Acyl-ACP thioesterase
10087428 ยท 2018-10-02
Assignee
Inventors
Cpc classification
International classification
C12P7/64
CHEMISTRY; METALLURGY
C12N1/00
CHEMISTRY; METALLURGY
Abstract
An acyl-ACP thioesterase consisting of an amino acid sequence of the 115.sup.th to 274.sup.th amino acids set forth in SEQ ID NO: 1; an acyl-ACP thioesterase gene encoding the protein; a transformant having the gene; and a method of producing a lipid using the transformant.
Claims
1. A method of modifying a fatty acid composition in a lipid, comprising introducing a gene encoding a protein selected from the following (a) to (c) or a recombinant vector comprising the gene into a host: (a) A protein consisting of the amino acid sequence of the 115th to 274th amino acids set forth in SEQ ID NO: 1; (b) A protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (a), and having acyl-ACP thioesterase activity; and (c) A protein comprising an amino acid sequence selected from (i) to (x) below, but not the amino acid sequence of SEQ ID NO:1, and having acyl-ACP thioesterase activity: (i) the amino acid sequence of the 36th to 274th amino acids set forth in SEQ ID NO: 1; (ii) the amino acid sequence of the 45th to 274th amino acids set forth in SEQ ID NO: 1; ii) the amino acid sequence of the 55th to 274th amino acids set forth in SEQ ID NO: 1; (iv) the amino acid sequence of the 65th to 274th amino acids set forth in SEQ ID NO: 1; (v) the amino acid sequence of the 75th to 274th amino acids set forth in SEQ ID NO: 1; (vi) the amino acid sequence of the 85th to 274th amino acids set forth in SEQ ID NO: 1; (vii) the amino acid sequence of the 95th to 274th amino acids set forth in SEQ ID NO: 1; (viii) the amino acid sequence of the 105th to 274th amino acids set forth in SEQ ID NO: 1; (ix) the amino acid sequence of the 115.sup.th to 274.sup.th amino acids set forth in SEQ ID NO: 1; and (x) one of the amino acid sequences of (i)-(ix) but in which 1 or more and 20 or less amino acids are mutated; expressing the protein in the host cell; and modifying the fatty acid composition of the lipid produced by the host cell as a result of expression of the protein.
2. The method according to claim 1, wherein the protein is protein (b) in which 1 or more and 10 or less amino acids in the sequence of protein (a) are mutated, in which the amino acid sequence of the protein with the mutated amino acid sequence has 90% or more identity with the amino acid sequence of protein (a), and in which the protein with the mutated amino acid sequence has acyl-ACP thioesterase activity.
3. The method according to claim 1, wherein the protein is protein (c) and protein (c) is a protein selected from the group consisting of: a protein consisting of the amino acid sequence of the 36th to 274th amino acids set forth in SEQ ID NO: 1; a protein consisting of the amino acid sequence of the 45th to 274th amino acids set forth in SEQ ID NO: 1; a protein consisting of the amino acid sequence of the 55th to 274th amino acids set forth in SEQ ID NO: 1; a protein consisting of the amino acid sequence of the 65th to 274th amino acids set forth in SEQ ID NO: 1; a protein consisting of the amino acid sequence of the 75th to 274th amino acids set forth in SEQ ID NO: 1; a protein consisting of the amino acid sequence of the 85th to 274th amino acids set forth in SEQ ID NO: 1; a protein consisting of the amino acid sequence of the 95th to 274th amino acids set forth in SEQ ID NO: 1; a protein consisting of the amino acid sequence of the 105th to 274th amino acids set forth in SEQ ID NO: 1; and a protein having any one of these amino acid sequences, in which 1 or more and 20 or less amino acids are mutated, and having acyl-ACP thioesterase activity.
4. The method according to claim 1, wherein the host is a microalga.
5. A method of modifying a fatty acid composition in a lipid, comprising introducing a gene consisting of any one of the following DNAs (d) to (f) or a recombinant vector comprising the gene into a host: (d) A DNA consisting of the nucleotide sequence of the 343rd to 825th nucleotides set forth in SEQ ID NO: 2; (e) A DNA consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence of the DNA (d), and encoding a protein having acyl-ACP thioesterase activity; and (f) A DNA comprising a nucleotide sequence selected from (xi) to (xx) below, but not the DNA sequence of SEQ ID NO:2, and encoding a protein having acyl-ACP thioesterase activity: (xi) a DNA comprising the nucleotide sequence of the 106th to 825th nucleotides set forth in SEQ ID NO: 2; (xii) a DNA comprising the nucleotide sequence of the 133rd to 825th nucleotides set forth in SEQ ID NO: 2; (xiii) a DNA comprising the nucleotide sequence of the 163rd to 825th nucleotides set forth in SEQ ID NO: 2; (xiv) a DNA comprising the nucleotide sequence of the 193rd to 825th nucleotides set forth in SEQ ID NO: 2; (xv) a DNA comprising the nucleotide sequence of the 223rd to 825th nucleotides set forth in SEQ ID NO: 2; (xvi) a DNA comprising the nucleotide sequence of the 253rd to 825th nucleotides set forth in SEQ ID NO: 2; (xvii) a DNA comprising the nucleotide sequence of the 283rd to 825th nucleotides set forth in SEQ ID NO: 2; (xviii) a DNA comprising the nucleotide sequence of the 313rd to 825th nucleotides set forth in SEQ ID NO: 2; (xix) a DNA comprising the nucleotide sequence of the 343.sup.rd to 825.sup.th nucleotides set forth in SEQ ID NO: 2; and (xx) a DNA comprising any one of nucleotide sequences (xi)-(xix), in which 1 or more and 20 or less nucleotides are mutated, and encoding a protein having acyl-ACP thioesterase activity; expressing the DNA in the host cell; and modifying the fatty acid composition of the lipid produced by the host cell as a result of expression of the DNA.
6. The method according to claim 5, wherein the DNA is DNA (e) in which 1 or more and 10 or less nucleotides in the sequence of DNA (d) are mutated, in which the DNA sequence of the DNA with the mutated nucleotide sequence has 90% or more identity with the nucleotide sequence of DNA (d), and in which the DNA with the mutated nucleotide sequence encodes a protein having acyl-ACP thioesterase activity.
7. The method according to claim 5, wherein the DNA is DNA (f) and DNA (f) is a DNA selected from the group consisting of: a DNA consisting of the nucleotide sequence of the 106th to 825th nucleotides set forth in SEQ ID NO: 2; a DNA consisting of the nucleotide sequence of the 133rd to 825th nucleotides set forth in SEQ ID NO: 2; a DNA consisting of the nucleotide sequence of the 163rd to 825th nucleotides set forth in SEQ ID NO: 2; a DNA consisting of the nucleotide sequence of the 193rd to 825th nucleotides set forth in SEQ ID NO: 2; a DNA consisting of the nucleotide sequence of the 223rd to 825th nucleotides set forth in SEQ ID NO: 2; a DNA consisting of the nucleotide sequence of the 253rd to 825th nucleotides set forth in SEQ ID NO: 2; a DNA consisting of the nucleotide sequence of the 283rd to 825th nucleotides set forth in SEQ ID NO: 2; a DNA consisting of the nucleotide sequence of the 313rd to 825th nucleotides set forth in SEQ ID NO: 2; and a DNA having any one of these nucleotide sequences, in which 1 or more and 20 or less nucleotides are mutated, and encoding a protein having acyl-ACP thioesterase activity.
8. The method according to claim 5, wherein the host is a microalga.
9. A method of enhancing productivity of a lipid, comprising introducing a gene encoding a protein selected from the following (a) to (c) or a recombinant vector comprising the gene into a host: (a) A protein consisting of the amino acid sequence of the 115th to 274th amino acids set forth in SEQ ID NO: 1; (b) A protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (a), and having acyl-ACP thioesterase activity; and (c) A protein comprising an amino acid sequence selected from (i) to (x) below, but not the amino acid sequence of SEQ ID NO:1, and having acyl-ACP thioesterase activity: (i) the amino acid sequence of the 36th to 274th amino acids set forth in SEQ ID NO: 1; (ii) the amino acid sequence of the 45th to 274th amino acids set forth in SEQ ID NO: 1; (iii) the amino acid sequence of the 55th to 274th amino acids set forth in SEQ ID NO: 1; the amino acid sequence of the 65th to 274th amino acids set forth in SEQ ID NO: 1; (v) the amino acid sequence of the 75th to 274th amino acids set forth in SEQ ID NO: 1; (vi) the amino acid sequence of the 85th to 274th amino acids set forth in SEQ ID NO: 1; (vii) the amino acid sequence of the 95th to 274th amino acids set forth in SEQ ID NO: 1; (viii) the amino acid sequence of the 105th to 274th amino acids set forth in SEQ ID NO: 1; (ix) the amino acid sequence of the 115.sup.th to 274.sup.th amino acids set forth in SEQ ID NO: 1; and (x) one of the amino acid sequences of (i)-(ix) but in which 1 or more and 20 or less amino acids are mutated; expressing the protein in the host cell; and enhancing productivity of the lipid produced by the host cell as a result of expression of the protein.
10. The method according to claim 9, wherein the protein is protein (b) in which 1 or more and 10 or less amino acids in the sequence of protein (a) are mutated, in which the amino acid sequence of the protein with the mutated amino acid sequence has 90% or more identity with the amino acid sequence of protein (a), and in which the protein with the mutated amino acid sequence has acyl-ACP thioesterase activity.
11. The method according to claim 9, wherein the protein is protein (c) and protein (c) is a protein selected from the group consisting of: a protein consisting of the amino acid sequence of the 36th to 274th amino acids set forth in SEQ ID NO: 1; a protein consisting of the amino acid sequence of the 45th to 274th amino acids set forth in SEQ ID NO: 1; a protein consisting of the amino acid sequence of the 55th to 274th amino acids set forth in SEQ ID NO: 1; a protein consisting of the amino acid sequence of the 65th to 274th amino acids set forth in SEQ ID NO: 1; a protein consisting of the amino acid sequence of the 75th to 274th amino acids set forth in SEQ ID NO: 1; a protein consisting of the amino acid sequence of the 85th to 274th amino acids set forth in SEQ ID NO: 1; a protein consisting of the amino acid sequence of the 95th to 274th amino acids set forth in SEQ ID NO: 1; a protein consisting of the amino acid sequence of the 105th to 274th amino acids set forth in SEQ ID NO: 1; and a protein having any one of these amino acid sequences, in which 1 or more and 20 or less amino acids are mutated, and having acyl-ACP thioesterase activity.
12. The method according to claim 9, wherein the host is a microalga.
13. A method of enhancing productivity of a lipid, comprising introducing a gene consisting of any one of the following DNAs (d) to (f) or a recombinant vector comprising the gene into a host: (d) A DNA consisting of the nucleotide sequence of the 343rd to 825th nucleotides set forth in SEQ ID NO: 2; (e) A DNA consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence of the DNA (d), and encoding a protein having acyl-ACP thioesterase activity; and (f) A DNA comprising a nucleotide sequence selected from (xi) to (xx) below, but not the DNA sequence of SEQ ID NO:2, and encoding a protein having acyl-ACP thioesterase activity: (xi) a DNA comprising the nucleotide sequence of the 106th to 825th nucleotides set forth in SEQ ID NO: 2; (xii) a DNA comprising the nucleotide sequence of the 133rd to 825th nucleotides set forth in SEQ ID NO: 2; (xiii) a DNA comprising the nucleotide sequence of the 163rd to 825th nucleotides set forth in SEQ ID NO: 2; (xiv) a DNA comprising the nucleotide sequence of the 193rd to 825th nucleotides set forth in SEQ ID NO: 2; (xv) a DNA comprising the nucleotide sequence of the 223rd to 825th nucleotides set forth in SEQ ID NO: 2; (xvi) a DNA comprising the nucleotide sequence of the 253rd to 825th nucleotides set forth in SEQ ID NO: 2; (xvii) a DNA comprising the nucleotide sequence of the 283rd to 825th nucleotides set forth in SEQ ID NO: 2; (xviii) a DNA comprising the nucleotide sequence of the 313rd to 825th nucleotides set forth in SEQ ID NO: 2; (xix) a DNA comprising the nucleotide sequence of the 343.sup.rd to 825.sup.th nucleotides set forth in SEQ ID NO: 2; and (xx) a DNA comprising any one of nucleotide sequences (xi)-(xix), in which 1 or more and 20 or less nucleotides are mutated, and encoding a protein having acyl-ACP thioesterase activity; expressing the DNA in the host cell; and modifying the fatty acid composition of the lipid produced by the host cell as a result of expression of the DNA.
14. The method according to claim 13, wherein the DNA is DNA (e) in which 1 or more and 10 or less nucleotides are mutated, in which the DNA sequence of the DNA with the mutated nucleotide sequence has 90% or more identity with the nucleotide sequence of DNA (d), and in which the DNA with the mutated nucleotide sequence encodes a protein having acyl-ACP thioesterase activity.
15. The method according to claim 13, wherein the DNA is DNA (f) and DNA (f) is a DNA selected from the group consisting of: a DNA consisting of the nucleotide sequence of the 106th to 825th nucleotides set forth in SEQ ID NO: 2; a DNA consisting of the nucleotide sequence of the 133rd to 825th nucleotides set forth in SEQ ID NO: 2; a DNA consisting of the nucleotide sequence of the 163rd to 825th nucleotides set forth in SEQ ID NO: 2; a DNA consisting of the nucleotide sequence of the 193rd to 825th nucleotides set forth in SEQ ID NO: 2; a DNA consisting of the nucleotide sequence of the 223rd to 825th nucleotides set forth in SEQ ID NO: 2; a DNA consisting of the nucleotide sequence of the 253rd to 825th nucleotides set forth in SEQ ID NO: 2; a DNA consisting of the nucleotide sequence of the 283rd to 825th nucleotides set forth in SEQ ID NO: 2; a DNA consisting of the nucleotide sequence of the 313rd to 825th nucleotides set forth in SEQ ID NO: 2; and a DNA having any one of these nucleotide sequences, in which 1 or more and 20 or less nucleotides are mutated, and encoding a protein having acyl-ACP thioesterase activity.
16. The method according to claim 13, wherein the host is a microalga.
Description
EXAMPLES
(1) Hereinafter, the present invention will be described more in detail with reference to Examples, but the present invention is not limited thereto.
Example 1. Preparation of Escherichia coli Transformant Having Nga07062 Gene, and Production of Lipid by Escherichia coli Transformant
(2) 1. Preparation of Nga07062 Gene
(3) Information on sequences of total 9052 genes of Nannochloropsis gaditana CCMP 526 were acquired from Nannochloropsis Genome Project (nannochloropsis.genomeprojectsolutions-databases.com/) provided by Colorado School of Mines and Genome Project Solutions. For an Nga07062 gene (gene consisting of a nucleotide sequence set forth in SEQ ID NO: 2) being one of the genes, a function was identified by the following method.
(4) 2. Construction of Plasmid for Nga07062 Gene Expression
(5) The Nga07062 gene was used as a template, and an Nga07062 gene fragment consisting of a nucleotide sequence of the 106.sup.th to 825.sup.th nucleotides set forth in SEQ ID NO: 2 was prepared by PCR using a pair of primers set forth in SEQ ID NO: 3 and SEQ ID NO: 4 as shown in Table 1 below. Herein, the gene having the nucleotide sequence set forth in SEQ ID NO: 2 was obtained utilizing customer synthesis service of an artificial gene. Moreover, a plasmid vector pBluescriptII SK() (manufactured by Stratagene, Inc.) was used as a template, and the pBluescriptII SK() was amplified by PCR using a pair of primers set forth in SEQ ID NOs: 5 and 6 shown in Table 1 below. Then, the resultant was subjected to digestion by restriction enzyme DpnI (manufactured by TOYOBO Co., Ltd.) treatment. These two fragments were purified using a High Pure PCR Product Purification Kit (manufactured by Roche Applied Science Corporation), and then fused using an In-Fusion HD Cloning Kit (manufactured by Clontech, Inc.) to construct a plasmid Nga07062_106 for Nga07062 gene expression. This expression plasmid was constructed in the form of removing an amino acid sequence of the 1.sup.st to 35.sup.th amino acids on a side of an N-terminus of an amino acid sequence (SEQ ID NO: 1) encoded by the Nga07062 gene, and fusing with an amino acid sequence of the 1.sup.st to 29.sup.th amino acids on a side of an N-terminus of a LacZ protein derived from the plasmid.
(6) The Nga07062 gene consisting of a nucleotide sequence set forth in SEQ ID NO: 2 was used a template, and PCR was carried out by using pairs of any one of primers set forth in SEQ ID NOs: 7 to 13, and a primer set forth in SEQ ID NO: 4, shown in Table 1 below, to prepare an Nga07062 gene fragment consisting of a nucleotide sequence of the 163.sup.rd to 825.sup.th nucleotides set forth in SEQ ID NO: 2, an Nga07062 gene fragment consisting of a nucleotide sequence of the 193.sup.rd to 825.sup.th nucleotides set forth in SEQ ID NO: 2, an Nga07062 gene fragment consisting of a nucleotide sequence of the 223.sup.rd to 825.sup.th nucleotides set forth in SEQ ID NO: 2, an Nga07062 gene fragment consisting of a nucleotide sequence of the 253.sup.rd to 825.sup.th nucleotides set forth in SEQ ID NO: 2, an Nga07062 gene fragment consisting of a nucleotide sequence of the 283.sup.rd to 825.sup.th nucleotides set forth in SEQ ID NO: 2, an Nga07062 gene fragment consisting of a nucleotide sequence of the 313.sup.rd to 825.sup.th nucleotides set forth in SEQ ID NO: 2, and an Nga07062 gene fragment consisting of a nucleotide sequence the 343.sup.rd to 825.sup.th nucleotides set forth in SEQ ID NO: 2, respectively.
(7) Each of the resultant gene fragments was fused with the pBluescriptII SK() vector in a manner similar to the method described above to construct a plasmid Nga07062_163 for Nga07062 gene expression, a plasmid Nga07062_193 therefor, a plasmid Nga07062_223 therefor, a plasmid Nga07062_253 therefor, a plasmid Nga07062_283 therefor, a plasmid Nga07062_313 therefor, and a plasmid Nga07062_343 therefor, respectively. Herein, these expression plasmids were constructed in the form of removing amino acid sequences of the 1.sup.st to 54.sup.th amino acids, the 1.sup.st to 64.sup.th amino acids, the 1.sup.st to 74.sup.th amino acids, the 1.sup.st to 84.sup.th amino acids, the 1.sup.st to 94.sup.th amino acids, the 1.sup.st to 104.sup.th amino acids or the 1.sup.st to 114.sup.th amino acids on the side of the N-terminus of the amino acid sequence (SEQ ID NO: 1) encoded by the Nga07062 gene, respectively, and fusing with the amino acid sequence of the 1.sup.st to 29.sup.th amino acids on the side of the N-terminus of the LacZ protein derived from the plasmid.
(8) TABLE-US-00001 TABLE1 NucleotideSequenceofPrimers SEQIDNO:3 GCGGCCGCTCTAGAGCCGGCCCGAGCACTCAGCCATC SEQIDNO:4 ACAAAATATTAACGCCTAACTGATGTCCACCTTCTTC SEQIDNO:5 CTCTAGAGCGGCCGCCACCG SEQIDNO:6 GCGTTAATATTTTGTTAAAATTCG SEQIDNO:7 GCGGCCGCTCTAGAGTCATCCTTCTCGATCTTGTTG SEQIDNO:8 GCGGCCGCTCTAGAGGTAGCAGGATCATTCGTCGG SEQIDNO:9 GCGGCCGCTCTAGAGATCGCTGGGCATACAGCAGG SEQIDNO:10 GCGGCCGCTCTAGAGGATGAAGTAAAGTCTCCGCAG SEQIDNO:11 GCGGCCGCTCTAGAGAATGTAGGAGGCGGCGCCCCAG SEQIDNO:12 GCGGCCGCTCTAGAGCCCTACACGGTCACTTTTGC SEQIDNO:13 GCGGCCGCTCTAGAGCATGATCGAGTGGACACAAAAC
3. Introduction of Nga07062 Gene Expression Plasmid into Escherichia coli
(9) An Escherichia coli mutant strain, strain K27 (fadD88) (Overath et al, Eur. J. Biochem. 7, 559-574, 1969), was transformed by a competent cell transformation method, using each of the Nga07062 gene expression plasmids constructed in the above. Each transformant was cultured overnight at 37 C., and each colony thus obtained was inoculated in 1 mL of LBAmp liquid medium (Bacto Trypton 1%, yeast extract 0.5%, NaCl 1%, and Ampicillin sodium 50 g/mL), and then cultured overnight at 37 C. Twenty microliters of the culture fluid was inoculated to 2 mL of Overnight Express Instant TB medium (Novagen, Inc.) and was subjected to shaking culture at 30 C. After 16 hours cultivation, lipid components contained in the culture fluid were analyzed by the method described below in the following item 5. As a negative control, Escherichia coli strain K27 transformed with the plasmid vector pBluescriptII SK() was also subjected to the same experiment.
(10) 4. Extraction of Lipid from Escherichia coli Culture Fluid and Analysis of Fatty Acid Contained Therein
(11) To 1 mL of the culture fluid, 50 L of 7-pentadecanone (1 mg/mL) as an internal standard was added, and then 0.5 mL of chloroform, 1 mL of methanol and 10 L of 2N hydrochloric acid were added. The mixture was sufficiently stirred and then was left for 30 minutes. Further, 0.5 mL of chloroform and 0.5 mL of a 1.5% aqueous solution of potassium chloride were added thereto. The mixture was stirred and centrifuged for 15 minutes at 3,000 rpm, and then the chloroform layer (lower layer) was collected with pasteur pipette. A nitrogen gas was blown onto the resultant chloroform layer to be dried into solid, 0.7 mL of 0.5 N potassium hydroxide/methanol solution was added thereto, and the resultant mixture was kept warm at 80 C. for 30 minutes. One milliliter of 14% solution of boron trifluoride (manufactured by Sigma-Aldrich) was added to the sample, and the mixture was kept warm at 80 C. for 10 minutes. Thereafter, 1 mL of saturated saline and 1 mL of hexane were added thereto, and the mixture was sufficiently stirred and then was left for 30 minutes at room temperature. Then, the hexane layer (upper layer) was collected to obtain fatty acid esters.
(12) The obtain fatty acid esters were provided for gas chromatographic analysis. The gas chromatography was carried out under the conditions as follows:
(13) capillary column: DB-1 MS 30 m200 m0.25 m (J&W Scientific, Inc.),
(14) mobile layer: high purity helium,
(15) flow rate inside the column: 1.0 mL/min,
(16) temperature rise program: 100 C. (for 1 min).fwdarw.10 C./min.fwdarw.300 C. (for 5 min),
(17) equilibration time: for 1 min,
(18) injection port: split injection (split ratio: 100:1),
(19) pressure 14.49 psi, 104 mL/min,
(20) amount of injection 1 L,
(21) cleaning vial: methanolchloroform, and
(22) detector temperature: 300 C.
(23) Moreover, fatty acid ester was identified by providing the identical sample for a gas chromatography-mass spectrometry analysis under identical conditions.
(24) Amounts of fatty acid methyl esters were quantitatively determined based on the peak areas of the above gas chromatographic analysis. The peak area corresponding to the each fatty acids was compared with that of 7-pentadecanone as the internal standard, and carried out corrections between the samples, and then the amount of the each fatty acids per liter of the culture fluid was calculated. Further, the total amount of the each fatty acids was calculated by summing the amounts of the each fatty acids thus obtained, and ratio (weight percent) of the each fatty acids in the total amount of fatty acids was calculated.
(25) Table 2 shows the results of measuring a ratio of each fatty acid and a total amount of fatty acids. Herein, in Table below, the description of Cx:y for the fatty acid composition represents a fatty acid having x as the number of carbon atoms, and y as the number of double bonds.
(26) TABLE-US-00002 TABLE 2 Total amount Introduced of fatty acids Fatty Acid Composition (%) plasmid (mg/L) C12:1 C12:0 C14:1 C14:0 C16:1 C16:0 C17:0 C18:1 C19:0 pBS 149.6 0.0 0.0 0.0 4.5 2.9 49.3 26.9 9.1 7.3 Nga07062_106 155.4 0.0 0.0 1.2 5.2 8.2 44.6 20.6 16.3 3.4 Nga07062_163 208.7 0.0 1.2 0.8 7.9 1.9 48.4 28.2 5.1 6.4 Nga07062_193 284.1 0.9 1.3 4.1 7.4 14.5 41.4 14.8 12.9 2.8 Nga07062_223 377.1 2.4 2.6 9.0 12.1 14.9 35.0 12.8 8.7 2.7 Nga07062_253 377.4 3.1 2.8 10.4 11.1 17.2 32.7 11.1 8.8 2.8 Nga07062_283 373.0 2.6 2.6 9.0 12.3 15.3 34.7 12.5 8.1 3.0 Nga07062_313 303.2 1.9 2.2 7.3 11.2 12.8 37.3 15.6 8.2 3.4 Nga07062_343 245.2 0.7 1.7 3.0 9.4 8.6 43.2 21.1 8.0 4.2
(27) As shown in Table 2, an increase in a total amount of fatty acids was observed in the transformant having the Nga07062 gene fragment in comparison with the transformant (pBS of Table 2) having the plasmid vector pBluescriptII SK(). Moreover, the fatty acid composition changed in the transformant in comparison with the transformant having the plasmid vector pBluescriptII SK(). In particular, ratios of the fatty acids of C12:1, C12:0, C14:1, C14:0 and C16:1 increased. From these results, the protein encoded by the Nga07062 gene is thought to be the acyl-ACP thioesterase in which a specific fatty acid is cut out from acyl-ACP. Moreover, a protein containing at least the amino acid sequence of the 115.sup.th to 274.sup.th amino acids set forth in SEQ ID NO: 1 was found to show the acyl-ACP thioesterase activity.
Example 2. Preparation of Escherichia coli Transformant Having Acyl-ACP Thioesterase Gene Derived from Nannochloropsis oculata, and Production of Lipid by Escherichia coli Transformant
(28) 1. Preparation of Gene Encoding Acyl-ACP Thioesterase Derived from Nannochloropsis oculata (Hereinafter, Referred to as NoTE), and Construction of Plasmid for NoTE Gene Expression
(29) Total RNA of Nannochloropsis oculata NIES 2145 was extracted, and reverse transcription was performed using SuperScript (trade name) III First-Strand Synthesis SuperMix for qRT-PCR (manufactured by Invitrogen Corporation) to obtain cDNA. This cDNA was used as a template, and a gene fragment consisting of a nucleotide sequence set forth in SEQ ID NO: 15 was prepared by PCR using a pair of primers set forth in SEQ ID NO: 18 and SEQ ID NO: 27 shown in Table 3 below. The resultant gene fragment was subjected to cloning to the plasmid vector pBluescriptII SK() in a manner similar to the method in the item 2. in Example 1 to construct a plasmid NoTE_1 for NoTE gene expression. This expression plasmid was constructed in the form of fusing on a side of an N-terminus of 1.sup.st amino acid of an amino acid sequence (SEQ ID NO: 14) encoded by the NoTE gene with the amino acid sequence of the 1.sup.st to 29.sup.th amino acids on the side of the N-terminus of the LacZ protein derived from the plasmid.
(30) In a similar manner, the cDNA was used a template, and PCR was carried out by using pairs of any one of primers set forth in SEQ ID NOs: 19 to 26, and a primer set forth in SEQ ID NO: 27, shown in Table 3 below, to prepare a gene fragment consisting of a nucleotide sequence of the 145.sup.th to 864.sup.th nucleotides set forth in SEQ ID NO: 15, a gene fragment consisting of a nucleotide sequence of the 172.sup.nd to 864.sup.th nucleotides set forth in SEQ ID NO: 15, a gene fragment consisting of a nucleotide sequence of the 232.sup.nd to 864.sup.th nucleotides set forth in SEQ ID NO: 15, a gene fragment consisting of a nucleotide sequence of the 262.sup.nd to 864.sup.th nucleotides set forth in SEQ ID NO: 15, a gene fragment consisting of a nucleotide sequence of the 292.sup.nd to 864.sup.th nucleotides set forth in SEQ ID NO: 15, a gene fragment consisting of a nucleotide sequence of the 322.sup.nd to 864.sup.th nucleotides set forth in SEQ ID NO: 15, a gene fragment consisting of a nucleotide sequence the 352.sup.nd to 864.sup.th nucleotides set forth in SEQ ID NO: 15, and a gene fragment consisting of a nucleotide sequence the 382.sup.nd to 864.sup.th nucleotides set forth in SEQ ID NO: 15, respectively. Each of the resultant gene fragments was fused with the pBluescriptII SK() vector in a manner similar to the method described above to construct a plasmid NoTE_145 for NoTE gene expression, a plasmid NoTE_172 therefor, a plasmid NoTE_232 therefor, a plasmid NoTE_262 therefor, a plasmid NoTE_292 therefor, a plasmid NoTE_322 therefor, a plasmid NoTE_352 therefor, and a plasmid NoTE_382 therefor, respectively. Herein, these expression plasmids were constructed in the form of removing amino acid sequences of the 1.sup.st to 48.sup.th amino acids, the 1.sup.st to 57.sup.th amino acids, the 1.sup.st to 77.sup.th amino acids, the 1.sup.st to 87.sup.th amino acids, the 1.sup.st to 97.sup.th amino acids, the 1.sup.st to 107.sup.th amino acids, the 1.sup.st to 117.sup.th amino acids or the 1.sup.st to 127.sup.th amino acids on the side of the N-terminus of the amino acid sequence (SEQ ID NO: 14) encoded by the NoTE gene, respectively, and fusing with the amino acid sequence of the 1.sup.st to 29.sup.th amino acids on the side of the N-terminus of the LacZ protein derived from the plasmid.
(31) TABLE-US-00003 TABLE3 NucleotideSequenceofPrimers SEQIDNO:18 GCGGCCGCTCTAGAGATGACGCCTTTGGCCTTCAC SEQIDNO:19 GCGGCCGCTCTAGAGTCCGGCTGTTCACATAGCAC SEQIDNO:20 GCGGCCGCTCTAGAGCTTAGAACCAGCTTCCCAGTC SEQIDNO:21 GCGGCCGCTCTAGAGGCTGCCATTTCCCTGCCGTCG SEQIDNO:22 GCGGCCGCTCTAGAGTGCGAGACGGCCCACGCCGGG AC SEQIDNO:23 GCGGCCGCTCTAGAGAGACGAGGTGAGAGGAAGGC SEQIDNO:24 GCGGCCGCTCTAGAGGATGGTGGAAAAGGCGAGGCC SEQIDNO:25 GCGGCCGCTCTAGAGGCTACATGCAATCCATCCTTA TTC SEQIDNO:26 GCGGCCGCTCTAGAGCATGATCGCGTCGACACCAAG C SEQIDNO:27 ACAAAATATTAACGCCTAGCTAATATCAATTTTCTT TGG
2. Introduction of NoTE Gene Expression Plasmid into Escherichia coli, Extraction of Lipid from Escherichia coli Culture Fluid, and Analysis of Fatty Acid Contained Therein
(32) The NoTE expression plasmid was introduced into Escherichia coli in a manner similar to the method in item 3. in Example 1 to analyze a lipid in a manner similar to the method in item 4. in Example 1.
(33) TABLE-US-00004 TABLE 4 Total amount Introduced of fatty acids Fatty Acid Composition (%) plasmid (mg/L) C12:1 C12:0 C14:1 C14:0 C16:1 C16:0 C17:0 C18:1 C19:0 pBS 228.0 0.0 0.0 0.0 4.7 3.5 47.3 27.9 11.4 5.2 NoTE_1 348.8 1.3 2.2 6.9 10.2 11.8 35.9 16.9 11.9 2.9 NoTE_145 372.4 2.1 2.6 10.0 10.4 18.1 32.4 11.4 11.6 1.4 NoTE_172 364.7 1.1 1.4 5.4 5.5 23.1 37.6 10.1 15.1 0.6 NoTE_232 429.2 4.5 3.0 15.9 12.4 24.8 23.8 8.4 6.6 0.7 NoTE_262 360.6 6.5 3.9 18.8 13.6 25.9 19.2 7.0 4.8 0.4 NoTE_292 460.2 2.8 2.3 12.0 10.8 21.7 28.9 10.6 9.1 1.8 NoTE_322 441.5 4.5 3.0 16.0 11.9 24.5 23.4 9.0 6.7 1.0 NoTE_352 299.2 3.7 2.2 10.2 7.2 26.3 30.9 9.1 9.8 0.7 NoTE_382 349.3 1.5 1.6 5.9 5.7 21.2 37.5 11.2 14.6 0.8
(34) As shown in Table 4, an increase in a total amount of fatty acids was observed in the transformant having the NoTE gene fragment in comparison with the transformant (pBS of Table 4) having the plasmid vector pBluescriptII SK(). Moreover, the fatty acid composition changed in the transformant in comparison with the transformant having the plasmid vector pBluescriptII SK(). In particular, ratios of the fatty acids of C12:1, C12:0, C14:1, C14:0 and C16:1 increased. From these results, the protein encoded by the NoTE gene is thought to be the acyl-ACP thioesterase in which a specific fatty acid is cut out from acyl-ACP. Moreover, a protein containing at least the amino acid sequence of the 128.sup.th to 287.sup.th amino acids set forth in SEQ ID NO: 14 was found to show the acyl-ACP thioesterase activity.
Example 3. Preparation of Escherichia coli Transformant Having Acyl-ACP Thioesterase Gene Derived from Nannochloropsis granulata, and Production of Lipid by Escherichia coli Transformant
(35) 1. Preparation of Gene Encoding Acyl-ACP Thioesterase Derived from Nannochloropsis granulata (Hereinafter, Referred to as NgrTE), and Construction of Plasmid for NgrTE Gene Expression
(36) Total RNA of Nannochloropsis granulata NIES2588 was extracted, and reverse transcription was performed using SuperScript (trade name) Ill First-Strand Synthesis SuperMix for qRT-PCR (manufactured by Invitrogen Corporation) to obtain cDNA. This cDNA was used as a template, and a gene fragment consisting of a nucleotide sequence set forth in SEQ ID NO: 17 was prepared by PCR using a pair of primers set forth in SEQ ID NO: 28 and SEQ ID NO: 33 shown in Table 5 below. The resultant gene fragment was subjected to cloning to the plasmid vector pBluescriptII SK() in a manner similar to the method in the item 2. in Example 1 to construct a plasmid NgrTE_1 for NgrTE gene expression. This expression plasmid was constructed in the form of fusing on a side of an N-terminus of 1.sup.st amino acid of an amino acid sequence (SEQ ID NO: 16) encoded by the NgrTE gene with the amino acid sequence of the 1.sup.st to 29.sup.th amino acids on the side of the N-terminus of the LacZ protein derived from the plasmid.
(37) In a similar manner, the cDNA was used a template, and PCR was carried out by using pairs of any one of primers set forth in SEQ ID NOs: 29 to 32, and a primer set forth in SEQ ID NO: 33 shown in Table 5 below, to prepare a gene fragment consisting of a nucleotide sequence of the 103.sup.rd to 858.sup.th nucleotides set forth in SEQ ID NO: 17, a gene fragment consisting of a nucleotide sequence of the 183.sup.rd to 858.sup.th nucleotides set forth in SEQ ID NO: 17, a gene fragment consisting of a nucleotide sequence of the 253.sup.rd to 858.sup.th nucleotides set forth in SEQ ID NO: 17, and a gene fragment consisting of a nucleotide sequence of the 376.sup.th to 858.sup.th nucleotides set forth in SEQ ID NO: 17, respectively. Each of the resultant gene fragments was fused with the pBluescriptII SK() vector in a manner similar to the method described above to construct a plasmid NgrTE_103 for NgrTE gene expression, a plasmid NgrTE_163 therefor, a plasmid NgrTE_253 therefor, and a plasmid NgrTE_376 therefor, respectively. Herein, these expression plasmids were constructed in the form of removing amino acid sequences of the 1.sup.st to 34.sup.th amino acids, the 1.sup.st to 54.sup.th amino acids, the 1.sup.st to 84.sup.th amino acids or the 1.sup.st to 125.sup.th amino acids on the side of the N-terminus of the amino acid sequence (SEQ ID NO: 16) encoded by the NgrTE gene, respectively, and fusing with the amino acid sequence of the 1.sup.st to 29.sup.th amino acids on the side of the N-terminus of the LacZ protein derived from the plasmid.
(38) TABLE-US-00005 TABLE5 NucleotideSequenceofPrimers SEQIDNO:28 GCGGCCGCTCTAGAGATGACGCCTTTGGCCTTCAC SEQIDNO:29 GCGGCCGCTCTAGAGTCCTCCCAGGTCACTCGACC SEQIDNO:30 GCGGCCGCTCTAGAGACACTTAGCAACAGCTTTCC SEQIDNO:31 GCGGCCGCTCTAGAGCTATGTGAGACGGCCCACAC SEQIDNO:32 GCGGCCGCTCTAGAGCATGATCGCGTCGACACGAAG SEQIDNO:33 ACAAAATATTAACGCCTAGCTAATGTCAATTTTCTT TGG
2. Introduction of NgrTE Gene Expression Plasmid into Escherichia coli, Extraction of Lipid from Escherichia coli Culture Fluid, and Analysis of Fatty Acid Contained Therein
(39) The NgrTE expression plasmid was introduced into Escherichia coli in a manner similar to the method in item 3. in Example 1 to analyze a lipid in a manner similar to the method in item 4. in Example 1.
(40) TABLE-US-00006 TABLE 6 Total amount Introduced of fatty acids Fatty Acid Composition (%) plasmid (mg/L) C12:1 C12:0 C14:1 C14:0 C16:1 C16:0 C17:0 C18:1 C19:0 pBS 181.4 0.0 0.0 0.0 6.4 2.5 48.1 28.3 5.9 8.7 NgrTE_1 317.1 2.1 3.9 9.1 14.9 10.1 33.5 14.2 6.9 5.1 NgrTE_103 344.0 2.8 4.0 12.3 14.1 14.5 29.7 11.2 7.9 3.3 NgrTE_163 328.4 2.2 4.1 9.4 14.9 9.9 32.9 14.6 7.0 4.9 NgrTE_253 414.1 4.5 4.1 16.5 12.6 19.3 24.3 8.9 7.3 2.6 NgrTE_376 296.4 1.4 2.1 6.6 9.9 9.9 36.5 17.7 8.1 7.9
(41) As shown in Table 6, an increase in a total amount of fatty acids was observed in the transformant having the NgrTE gene fragment in comparison with the transformant (pBS of Table 6) having the plasmid vector pBluescriptII SK(). Moreover, the fatty acid composition changed in the transformant in comparison with the transformant having the plasmid vector pBluescriptII SK(). In particular, ratios of the fatty acids of C12:1, C12:0, C14:1, C14:0 and C16:1 increased.
Example 4. Preparation of Escherichia coli Transformant Having Mutated NoTE Gene, and Production of Lipid by Escherichia coli Transformant
(42) 1. Preparation of Mutated NoTE Gene, and Construction of Plasmid for Mutated NoTE Gene Expression
(43) A gene sequence (SEQ ID NO: 35) encoding a mutated NoTE set forth in SEQ ID NO: 34 was prepared using custom synthesis service of an artificial gene. The amino acid sequence of the 128.sup.th to 287.sup.th amino acids set forth in SEQ ID NO: 34 shows about 84% identity with the amino acid sequence of the 115.sup.th to 274.sup.th amino acids set forth in SEQ ID NO: 1.
(44) This gene fragment was used as a template, and a gene fragment consisting of a nucleotide sequence set forth in SEQ ID NO: 35 was prepared by PCR using a pair of primers set forth in SEQ ID NO: 22 shown in Table 3 above and SEQ ID NO: 36 and shown in Table 7 below. The resultant gene fragment was subjected to cloning to a plasmid vector pBluescriptII SK() in a manner similar to the method in item 2. in Example 1 to construct a plasmid NoTE_262-mutant for mutated NoTE gene expression. This expression plasmid was constructed in the form of removing an amino acid sequence of the 1.sup.st to 87.sup.th amino acids on a side of an N-terminus of an amino acid sequence (SEQ ID NO: 34) encoded by a mutated NoTE gene, and further fusing with the amino acid sequence of the 1.sup.st to 29.sup.th amino acids on the side of the N-terminus of the LacZ protein derived from the plasmid.
(45) TABLE-US-00007 TABLE7 NucleotideSequenceofPrimer SEQIDNO:36 ACAAAATATTAACGCCTAGCTAGTAGCAATTTTCC
2. Introduction of Mutated NoTE Gene Expression Plasmid into Escherichia coli, Extraction of Lipid from Escherichia coli Culture Fluid, and Analysis of Fatty Acid Contained Therein
(46) The mutated-NoTE expression plasmid was introduced into Escherichia coli in a manner similar to the method in item 3. in Example 1 to analyze a lipid in a manner similar to the method in item 4. in Example 1.
(47) TABLE-US-00008 TABLE 8 Total amount Introduced of fatty acids Fatty Acid Composition (%) plasmid (mg/L) C12:1 C12:0 C14:1 C14:0 C16:1 C16:0 C17:0 C18:1 C19:0 pBS 203.8 0.0 0.0 0.0 5.3 1.6 46.3 29.2 4.3 13.2 NoTE_262-mutant 511.9 5.5 5.5 7.7 19.7 13.5 27.9 9.4 6.3 4.5
(48) As shown in Table 8, an increase in a total amount of fatty acids was observed in the transformant having the mutated-NoTE gene fragment in comparison with the transformant (pBS of Table 8) having the plasmid vector pBluescriptII SK(). Moreover, the fatty acid composition changed in the transformant in comparison with the transformant having the plasmid vector pBluescriptII SK(). In particular, ratios of the fatty acids of C12:1, C12:0, C14:1, C14:0 and C16:1 increased. From these results, the mutated-NoTE was found to show the acyl-ACP thioesterase activity.
Example 5. Preparation of Nannochloropsis Transformant Having NoTE Gene, and Production of Lipid by Nannochloropsis Transformant
(49) 1. Construction of Plasmid for NoTE Gene Expression
(50) The cDNA of Nannochloropsis oculata NIES 2145 was used as a template, and PCR using a pair of primers set forth in SEQ ID NO: 37 and SEQ ID NO: 38 shown in Table 9 below was carried out to prepare a NoTE gene fragment consisting of a nucleotide sequence of the 292.sup.nd to 864.sup.th nucleotides set forth in SEQ ID NO: 15.
(51) A VCP1 promoter sequence (SEQ ID NO: 54), a VCP chloroplast transit peptide sequence (SEQ ID NO: 55) and a VCP1 terminator sequence (SEQ ID NO: 56) were artificially synthesized based on the complete cds sequence (Accession number: JF957601.1) of the VCP1 (violaxanthin/(chlorophyll a)-binding protein) gene of Nannochloropsis sp. W2J3B registered in GenBank. The thus-synthesized DNA fragment was used as a template, and PCR was carried out using a pair of primers set forth in SEQ ID NO: 39 and SEQ ID NO: 40, a pair of primers set forth in SEQ ID NO: 41 and SEQ ID NO: 42, and a pair of primers set forth in SEQ ID NO: 43, and SEQ ID NO: 44 as shown in Table 9 below to prepare the VCP1 promoter sequence, the VCP1 chloroplast transit peptide sequence and the VCP1 terminator sequence, respectively. Moreover, a plasmid vector pUC19 (manufactured by TAKARA BIO Inc.) was used as a template, and PCR using a pair of primers set forth in SEQ ID NO: 45 and SEQ ID NO: 46 shown in Table 9 below was carried out to amplify the plasmid vector pUC19.
(52) The NoTE gene fragment, the VCP1 promoter sequence, the VCP1 chloroplast transit peptide sequence and the VCP1 terminator sequence obtained as described above were fused with the plasmid vector pUC19 in a manner similar to the method in item 2. in Example 1 to construct an expression plasmid NoTE_292_Nanno in Nannochloropsis. This expression plasmid consisted of the pUC19 vector sequence and an insert sequence (SEQ ID NO: 57; hereinafter, referred to as fragment for NoTE gene expression) in which the VCP1 promoter sequence, the VCP1 chloroplast transit peptide sequence, the NoTE gene fragment and the VCP1 terminator sequence were linked in this order.
(53) 2. Construction of Plasmid for Zeocin Resistance Gene Expression in Nannochloropsis
(54) A Zeocin resistance gene (SEQ ID NO: 58), and a tubulin promoter sequence (SEQ ID NO: 59) derived from Nannochloropsis gaditana CCMP 526 described in literature (Randor Radakovits, et al., Nature Communications, DO1:10.1038/ncomms1688, 2012) were artificially synthesized. The thus-synthesized DNA fragment was used as a template, and PCR was carried out using a pair of primers set forth in SEQ ID NO: 47 and SEQ ID NO: 48, and a pair of primers set forth in SEQ ID NO: 49 and SEQ ID NO: 50, to prepare a Zeocin resistance gene and a tubulin promoter sequence, respectively. These amplified fragments were fused with the VCP1 terminator sequence and the amplified fragment of a plasmid vector pUC19 prepared in item 1. as described above in a manner similar to the method in item 2. in Example 1 to construct a Zeocin resistance gene expression plasmid. This expression plasmid consisted of a pUC19 vector sequence, and an insert sequence (SEQ ID NO: 60; hereinafter, referred to as fragment for Zeocin resistance gene expression) in which the tubulin promoter sequence, the Zeocin resistance gene, and the VCP1 terminator sequence were linked in this order.
(55) 3. Introduction of Fragment for NoTE Gene Expression into Nannochloropsis
(56) The expression plasmid NoTE_292_Nanno was used as a template, and PCR was carried out using a pair of primers set forth in SEQ ID NO: 51 and SEQ ID NO: 52 shown in Table 9 below to amplify a fragment for NoTE gene expression (SEQ ID NO: 57) in the plasmid. Moreover, the plasmid for Zeocin resistance gene expression was used as a template, and PCR was carried out using a pair of primers set forth in SEQ ID NO: 52 and SEQ ID NO: 53 to amplify a fragment for Zeocin resistance gene expression (SEQ ID NO: 60). Both of amplified fragments were purified using a High Pure PCR Product Purification Kit (manufactured by Roche Applied Science Corporation). Herein, sterilized water was used for elution upon purification without using an elution buffer included in the kit.
(57) About 10.sup.9 cells of Nannochloropsis oculata NIES 2145 were washed with a 384 mM sorbitol solution to completely remove a salt, and the resultant was used as a host cell of transformation. The amplified fragment for NoTE gene expression (SEQ ID NO: 57) and fragment for Zeocin resistance gene expression (SEQ ID NO: 60) as described above were mixed by about 500 ng for each with the host cell, and electroporation was carried out under conditions of 50 F, 500 and 2,200 v/2 mm. After 24 hours cultivation in an f/2 liquid medium, the resultant material was inoculated in an f/2 agar medium containing 2 g/mL of Zeocin, and cultured for two to three weeks under 12 h/12 h light-dark conditions at 25 C. under an atmosphere of 0.3% CO.sub.2. A transformant containing the fragment for NoTE gene expression (SEQ ID NO: 57) was selected from the resultant colonies by a PCR method. The thus-selected strain was seeded to 20 mL of a culture medium (hereinafter, referred to as N15P5 medium) in which a nitrogen concentration in the f/2 medium was reinforced 15 times, and a phosphorus concentration therein was reinforced 5 times, and subjected to shaking culture for four weeks under the 12 h/12 h light-dark conditions at 25 C. under the atmosphere of 0.3% CO.sub.2 (preculture). Then, 2 mL of the preculture fluid was subcultured to 18 mL of the N15P5 medium, and subjected to shaking culture for two weeks under the 12 h/12 h light-dark conditions at 25 C. under the atmosphere of 0.3% CO.sub.2. In addition, as a negative control, an experiment was also conducted on NIES 2145 being wild-type.
(58) TABLE-US-00009 TABLE9 NucleotideSequenceofPrimers SEQIDNO:37 CGCGGTGTTGCGCGCAGACGAGGTGAGAGGAAGGC SEQIDNO:38 CTCTTCCACAGAAGCCTAGCTAATATCAATTTTCTT TGG SEQIDNO:39 CGAGCTCGGTACCCGGGCGGTCTTTTGTCCTTTCCT C SEQIDNO:40 AATCTGCTCGGAGGGGAGGATC SEQIDNO:41 CCCTCCGAGCAGATTATGAAGACCGCCGCTCTCCTC SEQIDNO:42 GCGCGCAACACCGCGGGTGCGGGAGAAC SEQIDNO:43 GCTTCTGTGGAAGAGCCAGTG SEQIDNO:44 ACTCTAGAGGATCCCCTGATCTTGTCCATCTCGTG SEQIDNO:45 GGGATCCTCTAGAGTCGACC SEQIDNO:46 CGGGTACCGAGCTCGAATTC SEQIDNO:47 CTTTTTTGTGAAGCAATGGCCAAGTTGACCAGTGCC G SEQIDNO:48 CTCTTCCACAGAAGCTTAGTCCTGCTCCTCGGCCAC G SEQIDNO:49 CGAGCTCGGTACCCGACTGCGCATGGATTGACCGA SEQIDNO:50 TGCTTCACAAAAAAGACAGCTTCTTGAT SEQIDNO:51 GGCGGTCTTTTGTCCTTTCCTC SEQIDNO:52 CTGATCTTGTCCATCTCGTG SEQIDNO:53 ACTGCGCATGGATTGACCGA
2. Extraction of Lipid from Nannochloropsis Culture Fluid, and Analysis of Fatty Acid Contained Therein
(59) After the culture, lipid of the resultant Nannochloropsis culture fluid was extracted and analyzed in a manner similar to the method in item 4. in Example 1. Table 10 shows the results. In addition, in Table 10, n represents an integer of 0 to 5. For example, when C18:n was described, the description represents a total of fatty acids having compositions of C18:0, C18:1, C18:2, C18:3, C18:4 and C18:5.
(60) TABLE-US-00010 TABLE 10 Total amount of fatty acids Fatty Acid Composition (%) (mg/L) C12:0 C14:0 C16:1 C16:0 C18:n C20:n Wild type 1108 169 0.1 0.0 3.9 0.2 28.9 1.0 35.5 1.4 19.0 0.3 12.7 2.1 NoTE-Introduced 1352 59 0.3 0.0 6.3 0.1 30.6 0.3 36.1 0.3 16.3 0.2 10.4 0.4 strain
(61) As shown in Table 10, in the Nannochloropsis transformant (NoTE-introduced strain in Table 10) having the NoTE gene fragment, an increase in a total amount of fatty acid was observed in comparison with the Nannochloropsis NIES2145 (wild-type in Table 10) being the host. Moreover, in the transformant, ratios of fatty acids of C12:0 and C14:0 significantly increased in comparison with the Nannochloropsis NIES2145 (p<0.01 for all).
(62) Having described our invention as related to the present embodiments, it is our intention that the invention not be limited by any of the details of the description, unless otherwise specified, but rather be construed broadly within its spirit and scope as set out in the accompanying claims.
(63) This application claims priority on Patent Application No. 2012-286058 filed in Japan on Dec. 27, 2012, which is entirely herein incorporated by reference.