METHOD FOR PREPARING A CANINE MODEL OF ATHEROSCLEROSIS

20180279591 ยท 2018-10-04

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a method for preparing a canine model of atherosclerosis, in particular, relates to a method for preparing an apolipoprotein E (APOE) gene knock-out disease canine model with the use of gene knock-out technology.

    Claims

    1. A method for establishing an APOE gene knock-out canine model, comprising the following steps: (1) obtaining a fertilized ovum or an oocyte from APOE gene knock-out canine prepared by gene editing technology; and (2) transplanting the fertilized ovum or the oocyte into one of the fallopian tubes of a female canine, of which both fallopian tubes have been embryo flushed.

    2. The method according to claim 1, wherein the gene editing technology is CRISPR, TALEN or ZFN.

    3. The method according to claim 1, further comprising the following steps: (1) determining a target site sequence directed to an exon sequence of canine APOE gene; (2) synthesizing sgRNA sequence and its complementary sequence according to the target site sequence determined in step (1), linking the synthesized sequence with a skeleton vector to construct a sgRNA targeting vector; (3) in vitro transcribing the sgRNA targeting vector to obtain mRNA of the sgRNA, in vitro transcribing CRISPR/Cas9 to obtain mRNA of CRISPR/Cas9; (4) mixing the mRNA of the sgRNA and the mRNA of CRISPR/Cas9 obtained in step (3), intracytoplasmic injecting the obtained mixture into the fertilized ovum or oocyte; and (5) transplanting the fertilized ovum or oocyte into one of the fallopian tubes of a female canine, of which both fallopian tubes have been embryo flushed.

    4. The method according to claim 3, wherein the target site sequence is determined to direct to the sequences of exon 2 (SEQ ID NO: 1), exon 3 (SEQ ID NO: 2) or exon 4 (SEQ ID NO: 3).

    5. The method according to claim 3, wherein the target site sequence in step (1) is the sequence selected to direct to exon 3 (SEQ ID NO: 2) as follows: TABLE-US-00009 (SEQIDNO:4) 5-CCGGGTGGCAGACTGGCCAGCCC-3.

    6. The method according to claim 3, wherein the synthesized sgRNA sequence and its complementary sequence in step (2) are as follows: sgRNA sequence: ataGGGCTGGCCAGTCTGCCACCgt (SEQ ID NO: 5); and complementary sequence of the sgRNA sequence: taaaacGGTGG CAGACTGGCCAGCC (SEQ ID NO: 6).

    7. The method according to claim 3, wherein in step (5), the fertilized ovum or oocyte is transplanted into the less bleeding fallopian tubes of a female canine, of which both fallopian tubes have been embryo flushed.

    8. The method according to claim 1, further comprising the following steps: (1) determining a target site sequence directed to an exon sequence of the canine APOE gene sequence; (2) synthesizing sgRNA sequence and its complementary sequence according to the target site sequence determined in step (1), linking the synthesized sequence with a skeleton vector to construct a sgRNA targeting vector; (3) in vitro transcribing the sgRNA targeting vector to obtain mRNA of the sgRNA, in vitro transcribing CRISPR/Cas9 to obtain mRNA of CRISPR/Cas9; (4) mixing the mRNA of the sgRNA and the mRNA of CRISPR/Cas9 obtained in step (3), intracytoplasmic injecting the obtained mixture into canine somatic cells, nuclear transplanting the somatic cells into a canine enucleated oocyte; and (5) transplanting the canine enucleated oocyte into one of the fallopian tubes of a female canine, of which both fallopian tubes have been embryo flushed.

    9. A canine APOE gene targeting vector, consisting of an sgRNA sequence and its complementary sequence directed to a target site sequence of an exon of the canine APOE gene, and a skeleton vector.

    10. The gene targeting vector according to claim 9, wherein the exon of the canine APOE gene is exon 2 (SEQ ID NO: 1), exon 3 (SEQ ID NO: 2) or exon 4 (SEQ ID NO: 3) thereof.

    11. The gene targeting vector according to claim 9, wherein the target site sequence is selected as follows: 5-CCGGGTGGCAGACTGGCCAGCCC-3 (SEQ ID NO: 4).

    12. The gene targeting vector according to claim 9, wherein the sgRNA sequence and its complementary sequence are as follows: sgRNA sequence: ataGGGCTGGCCAGTCTGCCACCgt (SEQ ID NO: 5); and complementary sequence of the sgRNA sequence: taaaacGGTGG CAGACTGGCCAGCC (SEQ ID NO: 6).

    13. Ear fibroblast BGD-APOEKO-EFO of APOE gene knock-out beagle canine, which is deposited in China General Microbiological Culture Collection Center (CGMCC) on Mar. 1, 2017 with a CGMCC depository No. 13804.

    14. A primer pair for detecting APOE gene knock-out canine, comprising a genomic sequence comprising a sequence fragment as shown by cctggaccagggaggct (SEQ ID NO: 7), wherein the primer pair is designed to direct to the sequence as shown by cctggaccagggaggct (SEQ ID NO: 7).

    15. The primer pair according to claim 14, wherein the sequences of the primer pair are as follows: TABLE-US-00010 ForwardprimerF: (SEQIDNO:8) 5-CATTGTTGTCAGGCAGGTAGC-3; and ReverseprimerR: (SEQIDNO:9) 5-GAAGGGTGCGAGGGATTGA-3.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0042] FIG. 1 is a schematic diagram of the canine APOE gene target site sequence.

    [0043] FIG. 2 shows Exon 3 sequence of the APOE gene of a wildtype canine and mutated sequence of Exon 3 sequence of the APOE gene of the gene knock-out canine, numbered 161207.

    [0044] FIG. 3 shows sequence comparison of the APOE gene from different origins.

    [0045] FIG. 4 shows a sequencing peak diagram of the APOE gene-edited canine.

    DETAILED DESCRIPTION OF THE INVENTION

    [0046] Technical solutions of the present invention are further described in below through combining embodiments and drawings of the description. These embodiments are for illustrating rather than setting limit to the scopes of protection of the present invention.

    Embodiment 1: Constructing, In Vitro Transcription and Verification of Transgenic Targeting Vector

    [0047] Choosing a target site sequence: 5-CCGGGTGGCAGACTGGCCAGCCC-3 (SEQ ID NO: 4) (see FIG. 1) based on Exon 3 of canine APOE gene according to canine APOE gene sequence information provided by NCBI. The sgRNA sequence identifying the target site sequence is 5-GGGCTGGCCAGTCTGCCACC-3 (SEQ ID NO: 10). When constructing a vector, the skeleton vector T7-gRNA (commercially available from Addgene) is enzyme digested with BbsI for subsequent experiments; sgRNA sequence: ataGGGCTGGCCAGTCTGC CACCgt (SEQ ID NO: 5) and sgRNA complementary sequence: taaaacGGTGGCAGACTGGCCAGCC (SEQ ID NO: 6) are designed; sgRNA sequence and the sgRNA complementary sequence are annealing linked, and then linked with enzyme digested T7-gRNA plasmid. A PCR product is recovered after PCR amplifying the T7-sgRNA plasmid, and an in vitro transcription kit is used for in vitro transcribing the PCR product of T7-sgRNA.

    [0048] At first, the plasmid of CRISPR/Cas9 is linearized. The reacting system is as follows: 30 g plasmid, 5 l restriction endonuclease AflII; 10 l of 10 Buffer and ddH.sub.2O, the total volume is 100 l. Then 100 l of phenol: chloroform: isopropyl alcohol (25:24:1) is added to purify the linearized plasmid DNA, and then 12,000 g centrifugation for 5 min; sucking 50 l supernatant into a 1.5 ml centrifugation tube without RNase, adding sodium acetate in 1/10 volume and anhydrous ethanol in 3 times volume to precipitate plasmid DNA, and then 12,000 g centrifugation for 5 min; discarding the supernatant, discard the remaining supernatant at the best; adding 150 l of 70% ethanol to wash the plasmid, and then 12,000 g centrifugation for 5 min; drying in air for 3-5 min, dissolving DNA with 15 l ddH.sub.2O of RNase-free, and measuring the concentration.

    [0049] In Vitro Transcription of mRNA with a Kit (Ambion):

    [0050] The system of in vitro transcription is as follows: 1 g linearized plasmid DNA, 10 l 2NTP/CAP, 2 l 10 Buffer, 2 l RNA synthetase and ddH.sub.2O, total volume is 20 l. After mixing homogeneously, incubating for 1 hr at 37 C.; adding 1 l of TURBO DNA enzyme, digesting plasmid template, and incubating for 30 min at 37 C. Then, mixing 20 l in vitro transcription product, 20 l 10 Reaction Buffer, 10 l ATP (10 mM), 2.5 l RNase inhibitor, 2 l Poly (A) polymerase and nuclease-free ddH.sub.2O to form a system of in vitro transcription of poly (A) mRNA, with a total volume of 100 l, incubating for 1 hr at 37 C. After incubation, adding 350 l binding buffer to the reaction system and mixing homogeneously through blowing; adding 250 l anhydrous ethanol, mixing homogeneously; then transferring the sample into an mRNA purification column, then 10,000 g centrifugation for 1 min at room temperature; discarding the filtrate, and then reloading the column, rinsing the column with 500 l eluent, and then 10,000 g centrifugation for 1 min at room temperature; repeating the rinsing one time, discarding the filtrate, centrifugation of the empty column for 1 min to rinse off impurities such as proteins; then the column is placed into a new centrifugation tube, adding 50 l RNA eluent to the central position of the column, covering the lid and incubating for 10 min at 65 C., then 10,000 g centrifugation for 1 min at room temperature; and measuring quality and concentration of the RNA.

    [0051] The sgRNA of CRISPR and mRNA of Cas9 are mixed so that sgRNA has a final concentration of 20 ng/l, and Cas9 has a final concentration of 200 ng/l, storing at 80 C. for cytoplasmic injection.

    [0052] The constructed sgRNA and Cas9 plasmid are co-transferred to canine skin fibroblasts, and G418 is used for screening. DNA is extracted from cell clones obtained by screening as a template, and the following primer pair is used to conduct PCR, which amplifies a DNA fragment of total 660 bp at the upstream and downstream of the target being identified and cleaved by sgRNA:

    TABLE-US-00005 ForwardprimerF: (SEQIDNO:8) 5-CATTGTTGTCAGGCAGGTAGC-3; and ReverseprimerR: (SEQIDNO:9) 5-GAAGGGTGCGAGGGATTGA-3.

    [0053] The target fragment obtained through PCR amplification is subjected to DNA sequencing to determine the targeting efficiency of the vector. Total of 30 cell clones are obtained after transfection and screening, 26 cell clones have the gene mutation in the region of the target site showed by the PCR sequencing. The mutation efficiency is 86.7%, which proves that the constructed vector has a high accuracy, and the targeting efficiency is higher. Therefore, the constructed vector can be used for the preparation of APOE gene knock-out canine.

    Embodiment 2: Embryo Transplanting of APOE Gene Knock-Out Canine

    [0054] Total of 13 female beagle canines of natural estrous are used as donors of fertilized ova and also receptors of embryo transplanting for experimental research. Blood sample is taken to measure progesterone level in serum. If the progesterone concentration is at 4-7 ng/ml, the ovulatory period is determined. Natural mating is performed after 48 hr of ovulation, and followed by flushing the fertilized ova. 65 fertilized ova are collected from 13 female canines. After the fertilized ova are collected, they are subjected to removing cumulus granulosa cells by using TCM199 medium comprising 0.1% hyaluronidase, followed by putting into droplets of HEPES buffered TCM199 medium (HM, GIBCO11150), and then placing on an inverted microscope equipped with a micromanipulator. A mixture comprising mRNA of sgRNA and mRNA of Cas9 prepared in Embodiment 1 at a ratio of 1:1 in volume is sucked with a microinjection needle, and then injected into cytoplasm of a fertilized ovum. The fallopian tube is flushed with 10 ml of HEPES buffered TCM199 medium (HM, GIBCO11150) comprising 10% fetal bovine serum, and the ovum flushing fluid is discharged from the injection needle ligated at umbrella of the fallopian tube, and is collected into a 10 ml centrifugation tube.

    [0055] After the intraplasmic injection, the embryos are loaded into an embryo transplanting tube, and the embryos in the embryo transplanting tube are injected from the fallopian tube umbrella into the less bleeding one of fallopian tubes when embryo flushing.

    TABLE-US-00006 TABLE 1 Embryo Transplanting Results Number of Numbers of No. of receptor transplanted Number of gene knock-out canines fertilized ova offspring canine FRA1115 8 0 0 FRA1121 4 0 0 FRA1126 5 0 0 FRA1118 1 0 0 FRA1124 5 4 1 FRA1123 6 1 0 FRA1129 7 1 0 FRA1024 8 0 0 FRA1130 6 2 0 FRA1139 2 1 0 FRA1137 2 6 1 FRA1140 8 0 0 FRA1146 3 1 0 Total 65 13 2

    [0056] It can be seen from Table 1 that 13 female beagle canines transplanted with 65 fertilized ova produced a total of 13 offspring, and two of them are gene knock-out canines. Detection and verification are given in the following embodiments.

    Embodiment 3: Gene Mutation Detection of APOE Gene Knock-Out Canine

    [0057] After the puppies are born, ear tissue and tail tissue are collected for identification. After the tissue block is fragmented in a centrifugation tube, protease K is added for water bath and cleavage at 56 C. for 13 h. Then 700 l of Genomic Lysis Buffer sucked with a pipette is added to the cleavage system, mixing homogeneously through turning upside down, and then 10000 g centrifugation for 1 min. The supernatant is sucked to a purifying column with a pipette, 10000 g, standing for 1 min at room temperature. A new collecting tube is used, and 200 l DNA Pre-Wash Buffer is added to the centrifugation column, 10000 g, followed by standing for 1 min at room temperature, centrifuging for 1 min, and discarding wasted liquid. 400 l g-DNA Wash Buffer is added to the centrifugation column, 10000 g, standing for 1 min at room temperature, centrifuging for 1 min, and discarding the wasted liquid. The purifying column and collecting tube are re-centrifuged, 10000 g, centrifuging for 2 min. The purifying column is placed in a newly replaced 1.5 ml centrifugation tube, 50 l Elution Buffer is added to elute DNA, followed by standing for 2 min at room temperature, and then 12000 rpm, centrifuging for 1 min. The obtained solution is canine genomic DNA.

    [0058] The canine genomic DNA is used as a template to carry out PCR, the primers are as follows:

    TABLE-US-00007 ForwardprimerF: (SEQIDNO:8) 5-CATTGTTGTCAGGCAGGTAGC-3; and ReverseprimerR: (SEQIDNO:9) 5-GAAGGGTGCGAGGGATTGA-3.

    [0059] After amplification, a DNA fragment of total 660 bp at the upstream and downstream of the target being identified and cleaved by sgRNA. The target fragment obtained through PCR amplifying is undergone DNA sequencing, and is compared with canine APOE gene sequence provided by NCBI database to determine the mutation type of the APOE gene.

    [0060] Upon sequencing and sequence alignment, it is demonstrated that among the 13 puppies, two puppies (one male and one female) have mutations in the Exon 3 target site of the APOE gene. The male canine (numbered 161207) has a deletion of a 34 bp fragment and an insertion of a 17 bp fragment, causing APOE gene homozygous double knock-out and resulting a mutated APOE protein starting from the 37.sup.th amino acid and terminating at the 63.sup.th amino acid; the female canine (numbered 170111) has a heterozygous mutation of deleting 33 bp at one side and deleting 51 bp at the other side. FIG. 2 shows Exon 3 sequence (SEQ ID NO: 2) of the APOE gene of a wildtype canine, and mutated sequence (SEQ ID NO: 11) of Exon 3 sequence of the APOE gene of the gene knock-out canine numbered 161207, which shows that a fragment of 34 bp was deleted, and a fragment of 17 bp was inserted at the same time. The bold part of Exon 3 sequence of APOE gene of the gene knock-out canine (numbered 161207) demonstrates the added fragment of 17 bp. Particularly, the sequence of the corresponding site prior to mutation is tggagccagaggccgggtggcagactggccagcc (SEQ ID NO: 12), and the sequence after the mutation is cctggaccagggaggct (SEQ ID NO: 7).

    [0061] FIG. 3 shows the sequences alignment among the sequence of the 641.sup.st to the 720.sup.th nucleotide of Exon 3 of the APOE gene of a wildtype canine, the corresponding sequences of the Exon 3 from ear and tail tissues of APOE gene knock-out canine (numbered 161207), respectively, and the corresponding sequences of Exon 3 from ear and tail tissues of APOE gene knock-out canine (numbered 170111), respectively. Note that the target sequence is marked with a box; letter suffix E after the numeric number indicates ear tissue, suffix W after the numeric number indicates tail tissue; A and B indicate the number of alleles of APOE heterozygous knock-out canine, numbered 170111.

    [0062] The Ear fibroblast BGD-APOEKO-EFO of APOE gene knock-out beagle canine numbered 161207 is deposited in China General Microbiological Culture Collection Center (CGMCC) on Mar. 1, 2017 with a CGMCC depository No. 13804.

    [0063] FIG. 4 shows a sequencing peak diagram of the APOE gene edited canine. The numbers in the figure are serial numbers of the canine, letter E indicates ear tissue, and letter W indicates tail tissue; 161206E/W indicates ear tissue and tail tissue of wildtype canine, respectively, and the target site region of the wildtype gene is marked with a box (see FIGS. 4A and 4B); 161207E/W indicates ear tissue and tail tissue of male canine having APOE gene mutation respectively, and the mutated sequence information is indicated in the box (see FIGS. 4C and 4D); 170111E/W indicates ear tissue and tail tissue of female canine having APOE gene mutation respectively, A and B are serial numbers of heterozygous mutation alleles, and the arrows point out the mutation region (see FIGS. 4E-4H).

    Embodiment 4: Blood Lipid Detection of the APOE Gene Knock-Out Canine

    [0064] Blood is collected from three-month old APOE gene knock-out canine (161207), and is centrifuged for separating serum. The contents of total cholesterol, triglyceride, high-density lipoprotein and low-density lipoprotein in serum are measured. The results show that comparing with control canines (numbered 161205 and 161206, respectively), the contents of total cholesterol, triglyceride, high density lipoprotein and low density lipoprotein in serum of APOE gene knock-out canine are apparently higher than the control group (Table 2). It can be seen that the knock-out of APOE gene causes abnormal metabolism of lipids in the gene knock-out canine, leading to significant increase of blood lipid, which further verifies that the present invention obtains the APOE gene knock-out canine.

    TABLE-US-00008 TABLE 2 Blood lipid detection result of the APOE gene knock-out canine Serial No. Items 161207(APOE/) 161205(WT) 161206(WT) Total 22.92 7.225 8.25 cholesterol (mmol/L) Triglycerides 2.25 1.505 0.86 (mmol/L) High density 8.80 5.535 6.08 lipoprotein (mmol/L) Low density 13.10 1.15 1.78 lipoprotein (mmol/L)