uricase of the present invention is administered at a dose of about 0.5 mg to 100 mg/kg animal body weight (preferably 1 mg to 50 mg/kg animal body weight) per day, a satisfactory result can be obtained. For example, several separate doses may be administered daily, or the dose may be proportionally reduced, as urgent required by the therapeutic situation.

    [0124] Prior to injection, the pegylated mutant uricase of the present invention may be mixed with a phosphate buffered saline solution or any other suitable solution known to those skilled in the art, and the pharmaceutical composition of the present invention may be administered as a lyophilate or a liquid formulation as desired.

    [0125] A Method for Reducing Uric Acid Levels in Body Fluids or Tissues

    [0126] In another preferred embodiment, the method comprises: ingesting the pharmaceutical composition of the present invention. The subject is human.

    [0127] In another preferred embodiment, the method comprises: ingesting the pharmaceutical composition of the present invention. The subject is an animal, preferably a rat, a rabbit.

    [0128] The main advantages of the present invention include:

    [0129] (1) In the present invention, a cysteine is site-directed introduced into a uricase, and the mutant uricase formed after the introduction of the cysteine can retain at least 70% activity (e.g. 70-200%, preferably 80-150%, more preferably 90-140%) of a wild-type uricase.

    [0130] (2) The cysteine residue in the mutant uricase of the present invention is coupled with PEG to obtain a pegylated mutant uricase. The PEG-modified mutant uricase has the following characteristics: an extended half-life, homogenization of the product, and a stable enzyme activity.

    [0131] The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only for illustrating the present invention and not intended to limit the scope of the present invention. The conditions of the experimental methods not specifically indicated in the following examples are usually in accordance with conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions described in the Journal of Microbiology: An Experimental Handbook (edited by James Cappuccino and Natalie Sherman, Pearson Education Press) or the manufacturer's proposed conditions. Unless otherwise specified, percentages and parts are percentages by weight and parts by weight.

    [0132] Unless otherwise specified, the materials used in the examples are all commercially available products, in which plasmids and E. coli are purchased from Novagen.

    Example 1 Determination of the Mutation Site

    [0133] After extensive analysis and researches, 8 mutation sites (site-directed mutation to Cys) were determined, of which 6 sites were exposed to the outside of the tetramer, and 2 sites were located at the C terminal and the N terminal (Table 1, FIG. 1).

    TABLE-US-00001 TABLE 1 Selection of different mutation sites and the amino acids replaced by cysteine (Cys) mutation position No. (monomer) original animo acid K103C 103 Lys N148C 148 Asn Q177C 177 Gln G202C 202 Gly K228C 228 Lys K291C 291 Lys N-ter-C 0 an Cys is introduced C-ter-C 305 an Cys is introduced

    Example 2 Construction of Mutant Strains

    [0134] 2.1 Obtainment of the Mutant Gene

    [0135] K291C, mutation at N terminal and C terminal were obtained by a method of full sequence synthesis, K103C, N148C, Q177C, G202C, K228C, G274C were obtained by duplex PCR, and the sequences of the primers were shown as follows:

    TABLE-US-00002 TABLE2 primerdesignfordifferentmutationsequences SEQID NameofthePrimer Sequence(5-3) NO.: PBC-F(containing GCATCCGATGACCCAATCCATGGCT 4 aNcoIsite) PBC-R(containing ACCCAATGGATCCTCATCACAGTCT 5 aBamHIsite) PBC-K103C-F TTTCCTTTCTTCCTTCTGTCATGTCATCAGAGCT 6 CA PBC-K103C-R TGAGCTCTGATGACATGACAGAAGGAAGAAAG 7 GAAA PBC-N148C-F GAGGTTGAACAGATAAGGTGTGGACCTCCAGTC 8 ATT PBC-N148C-R AATGACTGGAGGTCCACACCTTATCTGTTCAAC 9 CTC PBC-Q177C-F AAGGATTCATCAAGGACTGCTTCACCACCCTCC 10 CTG PBC-Q177C-R CAGGGAGGGTGGTGAAGCAGTCCTTGATGAATC 11 CTT PBC-G202C-F CGCTACCACCAGTGCAGAGATGTGGACTTTGA 12 PBC-G202C-R TCAAAGTCCACATCTCTGCACTGGTGGTAGCG 13 PBC-K228C-F AATTTGCTGGGCCCTATGACTGTGGCGAGTACT 14 CA PBC-K228C-R TGAGTACTCGCCACAGTCATAGGGCCCAGCAAA 15 TT

    [0136] 2.2 Construction of the Expression Plasmid

    [0137] The plasmid pET3d (purchased from Novagen) or pET24d (purchased from Novagen) and a target fragment were subjected to a double-enzyme digestion, respectively (FIG. 2), recovered and ligated with a T4 ligase, all of the ligation products were added into 50 L of freshly thawed common Escherichia coli (for example, DH5 competent cell), gently blended, placed in an ice-bath for 30 mins, heat-shocked at 42 C. for 90s; and immediately placed in an ice-bath for 2 min; then 500 L of a sterile LB medium was added and blended, cultured at 37 C., 200 rpm for 1h for rendering the bacteria recover, coated on the plate containing the corresponding resistance; monoclonal colonies were selected; and the successfully transformed strains were identified by PCR.

    [0138] 2.3 Construction of the Mutant Strains

    [0139] The plasmid was extracted, the plasmids that were correctly sequenced as described above were transformed into E. coli BL21(DE3)pLysS (purchased from Novagen) and BL21(DE3) (purchased from Novagen) respectively to construct expression strains (mutant strains), and the mutant strains were identified by PCR (FIG. 3a and FIG. 3b).

    Example 3 Expression of Mutant Uricase and Determination of its Activity

    [0140] BL21(DE3)pLysS-pET3d-PBC-C grown on Amp and Ch1 double-antibody plate and BL21(DE3)-pET24d-PBC-C grown on Kan monoclonal antibody plate were activated in 5 ml of tubes, respectively, overnight at 37 C., 220 rpm, transferred to 100 ml of shake flasks, shaked for 2h at 37 C., 220 rpm, to OD600 of about 0.6; IPTG was added for the induction overnight at 28 C., 220 rpm; the supernatant was removed by centrifugation at 8000 rpm and the bacteria was collected; the bacteria was resuspended in 1/10 volume of the bacteria liquid, and then was subjected to supersonic treatment over 5s at 20 kHz, then stopped for 5s until completely crushed, separated by centrifugation, the supernatant and precipitate after broken were detected by SDS-PAGE electrophoresis (FIG. 4a and FIG. 4b); after the above precipitate was resuspended and rinsed once with an equal volume of PBS, the precipitate was obtained by centrifugation at 12000 rpm for 10 min, and dissolved in 0.1M, pH 10.12 of CBS, and the supernatant was obtained by centrifugation at 12000 rpm for 10 min and used as a enzyme crude extract.

    [0141] The activity of uricase was detected by UV spectrophotometry, enzymatic reaction rate was detected by measuring the decrease in absorbance at 290 nm caused by the oxidation of uric acid to allantoin. The enzyme activity unit is defined as follows: at 37 C., pH 8.5, the amount of uricase needed to catalyze the decomposition of 1 mol of uric acid per minute is defined as 1 enzyme activity unit. The efficacy of uricase is represented as the activity unit of protein per mg (U/mg). Through preliminary experiments, the absorption spectrum of uricase has been scanned and showed a maximum absorption peak at 290 nm, and the extinction coefficient of 1 mM uric acid at 290 nm was 12.04 mM-1 cm-1. Therefore, the oxidation of 1 M uric acid in the reaction caused the reduction of absorbance by 12.04 mAu. The absorbance is derived from the linear part as the changes of the uric acid concentration. Wherein the calculation formula of enzyme activity is shown as follows:


    Enzyme activity (U/ml)=(OD.sub.bOD.sub.t)*V.sub.t*df/12.04*1.0*Vs*t

    [0142] (Odb: the absorbance value in a blank control tube; Odt: the absorbance value in a detection tube; Vt: the total reaction volume, 1.28 ml; df: the dilution fold before sample addition to the system; Vs: the total volume after adding the test sample of uricase, 0.2 ml; t: the reaction time, 5 min; 12.04: the molar extinction coefficient of the substrate, uric acid under the test conditions; 1.0: optical path of cuvette, 1.0 cm)


    Enzyme activity (U/mg)=(U/ml)/C

    [0143] (C: enzyme concentration, mg/ml)

    [0144] Determination method of the activity:

    [0145] (1) 1 mL of uric acid working solution was added to 2 EP tubes, respectively, marked as a reaction tube and a control tube, and subjected to the warm bath at 37 C. for 5 mins;

    [0146] (2) Reaction tube: 200 L of diluted enzyme solution was added at 37 C., and reacted for 5 min; control tube: no treatment at 37 C. and reacted for 5 min;

    [0147] (3) Reaction tube: 80 L, 20% of KOH was added to quench the reaction; control tube: after 80 L, 20% of KOH was added to quench the reaction, 200 L of diluted enzyme solution was added;

    [0148] (4) UV absorption wavelength was determined at 290 nm.

    [0149] The results were shown in Table 3. The results showed that after the E. coli was induced to express the mutant uricase, the activity retention and protein concentration of the mutant strains K103C and K291C exhibited a significant advantage.

    TABLE-US-00003 TABLE 3 Protein extraction concentration and activity of recombinant uricase of different mutants average specific activity average protein activity of retention concentration enzyme No. ratio mg/mL U/mg K103C 104% 3.09 12.82 N148C 125% 2.87 17.11 Q177C 88% 3.47 16.44 G202C 114% 3.25 22.23 K228C 148% 4.08 16.37 K291C 111% 3.45 15.98 N-ter-C 133% 1.63 20.11 C-ter-C 108% 2.05 12.07 Note: -ter- represents terminal.

    [0150] Wherein N-ter-C represents that a Cys is added at N terminal, whereas C-ter-C represents that a Cys is added at C terminal.

    Example 4 PEG Modification for the Mutant Uricase

    [0151] PBC of different mutants was formulated to a concentration of 2 mg/ml, with a molar ratio to MAL-mPEG (maleimide-type PEG, with a molecular weight of approximately 20 kD) of 1:2, a final reaction protein concentration of 1 mg/ml, pH 7, reacted at room temperature for 2h, and the electrophoresis detection was performed.

    [0152] The results were shown in FIGS. 5a and 5b. The results showed that the unmutated wild-type uricase could not be pegylated (lane 8 in FIG. 5a and lane 3 in FIG. 5b), whereas each mutant uricase after site-directed mutagenesis could be PEGylated, wherein the K103C mutant has the highest modification efficiency.

    [0153] K103C mutant was taken as an example. After PEGylation, the molecular weight of K103C monomer was 35 Kda, and the molecular weight of a PEG molecule was 20 Kda. Due to the hydration of the PEG molecule, the actual apparent molecular weight could be increased by approximately 1.5-2.5 times. Therefore, after PEGylation, the molecular weight of the uricase monomer will be about 65-85 kDa. The actual experiments showed that there was a protein band at a position of about 70 kDa, indicating that this band was a pegylated uricase monomer (FIG. 5a).

    [0154] The mutant with a Cys added at N-terminal was taken as an example. After PEGylation, the molecular weight was about 65-85 Kda. The band at about 70 Kda in the figure was a PEG-modified monomer uricase, which showed that the enzyme added with Cys can be modified by PEG. (FIG. 5b)

    [0155] On a molar basis, one mole of the mutant uricase was modified by about 0.5-0.8 moles of PEG on average.

    Example 5 Determination of Properties for the PEG-Modified Mutant Strain K103C (PEG-K103C)

    [0156] 5.1 Determination of Stability

    [0157] pH stability: the mutant uricases, K103C and PEG-K103C were formulated into solutions with the same concentration, pH was adjusted to 5, 6, 7, 8, 9, 10, and the enzyme activity was determined after placed for 2h.

    [0158] Temperature stability: the mutant uricases, K103C and PEG-K103C were placed at 4 C., 20 C., 37 C., 50 C., 60 C. for 2h, and the enzyme activity was then determined.

    [0159] The results were shown in FIG. 6 and FIG. 7.

    [0160] The above results showed that the mutant uricase K103C had a wider range of pH tolerance after PEG modification, especially at physiological pH, the activity was greatly improved, and the thermal stability was also improved. After incubated at 40 C. for 2 hours, the good activity was still maintained.

    [0161] 5.2 Determination of Michaelis Constant

    [0162] By comparing Michaelis constant, the maximum enzymatic reaction rate and the catalytic constant of the mutant K103C before and after PEG modification, the effect of PEG modification on mutant uricase was evaluated.

    TABLE-US-00004 TABLE 4 Michaelis constant calculation for PEG-K103C absorbance custom-character (M) A290 (mAu) 0.04 25.00 0.0269 37.24 0.06 16.67 0.0283 35.29 0.08 12.50 0.0302 33.07 0.10 10.00 0.0309 32.40 0.12 8.33 0.0310 32.29

    [0163] The data below was obtained by software calculation and analysis:

    [0164] Km=0.0108 AAmax=0.034 slope=0.3184 R2=0.9713

    [0165] Vmax=1.823 M/min kcat=743.78 min-1

    TABLE-US-00005 TABLE 5 Michaelis constant calculation for the recombinant urate oxidase K103C absorbance custom-character (M) A290 (mAu) 0.04 25.00 0.0310 32.31 0.06 16.67 0.0344 29.10 0.08 12.50 0.0344 29.10 0.10 10.00 0.0367 27.27 0.12 8.33 0.0361 27.72

    [0166] The data below was obtained by software calculation and analysis:

    [0167] Km=0.0114 AAmax=0.040 slope=0.2891 R2=0.9265

    [0168] Vmax=2. 333 M/min kcat=951. 84 min-1

    [0169] The results were shown in Table 4, Table 5. The results showed that after PEG modification, the mutant K103C exhibited little change in Michaelis constant, indicating that the modification of PEG did not shield active sites of the enzyme, largely retaining the affinity of the enzyme to the substrate; however, the maximum reaction rate and catalytic constant after enzyme modification were slightly lower than that before modification, which may be related to the wrapping effect of PEG on the enzyme, thereby making the enzymatic reaction more gentle and more suitable for the physiological environment in vivo.

    [0170] 5.3 Determination of the Half-Life

    [0171] 30 5-week-old BABL/C male mice (20 g2 g), were randomly divided into 3 groups. In Group 1 (10 mice), PEG-modified recombinant uricase PEG-K103C was injected via tail vein at a dose of 10 mg/kg. After 2 h, 4 h, 8 h, 16 h, 24 h, 36 h, 48 h, 72 h, 96 h, 120 h, eyes were removed, the blood was collected and centrifuged, and the supernatant was obtained. The supernatant was then diluted by 20-fold for determining the uricase activity in plasma. In Group 2 (10 mice), recombinant uricase K103C was injected via tail vein at a dose of 10 mg/kg. After 5 min, 15 min, 30 min, 45 min, 1 h, 2 h, 4 h, 8 h, 16 h, 24 h, eyes were removed, the blood was collected and centrifuged, and the supernatant was obtained. The supernatant was then diluted by 20-fold for determining the uricase activity in plasma. In Group 3, 10 mice were used as a control group, and an equal volume of saline was injected. After 5 min, 15 min, 30 min, 45 min, 1 h, 2 h, 4 h, 8 h, 16 h, 24 h, eyes were removed, the blood was collected and centrifuged, and the supernatant was obtained. The supernatant was then diluted by 20-fold for determining the uricase activity in plasma.

    [0172] The results were shown in FIG. 8. The results showed that the half-life of the mutant uricase K103C in serum was about 1 h, the enzyme activity could only be maintained up to 24h; whereas PEG-modified enzyme reduced the rate of degradation in mice due to the wrapping effect of PEG, the half-life was about 72h, and the longest action time could reach 96h.

    [0173] All literatures mentioned in the present application are incorporated by reference herein, as though individually incorporated by reference. Additionally, it should be understood that after reading the above teaching, many variations and modifications may be made by the skilled in the art, and these equivalents also fall within the scope as defined by the appended claims.