RETINOID COMPOSITIONS AND METHODS OF INCREASING IMMUNE CELL-MEDIATED KILLING OF IDH MUTANT CANCER CELLS
20180280335 ยท 2018-10-04
Inventors
Cpc classification
A61K39/464429
HUMAN NECESSITIES
A61K35/17
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K39/464429
HUMAN NECESSITIES
A61K35/17
HUMAN NECESSITIES
International classification
A61P35/00
HUMAN NECESSITIES
Abstract
Provided herein are methods of treating an IDH mutant cancer in a subject comprising administering to the subject a therapeutically effective amount of a composition comprising an all-trans retinoic acid (ATRA). In some embodiments, the methods increase an NK-cell-mediated immune response and/or a T cell-mediated immune response to the cancer. In some embodiments, the cancer is a glioma or a chondrosarcoma. In some embodiments, the expression of one or more NKG2D ligands (e.g., ULBP1 and ULBP3) is increased in a tumor microenvironment of the cancer. In some embodiments, CCL2 production, the number of NK cells, and/or apoptosis of tumor cells is increased in a tumor microenvironment of the cancer. In some embodiments, the subject has an IDH1 mutation at arginine 132 or an IDH2 mutation at arginine 172. In some embodiments, method reduces growth of a tumor.
Claims
1. A method of treating an IDH mutant cancer in a subject comprising administering to the subject a therapeutically effective amount of a composition comprising an all-trans retinoic acid (ATRA), a bexarotene, or a 13-cis retinoic acid.
2. The method of claim 1, wherein all-trans retinoic acid (ATRA) is selected.
3. The method of claim 1, wherein the method increases an NK-cell-mediated immune response to the cancer, a T cell-mediated immune response to the cancer, or a combination thereof.
4. The method of claim 1, wherein the cancer is a glioma.
5. The method of claim 1, wherein the cancer is a chondrosarcoma.
6. The method of claim 1, wherein expression of one or more NKG2D ligands is increased in a tumor microenvironment of the cancer.
7. The method of claim 6, wherein the one or more NKG2D ligands is selected from the group consisting of ULBP1 and ULBP3.
8. The method of claim 1, wherein CCL2 production is increased in a tumor microenvironment of the cancer.
9. The method of claim 1, wherein the method increases the number of NK cells in a tumor microenvironment of the cancer.
10. The method of claim 1, wherein the composition consists essentially of an all-trans retinoic acid (ATRA) effective to increase an NK-cell-mediated and/or T cell-mediated immune response to the cancer.
11. The method of claim 1, further comprising administering to the subject a therapeutically effective amount of natural killer (NK) cells.
12. The method of claim 1, wherein the subject has an IDH1 mutation at arginine 132.
13. The method of claim 1, wherein the subject has an IDH2 mutation at arginine 172.
14. The method of claim 1, wherein the method increases apoptosis of tumor cells in a tumor microenvironment of the cancer.
15. The method of claim 1, wherein the method reduces growth of a tumor.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
DETAILED DESCRIPTION OF THE INVENTION
[0022] Provided herein are methods of treating an IDH mutant cancer in a subject. The methods comprise administering to the subject a therapeutically effective amount of a composition comprising an all-trans retinoic acid (ATRA) effective to increase an NK cell-mediated and/or T cell-mediated immune response to the cancer. Terms used throughout this application are to be construed with ordinary and typical meaning to those of ordinary skill in the art. However, Applicants desire that the following terms be given the particular definition as defined below.
Definitions
[0023] As used in the specification and claims, the singular form a, an, and the include plural references unless the context clearly dictates otherwise. For example, the term a cell includes a plurality of cells, including mixtures thereof.
[0024] The term administering refers to an administration that is oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra joint, intra-tumor, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation or via an implanted reservoir. The term parenteral includes subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intrahepatic, intralesional, and intracranial injections or infusion techniques.
[0025] The terms about and approximately are defined as being close to as understood by one of ordinary skill in the art. In one non-limiting embodiment the terms are defined to be within 10%. In another non-limiting embodiment, the terms are defined to be within 5%. In still another non-limiting embodiment, the terms are defined to be within 1%.
[0026] The term all-trans retinoic acid is also referred to herein as ATRA and means a composition having the below chemical formula. An ATRA composition comprises, consists essentially of, or consists of ATRA.
##STR00001##
[0027] The term cancer is used to address any neoplastic disease, and is not limited to epithelial neoplasms (surface and glandular cancers; such a squamous cancers or adenomas). The term cancer is used here to describe both solid tumors and hematologic malignancies, including gliomas, epithelial (surface and glandular) cancers, soft tissue and bone sarcomas, angiomas, mesothelioma, melanoma, lymphomas, leukemias and myeloma.
[0028] The term CCL2 refers herein to a CC motif chemokine ligand 2. CCL2 is also known as chemokine (CC motif) ligand 2, SCYA2, small inducible cytokine A2 (monocyte chemotactic protein 1, homologous to mouse Sig-je), GDCF-2, HC11, MCAF, MCP-1, MCP1, MGC9434, monocyte chemoattractant protein-1, monocyte chemotactic and activating factor, monocyte chemotactic protein 1, homologous to mouse Sig-je, monocyte secretory protein JE, small inducible cytokine subfamily A (Cys-Cys), member 2, and SMC-CF. In some embodiments, the CCL2 polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 10618 Entrez Gene: 6347 Ensembl: ENSG00000108691 OMIM: 158105 UniProtKB: P13500.
[0029] The term CXCL2 refers herein to a CXC motif chemokine ligand 2. CXCL2 is also known as chemokine (CXC motif) ligand 2, GRO2, GRO2 oncogene, CINC-2a, GROb, MGSA-b, MIP-2a, and SCYB2. In some embodiments, the CXCL2 polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 4603 Entrez Gene: 2920 Ensembl: ENSG00000081041 OMIM: 139110 UniProtKB: P19875.
[0030] The term CXCL12 refers herein to a CXC motif chemokine ligand 12. CXCL12 is also known as chemokine (CXC motif) ligand 12, SDF1, SDF1A, SDF1B, stromal cell-derived factor 1, PBSF, SCYB12, SDF-1a, SDF-1b, TLSF-a, TLSF-b, and TPAR1. In some embodiments, the CXCL12 polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 10672 Entrez Gene: 6387 Ensembl: ENSG00000107562 OMIM: 600835 UniProtKB: P48061. The terms CXCL12.1 (also known as CXCL12a) and CXCL12.2 (CXCL12b) refer to two isoforms of CXCL12 produced by alternate splicing.
[0031] The terms cell, cell line, and cell culture include progeny. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations.
[0032] A composition is intended to include a combination of active agent or agents (for example, one or more retinoic acid agents) and another compound or composition, inert (for example, a detectable agent or label) or active, such as an adjuvant.
[0033] As used herein, the term comprising is intended to mean that the compositions and methods include the recited elements, but not excluding others. Consisting essentially of when used to define compositions and methods, shall mean excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like. Consisting of shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions of this invention. Embodiments defined by each of these transition terms are within the scope of this invention.
[0034] A control is an alternative subject or sample used in an experiment for comparison purpose. A control can be positive or negative. Various controls within the scope of the present invention are described in more detail below.
[0035] An effective amount is an amount sufficient to effect beneficial or desired results. An effective amount can be administered in one or more administrations, applications or dosages.
[0036] As used herein, gene expression and protein expression refer to the process by which polynucleotides are transcribed into mRNA and the process by which the transcribed mRNA is subsequently being translated into peptides, polypeptides, or proteins, respectively. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. Gene overexpression refers to the overproduction of the mRNA transcribed from the gene, at a level that is about 2.5 times higher, about 5 times higher, or about 10 times higher than the expression level detected in a control sample. Protein overexpression includes the overproduction of the protein product encoded by a gene at a level that is about 2.5 times higher, about 5 times higher, or about 10 times higher than the expression level detected in a control sample.
[0037] The term identity or homology shall be construed to mean the percentage of nucleotide bases or amino acid residues in the candidate sequence that are identical with the bases or residues of a corresponding sequence to which it is compared, after aligning the sequences and introducing gaps, if necessary to achieve the maximum percent identity for the entire sequence, and not considering any conservative substitutions as part of the sequence identity. Neither N- nor C-terminal extensions nor insertions shall be construed as reducing identity or homology. A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region) that has a certain percentage (for example, about 80%, about 85%, about 90%, or about 95%) of sequence homology to another sequence means that, when aligned, that percentage of bases (or amino acids) are the same in comparing the two sequences. This alignment and the percent homology or sequence identity can be determined using software programs known in the art. In one embodiment, default parameters are used for alignment. In one embodiment a BLAST program is used with default parameters. In one embodiment, BLAST programs BLASTN and BLASTP are used with the following default parameters: Genetic code=standard; filter=none; strand=both; cutoff=60, expect=10; Matrix=BLOSUM62; Descriptions=50 sequences; sort by=HIGH SCORE; Databases=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+SwissProtein+SPupdate+PIR.
[0038] The term IDH refers herein to an NADP+-dependent isocitrate dehydrogenase polypeptide that in humans is encoded by one of an IDH1 and IDH2 gene. In some embodiments, the IDH1 polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 5382, Entrez Gene: 3417, Ensembl: ENSG00000138413, OMIM: 147700 or UniProtKB: O75874. In some embodiments, the IDH1 polynucleotide comprises the sequence of SEQ ID NO:1, or a polynucleotide sequence having at or greater than about 80%, at or greater than about 85%, at or greater than about 90%, at or greater than about 95%, or at or greater than about 98% homology with SEQ ID NO:1, or a polynucleotide comprising a portion of SEQ ID NO:1. In some embodiments, the IDH2 polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 5383, Entrez Gene: 3418, Ensembl: ENSG00000182054, OMIM: 147650, UniProtKB: P48735. In some embodiments, the IDH2 polynucleotide comprises the sequence of SEQ ID NO:2, or a polynucleotide sequence having at or greater than about 80%, at or greater than about 85%, at or greater than about 90%, at or greater than about 95%, or at or greater than about 98% homology with SEQ ID NO:2, or a polynucleotide comprising a portion of SEQ ID NO:2.
[0039] The term IDH mutation refers to a difference in an IDH polynucleotide or polypeptide as compared to a corresponding IDH wild type polynucleotide or polypeptide, which difference in sequence affects the function of the IDH polypeptide. In some embodiments, an IDH mutation increases production of 2-hydroxyglutarate (2-HG) as associated with IDH's oxidative decarboxylation of isocitrate. An IDH mutation can, in some embodiments, include a mutation in IDH1, IDH2, or combinations thereof. In some embodiments, an IDH1 mutation occurs at amino acid 132 and/or a corresponding polynucleotide. In other or further embodiments, an IDH2 mutation occurs at amino acid 172 and/or a corresponding polynucleotide. Other IDH mutations encompassed by the term IDH mutation are: IDH1 R132 variants R132H, R132C, R132G, R132S, and R132L; IDH2 R140 variants R140Q, R140L, and R140W; and IDH2 R172 variant R172K.
[0040] The term IDH mutant cancer refers to a cancer identified as being caused by or associated with an IDH mutation. In some embodiments, the IDH mutant cancer is a glioma, an acute myeloid leukemia (AML), a myelodysplastic syndrome (MDS), a myeloproliferative neoplasms (MPN), a cholangiocarcinoma, a chondrosarcoma, a cholangiosarcoma, a breast cancer or a skin cancer. In some embodiments, the IDH mutant cancer is a glioma. In some embodiments, the glioma is an adult grade II or III glioma. In some embodiments, the IDH mutant cancer is an astrocytoma, an oligodendroglioma or glioblastoma. In some embodiments, the astrocytoma is a grade II or III astrocytoma. In some embodiments, the glioblastoma is a secondary glioblastoma or a glioblastoma multiforme. In some embodiments, the IDH mutant cancer is a chondrosarcoma.
[0041] The term IFITM3 refers herein to an interferon induced transmembrane protein 3. IFITM3 is also known as 1-8U, dispanin subfamily A member 2b, and DSPA2b. In some embodiments, the IFITM3 polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 5414 Entrez Gene: 10410 Ensembl: ENSG00000142089 OMIM: 605579 UniProtKB: Q01628.
[0042] The term IRF1 refers herein to an interferon regulatory factor 1. IRF1 is also known as MAR. In some embodiments, the IRF1 polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 6116 Entrez Gene: 3659 Ensembl: ENSG00000125347 OMIM: 147575 UniProtKB: P10914.
[0043] Mammal for purposes of treatment refers to any animal classified as a mammal, including human, domestic and farm animals, nonhuman primates, and zoo, sports, or pet animals, such as dogs, horses, cats, cows, etc.
[0044] The term MICA refers to a ligand for the NKG2-D type II integral membrane protein receptor that is also known as MHC Class I Polypeptide-Related Sequence A. In some embodiments, the MICA polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 7090, Entrez Gene: 100507436, Ensembl: ENSG00000204520, OMIM: 600169, and UniProtKB: Q29983.
[0045] The term MICB refers to a heavily glycosylated protein which is a ligand for the NKG2D type II receptor that is also known as MHC Class I Polypeptide-Related Sequence B. In some embodiments, the MICB polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 7091, Entrez Gene: 4277, Ensembl: ENSG00000204516, OMIM: 602436, and UniProtKB: Q29980.
[0046] As used herein, the terms neoplastic cells, neoplasia, tumor cells, tumor, cancer, and cancer cells (used interchangeably) refer to cells which exhibit relatively autonomous growth, so that they exhibit an aberrant growth phenotype characterized by a significant loss of control of cell proliferation (i.e., de-regulated cell division). Tumor cells can be malignant or benign. A metastatic cell or tissue means that the cell can invade and destroy neighboring body structures.
[0047] The term NK cell refers herein to a natural killer cell. Known human NK cell surface markers are CD16 (Fc?RIII) and CD56.
[0048] The term NKG2D refers herein to a transmembrane protein characterized by a type II membrane orientation (has an extracellular C terminus) and the presence of a C-type lectin domain. NKG2D binds to a diverse family of ligands that include MHC class I chain-related A and B proteins and UL-16 binding proteins. NKG2D is also known as KLRK1. In some embodiments, the NKG2D polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 18788, Entrez Gene: 22914, Ensembl: ENSG00000213809, OMIM: 611817, and UniProtKB: P26718.
[0049] A pharmaceutical composition is intended to include the combination of an active agent with a pharmaceutically acceptable carrier, inert or active, making the composition suitable for diagnostic or therapeutic use in vivo or ex vivo.
[0050] The term pharmaceutically acceptable carrier means a carrier or excipient that is useful in preparing a pharmaceutical composition that is generally safe and non-toxic, and includes a carrier that is acceptable for veterinary and/or human pharmaceutical use. As used herein, the term pharmaceutically acceptable carrier encompasses any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, and emulsions, such as an oil/water or water/oil emulsion, and various types of wetting agents. As used herein, the term carrier encompasses any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further below. The pharmaceutical compositions also can include preservatives. A pharmaceutically acceptable carrier as used in the specification and claims includes both one and more than one such carrier.
[0051] The terms pharmaceutically effective amount, therapeutically effective amount, and therapeutically effective dose refer to the amount of a composition such as an ATRA composition that will elicit the biological or medical response of a tissue, system, animal, or human that is being sought by the researcher, veterinarian, medical doctor or other clinician. In some embodiments, a desired response is a treatment of a cancer. In some embodiments, a desired response is an NK-cell mediated treatment of cancer. As used herein, a therapeutically effect amount for an NK-cell mediated treatment of cancer refers to an amount of ATRA that is sufficient to upregulate NK cell ligands on tumor or cancer cells, to increase production of NK and/or T cell chemotaxis cytokines by the tumor or cancer cells, and/or to increase NK-cell mediated killing of tumor or cancer cells.
[0052] In some instances, a desired biological or medical response is achieved following administration of multiple dosages of the composition to the subject over a period of days, weeks, or years. The terms pharmaceutically effective amount, therapeutically effective amount, and therapeutically effective dose include that amount of a composition such as an ATRA composition that, when administered, is sufficient to prevent development of, or alleviate to some extent, one or more of the symptoms of the condition or disorder being treated. The therapeutically effective amount will vary depending on the composition, such as the ATRA composition, the disorder or conditions and its severity, the route of administration, time of administration, rate of excretion, drug combination, judgment of the treating physician, dosage form, and the age, weight, general health, sex and/or diet of the subject to be treated. In the context of the present method, a pharmaceutically or therapeutically effective amount or dose of an ATRA composition includes an amount that is sufficient to prevent development of, suppress the growth of, or reduce the numbers of, one or more cancers or tumors.
[0053] The terms prevent, preventing, prevention, and grammatical variations thereof as used herein, refer to a method of partially or completely delaying or precluding the onset or recurrence of a disorder or conditions and/or one or more of its attendant symptoms or barring a subject from acquiring or reacquiring a disorder or condition or reducing a subject's risk of acquiring or reacquiring a disorder or condition or one or more of its attendant symptoms.
[0054] The term RBP1 refers herein to a retinol binding protein 1. RBP1 is also known as CRABP-1, CRBP, CRBP1, CRBPI, and RBPC. In some embodiments, the RBP1 polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 9919 Entrez Gene: 5947 Ensembl: ENSG00000114115 OMIM: 180260 UniProtKB: P09455.
[0055] The term RBP4 refers herein to a retinol binding protein 4. In some embodiments, the RBP4 polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 9922 Entrez Gene: 5950 Ensembl: ENSG00000138207 OMIM: 180250 UniProtKB: P02753.
[0056] The term STAT1 refers herein to a signal transducer and activator of transcription 1. STAT1 is also known as ISGF-3, STAT91, and transcription factor ISGF-3 components p91/p84. In some embodiments, the STAT1 polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 11362 Entrez Gene: 6772 Ensembl: ENSG00000115415 OMIM: 600555 UniProtKB: P42224.
[0057] The term STING refers herein to a transmembrane protein 173. STING is also known as TMEM173, ERIS, FLJ38577, MITA, MPYS, NET23, and stimulator of interferon genes. In some embodiments, the STING polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 27962 Entrez Gene: 340061 Ensembl: ENSG00000184584 OMIM: 612374 UniProtKB: Q86WV6.
[0058] The term subject is defined herein to include animals such as mammals, including, but not limited to, primates (e.g., humans), cows, sheep, goats, horses, dogs, cats, rabbits, rats, mice and the like. In some embodiments, the subject is a human.
[0059] To suppress tumor growth indicates a curtailment of growth state when compared to growth without contact with an ATRA composition described herein. Tumor cell growth can be assessed by any means known in the art, including, but not limited to, measuring tumor size, determining whether tumor cells are proliferating using a .sup.3H-thymidine incorporation assay, or counting tumor cells. Suppressing tumor cell growth means any or all of the following states: slowing, delaying, and stopping tumor growth, as well as tumor shrinkage.
[0060] The term tumor microenvironment refers to the spatial (e.g., extracellular) and cellular environment surrounding a tumor and includes the tumorous or malignant cells. The tumor microenvironment comprises, for example, surrounding vasculature, immune cells (e.g., bone marrow-derived inflammatory cells, lymphocytes, macrophages), fibroblasts, signaling molecules, extracellular matrix material, and other such components. The tumor microenvironment and the tumor cells therein can affect each other. For instance, tumor cells can release factors stimulating angiogenesis in the tumor microenvironment, while immune cells can counter growth or evolution of tumor cells. By contrast, the term is distinguished from tumor (and neoplasm) in that a tumor is a collection of cells having abnormal (e.g., benign or malignant) growth without respect to the microenvironment around it.
[0061] The terms treat, treating, treatment and grammatical variations thereof as used herein, include partially or completely delaying, alleviating, mitigating or reducing the intensity of one or more attendant symptoms of a disorder or condition and/or alleviating, mitigating or impeding one or more causes of a disorder or condition. Treatments according to the invention may be applied preventively, prophylactically, pallatively or remedially. Prophylactic treatments are administered to a subject prior to onset (e.g., before obvious signs of cancer), during early onset (e.g., upon initial signs and symptoms of cancer), or after an established development of cancer. Prophylactic administration can occur for several days to years prior to the manifestation of symptoms of an infection. In some instances, the terms treat, treating, treatment and grammatical variations thereof, include partially or completely reducing the size of a solid tumor or reducing the number of solid tumors as compared with prior to treatment of the subject or as compared with the incidence of such symptom in a general or study population.
[0062] The term tumor microenvironment refers to the immediate cellular environment in which a tumor exists, comprising tumor cells, cells of haematopoietic origin, cells of mesenchymal origin, and extracellular matrix.
[0063] The term ULBP1 refers to a polypeptide ligand of natural killer group 2, member D (NKG2D). In some embodiments, the ULBP1 polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 14893, Entrez Gene: 80329, Ensembl: ENSG00000111981, OMIM: 605697, and UniProtKB: Q9BZM6.
[0064] The term ULBP2 refers to a polypeptide ligand of natural killer group 2, member D (NKG2D). In some embodiments, the ULBP2 polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 14894, Entrez Gene: 80328, Ensembl: ENSG00000131015, OMIM: 605698, and UniProtKB: Q9BZM5.
[0065] The term ULBP3 refers to a polypeptide ligand of natural killer group 2, member D (NKG2D). In some embodiments, the ULBP3 polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 14895, Entrez Gene: 79465, Ensembl: ENSG00000131019, OMIM: 605699, and UniProtKB: Q9BZM4.
Methods of Treatment
[0066] Provided herein are methods of treating an IDH mutant cancer in a subject. The methods comprise administering to the subject a therapeutically effective amount of a composition comprising an all-trans retinoic acid (ATRA), a bexarotene, or a 13-cis retinoic acid. It is a surprising finding of the present invention that ATRA, bexarotene, 13-cis retinoic acid, or combinations thereof can increase NK cell-mediated killing of IDH mutant tumor cells. It is further surprising that ATRA, bexarotene, 13-cis retinoic acid, or combinations thereof can increase expression of NK cell ligands and production of NK and T cell chemokines by IDH mutant tumor cells. Accordingly, in some embodiments, the method comprises administering ATRA, bexarotene, 13-cis retinoic acid, or combinations thereof in an amount effective to increase an NK cell-mediated immune response to the cancer. In some or further embodiments, the method comprises administering ATRA, bexarotene, 13-cis retinoic acid, or combinations thereof in an amount effective to increase a T cell-mediated immune response to the cancer.
[0067] Increased NK cell-mediated immune responses to a cancer include, but are not limited to, increased NK cell infiltration and/or expansion in the tumor microenvironment, NK cell-mediated tumor cell apoptosis and/or lysis, NK cell activation (e.g., by increased IL-12, IL-15, IL-18, IL-2, and CCL5), secretion of soluble factors such as cytokines (e.g., IFN? and TNF?) by NK cells, secretion of NK cell ligands (e.g., NKG2D ligands), upregulation of NK cell markers, secretion of cytolytic factors such as perforin, proteases, and granzymes by NK cells, reduction in tumor size or growth, and the like.
[0068] Increased T cell-mediated immune responses to a cancer include, but are not limited to, increased T-cell infiltration and/or expansion in the tumor microenvironment, T-cell-mediated tumor cell apoptosis and/or lysis, T-cell activation (e.g., by increased costimulation of T-cell receptor and CD28; IL-2 expression), secretion of soluble factors such as cytokines by T-cells, upregulation of T-cell markers (e.g., CD69, CD71, CD25, HLA-DR) secretion of cytolytic factors such as perforin, granzymes, and granulysin or expression of FAS ligand by T-cells, reduction in tumor size or growth, and the like.
[0069] NK cell ligands upregulated by retinoids (e.g., ATRA) include, but are not limited to, NKG2D ligands. Expression of one or more NKG2D ligands can be increased within the IDH mutant tumor microenvironment and/or within the IDH tumor cells themselves. In some embodiments, the one or more NKG2D ligands is selected from the group consisting of ULBP1, ULBP3, MICA and MICB. In some embodiments, the increased expression of ULBP1, ULBP3, MICA and/or MICB by the tumor cell is at least about 5% higher, at least about 10% higher, at least about 20% higher, at least about 30% higher, at least about 40% higher, at least about 50% higher, at least about 100% higher, or at least about 500% higher than a control cell not exposed to ATRA. The term higher as used herein refers to either the percentage of NKG2D ligand-producing tumor cells or the mean level of NKG2D ligand production by a population of tumor cells, or both.
[0070] In other or further embodiments, administration of a retinoid (e.g., ATRA) results in an increase in chemokine production within the IDH mutant tumor microenvironment and/or within the IDH tumor cells themselves. In some embodiments, the chemokine is CCL2. In some embodiments, the increased production of CCL2 by the tumor cell is at least about 5% higher, at least about 10% higher, at least about 20% higher, at least about 30% higher, at least about 40% higher, at least about 50% higher, at least about 100% higher, or at least about 500% higher than a control cell not exposed to ATRA. The term higher as used herein refers to either the percentage of CCL2-producing tumor cells or the mean level of CCL2 production by a population of tumor cells, or both. Increased production of such NK cell and/or T cell chemokines may be determined and/or measured via any method known to one of ordinary skill in the art.
[0071] Changes in expression of soluble or cell-associated factors (e.g., NKG2D ligands, CCL2, etc.) can be determined by measurement of a factor of interest in a biological sample of the subject. Expression measurements are typically compared to a control (e.g., an untreated control, a biological sample obtained prior to treatment, or a general number or average that is known and not identified in the method using a sample). Measurements can be obtained on cells directly (e.g., by flow cytometry) or in a medium of the biological sample (e.g., blood, lymph), where appropriate.
[0072] Expression of factors can be determined at the transcriptional level, the translational level, or combinations thereof, and can be measured via a wide array of methods used to measure gene or polypeptide expression levels. In some embodiments, the factor of interest (e.g., NKG2D ligands, CCL2, etc.) can be measured at the gene transcription level. For example and without limitation, levels of mRNA transcripts of a factor of interest can be determined by radiation absorbance (e.g., ultraviolet light absorption at 260, 280, or 230 nm), quantification of fluorescent dye or tag emission (e.g., ethidium bromide intercalation), quantitative polymerase chain reaction (qPCR) of cDNA produced from mRNA transcripts, southern blot analysis, gene expression microarray, or other suitable methods. Increased levels of mRNA transcripts can be used to infer or estimate increased levels of polypeptide expression.
[0073] In some embodiments, expression of a factor of interest can be measured at the post-translational level. For example and without limitation, levels of a factor of interest (e.g., a polypeptide, granzyme, lysin, ligand, etc.) can be determined by radiation absorbance (e.g., ultraviolet light), bicinchoninic acid (BCA) assay, Bradford assay, biuret test, Lowry method, Coomassie-blue staining, silver-staining, functional or enzymatic assay, cell-binding or cell-activation/response assay, immunodetection and/or Western blot analysis, or other suitable methods.
[0074] In some embodiments, increased CCL2 production in the tumor or tumor microenvironment can increase immune cell recruitment, or can increase anti-tumor immune cell recruitment. In some embodiments, the immune cell recruited by CCL2 is a NK cell. In some embodiments, increased CCL2 production facilitates an increase in number of NK cells in a tumor microenvironment of the cancer.
[0075] In some embodiments of the method of treatment, the cancer is a tumor. A tumor includes a glioma, carcinoma, a sarcoma, lymphoma and leukemia. Tumors can arise in any tissue including, but not limited to, breast, head and neck, lung, airways, prostate, colon, brain, cervix, uterus, ovaries, fallopian tubes, pancreas, esophagus, stomach, gastrointestinal tract, genitourinary tract, skin, liver, kidney, bone, soft connective tissue, central and peripheral nervous system and endocrine and exocrine tissues. In some embodiments, the cancer is a glioma. In some embodiments, the cancer is an astrocytoma, an oligodendroglioma or glioblastoma. In some embodiments, the astrocytoma is a grade II or III astrocytoma. In some embodiments, the glioblastoma is a secondary glioblastoma. In some embodiments, the cancer is a chondrosarcoma. In some embodiments, the tumor is malignant. In some embodiments, the tumor is solid.
[0076] The subject of treatment according to the methods described herein may be any animal, mammal, warm-blooded mammal or human. In one embodiment, the subject of treatment is a human. The composition comprising ATRA, bexarotene, or 13-cis retinoic acid can be administered to the subject via various methods. In some embodiments, the administration is intratumoral. In some embodiments, the administration is intracranial.
[0077] Treatments according to the invention may be applied preventively, prophylactically, pallatively or remedially. Prophylactic treatments are administered to a subject prior to onset (e.g., before obvious signs of cancer), during early onset (e.g., upon initial signs and symptoms of cancer), or after an established development of cancer or precancerous condition including, but not limited to, a chronic infection. Prophylactic administration can occur for several days to years prior to the manifestation of symptoms of cancer. In some instances, the terms treat, treating, treatment and grammatical variations thereof, include partially or completely reducing the size of a tumor, reducing the number of tumors, and reducing the spread or incidence of a cancer as compared with prior to treatment of the subject or as compared with the incidence of such symptom in a general or study population.
[0078] The methods disclosed herein can provide an array of benefits when administered to a subject having an IDH mutant tumor. In some embodiments, the method increases tumor cell death in a tumor microenvironment of the cancer. In some embodiments, the method increases apoptosis of tumor cells in a tumor microenvironment of the cancer. In some embodiments, the method reduces growth of a tumor, or the size of the tumor. In some embodiments, the method reduces malignancy (metastasis) of the tumor or tumor cells. In some embodiments, the method increases infiltration into the tumor microenvironment of anti-cancer immune cells (e.g., NK cells, tumor-specific T-cells). In some embodiments, the method increases RBP1 expression in IDH mutant tumor cells.
[0079] Also included herein are methods of administering to a subject 1) a therapeutically effective amount of a composition comprising an all-trans retinoic acid (ATRA), bexarotene, or 13-cis retinoic acid, and 2) a therapeutically effective amount of NK cells and/or T cells.
[0080] Administered NK cells and/or T-cells can be from cells obtained from the subject, which are manipulated in vitro. For instance, the NK cells and/or T-cells can be stimulated, activated, and/or expanded in culture. In some embodiments, the NK cells and/or T-cells can be engineered to contain an additional polynucleotide (e.g., to express a protein of interest in the cell).
[0081] Also disclosed herein are methods to predict the likelihood a subject with a cancer will respond therapeutically to a therapy comprising administering a composition comprising an all-trans retinoic acid (ATRA), bexarotene, or 13-cis retinoic acid, the method comprising obtaining a tumor sample from the subject; and determining a presence of an IDH mutation in the tumor sample; wherein the presence of an IDH mutation indicates the subject will respond therapeutically to the therapy; and wherein an absence of an IDH mutation indicates the subject will not respond therapeutically to the therapy. In some embodiments wherein the IDH mutation is present, the methods can further comprise administering the therapy to the subject.
[0082] It should also be understood that the foregoing relates to preferred embodiments of the present invention and that numerous changes may be made therein without departing from the scope of the invention. The invention is further illustrated by the following examples, which are not to be construed in any way as imposing limitations upon the scope thereof. On the contrary, it is to be clearly understood that resort may be had to various other embodiments, modifications, and equivalents thereof, which, after reading the description herein, may suggest themselves to those skilled in the art without departing from the spirit of the present invention and/or the scope of the appended claims. All patents, patent applications, and publications referenced herein are incorporated by reference in their entirety for all purposes.
EXAMPLE 1
Materials and Methods
[0083] Cell lines and Cell Culture. Immortalized human syngeneic astrocyte cell lines with retrovirally transduced IDH1 mutant (R132H) construct, IDH wild-type (IDHwt; also referred to herein as IDH wt, wtIDH, and IDH WT) construct and mock-transduced with a retroviral vector were obtained from Dr. Tim Chan's group (MSKCC). The cells were cultured in Dulbecco's Modified Essential Medium (DMEM) supplemented with 10% FBS, 2 mM L-glutamine, 100 U/ml penicillin, and 100 ?g/ml streptomycin (Complete Medium, (CM)). All reagents were obtained from HyClone? (GE Healthcare). The cells were maintained in a humidified incubator at 37? C. and 5% CO.sub.2. Medium was replaced every 2 days and the cells were split when they were about 80% confluent. All cell lines were negative for mycoplasma infections.
[0084] Glioma cell culture. Resected tumors from Glioma patients (both IDH wt and mutant) were mechanically dissociated to form a single cell suspension. Contaminating RBCs were removed using an RBC lysis buffer (eBioscience) and cells were propagated into neural stem cells in Neurocult? NS-A proliferation kit supplemented with 20 ng/mL Human Recombinant EGF, 10 ng/mL Human Recombinant bFGF) and 2 ?g/mL Heparin Solution (Stemcell Technologies Canada Inc.). After 3 weeks in culture, neurospheres were moved to Complete Medium (CM) in order to propagate differentiation into adherent cell lines.
[0085] Mice. 6-8 week old Balb/c nude mice (CAnN.Cg-Foxn1nu/Crl) were purchased from Charles River Laboratories. Mice were injected with 10.sup.6 IDH WT or mutant primary glioma cells sub-cutaneously in the right flank. When the tumors were about 25 mm.sup.2, ATRA treatment was started. 10 mg/Kg ATRA was administered to mice intra-peritoneally (i.p.) every alternate day until termination of the experiment. DMSO-treated mice were used as controls. The mice were monitored for signs of drug toxicity such as weight-loss, lethargy, skin lesions and diarrhea. The tumors were measured every 3 days, and the mice were sacrificed when the tumors were about 400 mm.sup.2. For NK depletion experiments, 6-week old B6 nude mice (B6.Cg-Foxn1nu/J) were purchased from The Jackson Laboratory. NK depletion was performed by injecting mice with 200 ?g of anti-NK1.1 antibody (Biolegend) i.p. on the day ATRA treatment was started. Mice injected with 200 ?g of an isotype antibody were used as controls. Mice were bled and evaluated for circulating NKs by flow cytometry.
[0086] Immunocompetent mouse model. The RCAS/tva system was used to ectopically express muIDH1 (R132H) in PDGF-driven gliomas. RCAS retroviral vectors were used to transfer genes to specific cell types in vivo that express the receptor tva to develop a pair of isogenic mouse tumor models that differ only in IDH1 mutation status. Three RCAS vectors expressing PDGF, wtIDH1-shp53, or muIDH1 (R132H)-shp53 were constructed and used in three different Ntva mouse strains. Mice were injected with RCAS-PDGF-producing DF1 cells together with either DF1 cells producing RCAS-wtIDH1-shp53 (wtIDH1) or RCAS-mutantIDH1-shp53 (muIDH1). Tumors were generated from these injections with identical genomic backgrounds, with the initiating events differing only in IDH1 mutation status. The mice were sacrificed when they showed signs of CNS pathology and the tumors were harvested.
[0087] All-trans Retinoic acid (ATRA) treatment of astrocytes and primary glioma cells. ATRA was purchased from Sigma Aldrich? and reconstituted in DMSO. ATRA was added at a 1 ?M final concentration to cell culture medium for 48 hours. After treatment, the cells either lysed in Trizol? for qPCR analysis, or were used in NK cytotoxicity assays.
[0088] RBP1 silencing and RBP1 overexpression studies. For RBP1 silencing, IDH WT glioma cells were transduced with RBP1 shRNA lentivirus (SantaCruz biotechnologies) for 18 hours. The cells were maintained in CM containing 10 ?g/ml Puromycin to select for the RBP1-silenced cells. IDH WT cells transduced with a mock shRNA lentiviral vector were used as controls.
[0089] For RBP1 overexpression studies, IDH mutant glioma cells were transduced with RBP1 expressing lentiviral vectors (Origene Inc) for 3 hours. The cells were maintained in CM containing 10 ?g/ml Puromycin to select for lentivirus-transduced cells. Cells transduced with a mock lentiviral vector were used as controls.
[0090] Isolation of NK cells from donor PBMCs. Peripheral blood samples were collected in preservative-free heparin tubes (10 U/mL) and were layered onto an equal volume of Ficoll-Hypaque density gradient solution (Amersham Pharmacia Biotech Ltd., Little Chalfont, UK) and centrifuged at 2250 rpm at 20? C. The mononuclear cells (PBMCs) were collected and washed twice with PBS (Hyclone?, GE Healthcare). Cell viability was determined by trypan blue exclusion and exceeded 95%. Isolated PBMCs were used for NK cell isolation using CD56 Microbeads (Miltenyi Biotec Inc.) and a MidiMACS separation column, according to the manufacturer's instructions. Purity was (>95%), as determined by FACS analysis.
[0091] Isolation of NK cells from mice. The spleen from na?ve Balb/c mice was isolated and mechanically dissociated to form single-cell suspension. RBCs were lysed using a RBC lysis buffer (eBioscience). The cells were used for NK isolation using NK cell isolation kit (mouse) (Miltenyi Biotec Inc.) and a MidiMACS separation column, according to the manufacturer's instructions. Purity was (>95%), as determined by FACS analysis.
[0092] NK-92 cell culture. For some experiments, NK92 cells were used instead of donor NK cells. NK92 cells (ATCC? CRL-2407?) were obtained from ATCC. The cells were grown in Alpha Minimum Essential medium with 2 mM L-glutamine and 1.5 g/L sodium bicarbonate, 0.2 mM inositol, 0.1 mM 2-mercaptoethanol, 0.02 mM folic acid (all from Sigma Aldrich), 12.5% horse serum and fetal bovine serum (ATCC) to a final concentration of 12.5%. Fresh medium was added every 2-3 days and once a week, the cells were counted and re-suspended at a final concentration of 5?10.sup.5 cells/mL in fresh medium.
[0093] NK cytotoxicity assay. The flow cytometric CFSE/7-AAD cytotoxicity assay was performed as previously described with slight modifications. Astrocytes or Glioma cells (5?10.sup.5) were labeled with 500 nM CFSE (from a 1 mM stock solution in dimethyl sulfoxide [Sigma] stored at ?20? C.) in PBS for 15 min at 37? C. The cells were then washed twice in complete medium and used immediately for the cytotoxicity assay. The CFSE-labeled target cells (25,000 cells) were used at E (effector):T (target) ratios of 1:10. After 6 h incubation, the cells were stained with 0.25 ?g/ml of 7-AAD and analyzed by flow cytometry.
[0094] Flow cytometry for TILs. IDH WT and mutant tumors were dissociated to form a single cell suspension (SCS). The SCS was then overlaid onto sucrose gradient (Lympholyte-M) and centrifuged at 2400 rpm for 20 minutes. Immune cells at the interphase of the 2 liquids were collected and washed once with PBS. The cells were then stained with appropriate antibodies and acquired on a BD LSR Fortessa flow cytometer. Briefly, cells were washed with PBS and stained with 1 ?g antibody for 30 minutes at 4? C. After incubation, the cells were washed three times with FACS buffer (PBS+10% FBS+0.1% Na-azide), resuspended in a final volume of 200 ?l of FACS buffer and run through the flow cytometer. Flow cytometry data was analyzed on the Flowjo? v9.1 software. Antibodies used for flow cytometry were as follows: CD45?PE-Cy7, NKp46-FITC, CD11b-APC-Cy7, Gr-1-APC, F4/80-eFluor450, Ly6-c-PerCP-Cy5.5 and CD11c-PE.
[0095] Quantitative Real time RT-PCR. 5?10.sup.5 IDH mutant and WT astrocytes, as well as patient glioma cells were lyzed in Trizol and RNA was extracted from the cells using the Chloroform extraction method. cDNA was transcribed from the RNA using iScript cDNA synthesis kit (BioRad). Real-time PCR was performed on an CFX96 Touch? Real-Time PCR Detection System (Bio-Rad) equipped with a 96-well reaction plate. Briefly, 2 ?L cDNA was added to 5 ?L of the 2?SYBR Green PCR mastermix (Thermo Scientific), 800 nM of each primer, and water was added to 10 ?L. The thermal denaturation protocol was run at the end of the PCR to determine the number of products that were present in the reaction. Reactions were typically run in triplicates. The cycle number at which the reaction crossed an arbitrarily-placed threshold (C.sub.T) was determined for each gene and the relative amount of each gene to 18 S rRNA was described using the equation 2.sup.??C.sub.T where ?C.sub.T=(C.sub.TtargetRNA?C.sub.T18S rRNA).
Results
[0096] RBP1 and genes downstream of retinoic acid signaling are down-regulated in IDH mutant gliomas. Analysis of TCGA database shows that RBP1 is one of the most downregulated genes in IDH mutant tumors. Pathway analysis also showed that the retinoic acid pathway was also one of the most negatively regulated pathways in IDH mutant cells. Real-time PCR analysis also showed that in primary glioma cells, IDH mutants had significantly lower expression of a variety of genes down-stream of retinoic acid signaling viz. STAT1, type 1 immune response genes and STING (
[0097] ATRA induced increased cytotoxic killing of IDH mutant cells in an NKG2D-ligand dependent manner. The ability of ATRA to sensitize IDH mutant cells to killing by NK cells was evaluated. For this purpose, IDH mutant and WT cells were treated with 1 ?M ATRA for 48 hours and assessed for killing by NK-92 cells (ATCC) at a 10:1 E:T ratio. IDH mutant cells treated with ATRA were significantly more susceptible to killing by NK-92 cells, compared to DMSO-treated controls. Interestingly, ATRA treatment increased NK-92-mediated killing in IDH mutant cells to WT levels (
[0098] ATRA promotes tumor stasis in IDH mutant tumor-bearing mice. To determine the value of ATRA as a therapeutic modality, its anti-tumor efficacy in vivo was evaluated. Athymic nude mice were implanted with 10.sup.6 IDH mutant or WT primary glioma cells in the flank. 21 days after tumor inoculation (when tumors were about 25 mm.sup.2), 10 mg/kg ATRA was administered every other day for 21 days. Tumors were measured every 3 days. Mice treated with ATRA had significantly slower tumor growth compared with DMSO (vehicle)-treated mice, and mice with WT tumors (
[0099] These studies were replicated in a RCAS tva mouse model that was ectopically induced to express the wild type or mutant IDH. As observed in the nude mouse model, mice bearing IDH mutant tumors (
[0100] Anti-tumor effects of ATRA in vivo is dependent upon NK activity in vivo. Contrary to the delayed pro-differentiation effect of ATRA in vitro (
[0101] ATRA induces genetic changes in IDH mutant gliomas, with an emphasis on immune cell chemotaxis. To evaluate overall gene expression changes and to decipher pathway activation in IDH mutants after ATRA treatment, a gene microarray was performed. IDH wt and mutant cells from primary gliomas were treated with 1 ?M ATRA for 48 hours and RNA was extracted from the cells. Microarray analysis was performed using Clariom S microarray chips. ATRA was observed to induce a wide-ranging effect on IDH mutant cells, as seen in heat maps (
[0102] ATRA increases chemotaxis towards IDH mutant cells in a CCL2-dependent manner. In vivo, ATRA induced changes in the tumor microenvironment, inducing increased migration of NK cells, and decreased MDSCs and monocyte migration (
[0103] RBP1 down regulation emulates the IDH mutant phenotype in IDH WT cells. IDH mutant cells have decreased RBP1 levels, leading to impaired RA production. Results thus far demonstrated that supplementing IDH mutant cells with ATRA effectively overcomes the immune evasion observed in IDH mutant tumors. Therefore, the role of RBP1 silencing in generation of the IDH mutant immune evasive phenotype was further investigated. Lentiviral RBP1shRNA was transduced into IDH WT cells to silence the RBP1 gene. IDH WT cells transfected with a mock vector (mock-transfected) served as controls. RBP1 shRNA transfection and gene knockdown was confirmed by PCR (
[0104] RBP1 overexpression reverses immune evasion in IDH mutant gliomas. To determine whether RBP1 overexpression would reverse the immune evasion observed in IDH mutant gliomas, IDH mutant glioma cells were transduced with RBP1 lentivirus (2 MOI). Cells were analyzed for NK cytotoxicity and gene expression of RA pathway genes. There was only a modest increase in NK cell cytotoxicity in RBP1-transduced cells. However, addition of 10 ?M retinol to the cell culture medium of RBP1-transduced IDH mutant cells significantly increased recognition and killing by NK cells (
[0105] ATRA has superior anti-tumor efficacy compared to 13-cis RA and Bexarotene. There are multiple isoforms of RA that have demonstrated varying degrees of efficacy in clinical trials. Therefore, the efficacy of two other RA isoforms were compared with ATRA in IDH mutant gliomas. As shown in
[0106] All-trans retinoic acid induces differentiation in IDH mutant glioma cells. All-trans retinoic acid (ATRA) is a differentiating agent for multiple types of cancers, including IDH mutant acute myeloid leukemia (AML). Therefore, efficacy of ATRA as a differentiating agent in IDH mutant gliomas was evaluated. IDH mutant or WT primary glioma neurospheres were treated with 1 ?M ATRA for 2, 7 or 14 days. At each time point, cells were evaluated for morphological changes and changes in their molecular profile. Vehicle (DMSO)-treated cells served as controls, while cells treated with 10% FBS served as differentiation (positive) controls. ATRA induced morphological changes in IDH mutant primary glioma neurospheres, but not WT neurospeheres, after treatment for 14 days (
Discussion
[0107] Mutation in the IDH1 or IDH2 genes occurs frequently in gliomas and other human malignancies. These mutations can impart the mutant IDH enzyme with a neomorphic activitythe ability to synthesize 2-hydroxyglutarate (2-HG), which leads to a reprogramming of the chromatin state, a block in differentiation, and the establishment of the glioma hypermethylator phenotype (G-CIMP). It has been hypothesized that the extensive DNA methylation that occurs in G-CIMP tumors maintains glioma cancer cells in a dedifferentiated state. The aberrant gene expression profile activated by mutant IDH1 blocks differentiation, causing the malignant expansion of tumor-initiating cells with capacity to self-renew. Apart from dedifferentiation, 2-HG also induces repression of multiple genes involved in immune response. Multiple studies have described immune evasion in IDH mutant tumors using a variety of mechanisms. For instance, IDH mutant tumors evade recognition and killing by NK cells by downregulating the expression of NKG2D ligands, especially ULBP3. In addition, IDH mutant tumor microenvironments are rich in immunosuppressive cell subsets such as monocytes, and significantly lack effector cells such as CD8+ T cells and NK cells.
[0108] To further understand mechanisms of immune evasion in IDH mutant gliomas, the genes most differentially downregulated in IDH mutant tumors were analyzed. In an overall cohort of 198 patients, RBP1 was consistently hypermethylated in IDH1 or IDH2 MUT glioma tumors but not in WT tumors. Data disclosed herein and from The Cancer Genome Atlas (TCGA) database showed that RBP1 methylation is associated with decreased expression of CRBP1. Diagnostically, RBP1 methylation has also been established as a single biomarker for detecting both IDH1 and IDH2 mutations in gliomas. Studies in breast cancer cells have shown that silencing of RBP1 plays an important role in RA signaling by lowering all-trans-retinoic acid (ATRA) production and loss of retinoic acid receptor (RAR) levels, leading to loss of cell differentiation and tumor progression. This mechanism may help describe the molecular features of tumorigenesis in G-CIMP tumors.
[0109] ATRA is an active metabolite of vitamin A and mediates its biological effects by activating one or more of the closely related retinoic acid receptors (RAR?, RAR?, and RAR?) that function as ligand-dependent transcriptional regulators. These receptors form heterodimers with retinoid receptors (RXR?, ?, and ?) and bind to retinoid responsive response elements (RAREs) located in the promoter region of retinoid target genes to stimulate gene transcription. Thus, through receptor-mediated gene transcription, ATRA regulates a wide range of biological processes, including development, differentiation, proliferation, and apoptosis. In particular, the pro-differentiating effects of ATRA are documented in AML cell lines and primary patient samples. ATRA is also known to induce transcription of multiple immune genes, including STAT1 and type-1 interferons. IDH mutant gliomas have mechanisms to evade the immune system, including the down regulation of NKG2D ligands, especially ULBP1 and ULBP3 on IDH mutant cells in order to escape detection and killing by NK cells. Interestingly, ULBP1 and ULBP3 (also known as Retinoic acid early transcript 1 genes (RAET1) are induced by retinoic acid and interact with NKG2D receptors on NK and CD8+ T cells to trigger immune cell activation and tumor cell lysis. Anti-tumor effects of ATRA in IDH mutant gliomas were analyzed by sensitizing glioma cells to recognition and lysis by NK cells.
[0110] ATRA significantly increased the expression levels of NKG2D ligands ULBP1 and ULBP3 in vitro, while concomitantly increasing the killing of IDH mutant tumor cells by NK cells in an NKG2D-dependant manner (
[0111] Microarray studies revealed that ATRA induced gene expression changes in IDH mutant cells. Interestingly, pathway analysis showed that immune cell chemotaxis was one of the most highly upregulated pathways in ATRA-treated IDH mutant cells (
[0112] ATRA-induced chemotaxis of NK cells and macrophages was replicated in vitro in transwell assays. Therefore, to further dissect the mechanisms of ATRA-induced migration, a chemokine array was performed. The array revealed two significant changes to the chemokine profile of ATRA-treated IDH mutant cells: i) increased production of CCL2 and ii) decreased production of CXCL12 (
[0113] The efficacy of ATRA in reversing the immune evasive phenotype in IDH mutant gliomas was remarkable. It was hypothesized that the retinoic acid deficiency in IDH mutant gliomas was due to down regulation of RBP1 in those cells. To confirm this hypothesis, it was evaluated whether RBP1 down regulation was necessary and sufficient for the immune evasive characteristics of IDH mutant cells. RBP1 gene expression was silenced in IDH wild-type cells using siRNA transfection. RBP1-silenced cells significantly down regulated the expression of RBP1, as well as NKG2D ligands, reflected by the decreased recognition and killing by NK cells. Thus, like IDH mutant cells, RBP1-silenced IDH wild type cells escaped recognition and NK killing. Even in terms of gene expression levels of genes downstream of ATRA signaling, RBP1-silenced IDH wild type cells resembled IDH mutant cells (
[0114] Retinoic acid has been used as a chemotherapeutic agent in a wide variety of cancers, in pre-clinical as well as clinical applications. 13-cis-RA is the most common form of RA used in clinics, and is effective in a variety of neoplasms. Therefore, the efficacy of 13-cis RA was compared with ATRA and Bexarotene (a synthetic retinoic acid analogue) in IDH mutant gliomas. ATRA was the most effective RA isoform in terms of tumor growth, although the differences between the three groups were not significant. The difference between the three isoforms, however, lay in the biology. There were significant differences in the induction of NKG2D ligand expression between ATRA, 13-cis RA and bexarotene. Importantly, ATRA induced the highest level of NK-mediated killing in IDH mutant cells (
[0115] The disparate effects of ATRA dysregulation on the immunogenicity of IDH mutant cells are disclosed herein. In IDH mutant tumors, ATRA treatment induced immune-related responses such as increased expression of type-1 immune response genes and NKG2D ligands. ATRA also increased the chemotaxis of inflammatory immune cells towards IDH mutant gliomas, in a CCL2-dependant manner. As compared to other RA isoforms currently used, ATRA was superior. Overall, disclosed herein is a novel role for ATRA as an immune adjuvant capable of reducing or reversing the immune evasive properties of IDH mutant gliomas.
EXAMPLE 2
Involvement of CCL2 in RA-Mediated Tumor Growth Stasis
[0116] IDH WT and MUT (IDH1 R132H) tumor-bearing mice were treated with 10 mg/kg ATRA every alternate day starting on day 18 after tumor inoculation. Mice were also injected with 1 ?g anti-CCL2 neutralizing antibody (or anti isotype antibody) on the 1st day of ATRA treatment. CCL2 blockade reversed ATRA-mediated tumor stasis in a MDSCs and NK cell dependent manner (
EXAMPLE 3
RA Treatment in Chondrosarcoma IDH Mutant
[0117] IDH mutant (HT-1080, R132C IDH1 mutation) chondrosarcoma cells were treated with different doses of ATRA or DMSO for 48 hours. After treatment, cells were evaluated for viability (
[0118] IDH mutant tumor cells produce reduced amounts of RBP1 compared to WT IDH tumor cells (
[0119] IDH WT chondrosarcoma cells and IDH mutant chondrosarcoma cells were treated with different doses of ATRA or DMSO for 48 hours and were evaluated for killing by NK cells (
EXAMPLE 4
RA Therapy in a Human Patient with IDH Mutant Glioma
[0120] A 44-year old female patient with diffuse IDH mutant glioma was treated with 40 mg/m2 ATRA on a treatment cycle of 21 days on, 7 days off. MRI images of the patient's brain were performed before (
EXAMPLE 5
Sequences
[0121]
TABLE-US-00001 AnIDH1polynucleotide SEQIDNO:1 1 gggctgaggaggcggggcctgggaggggacaaagccgggaagaggaaaagctcggaccta 61 ccctgtggtcccgggtttctgcagagtctacttcagaagcggaggcactgggagtccggt 121 ttgggattgccaggctgtggttgtgagtctgagcttgtgagcggctgtggcgccccaact 181 cttcgccagcatatcatcccggcaggcgataaactacattcagttgagtctgcaagactg 241 ggaggaactggggtgataagaaatctattcactgtcaaggtttattgaagtcaaaatgtc 301 caaaaaaatcagtggcggttctgtggtagagatgcaaggagatgaaatgacacgaatcat 361 ttgggaattgattaaagagaaactcatttttccctacgtggaattggatctacatagcta 421 tgatttaggcatagagaatcgtgatgccaccaacgaccaagtcaccaaggatgctgcaga 481 agctataaagaagcataatgttggcgtcaaatgtgccactatcactcctgatgagaagag 541 ggttgaggagttcaagttgaaacaaatgtggaaatcaccaaatggcaccatacgaaatat 601 tctgggtggcacggtcttcagagaagccattatctgcaaaaatatcccccggcttgtgag 661 tggatgggtaaaacctatcatcataggtcgtcatgcttatggggatcaatacagagcaac 721 tgattttgttgttcctgggcctggaaaagtagagataacctacacaccaagtgacggaac 781 ccaaaaggtgacatacctggtacataactttgaagaaggtggtggtgttgccatggggat 841 gtataatcaagataagtcaattgaagattttgcacacagttccttccaaatggctctgtc 901 taagggttggcctttgtatctgagcaccaaaaacactattctgaagaaatatgatgggcg 961 ttttaaagacatctttcaggagatatatgacaagcagtacaagtcccagtttgaagctca 1021 aaagatctggtatgagcataggctcatcgacgacatggtggcccaagctatgaaatcaga 1081 gggaggcttcatctgggcctgtaaaaactatgatggtgacgtgcagtcggactctgtggc 1141 ccaagggtatggctctctcggcatgatgaccagcgtgctggtttgtccagatggcaagac 1201 agtagaagcagaggctgcccacgggactgtaacccgtcactaccgcatgtaccagaaagg 1261 acaggagacgtccaccaatcccattgcttccatttttgcctggaccagagggttagccca 1321 cagagcaaagcttgataacaataaagagcttgccttctttgcaaatgctttggaagaagt 1381 ctctattgagacaattgaggctggcttcatgaccaaggacttggctgcttgcattaaagg 1441 tttacccaatgtgcaacgttctgactacttgaatacatttgagttcatggataaacttgg 1501 agaaaacttgaagatcaaactagctcaggccaaactttaagttcatacctgagctaagaa 1561 ggataattgtcttttggtaactaggtctacaggtttacatttttctgtgttacactcaag 1621 gataaaggcaaaatcaattttgtaatttgtttagaagccagagtttatcttttctataag 1681 tttacagcctttttcttatatatacagttattgccacctttgtgaacatggcaagggact 1741 tttttacaatttttattttattttctagtaccagcctaggaattcggttagtactcattt 1801 gtattcactgtcactttttctcatgttctaattataaatgaccaaaatcaagattgctca 1861 aaagggtaaatgatagccacagtattgctccctaaaatatgcataaagtagaaattcact 1921 gccttcccctcctgtccatgaccttgggcacagggaagttctggtgtcatagatatcccg 1981 ttttgtgaggtagagctgtgcattaaacttgcacatgactggaacgaagtatgagtgcaa 2041 ctcaaatgtgttgaagatactgcagtcatttttgtaaagaccttgctgaatgtttccaat 2101 agactaaatactgtttaggccgcaggagagtttggaatccggaataaatactacctggag 2161 gtttgtcctctccatttttctctttctcctcctggcctggcctgaatattatactactct 2221 aaatagcatatttcatccaagtgcaataatgtaagctgaatcttttttggacttctgctg 2281 gcctgttttatttcttttatataaatgtgatttctcagaaattgatattaaacactatct 2341 tatcttctcctgaactgttgattttaattaaaattaagtgctaattaccattaaaaaaaa 2401 aa AnIDH2polynucleotide SEQIDNO:2 1 attttgcaacgccataggcttccagcgactgctggtgatgtttctgatgccgacaaaagg 61 atcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacccgtattatctgg 121 cagttcatcaaggagaagctcatcctgccccacgtggacatccagctaaagtattttgac 181 ctcgggctcccaaaccgtgaccagactgatgaccaggtcaccattgactctgcactggcc 241 acccagaagtacagtgtggctgtcaagtgtgccaccatcacccctgatgaggcccgtgtg 301 gaagagttcaagctgaagaagatgtggaaaagtcccaatggaactatccggaacatcctg 361 ggggggactgtcttccgggagcccatcatctgcaaaaacatcccacgcctagtccctggc 421 tggaccaagcccatcaccattggcaggcacgcccatggcgaccagtacaaggccacagac 481 tttgtggcagaccgggccggcactttcaaaatggtcttcaccccaaaagatggcagtggt 541 gtcaaggagtgggaagtgtacaacttccccgcaggcggcgtgggcatgggcatgtacaac 601 accgacgagtccatctcaggttttgcgcacagctgcttccagtatgccatccagaagaaa 661 tggccgctgtacatgagcaccaagaacaccatactgaaagcctacgatgggcgtttcaag 721 gacatcttccaggagatctttgacaagcactataagaccgacttcgacaagaataagatc 781 tggtatgagcaccggctcattgatgacatggtggctcaggtcctcaagtcttcgggtggc 841 tttgtgtgggcctgcaagaactatgacggagatgtgcagtcagacatcctggcccagggc 901 tttggctcccttggcctgatgacgtccgtcctggtctgccctgatgggaagacgattgag 961 gctgaggccgctcatgggaccgtcacccgccactatcgggagcaccagaagggccggccc 1021 accagcaccaaccccatcgccagcatctttgcctggacacgtggcctggagcaccggggg 1081 aagctggatgggaaccaagacctcatcaggtttgcccagatgctggagaaggtgtgcgtg 1141 gagacggtggagagtggagccatgaccaaggacctggcgggctgcattcacggcctcagc 1201 aatgtgaagctgaacgagcacttcctgaacaccacggacttcctcgacaccatcaagagc 1261 aacctggacagagccctgggcaggcagtagggggaggcgccacccatggctgcagtggag 1321 gggccagggctgagccggcgggtcctcctgagcgcggcagagggtgagcctcacagcccc 1381 tctctggaggcctttctaggggatgtttttttataagccagatgtttttaaaagcatatg 1441 tgtgtttcccctcatggtgacgtgaggcaggagcagtgcgttttacctcagccagtcagt 1501 atgttttgcatactgtaatttatattgcccttggaacacatggtgccatatttagctact 1561 aaaaagctcttcacaaaa