Glycosyltransferase gene and use thereof
10087427 ยท 2018-10-02
Assignee
Inventors
Cpc classification
C12P19/60
CHEMISTRY; METALLURGY
C12N5/10
CHEMISTRY; METALLURGY
International classification
C12N9/12
CHEMISTRY; METALLURGY
C12P17/06
CHEMISTRY; METALLURGY
A01H5/00
HUMAN NECESSITIES
C12N5/10
CHEMISTRY; METALLURGY
Abstract
Provided is a polynucleotide encoding a protein that exhibits activity for transferring a sugar to a hydroxyl group at position 7 of a flavone, particularly flavone 4-glucoside, wherein the polynucleotide is selected from the group consisting of: (a) a polynucleotides comprising the base sequence of SEQ ID NO: 1 or SEQ ID NO: 5; (b) a polynucleotide that hybridizes, under stringent conditions, with a polynucleotide comprising the base sequence complementary to the base sequence of SEQ ID NO: 1 or SEQ ID NO: 5; (c) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 6; (d) a polynucleotide encoding a protein comprising an amino acid sequence in which one or more amino acids have been deleted, substituted, inserted, and/or added in the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 6.
Claims
1. A recombinant expression vector comprising a polynucleotide selected from the group consisting of the following (a) to (d): (a) a polynucleotide comprising the base sequence of SEQ ID NO: 1 or SEQ ID NO: 5; (b) a polynucleotide that encodes a protein comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 6; (c) a polynucleotide that encodes a protein (i) having one to five amino acids deleted, substituted, inserted and/or added in the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 6, and (ii) having activity that transfers a sugar to the hydroxyl group at position 7 of a flavone; and, (d) a polynucleotide encoding a protein (i) having an amino acid sequence identity of 95% or more with SEQ ID NO: 2 or SEQ ID NO: 6, and (ii) having activity that transfers a sugar to the hydroxyl group at position 7 of a flavone.
2. The recombinant expression vector according to claim 1, wherein the polynucleotide (i) comprises the base sequence of SEQ ID NO: 1 or SEQ ID NO: 5, or (ii) encodes a protein comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 6.
3. The recombinant expression vector according to claim 1, wherein the polynucleotide encodes a protein (i) having one to five amino acids deleted, substituted, inserted and/or added in the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 6, and (ii) having activity that transfers a sugar to the hydroxyl group at position 7 of flavone 4-glucoside.
4. The recombinant expression vector according to claim 1, wherein the polynucleotide encodes a protein (i) having an amino acid sequence identity of 95% or more with SEQ ID NO: 2 or SEQ ID NO: 6, and (ii) having activity that transfers a sugar to the hydroxyl group at position 7 of flavone 4-glucoside.
5. The recombinant expression vector according to claim 1, further comprising a second polynucleotide selected from the group consisting of the following (e) to (h): (e) a polynucleotide comprising the base sequence of SEQ ID NO: 3; (f) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO: 4; (g) polynucleotide that encodes a protein (i) having one to five amino acids deleted, substituted, inserted and/or added in the amino acid sequence of SEQ ID NO: 4, and (ii) having activity that transfers a sugar to the hydroxyl group at position 4 of a flavone; and, (h) a polynucleotide (i) encoding a protein that has activity that transfers a sugar to the hydroxyl group at position 4 of a flavone, and (ii) having a base sequence identity of 95% or more with the base sequence of SEQ ID NO: 3.
6. A non-human host cell comprising the recombinant expression vector according to claim 1.
7. A method for adding a sugar to the hydroxyl group at position 7 of a flavone comprising transforming the recombinant expression vector of claim 1 into a non-human host cell; producing a protein having activity that transfers the sugar to the hydroxyl group at position 7 of the flavone; and allowing the protein to catalyze a reaction to add a sugar to the hydroxyl group at position 7 of the flavone.
8. The method according to claim 7, wherein the flavone is flavone 4-glucoside.
9. A plant, progeny thereof, portion thereof or tissue thereof introduced with the recombinant expression vector according to claim 1.
10. A plant, progeny thereof, portion thereof or tissue thereof introduced with the recombinant expression vector of claim 5.
11. The portion of a plant according to claim 9, which is a cut flower.
12. A processed cut flower that uses the cut flower according to claim 11.
13. A method for producing a protein having activity that transfers a sugar to the hydroxyl group at position 7 of a flavone, comprising the following steps: culturing or growing the non-human host cell according to claim 6, and harvesting the protein having activity that transfers the sugar to the hydroxyl group at position 7 of the flavone from the non-human host cell.
14. The method according to claim 13, wherein the flavone is flavone 4-glucoside.
15. A method for producing a flavone in which a sugar has been added to the hydroxyl group at position 7, comprising the following steps: culturing or growing the non-human host cell according to claim 6, and harvesting the flavone in which the sugar has been added to the hydroxyl group at position 7 from the non-human host cell.
16. The method according to claim 15, wherein a sugar is also added to the hydroxyl group at position 4 of the flavone.
17. The recombinant expression vector according to claim 1, wherein the polynucleotide is operably linked to a promoter.
18. The recombinant expression vector of claim 17, wherein the promoter is selected from the group consisting of a bacterial promoter, a yeast promoter, a mold promoter, a and a promoter for use with animal cell hosts.
19. The recombinant expression vector of claim 17, wherein the promoter constitutively expresses a gene in plant cells.
20. The recombinant expression vector of claim 19, wherein the promoter is selected from the group consisting of cauliflower mosaic virus 35 S RNA promoter, rd29A gene promoter, rbcS promoter, and mac-1 promoter.
21. The recombinant expression vector of claim 17, wherein the promoter specifically expresses a gene in a plant tissue.
22. The non-human host cell according to claim 6, being a prokaryotic organism cell or an eukaryotic microorganism cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
BEST MODE FOR CARRYING OUT THE INVENTION
(12) The present invention relates to a polynucleotide selected from the group consisting of:
(13) (a) a polynucleotide composed of the base sequence of SEQ ID NO: 1 or SEQ ID NO: 5;
(14) (b) a polynucleotide that hybridizes under stringent conditions with a polynucleotide composed of a base sequence complementary to the base sequence of SEQ ID NO: 1 or SEQ ID NO: 5, and encodes a protein having activity that transfers a sugar to the hydroxyl group at position 7 of a flavone;
(15) (c) a polynucleotide that encodes a protein composed of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 6;
(16) (d) a polynucleotide that encodes a protein composed of an amino acid sequence in which one or a plurality of amino acids have been deleted, substituted, inserted and/or added in the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 6, and has activity that transfers a sugar to the hydroxyl group at position 7 of a flavone; and,
(17) (e) a polynucleotide that encodes a protein that has an amino acid sequence having identity of 90% or more with the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 6, and has activity that transfers a sugar to the hydroxyl group at position 7 of a flavone.
(18) In the present description, the term polynucleotide refers to DNA or RNA.
(19) In the present description, the term stringent conditions refers to conditions that allow a polynucleotide or oligonucleotide to selectively, detectably and specifically bind with genomic DNA. Stringent conditions are defined by a suitable combination of salt concentration, organic solvent (such as formamide) concentration, temperature and other known conditions. Namely, stringency is increased by reducing salt concentration, increasing organic solvent concentration or raising hybridization temperature. Moreover, washing conditions following hybridization also have an effect on stringency. These washing conditions are also defined by salt concentration and temperature, and washing stringency increases as a result of reducing salt concentration and raising temperature. Thus, the term stringent conditions refers to conditions under which there is specific hybridization only between base sequences having a high degree of identity such that the degree of identity between each base sequence is, for example, about 80% or more on average overall, preferably about 90% or more, more preferably about 95% or more, even more preferably 97% or more, and most preferably 98% or more. Examples of stringent conditions include conditions such that sodium concentration is 150 mM to 900 mM and preferably 600 mM to 900 mM at a pH of 6 to 8 and temperature of 60 C. to 68 C. Specific examples include carrying out hybridization under conditions consisting of 5SSC (750 mM NaCl, 75 mM trisodium citrate), 1% SDS, 5Denhardt's solution, 50% formaldehyde and 42 C., and carrying out washing under conditions consisting of 0.1SSC, (15 mM NaCl, 1.5 mM trisodium citrate), 0.1% SDS and 55 C.
(20) Hybridization can be carried out in accordance with, for example, a method known in the art or a method in compliance therewith such as the method described in Current Protocols in Molecular Biology (edited by Frederick M. Ausubel et al.). In addition, in the case of using a commercially available library, hybridization can be carried out in accordance with the method described in the usage manual provided therewith. Genes selected by such hybridization may be naturally-occurring genes, such as plant-derived genes, or non-plant-derived genes. In addition, genes selected by hybridization may be cDNA, genomic DNA or chemically synthesized DNA.
(21) The aforementioned phrase amino acid sequence in which one or a plurality of amino acids have been deleted, substituted, inserted and/or added refers to an amino acid sequence in which an arbitrary number of amino acids, such as 1 to 20, preferably 1 to 5 and more preferably 1 to 3, have been deleted, substituted, inserted and/or added. A type of genetic engineering technique in the form of site-specific mutagenesis is useful since it is a technique that enables a specific mutation to be introduced at a specific location, and can be carried out in compliance with the method described in Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. A protein composed of an amino acid sequence in which one or a plurality of amino acids have been deleted, substituted, inserted and/or added can be obtained by expressing this mutated DNA using a suitable expression system.
(22) In addition, the DNA according to the present invention can be obtained by a method known among persons with ordinary skill in the art, such as methods in which DNA is synthesized chemically such as the phosphoamidide method, or nucleic acid amplification methods that use a nucleic acid sample of a plant as a template and use primers designed based on the nucleotide sequence of a target gene.
(23) In the present description, the term identity refers to the amount (number) of amino acid residues or base residues composing the chains of two polypeptide sequences (or amino acid sequences) or polynucleotide sequences (or base sequences) for which their mutual matching relationship can be determined to be identical, refers to the degree of sequence correlation between two polypeptide sequences or two polynucleotide sequences, and can be calculated easily. Numerous methods are known for measuring identity between two polynucleotide sequences or two polypeptide sequences, and the term identity is known among persons with ordinary skill in the art (see, for example, Lesk, A. M. (Ed.), Computational Molecular Biology, Oxford University Press, New York (1988); Smith, D. W. (Ed.), Biocomputing: Informatics and Genome Projects, Academic Press, New York (1993); Grifin, A. M. & Grifin, H. G. (Ed.), Computer Analysis of Sequence Data: Part I, Human Press, New Jersey (1994); von Heinje, G., Sequence Analysis in Molecular Biology, Academic Press, New York (1987); Gribskov, M. & Devereux, J. (Ed.), Sequence Analysis Primer, M-Stockton Press, New York (1991)).
(24) In addition, although the value of identity as described in the present description may be a value calculated using an identity search program known among persons with ordinary skill in the art unless specifically indicated otherwise, it is preferably the value calculated using the ClustalW Program supported by Mac Vector application software (Version 9.5, Oxford Molecular Ltd., Oxford, England).
(25) The polynucleotide (nucleic acid, gene) of the present invention is that which encodes a protein of interest. Here, the term encode refers to expressing a protein of interest in a state in which it retains its activity. In addition, the term encode includes both the meanings of encoding a protein of interest in the form of a contiguous structural sequence (exon) and encoding a protein of interest mediated by an inclusion sequence (intron).
(26) A gene having a natural base sequence is obtained by analyzing with a DNA sequencer as is subsequently described in the examples. In addition, DNA encoding an enzyme having a modified amino acid sequence can be synthesized using commonly used site-specific mutagenesis or PCR by using DNA based on a naturally-occurring base sequence. For example, a desired modified DNA fragment is obtained by obtaining a DNA fragment desired to be modified by treating naturally-occurring cDNA or genomic DNA with a restrictase, and carrying out site-specific mutagenesis or PCR using this as a template and using primers introduced with desired mutations. Subsequently, this DNA fragment introduced with a mutation is linked with a DNA fragment that encodes the other portions of a target enzyme.
(27) Alternatively, in order to obtain DNA encoding an enzyme composed of a shortened amino acid sequence, an amino acid sequence longer than the target amino acid sequence, such as DNA encoding a full-length amino acid sequence, is cleaved by a desired restrictase, and in the case the resulting DNA fragment does not encode the entire target amino acid sequence, a DNA fragment composed of a sequence corresponding to the missing portion is synthesized and linked thereto.
(28) In addition, by expressing the resulting polynucleotide using a gene expression system in Escherichia coli and yeast and then measuring the enzyme activity thereof, the polynucleotide can be confirmed to encode a protein having activity that transfers a sugar to the hydroxyl group at position 7 of a flavone, and particularly flavone 4-glucoside. Moreover, a protein having activity that transfers a sugar to the hydroxyl group at position 7 of a polynucleotide product in the form of flavone, and particularly flavone 4-glucoside, can be obtained by expressing that polynucleotide. Alternatively, a protein having activity that transfers a sugar to the hydroxyl group at position 7 of a flavone, and particularly flavone 4-glucoside, can also be acquired by using an antibody to a polypeptide composed of the amino acid sequence set forth in SEQ ID NO: 2, and a polynucleotide that encodes a protein having activity that transfers a sugar to the hydroxyl group at position 7 of a flavone of other biological origin, and particularly flavone 4-glucoside, can also be cloned using that antibody.
(29) The present invention also relates to a vector, and particularly an expression vector, that contains (recombines) the aforementioned polynucleotide, and to a host that has been transformed by that vector.
(30) A prokaryotic organism or eukaryotic organism can be used for the host. Examples of prokaryotic organisms include bacteria in the manner of bacteria belonging to the genus Escherichia such as Escherichia coli, bacteria belong to the genus Bacillus such as Bacillus subtilis and other bacteria commonly used as hosts. Examples of eukaryotic organisms that can be used include lower eukaryotic organisms such as eukaryotic microorganisms in the manner of fungi, yeasts and molds.
(31) Examples of yeasts include Saccharomyces species microorganisms such as Saccharomyces cerevisiae, and examples of molds include Aspergillus species microorganisms such as Aspergillus oryzae or Aspergillus niger as well as Penicillium species microorganisms. Animal cells or plant cells can also be used as hosts, examples of animal cells used include mouse, hamster, monkey and human cells, and insect cells such as silkworm cells or adult silkworms per se are also used as hosts.
(32) The expression vector of the present invention may further contain a polynucleotide selected from the group consisting of the following (f) to (j):
(33) (f) a polynucleotide composed of the base sequence of SEQ ID NO: 3;
(34) (g) a polynucleotide that hybridizes under stringent conditions with a polynucleotide composed of a base sequence complementary to the base sequence of SEQ ID NO: 3, and encodes a protein having activity that transfers a sugar to the hydroxyl group at position 4 of a flavone;
(35) (h) a polynucleotide that encodes a protein composed of the amino acid sequence of SEQ ID NO: 4;
(36) (i) a polynucleotide that encodes a protein that is composed of an amino acid sequence in which one or a plurality of amino acids have been deleted, substituted, inserted and/or added in the amino acid sequence of SEQ ID NO: 4, and has activity that transfers a sugar to the hydroxyl group at position 4 of a flavone; and,
(37) (j) a polynucleotide that encodes a protein that has an amino acid sequence having identity of 90% or more with the amino acid sequence of SEQ ID NO: 4, and has activity that transfers a sugar to the hydroxyl group at position 4 of a flavone. These polynucleotides encode proteins having activity that transfers a sugar to the hydroxyl group at position 4 of a flavone, and are described in detail in International Publication No. WO 2013/108794 (Patent Document 11).
(38) In addition, the expression vector of the present invention contains an expression control region, such as a promoter, terminator or replication origin, that is dependent on the type of host into which it is introduced. A commonly used promoter is used for the promoter of a bacterial expression vector, and examples thereof include trc promoter, tac promoter and lac promoter, examples of yeast promoters that are used include glyceraldehyde triphosphate dehydrogenase promoter and PH05 promoter, and examples of mold promoters that are used include amylase promoter and trpC promoter. In addition, examples of promoters for use with animal cell hosts include viral promoters such as SV40 early promoter and SV40 late promoter.
(39) Examples of promoters that constitutively express a polynucleotide in plant cells include the 35S RNA promoter of cauliflower mosaic virus, rd29A gene promoter, rbcS promoter and mac-1 promoter. In addition, a promoter of a gene that is specifically expressed in a tissue can be used to express a tissue-specific gene.
(40) Preparation of an expression vector can be carried out in accordance with ordinary methods using restrictases or ligases and the like. In addition, host transformation by an expression vector can also be carried out in accordance with ordinary methods.
(41) A target protein can be obtained by culturing, cultivating or growing a host that has been transformed by the aforementioned expression vector, and recovering and purifying from the culture or medium in accordance with an ordinary method such as filtration, centrifugal separation, cell lysing, gel permeation chromatography or ion exchange chromatography.
(42) In the present description, although a description is provided of a gene that encodes a protein having activity that transfers a sugar to the hydroxyl group at position 7 of a flavone derived from Nemophilas, and particularly flavone 4-glucoside, the polynucleotide according to the present invention is not limited to a gene derived from Nemophilas, but rather the origin of the gene that encodes a protein having activity that transfers a sugar to the hydroxyl group at position 7 of a flavone, and particularly flavone 4-glucoside, may be a plant, animal or microorganism, and there are no particular limitations on the origin providing the resulting protein has activity that transfers a sugar to the hydroxyl group at position 4 of a flavone and can be used to modify flower color in plants.
(43) The present invention also relates to a plant, progeny thereof, portion thereof or tissue thereof obtained by introducing an exogenous polynucleotide, which encodes a protein having activity that transfers a sugar to the hydroxyl group at position 7 of a flavone, and particularly flavone 4-glucoside, into a plant and containing the polynucleotide in the plant. The plant portion or tissue can be in the form of a cut flower. Position 7 of a flavone, and particularly flavone 4-glucoside, can be glycosylated or that glycosylation can be suppressed by using the polynucleotide according to the present invention that encodes a protein having activity that transfers a sugar to the hydroxyl group at position 7 of a flavone, and particularly flavone 4-glucoside, thereby making it possible to alter flower color in a plant as a result thereof.
(44) Moreover, in addition to the polynucleotide of the present invention, a polynucleotide may also be introduced into a plant that encodes a protein having activity that transfers a sugar to the hydroxyl group at position 4 of the aforementioned flavone. As a result, a flavone having hydroxyl groups added to both position 4 and position 7 can be efficiently biosynthesized in a plant.
(45) At the current level of technology, technology can be used that enables a polynucleotide to be introduced into a plant followed by constitutively or tissue-specifically expressing that polynucleotide. Introduction of DNA into a plant can be carried out according to a method known among persons with ordinary skill in the art such as the Agrobacterium method, binary vector method, electroporation method, PEG method and particle gun method.
(46) Examples of transformable plants include, but are not limited to, rose, carnation, chrysanthemum, snapdragon, cyclamen, orchid, tulip gentian, freesia, African daisy, gladiola, baby's breath, kalanchoe, lily, fancy geranium, geranium, petunia, torenia, tulip, flamingo flower, moth orchid, rice, barley, wheat, rapeseed, potato, tomato, poplar, banana, eucalyptus, sweet potato, soybean, alfalfa, rubin, corn, cauliflower and dahlia plants.
(47) The present invention also relates to processed plants (processed cut flowers) using the aforementioned cut flowers. Here, examples of processed cut flowers include, but are not limited to, pressed flowers, preserved flowers, dry flowers and resin-sealed flowers that use these cut flowers.
(48) In addition, a flavone having a sugar added to the hydroxyl group at position 7, and particularly a flavone having a sugar added to the hydroxyl groups at both position 4 and position 7, produced according to the production method of the present invention can be used in applications such as the production methods of foods, pharmaceuticals or cosmetics.
(49) In the present invention, the expression of a target gene in a plant can be suppressed by a method such as the antisense method, co-suppression method or RNAi method. Although the method for suppressing expression of a target gene can be carried out by a method known among persons with ordinary skill in the art, examples thereof include the antisense RNA/DNA technique (Bioscience and Industry, 50, 322 (1992); Chemistry, 46, 681 (1991); Biotechnology, 9, 358 (1992); Trends in Biotechnology, 10, 87 (1992); Trends in Biotechnology, 10, 152 (1992); and, Cell Engineering, 16, 1463 (1997)), and the triple helix technique (Trends in Biotechnology, 10, 132 (1992)). For example, suppression of gene expression can be carried out using a single-stranded nucleic acid molecule comprising all or a portion of a nucleotide sequence identical to the antisense strand of the gene according to the present invention. This type of method is known as an antisense method. In the antisense method, expression of a target gene is suppressed by expressing RNA, having a sequence complementary to the gene for which expression is desired to be suppressed, at a high level. In this method, single-stranded RNA can be used that comprises the entire nucleotide sequence that is identical to the antisense strand of the polynucleotide (gene) according to the present invention. In addition, in the aforementioned method, single-stranded RNA can also be used that comprises a portion of a nucleotide sequence identical to the antisense strand of the gene according to the present invention. This partial single-stranded RNA is only required to be able to suppress expression of the gene according to the present invention, and although it can be suitably designed by a person with ordinary skill in the art, it is preferably specific for the gene according to the present invention, and the chain length thereof is preferably 5 nucleotides to 100 nucleotides, more preferably 5 nucleotides to 50 nucleotides and even more preferably 10 nucleotides to 20 nucleotides.
(50) Suppression of gene expression is carried out using a single-stranded nucleic acid molecule comprising all or a portion of a nucleotide sequence identical to the sense strand of the gene according to the present invention. Namely, this sense single-stranded nucleic acid can be used to suppress expression of the gene according to the present invention in the same manner as the aforementioned antisense single-stranded nucleic acid. In this method, single-stranded RNA can be used that comprises the entire nucleotide sequence that is identical to the sense strand of the gene according to the present invention. In addition, in the aforementioned method, single-stranded RNA can be used that comprises a portion of a nucleotide sequence that is identical to the sense strand of the gene according to the present invention. This partial single-stranded RNA is only required to suppress expression of the gene according to the present invention, and although it can be suitably designed by a person with ordinary skill in the art, it is preferably specific for the gene according to the present invention, and the chain length thereof is preferably 5 nucleotides to 100 nucleotides, more preferably 5 nucleotides to 50 nucleotides and even more preferably 10 nucleotides to 20 nucleotides.
(51) Moreover, suppression of gene expression is carried out using a double-stranded nucleic acid molecule comprising all or a portion of a nucleotide sequence identical to the gene according to the present invention. For example, an antisense or sense single-stranded nucleic acid of the gene according to the present invention can be expressed in an angiosperm by using this double-stranded nucleic acid molecule. The double-stranded nucleic acid molecule according to the present invention is preferably DNA, and the chain length and specific nucleotide sequence thereof correspond to the chain length and nucleotide sequenced of the target single-stranded nucleic acid molecule. For example, in the case of expressing the aforementioned antisense single-stranded nucleic acid, the double-stranded nucleic acid molecule according to the present invention contains the antisense strand of the gene according to the present invention as the encoded strand. In addition, in the case of expressing the aforementioned sense single-stranded nucleic acid, the double-stranded nucleic acid molecule according to the present invention contains the sense strand of the gene according to the present invention as the encoded strand.
(52) A double-stranded nucleic acid molecule can be expressed in a plant using a method known among persons with ordinary skill in the art. For example, a double-stranded nucleic acid molecule can be expressed by cultivating a plant body obtained by introducing an expression vector containing a promoter, the double-stranded nucleic acid molecule according to the present invention and a transcription terminator and the like into a target plant. Introduction of the expression vector into the plant can be carried out by a method known among persons with ordinary skill in the art, such as the Agrobacterium method, binary vector method, electroporation method, PEG method or particle gun method.
(53) Another example of a method for suppressing gene expression using a nucleic acid molecule according to the present invention is the co-suppression method. In this method, sense double-stranded DNA having the entire nucleotide sequence of the gene according to the present invention is introduced into a target plant. As a result, the sense single-stranded RNA according to the present invention is expressed and expression of the gene is then drastically suppressed by this RNA (Plant Cell, 9, 1357-1368, 1997).
(54) According to the present invention, a novel polynucleotide is provided that encodes a protein having activity that transfers a sugar to the hydroxyl group at position 7 of a flavone (and particularly flavone 4-glucoside). A protein having activity that transfers a sugar to the hydroxyl group at position 7 of a flavone (and particularly flavone 4-glucoside) can be produced by expressing the polynucleotide of the present invention in a suitable host cell. According to the present invention, a protein having activity that transfers a sugar to the hydroxyl group at position 7 of a flavone (and particularly flavone 4-glucoside) can be used to modify flower color by expressing constitutively or tissue-specifically in a plant. In addition, according to the present invention, a method for producing a flavone having a sugar added to the hydroxyl group at position 7, and particularly a flavone having a sugar added to the hydroxyl groups at both position 4 and position 7, and a composition containing a flavone obtained according to that production method, are provided.
EXAMPLES
(55) The following provides a detailed explanation of the present invention in accordance with examples thereof.
Example 1: Detection of Activity that Transfers Hydroxyl Groups to Position 4 and Position 7 in Flower Petals of Nemophila menziesii
(56) Flower petals of Nemophila menziesii were harvested at the development stages defined below, frozen with liquid nitrogen, and stored in a freezer at 80 C.
(57) Stage 1: Tightly closed buds without color (approx. 2 to 5 mm)
(58) Stage 2: Colored tightly closed buds (approx. 2 to 5 mm)
(59) Stage 3: Colored closed buds with the sepals beginning to open (approx. 5 to 10 mm)
(60) Stage 4: Buds with the petals beginning to open (approx. 10 to 15 mm)
(61) Stage 5: Completely opened petals
(62) <Preparation of Nemophila menziesii Flower Petal Extract>
(63) Flavone glycosyltransferase activity is expected to be detected in stages 1 and 2 of the flower petals prior to biosynthesis of anthocyanin. Therefore, flower petal extracts were prepared using stage 1 and stage 2 flower petals. 250 mg of a flower petal sample (125 mg each of stage 1 and stage 2 flower petals stored at 80 C.) were crushed with a mortar and pestle in liquid nitrogen followed by the addition of 2.0 ml of extraction buffer (composition: 100 mM potassium phosphate buffer (pH 7.5), 1 mM dithiothreitol (DTT), 50 mg/ml of polyvinylpyrrolidone 40 and 100 mg/ml of sucrose) and suspending the sample therein. The resulting suspension was centrifuged (10,000 rpm, 4 C., 10 minutes) followed by the addition of ammonium sulfate to the recovered supernatant to 30% of the saturated concentration. After stirring for 1 hour at 4 C., the suspension was centrifuged (10,000 rpm, 4 C., 10 minutes) followed by recovery of the supernatant. Ammonium sulfate was added to the resulting supernatant to 70% of the saturated concentration followed by stirring for 1 hour at 4 C. and centrifuging (10,000 rpm, 4 C., 10 minutes) to obtain a precipitate. This precipitate was dissolved in 500 l of elution buffer (composition: 2.5 mM Tris-HCl (pH 7.5), 1 mM DTT, 10 M amidinophenylmethanesulfonyl fluoride hydrochloride (APMSF)) and then desalted using the Sephadex G-25 DNA Grade NAP-5 Column (GE Healthcare Corp.) to remove the ammonium sulfate. This liquid was used as flower petal extract. The Avanti HP-26XP centrifuge (rotor: JA-2, Beckman Coulter Inc.) was used for centrifugation.
(64) <Measurement of Enzyme Activity Using Nemophila menziesii Flower Petal Extract>
(65) A reaction solution prepared by mixing 40 l of flower petal extract, 2 l of 50 mM UDP-glucose, 20 l of 1 M Tris-HCl (pH 7.5) and 5 l of 1 mM apigenin (dissolved in 50% aqueous acetonitrile solution containing 0.1% TFA) on ice and bringing to reaction volume of 200 l with water was stored for 20 minutes at 30 C. Subsequently, 200 l of stop buffer (90% aqueous acetonitrile solution containing 0.1% TFA) were added to stop the reaction followed by analyzing the reaction solution by high-performance liquid chromatography (Prominence, Shimadzu Corp.). Flavone was detected at 330 nm using the Shimadzu PDA SPD-M10AVP for the detector. The Shim-Pack ODS column (150 mm4.6 mm, Shimadzu Corp.) was used for the column. A liquid A (0.1% aqueous TFA solution) and a liquid B (90% aqueous methanol solution containing 0.1% TFA) were used for elution. Elution was carried out for 10 minutes at a linear concentration gradient from an 8:2 mixture of the two solutions to a 3:7 mixture of the two solutions followed by eluting for 6 minutes using a 3:7 mixture of the two solutions. The flow rate was 0.6 ml/min. A reaction solution obtained by carrying out the enzyme reaction under the same conditions using a flower petal extract obtained by subjecting the flower petal extract to heat treatment for 20 minutes at 100 C. was used as a control.
(66) As a result, in addition to flavone demonstrating the same retention time and absorption maximum as a purified apigenin 4,7-glucoside product and apigenin 7-glucoside standard, flavone demonstrating retention time close to that of apigenin 7-glucoside was biosynthesized (see
Example 2: Determination of Retention Time and Absorption Maximum of Apigenin 4-Glucoside
(67) When considering the biosynthetic pathway of apigenin 4,7-diglucoside in Nemophila menziesii flower petals, apigenin 4-glucoside and apigenin 7-glucoside are expected to be biosynthesized as intermediate products during the course of biosynthesis of apigenin 4,7-diglucoside (see
(68) According to these results, a protein having activity that respectively transfers a sugar to hydroxyl groups at position 4 and position 7 of flavone that is dependent on UDP-glucose was clearly determined to be present. There are thought to be three possible candidates for the biosynthetic pathway of flavone 4,7-diglucoside, consisting of a pathway by which glycosylation of the hydroxyl groups at position 4 and position 7 of the flavone is carried out by a single enzyme, a pathway by which glycosylation of the hydroxyl group at position 7 of the flavone is carried out after having carried out glycosylation of the hydroxyl group at position 4, and a pathway by which glycosylation of the hydroxyl group at position 4 of the flavone is carried out after having carried out glycosylation of the hydroxyl group at position 7 (see
Example 3: Acquisition of Candidate Genes Encoding Protein Having Activity that Transfers Sugar to Hydroxyl Group at Position 7 of Flavone 4-Glucoside
(69) <Isolation of Total RNA>
(70) Total RNA was isolated from the stage 1 and stage 2 flower petals of Nemophila menziesii using the Plant RNAeasy Kit (Qiagen Corp.) in accordance with the manufacturer's recommended protocol.
(71) <Expression Analysis of cDNA Derived from Nemophila menziesii Flower Petals>
(72) A reverse transcription reaction was carried out on 30 g of total RNA derived from Nemophila menziesii flower petals followed by the production of an equalized DNA library. After amplifying a clone of the resulting library by emulsion PCR, the base sequence was determined with the Genome Sequencer FLX (Roche Diagnostics K.K.). Sequences were extracted from the resulting sequence data that demonstrated identity with the gene sequence of gentian anthocyanin 3-glucosyltransferase. Candidate genes encoding glycosyltransferase were obtained by translating these sequences into amino acid sequences and assembling.
Example 4: Acquisition of Full-Length cDNA of Candidate Genes Encoding Protein Having Activity that Transfers Sugar to Hydroxyl Group at Position 7 of Flavone 4-Glucoside
(73) 30 types of glucosyltransferase candidate gene sequences were obtained in Example 3. Experiments were conducted on 20 of those genes (NmGT10 to NmGT29) in order to acquire full-length cDNA sequences.
(74) Acquisition of full-length cDNA sequences was carried out using the GeneRacer Kit (Invitrogen Inc.) in accordance with the manufacturer's recommended protocol. A region specific to that clone was selected from among the partial cDNA sequences obtained in Example 3, a RACE primer was designed based on the sequence of that region, and a 5,3-terminating sequence was acquired by RACE PCR. Primers for amplifying the full-length cDNA were designed based on this sequence, and a PCR reaction was carried out at a reaction volume of 50 l using Nemophila menziesii cDNA as template and using KOD-Plus Polymerase (Toyobo Co, Ltd.) in accordance with the manufacturer's recommended protocol (by repeating 30 cycles consisting holding for 2 minutes at 94 C., for 15 seconds at 94 C., for 30 seconds at 55 C. and for 2 minutes at 68 C., followed by holding at 4 C.). Nemophila menziesii cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen Inc.) and using the total RNA isolated in Example 2 as template in accordance with the manufacturer's recommended protocol. Plasmids containing the entire length of NmGT gene (pET SUMO-NmGT10 to pET SUMO-NmGT29) were acquired using these PCR products and using the pET SUMO TA Cloning Kit (Invitrogen Inc.) in accordance with the manufacturer's recommended protocol. The base sequences inserted into the plasmids were analyzed, and full-length cDNA sequences were acquired from the candidate genes encoding protein having activity that transfers a sugar to the hydroxyl group at position 7 of flavone 4-glucoside (NmGT10 to NmGT29). The pET SUMO-NmGT10 to pET SUMO-NmGT29 were used as E. coli expression constructs in Example 5 and subsequent examples.
Example 5: Experiment for Measuring Enzyme Activity of Protein Candidates Having Activity that Transfers Sugar to Hydroxyl Group at Position 7 of Flavone 4-Glucoside (Case of Using Crude Enzyme)
(75) <Expression of Glycosyltransferase in E. coli>
(76) pET SUMO-NmGT10 to pET SUMO-NmGT29 were introduced into E. coli strain BL2 using One Shot BL21 (DE3) (Invitrogen Inc.) in accordance with the manufacturer's recommended protocol to acquire transformed E. coli. The E. coli were cultured using the Overnight Express Auto-induction System 1 (Novagen Inc.) in accordance with the manufacturer's recommended protocol. The transformed E. coli were cultured in 2 ml of prepared culture broth at 37 C. until the OD600 value reached 0.5 (about 4 hours). This E. coli culture broth was added to a 50 ml of culture broth as pre-culture broth followed by final culturing overnight at 25 C.
(77) After having been cultured overnight, the E. coli culture broth was centrifuged (3,000 rpm, 4 C., 15 minutes), the harvested bacterial cells were suspended in 5 ml of sonic buffer (composition: 2.5 mM Tris-HCl (pH 7.0), 1 mM dithiothreitol (DTT), 10 IAM amidinophenylmethanesulfonyl fluoride hydrochloride (APMSF)), and the E. coli were crushed by ultrasonic treatment followed by centrifuging (15,000 rpm, 4 C., 10 minutes) and recovering the supernatant. The supernatant was used as a crude enzyme solution. The Avanti HP-26XP centrifuge (rotor: JA-2, Beckman Coulter Inc.) was used for centrifugation.
(78) <Measurement of Enzyme Activity>
(79) A reaction solution prepared by mixing 80 l of crude enzyme solution, 2 l of 50 mM UDP-glucose, 20 l of 1 M Tris-HCl (pH 7.5) and 1 l of 2 mM apigenin 4-glucoside (dissolved in 50% aqueous acetonitrile solution containing 0.1% TFA) on ice and bringing to reaction volume of 200 l with water was stored for 30 minutes at 30 C. Subsequently, 200 l of stop buffer (90% aqueous acetonitrile solution containing 0.1% TFA) were added to stop the reaction followed by analyzing the reaction solution by high-performance liquid chromatography (Prominence, Shimadzu Corp.). Flavone was detected at 330 nm using the Shimadzu PDA SPD-M10AVP for the detector. The Shim-Pack ODS column (150 mm4.6 mm, Shimadzu Corp.) was used for the column. A liquid A (0.1% aqueous TFA solution) and a liquid B (90% aqueous methanol solution containing 0.1% TFA) were used for elution. Elution was carried out for 10 minutes at a linear concentration gradient from an 8:2 mixture of the two solutions to a 3:7 mixture of the two solutions followed by eluting for 6 minutes using a 3:7 mixture of the two solutions. The flow rate was 0.6 ml/min. A reaction solution obtained by carrying out the enzyme reaction under the same conditions using a crude enzyme solution of E. coli introduced with pET SUMO vector not containing an insert was used as a control.
(80) As a result, peaks other than substrate were observed for NmGT22.
(81) Descriptions of NmGT22 (SEQ ID NO: 1) and its homolog in the form of NmGT22-II (SEQ ID NO: 5) are provided starting with Example 6.
Example 6: Experiment for Measuring Enzyme Activity of Protein Candidates Having Activity that Transfers Sugar to Hydroxyl Group at Position 7 of Flavone 4-Glucoside (Case of Using Purified Enzyme Following Addition of His-Tag)
(82) <Expression of Glucosyltransferase in E. coli and Protein Purification>
(83) E. coli strain BL2 introduced with pET SUMO-NmGT22 described in Example 5 was cultured using the Overnight Express Auto-induction System 1 (Novagen Inc.) in accordance with the manufacturer's recommended protocol. The transformed E. coli were cultured in 8 ml of prepared culture broth at 37 C. until the OD600 value reached 0.5 (about 4 hours). This E. coli culture broth was added to 200 ml of a culture broth as pre-culture broth followed by final culturing overnight at 25 C.
(84) After having been cultured overnight, the E. coli culture broth was centrifuged (1,000g, 4 C., 10 minutes), the harvested bacterial cells were suspended in 20 ml of extract (composition: buffer solution (300 mM KCl, 50 mM KH.sub.2PO.sub.4, 5 mM imidazole) (pH 8.0), 10 M amidinophenylmethanesulfonyl fluoride hydrochloride (APMSF)), and the E. coli were crushed by ultrasonic treatment followed by centrifuging (1,400g, 4 C., 20 minutes) and recovering the supernatant. The supernatant was passed through a 0.45 m filter and subjected to His-Tag purification using Profinia (Bio-Rad Corp.) in accordance with the manufacturer's recommended protocol. The resulting purified protein solution was centrifuged (7,500g, 4 C., 15 minutes) using a centrifugal filter unit (Ultracel-10K, Amicon Ultra), and the concentrated protein solution was used as NmGT-22 Protein Solution. The Avanti HP-26XP centrifuge (rotor: JA-2, Beckman Coulter Inc.) was used for centrifugation.
(85) <Measurement of Enzyme Activity>
(86) A reaction solution prepared by mixing 10 l of protein solution, 2 it of 50 mM UDP-glucose, 10 l of 1 M Tris-HCl (pH 7.5) and 1 l of 2 mM apigenin 4-glucoside (dissolved in 50% aqueous acetonitrile solution containing 0.1% TFA) on ice and bringing to reaction volume of 100 l with water was held for 20 minutes at 30 C. Subsequently, 100 l of stop buffer (90% aqueous acetonitrile solution containing 0.1% TFA) were added to stop the reaction followed by analyzing the reaction solution by high-performance liquid chromatography (Prominence, Shimadzu Corp.). Flavone was detected at 330 nm using the Shimadzu PDA SPD-M10AVP for the detector. The Shim-Pack ODS column (150 mm4.6 mm, Shimadzu Corp.) was used for the column. A liquid A (0.1% aqueous TFA solution) and a liquid B (90% aqueous methanol solution containing 0.1% TFA) were used for elution. Elution was carried out for 10 minutes at a linear concentration gradient from an 8:2 mixture of the two solutions to a 3:7 mixture of the two solutions followed by eluting for 6 minutes using a 3:7 mixture of the two solutions. The flow rate was 0.6 ml/min.
(87) As a result, flavone was synthesized that demonstrated the same retention time and absorption maximum as those of apigenin 4,7-diglucoside. The reaction rate (percentage of transformed substrate) was 100% (see
(88) In addition, base sequence and amino acid sequence identity were analyzed between NmGT22 and known glycosyltransferases. When NmGT22 was compared with glucosyltransferases derived from the same Nemophila menziesii, amino acid sequence identity between NmGT22 and NmGt3, between NmGT22 and NmGT4 and between NmGT22 and NmGT8 were 24%, 25% and 24%, respectively. In addition, amino acid sequence identity between NmGT22 and Pyrus communis-derived glucosyltransferase in the form of PcF7GT was 32% (see Table 1). Although the previously identified glucosyltransferase demonstrating the highest identity with NmGT22 was VvgGT2 (GenBank Accession No. JN164680), amino acid sequence identity was only 62% (see Table 1 and
(89) TABLE-US-00001 TABLE 1 Identity with NmGT22 (%) Amino Base Acid Function Sequence Sequence NmGT3 F4,7-GT 45 24 (+20) (does not function in plants) NmGT4 F4,7-GT 47 25 (+18) (does not function in plants) NmGT8 F4-GT 45 24 (+20) VvgGT2 GT adding sugar to hydroxybenzoic 65 62 (+16) acid and cinnamic acid PcF7GT Flavonoid7-GT 48 32 (+16)
(90) Based on these results as well, NmGT22 is presumed to demonstrate a function in plants that differs from that of known glycosyltransferases. In actuality, NmGT3 and NmGT4 do not have activity in plants that transfers a sugar to the hydroxyl group at position 4 and/or position 7 in a flavone. Although NmGT8 has activity that transfers a sugar to the hydroxyl group at position 4 of a flavone, it does not have activity that transfers a sugar to the hydroxyl group at position 7. Although VvgGT2 has a function that adds a sugar to hydroxybenzoic acid or cinnamic acid in grapes, it does not have activity that specifically transfers a sugar to the hydroxyl group at position 7 of a flavone in the manner of NmGT22. Although PcF7GT has activity that transfers a sugar to the hydroxyl group at position 7 of a type of flavonoid in the form of eriodictyol, flavones are not present in pears and the glycosyltransferase activity thereof on flavone 4glucoside is not known. Accordingly, it is thought to have substrate specificity that is clearly different from NmGT22, which demonstrates selective activity particularly with respect to flavone 4-glucoside. Moreover, although NmGT22 also has activity that specifically transfers a sugar to the hydroxyl group at position 5 of anthocyanin 3-glycoside (see
(91) In addition,
Example 7: Expression of NmGT22 Gene in Tabacco BY-2 Cells
(92) The presence or absence of glycosylation of the hydroxyl groups at position 4 and position 7 of a flavone in BY-2 cells in which NmGT22 and NmGT8 were co-expressed was evaluated in order to confirm that the NmGT22 gene of the present invention encodes a protein having activity that transfers a sugar to the hydroxyl group at position 7 of flavone 4-glucoside in plants.
(93) A binary vector pSPB6261 was constructed and introduced into a plant in order to co-express NmGT22 and NmGT8 in the plant.
(94) In the introduced binary vector pSPB6261, pBINPLUS (van Engel et al., Transgenic Research 4, p. 288) was used for the basic skeleton, and E1235S promoter (Mitsuhara et al., (1996) Plant Cell Physiol. 37, p. 49) was used for the promoter that expresses NmGT22 gene and NmGT8 gene, and HSP terminator (Plant Cell Physiol. (2010) 51, 328-332) was used for the terminator.
(95) Transformation of the BY-2 cells was carried out according to the method described below. First, the BY-2 cells were cultured in 100 ml of BY-2 culture broth medium (composition: 10 types of inorganic compounds (1.65 g/L of NH.sub.4NO.sub.3, 1.9 g/L of KNO.sub.3, 170 mg/L of KH.sub.2PO.sub.4, 6.2 mg/L of H.sub.3BO.sub.2, 22.3 mg/L of MnSO.sub.4.4H.sub.2O, 8.6 mg/L of ZnSO.sub.4.7H.sub.2O, 0.83 mg/L of KI, 0.25 mg/L of Na.sub.2MoO.sub.4.2H.sub.2O, 0.025 mg/L of CuSO.sub.4.5H.sub.2O, 0.025 mg/L of CoCl.sub.2.6H.sub.2O), 440 mg/L of CaCl.sub.2H.sub.2O, 370 mg/L of MgSO.sub.4.7H.sub.2O, 42.1 mg/L of Fe-EDTA, 30 g/L of sucrose, 100 mg/L of myo-inositol, 1 mg/L of thiamine-HCl, 0.2 mg/L of 2,4-dichlorophenoxyacetate) (pH 5.7), and the cells were cultured at 27 C. until the OD550 value reached 1.3 (about 3 days). 50 l of Agrobacterium solution introduced with pSPB6261, which was cultured at 28 C. in 5 ml of YEP medium (composition: 10 g/L of Bacto Yeast Extract, 10 g/L of Bacto Peptone, 5 g/L of NaCl) (pH 7.0) until the OD550 value reached 1.7, and 1.5 l of 20 mM acetosyringone were added to 3 ml of this BY-2 culture broth followed by additionally culturing for two and a half days at 27 C. After culturing for two and a half days, the co-culture broth of BY-2 cells and Agrobacterium was centrifuged (800 rpm, 15 C., 1 minute) followed by the addition of 10 ml of washing medium (composition: 10 types of inorganic compounds (1.65 g/L of NH.sub.4NO.sub.3, 1.9 g/L of KNO.sub.3, 170 mg/L of KH.sub.2PO.sub.4, 6.2 mg/L of H.sub.3BO.sub.3, 22.3 mg/L of MnSO.sub.4.4H.sub.2O, 8.6 mg/L of ZnSO.sub.4.7H.sub.2O, 0.83 mg/L of KI, 0.25 mg/L of Na.sub.2MoO.sub.4.2H.sub.2O, 0.025 mg/L of CuSO.sub.4.5H.sub.2O, 0.025 mg/L of CoCl.sub.2.6H.sub.2O), 440 mg/L of CaCl.sub.2H.sub.2O, 370 mg/L of MgSO.sub.4.7H.sub.2O, 42.1 mg/L of Fe-EDTA, 30 g/L of sucrose, 100 mg/L of myo-inositol, 1 mg/L of thiamine-HCl, 0.2 mg/L of 2,4-dichlorophenoxyacetate, disodium carbenicillin) (pH 5.7) to the cell layer obtained by removing the supernatant to suspend the cells. This suspension procedure was repeated five times to remove the Agrobacterium from the co-culture broth of BY-2 cells and Agrobacterium. The Himac CF16RX (Hitachi Ltd.) (rotor: T4SS31) was used for centrifugation. 1 ml of this BY-2 culture broth was inoculated into selective medium containing kanamycin (composition: 10 types of inorganic compounds (1.65 g/L of NH.sub.4NO.sub.3, 1.9 g/L of KNO.sub.3, 170 mg/L of KH.sub.2PO.sub.4, 6.2 mg/L of H.sub.3BO.sub.3, 22.3 mg/L of MnSO.sub.4.4H.sub.2O, 8.6 mg/L of ZnSO.sub.4.7H.sub.2O, 0.83 mg/L of KI, 0.25 mg/L of Na.sub.2MoO.sub.4.2H.sub.2O, 0.025 mg/L of CuSO.sub.4.5H.sub.2O, 0.025 mg/L of CoCl.sub.2.6H.sub.2O), 440 mg/L of CaCl.sub.2.H.sub.2O, 370 mg/L of MgSO.sub.4.7H.sub.2O, 42.1 mg/L of Fe-EDTA, 30 g/L of sucrose, 100 mg/L of myo-inositol, 1 mg/L of thiamine-HCl, 0.2 mg/L of 2,4-dichlorophenoxyacetate, disodium carbenicillin, kanamycin) (pH 5.7) followed by selecting transgenic BY-2 cells introduced with NmGT22 and NmGT8.
(96) <Analysis of Expression of NmGT22 Gene in BY-2 Cells>
(97) Expression of NmGT22 gene was analyzed using the selected BY-2 cell mass. Total RNA was acquired by isolating according to the method described in Example 3, and synthesis of cDNA was carried out according to the method described in Example 4. The reverse transcription PCR reaction was carried out at a reaction volume of 30 l using the cDNA as template and using ExTaq Polymerase (Takara Bio Inc.) in accordance with the manufacturer's recommended protocol (by repeating 25 cycles consisting holding for 2 minutes at 94 C., 1 minute at 94 C., 1 minute at 55 C. and for 2 minutes at 72 C., followed by holding at 4 C.). Primers were designed so as to specifically amplify the full length of NmGT22 cDNA (forward primer: ATGGAATGCAAAAATCCAGATTC, reverse primer: CTAGGTAATAAATCTGAAATTATTG). Since a 1432 b band corresponding to the full-length cDNA was detected when the reaction product was analyzed by agarose gel electrophoresis, NmGT22 gene was confirmed to have been transcribed in BY-2 cells.
(98) <Analysis of Function of NmGT22 in BY-2 Cells>
(99) Expression was similarly analyzed for NmGT8 (forward primer: ATGGAGAAAAAAACTATT, reverse primer: CTATTTCCAACCATCCAG, full-length cDNA: 1425 b) in order to select a BY-2 cell line in which transcription products are synthesized for full-length NmGT8 cDNA and full-length NmGT22 cDNA. An experiment was conducted that the BY-2 cell line in which full-length transcripts of NmGT8 and NmGT22 cDNA were confirmed was fed with apigenin which is a substrate of NmGT8 and NmGT22.
(100) Transgenic BY-2 cells were cultured in 100 ml of BY-2 culture broth medium at 27 C. until the OD550 value reached 1.1 (about 3 days). 130 l of 3 mM apigenin (dissolved in 50% aqueous acetonitrile solution containing 0.1% TFA) were added followed by additionally culturing at 27 C. for two and a half days.
(101) Apigenin-feeding experiments were similarly conducted with BY-2 cells not introduced with a gene and BY-2 cells introduced only with NmGT8 gene for the gene that encodes a protein having activity that transfers a sugar to a hydroxyl group of a flavone to serve as controls. The cell layer obtained by centrifuging the BY-2 culture broth (3,000 rpm, 15 C., 15 minutes) was crushed with a mortar and pestle in liquid nitrogen followed by the addition of 2 ml of extraction buffer (composition: methanol containing 1% HCl) and allowing to stand overnight at normal temperature. The supernatant recovered by centrifuging (3,000 rpm, 15 C., 15 minutes) the cell extract was concentrated to 200 l using a desiccator. The Himac CF16RX (Hitachi Ltd.) (rotor: T4SS31) was used for centrifugation. The cell extract was additionally centrifuged (15,000 rpm, 15 C., 15 minutes) and the recovered supernatant was passed through a 0.22 l filter and then analyzed by high-performance liquid chromatography (Prominence, Shimadzu Corp). The MX-205 (Tomy Digital Biology Co., Ltd., rotor: AR015-24) was used for centrifugation. Flavone was detected at 330 nm using the Shimadzu PDA SPD-M10AVP for the detector. The Shim-Pack ODS column (150 mm4.6 mm, Shimadzu Corp.) was used for the column. A liquid A (0.1% aqueous TFA solution) and a liquid B (90% aqueous methanol solution containing 0.1% TFA) were used for elution. Elution was carried out for 10 minutes at a linear concentration gradient from an 8:2 mixture of the two solutions to a 3:7 mixture of the two solutions followed by eluting for 6 minutes using a 3:7 mixture of the two solutions. The flow rate was 0.6 ml/min. Experiments consisting of feeding apigenin were similarly conducted on BY-2 cells not introduced with a gene and BY-2 cells introduced only with NmGT8 gene for the gene that encodes a protein having activity that transfers a sugar to a hydroxyl group of a flavone to serve as controls followed by analyses of the cell extracts (
(102) Apigenin 4,7-diglucoside accounted for 0.10% of the biosynthesized flavone compounds present in the cell extract obtained from non-transgenic BY-2 cells, and apigenin 4-glucoside was not detected. Apigenin 4,7-diglucoside and apigenin 4-glucoside were determined to account for 10.99% and 31.65%, respectively, of biosynthesized flavone compounds present in the cell extract obtained from transgenic BY-2 cells introduced with NmGT8 only. Apigenin 4,7-diglucoside accounted for 26.35% of the biosynthesized flavone compounds present in the cell extract obtained from transgenic BY-2 cells introduced with NmGT8 and NmGT22, while apigenin 4-glucoside was not detected. Since the remaining 73.65% constitutes flavone compounds also contained in the cell extract obtained from the control BY-2 cells, these were suggested to be apigenin diglucosides or flavone 7-glucosides and the like biosynthesized by the intrinsic activity of BY-2 cells (
(103) Apigenin 4-glucoside, which was detected in the cell extract obtained from BY-2 cells introduced with NmGT8 only, was not detected in the cell extract obtained from transgenic BY-2 cells introduced with NmGT8 and NmGT22. On the basis thereof, NmGT22 was suggested to function as a protein having activity that transfers a sugar to the hydroxyl group at position 7 of apigenin 4-glucoside by using apigenin 4-glucoside biosynthesized in BY-2 cells by NmGT8 as substrate. Flavone 4,7-diglucoside can therefore be biosynthesized by co-expression of NmGT22 and NmGT8.
Example 8: Expression of NmGT22 Gene in Rose
(104) <Production of Construct for Expressing NmGT22 Gene in Rose>
(105) The presence or absence of glycosylation of the hydroxyl groups at position 4 and position 7 of a flavone in a rose plant in which NmGT22 and NmGT8 were co-expressed was evaluated in order to confirm that the NmGT22 gene of the present invention encodes a protein having activity that transfers a sugar to the hydroxyl group at position 7 of flavone 4-glucoside in plants. Torenia flavone synthase was also expressed since roses do not inherently biosynthesize flavones.
(106) A binary vector pSPB6269 was constructed and introduced into a rose plant (variety: Ritapa Humera) in order to co-express NmGT22 and NmGT8 and torenia flavone synthase in the plant. The introduced construct pSPB6269 used the binary vector pBINPLUS (van Engel et al., Transgenic Research 4, p. 288) for the basic skeleton and had an expression cassette consisting of trenia flavone synthase, NmGT22 gene and NmGT8 gene. E1235S promoter (Mitsuhara et al., (1996) Plant Cell Physiol. 37, p. 49) was used for the promoter that expresses each gene.
(107) <Analysis of Expression of NmGT22 in Rose>
(108) Shoots were formed in selective medium containing kanamycin and individuals that were observed to take root were acclimated followed by analyzing gene expression in the same manner as the method described in Example 7 using transgenic rose leaves. As a result, NmGT22 gene was confirmed to have been transcribed in the rose plants.
(109) <Analysis of Function of NmGT22 in BY-2 Cells>
(110) A similar analysis of expression of torenia flavone synthase and NmGT8 was additionally carried out to select a rose strain in which transcription products were synthesized for full-length torenia flavone synthase cDNA, full-length NmGT8 cDNA and full-length NmGT22 cDNA (torenia flavone synthase forward primer: ATGGACACAGTCTTAATCAC, reverse primer: TCAAGCACCCGATATTGTG, full-length cDNA: 1539b; NmGT8 forward primer: ATGGAGAAAAAAACTATT, reverse primer: CTATTTCCAACCATCCAG, full-length cDNA: 1425 b). Flower color pigment was then analyzed for a rose strain in which transcription products were confirmed for the resulting full-length torenia flavone synthase cDNA, full-length NmGT8 cDNA and full-length NmGT22 cDNA. 0.2 g of completely open flower petals were freeze-dried for 24 hours or more followed by finely shredding with a spatula, adding 4 ml of extraction buffer (composition: 50% aqueous acetonitrile solution containing 0.1% TFA), and subjecting to ultrasonic treatment for 20 minutes. The flower petal extract was additionally centrifuged (15,000 rpm, 15 C., 15 minutes) and the recovered supernatant was passed through a 0.22 m filter followed by analyzing by high-performance liquid chromatography (Prominence, Shimadzu Corp). The MX-205 (Tomy Digital Biology Co., Ltd., rotor: AR015-24) was used for centrifugation. Flavone was detected at 330 nm using the Shimadzu PDA SPD-M10AVP for the high-performance liquid chromatography detector. The Shim-Pack ODS column (150 mm4.6 mm, Shimadzu Corp.) was used for the column. A liquid A (0.1% aqueous TFA solution) and a liquid B (90% aqueous methanol solution containing 0.1% TFA) were used for elution. Elution was carried out for 90 minutes at a linear concentration gradient from an 8:2 mixture of the two solutions to a 0:10 mixture of the two solutions followed by eluting for 5 minutes using a 0:10 mixture of the two solutions. The flow rate was 0.6 ml/min. Flower petal pigment was similarly analyzed for rose not introduced with a gene and transgenic rose introduced with torenia flavone synthase and NmGT8 only as controls (
(111) Although flavone 4-glucoside (apigenin 4-glucoside, tricetin 4-glucoside) was detected in transgenic rose introduced with torenia flavone synthase and NmGT8 only, flavone 4,7-diglucoside was not detected (
(112) Since flavone 4,7-diglucoside, which was not detected from transgenic rose introduced with only torenia flavone synthase and NmGT8, was detected in transgenic rose introduced with torenia flavone synthase, NmGT8 and NmGT22, NmGT22 was suggested to function as a protein having activity that transfers a sugar to the hydroxyl group at position 7 of flavone 4-glucoside by using flavone 4-glucoside biosynthesized in rose petals by NmGT8 as substrate. Flavone 4,7-diglucoside can therefore be biosynthesized by co-expression of NmGT22 and NmGT8.
Example 9: Experiment for Acquiring NmGT22-II and Measuring Enzyme Activity
(113) A sequence demonstrating 98% identity with the base sequence of NmGT22 (NmGT22-II (SEQ ID NO: 5)) was acquired in the same manner as Examples 3 and 4.
(114) pET SUMO-NmGT22-II was produced using the method described in Example 4, and enzyme activity was measured using the method described in Example 6. As a result, NmGT22-II was clearly determined to be a protein having activity that transfers a sugar to the hydroxyl group at position 7 of flavone 4-glucoside in the same manner as NmGT22. In addition, NmGT22-II demonstrated the same tendency as NnGT22 regarding substrate specificity with respect to flavones as well. NmGT22-II is located extremely close to NmGT22 in the phylogenetic tree, and amino acid sequence identity between NmGT22-II and NmGT22 was 99% (