Diacylglycerol acyltransferase 1 and application thereof in production of triacylglycerol
12077787 ยท 2024-09-03
Assignee
Inventors
- Haiqin Chen (Wuxi, CN)
- Wei Chen (Wuxi, CN)
- Xin Tang (Wuxi, CN)
- Jun Cao (Wuxi, CN)
- Jianxin Zhao (Wuxi, CN)
- Yongquan Chen (Wuxi, CN)
- Hao Zhang (Wuxi, CN)
Cpc classification
C12N9/1029
CHEMISTRY; METALLURGY
International classification
Abstract
Disclosed is a diacylglycerol acyltransferase 1, a recombinant Saccharomyces cerevisiae containing the diacylglycerol acyltransferase 1, and application thereof in production of triacylglycerol. The diacylglycerol acyltransferase 1 of the invention has a function of catalyzing synthesis of triacylglycerol. After the recombinant Saccharomyces cerevisiae containing the diacylglycerol acyltransferase 1 of the invention is subjected to induction culture for 48 h, the content of total fatty acid and triacylglycerol in the recombinant Saccharomyces cerevisiae containing the diacylglycerol acyltransferase 1 can be respectively increased by 1.94 folds and 12.09 folds as compared with those of Saccharomyces cerevisiae without the recombinant diacylglycerol acyltransferase 1. The instant invention provides a method for improving the ability of microorganisms to produce polyunsaturated fatty acids (PUFAs) by means of genetic engineering.
Claims
1. A recombinant Saccharomyces cerevisiae expressing diacylglycerol acyltransferase 1, wherein the recombinant Saccharomyces cerevisiae carries a recombinant vector pYES2-Madgat1b, wherein the recombinant vector pYES2-MadgatIb is constructed by connecting a gene encoding the diacylglycerol acyltransferase 1 of SEQ ID NO: 1 to vector pYES2.
2. The recombinant Saccharomyces cerevisiae of claim 1, wherein the Saccharomyces cerevisiae is Saccharomyces cerevisiae INVSc1.
3. A method of preparing diacylglycerol acyltransferase 1, using the recombinant Saccharomyces cerevisiae of claim 1, comprising: a) culturing the recombinant Saccharomyces cerevisiae of claim 1 in a culture medium without urea for 36-48 h; b) adding the Saccharomyces cerevisiae cells of step a) to a culture medium without glucose and with galactose, and culturing until OD.sub.600=0.3-0.5; and c) continuing induction culture for 48-96 h to obtain the diacylglycerol acyltransferase 1.
4. The method of claim 3, wherein the culture medium of step a) and step b) is an SC-U culture medium.
5. The method of claim 4, wherein the culture of step a) and step b) is carried out at a temperature of 28-30? C. and at a rotation speed of 200-250 rpm.
6. A method for producing triacylglycerol, using the recombinant Saccharomyces cerevisiae according to claim 1, comprising: a) culturing the recombinant Saccharomyces cerevisiae of claim 1 in a culture medium without urea for 36-48 h; b) adding the Saccharomyces cerevisiae cells of step a) to a culture medium without glucose and with galactose, and culturing until OD.sub.600=0.3-0.5; and c) continuing induction culture for 48-96 h to obtain the triacylglycerol.
7. The method of claim 6, wherein the culture medium of step a) and step b) comprises an SC-U culture medium; and the culture of step a) and step b) is carried out at a temperature of 28-30? C. and at a rotation speed of 200-250 rpm.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
DETAILED DESCRIPTION
(14) The invention is further explained in details below with regard to specific examples.
(15) The Mortierella alpina ATCC 32222 used in the following examples was purchased from the American Type Culture Collection (ATCC). E. coli DH5a, Saccharomyces cerevisiae (S. cerevisiae) auxotrophic strain INVSc1, and expression vector pYES2/NT C were purchased from Invitrogen. KOD plus high-fidelity DNA polymerase was purchased from Toyobo. Taq DNA polymerase was purchased from CWBIO. A reverse transcription kit (PrimeScript RT regent Kit with gDNA Eraser RR047A&R6110A) was purchased from Takara. A plasmid extraction kit was purchased from TIANGEN BIOTECH (BEIJING) CO., LTD. A fungal genomic DNA extraction kit was purchased from BioFlux. Restriction enzymes (EcoR I, Xba I), T.sub.4 ligase, Trizol, a PCR product purification kit, a gel recovery kit, GeneRuler DNA Ladder Mix, PageRuler Prestained Protein Ladder, and antibodies (6?His-Tag Monoclonal Antibody, HRP-Goat Anti-Mouse IgG [H+L]) were purchased from Thermo. n-pentadecanoic acid (C15:0), glycerol tripalmitate, 20% (w/w) hydrochloric acid methanol, acid washed glass beads and salmon sperm were purchased from Sigma. An acrylamide/methylene bisacrylamide 40% solution (29:1), TEMED, DEPC water, Ampicillin antibiotics, amino-free yeast nitrogen source (YNB) and various amino acids were purchased from Shanghai Bioengineering Co., Ltd. A yeast extract and a tryptone were purchased from Oxoid. A thin layer chromatography silica gel plate was purchased from Rushan Taiyang Silica Gel Co., Ltd. Bovine serum albumin was purchased from Macklin. Low-adsorption RNase-free pipette tips, RNase-free centrifuge tubes, RNase-free PCR tubes, 2 mL brown gas bottles and bottle caps were purchased from Suzhou Keqing Biology Co., Ltd. BCA protein assay kits were purchased from Shanghai Beyotime Biotechnology. Glass spotting capillary tubes were purchased from Shanghai Shendi Glass Instrument Co., Ltd. Skimmed milk powder was purchased from BD, USA.PVDF membranes and Plus ECL developer were purchased from MILLIPORE. Other reagents were purchased from Sinopharm Group.
(16) The reagents and formulas related to Saccharomyces cerevisiae (S. cerevisiae) transformation are based on the manual for pYES2 plasmid expression of Invitrogen, in which PEG-3350 was replaced by PEG-4000.
(17) Primers used in the following examples were synthesized by Shanghai Sunny Biotechnology Co., Ltd., and the sequencing work was completed by BGI, Shanghai.
(18) The Mortierella alpina ATCC 32222, the E. coli DH5a, and the Saccharomyces cerevisiae (S. cerevisiae) auxotrophic strain INVSc1 are all commercially available and do not need disposition for patent procedures)
(19) The culture media used in the following examples are as follows:
(20) LB liquid culture medium: 10 g/L tryptone, 5 g/L yeast extract, and 10 g/L NaCl.
(21) LB solid culture medium: 10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl, and 20 g/L agar.
(22) SOC recovery culture medium: 20 g/L tryptone, 5 g/L yeast extract, 0.5 g/L NaCl, 0.186 g/L KCl, 0.95 g/L MgCl.sub.2, and 3.6 g/L glucose.
(23) YPD liquid culture medium: 10 g/L yeast extract, 20 g/L tryptone, and 20 g/L glucose.
(24) YPD solid culture medium: 10 g/L yeast extract, 20 g/L tryptone, 20 g/L glucose, and 20 g/L agar.
(25) SC-U liquid culture medium: 20 g/L glucose, 6.7 g/L YNB, 0.1 g/L amino acids each (adenine, arginine, cysteine, leucine, lysine, threonine and tryptophan), and 0.05 g/L amino acids each (aspartic acid, histidine, isoleucine, methionine, phenylalanine, proline, serine, tyrosine and valine).
(26) SC-U solid culture medium: 20 g/L glucose, 6.7 g/L YNB, 0.1 g/L amino acids each (adenine, arginine, cysteine, leucine, lysine, threonine and tryptophan), 0.05 g/L amino acids each (aspartic acid, histidine, isoleucine, methionine, phenylalanine, proline, serine, tyrosine and valine), and 20 g/L agar.
(27) SC-U induction culture medium: 10 g/L raffinose, 6.7 g/L YNB, 0.1 g/L amino acids each (adenine, arginine, cysteine, leucine, lysine, threonine and tryptophan), 0.05 g/L amino acids each (aspartic acid, histidine, isoleucine, methionine, phenylalanine, proline, serine, tyrosine and valine), and 20 g/L galactose.
Example 1. Screening and Bioinformatics Analysis of Gene Encoding Diacylglycerol Acyltransferase 1
(28) Specific steps are as follows:
(29) dgat1 gene sequences with identified functions in different species were selected from NCBI as templates (Table 1), and BLAST alignment was carried out in the gene bank of the M. alpina ATCC 3222 strain that had been sequenced to obtain candidate target genes. Then, the candidate genes were compared and screened for a second time in the NCBI library, the finally obtained target gene was named Madgat1b, and the corresponding protein was named MaDGAT1B.
(30) In order to determine whether the screened MaDGAT1B belongs to a DGAT1 enzyme, it was compared with amino acid sequences of 5 typical DGAT1s from animals, higher plants, microorganisms and microalgae in Table 1, and amino acid homology and conserved structure analysis were performed by DNAMAN software. The results are shown in
(31) The research results show that there are 7 conserved domains in the DGAT1, respectively marked as Motif1-7. The corresponding conserved domains are as follows: Motif1 (GL segment), Motif2 (KSR segment), Motif3 (PTR segment), Motif4 (QP segment), Motif5 (LWLFFEFDRFYWWNWWNPPFSHP segment), Motif6 (FQL segment) and Motif7 (NGQPY segment). The DGAT1 generally has more than 500 amino acid residues with a molecular weight of 50-60 kD. The three-dimensional structure of the protein includes 6-9 hypothetical transmembrane regions.
(32) It can be seen from
(33) Based on the above results, the similarity of the amino acid sequences between the MaDGAT1B and the DGAT1s of different species is of biological significance, and the gene length, the number of amino acids, the conserved domains and the transmembrane regions all conform to the features of the DGAT1 enzyme, so it is believed that the screened MaDGAT1B has the function of the DGAT1 protein.
(34) TABLE-US-00001 TABLE 1 List of dgat1 genes from different sources Type Species Abbreviation Number dgat1 Homo sapiens Hsdgat1 NM_012079.6 Mouse Mmdgat1 NM_010046.3 Arabidopsis Atdgat1 NM_127503.3 Phaeodactylum Ptdgat1 XM_002177717.1 tricornutum Blastomyces Pbdgat1 KN305546.1 brasiliensis
Example 2. Cloning of Madgat1b
(35) Specific steps are as follows:
(36) The total RNA of Mortierella alpina ATCC 32222 was extracted by a Trizol method, reverse transcription was performed according to instructions of the Takara reverse transcription kit to obtain a cDNA library, and a PCR reaction was carried out in the cDNA library of the Mortierella alpina ATCC 32222 to amplify Madgat1b cDNA. Primers used to amplify the Madgat1b are shown in Table 2.
(37) The PCR instrument used was BIO-RAD T100 Thermal Cycler, KOD plus high-fidelity DNA polymerase was used, the reaction system was 50 ?L, and the system is specifically carried out according to the DNA polymerase instructions. The reaction process was as follows: pre-denaturation was performed at 94? C. for 3 min, then denaturation was performed at 94? C. for 30 s, annealing was performed at 60? C. for 30 s, extension was performed at 68? C. for 100 s, the above three steps were repeated 30 times, then full extension was performed at 68? C. for 7 min, and finally, the temperature was dropped to 12? C. and held for 5 min before termination reaction.
(38) After the completion of the reaction, the correct length of the amplification product band was verified by 1% agarose gel electrophoresis, and the PCR product was purified to obtain the Madgat1b cDNA.
(39) TABLE-US-00002 TABLE2 Primersequences Primer Name PrimerSequence(5-3) Uses Madgat1b SEQIDNo.3: ForMadgat1b F CCGGAATTCATGACCAAGAACGAGCCC gene Madgat1b SEQIDNo.4: amplification R CTAGTCTAGATCAGGCTACTGTCGAGGG Note: The restriction sites are underlined.
Example 3. Expression of Madgat1b in Saccharomyces Cerevisiae
(40) Specific steps are as follows:
(41) (1) Construction of Yeast Expression Vector
(42) After the Madgat1b PCR product was digested with the restriction enzymes EcoR I and Xba I, the digestion product was ligated to a corresponding multiple cloning site downstream a (3-galactosidase (GALL) promoter in the pYES2/NT C expression vector by the T.sub.4 ligase. The ligation product (not more than 5%) was introduced into E. coli DH5a by chemical transformation (under transformation conditions of 42? C. and 90 s), and preliminary screening was performed by using the LB agar medium plate with 0.1 g/L Ampicillin to obtain an E. coli positive transformant. Then the plasmid was extracted as a template, PCR amplification was carried out by using a universal primer T7/T7 terminator in Table 3, the product was verified by 1% agarose gel electrophoresis, and the E. coli positive transformants with correct band length were preliminarily screened out and subjected to sequencing analysis. After the successful sequencing, the recombinant plasmid was obtained, named pYES2-Madgat1b (the screening and verification results of the E. coli DH5a positive transformants are shown in
(43) (2) Transformation and Screening of Saccharomyces cerevisiae
(44) According to the pYES2 plasmid manual of Invitrogen, the recombinant plasmid pYES2-Madgat1b with correct sequence obtained in (1) and the empty vector pYES2/NT C (used as a negative control) were respectively transformed into the Saccharomyces cerevisiae strain INVSc1 by PEG/LiAc method, and preliminary screening was carried out by using the SC-U solid culture medium plate without ura.sup.? to obtain Saccharomyces cerevisiae positive transformants. Then the yeast genome was extracted as a template, PCR amplification was carried out by using the universal primer T7/T7 terminator in Table 3, the product was verified by 1% agarose gel electrophoresis, and the positive transformants with correct band length were preliminarily screened out and subjected to sequencing analysis to obtain recombinant Saccharomyces cerevisiae INVSc1-pYES2-Madgat1b and recombinant Saccharomyces cerevisiae INVSc1-pYES2. The screening verification results of the Saccharomyces cerevisiae positive transformants were shown in
(45) (3) Induction Culture
(46) The recombinant Saccharomyces cerevisiae INVSc1-pYES2-Madgat1b and the recombinant Saccharomyces cerevisiae INVSc1-pYES2 were cultured in the SC-U liquid culture medium at 28? C., 200 rpm for 48 h, and after centrifugation at 6000 rpm for 5 min, the culture medium was discarded and the cells was inoculated (initial OD.sub.600=0.4) into the SC-U induction culture medium containing galactose, but no glucose, to induce the expression of the Madgat1b. Culture was carried out for 48 h under the same conditions to obtain a fermentation broth. The fermentation broth was centrifuged at 12000 rpm for 1 min to collect cells. Part of the wet cells were taken for protein expression analysis. The rest of the cells were freeze-dried, and the biomass, and the lipid components and contents were determined.
(47) (4) Determination of Expression Level of Target Protein
(48) 2 mL of the fermentation broth after 48 h of induction was collected, and centrifuged at 12000 rpm, 4? C. for 1 min to collect cells. The Saccharomyces cerevisiae whole cell protein was extracted based on the pYES2 plasmid manual of Invitrogen. A lysate was added to the cells such that the OD.sub.600 value reached 50-100. Then 0.5 mm acid washed glass beads of the same volume as the lysate were added. The mixture was shaken in a vortex shaker for 30 seconds and placed on ice for 30 seconds. The whole cell protein extract was obtained after repeating 4 times of the above operation. The protein concentration of the whole cell protein extract was determined by using a BCA kit. The sample was separated through SDS-PAGE (10% separation gel), and electrotransferred (200 mA, 1 h) onto a PVDF membrane. An anti-his antibody with a dilution of 1:2000 was used as the primary antibody, and a mouse secondary antibody with a dilution of 1:5000 was used to bind to the aforementioned primary antibody, and then reacts with a chemiluminescent solution to develop chemiluminescent products, and photographing were carried out with an imager.
(49) The expression of the target protein MaDGAT1B in the yeast recombinant strain was analyzed by Western Blot. The 6?his tag at the N-terminus of the pYES2/NT C vector was selected as the antigen, and the molecular weight of the 6?his-tagged MaDGAT1B protein was about 64 kD as predicted with an online software ExPASy-ProtParam tool. The Western Blot results are shown in
(50) It can be seen from
(51) The whole cell protein extract of INVSc1-pYES2-Madgat1b was centrifuged at 20000 g for 15 min, and the supernatant and the precipitate were taken for protein concentration determination. Finally, the whole cell protein extract (20 ?g protein) and the protein precipitate (20 ?g protein) were respectively taken for Western Blot experiments (no experiment was performed for the supernatant due to low protein concentration), and the protein expression was estimated by Image J software. The results are shown in
(52) It can be seen from
(53) (5) Determination of Composition and Contents of Fatty Acids in Triacylglycerol
(54) Thin layer chromatography (TLC) is a method to separate components of a mixture based on their different distribution or retention rates between the stationary phase and the mobile phase of the TLC. The components are developed and colored to form chromatographic bands, and the bands can be treated by a proper technique to obtain qualitative and quantitative detection results. Therefore, the thin layer chromatography was used to separate TAG from the total lipids of the cells obtained in (3), and the fatty acid composition and contents of the TAG were detected by a GC-MS technique.
(55) Specific steps are as follows:
(56) 20 mg of cells was weighed into a lipid extraction glass bottle, the total lipids were extracted with a mixed organic reagent of chloroform:methanol:water=2:2:1 (v/v/v), various lipids were separated on a thin layer chromatography plate by using a mixed solvent of n-hexane:diethyl ether:acetic acid=80:20:1 (v/v/v) as a developing solvent, spots were visualized with iodine fuming, and grey-scale analysis was carried out using Image J software to estimate the proportion of TAG in total fatty acids. Then, the spots of the TAG were immediately scraped off and placed in the lipid extraction glass bottle, followed by the addition of a pentadecanoic acid standard as an internal standard. Methyl esterification was carried out in a 60? C. water bath for 3 hours by using a solvent of hydrochloric acid:methanol=1:9 (w/w). Fatty acid methyl ester was extracted with n-hexane. The fatty acid composition and contents in TAG were analyzed by a Shimadzu single quadrupole gas chromatography-mass spectrometer GC MS-QP2010 Ultra.
(57) Operating conditions were as follows: a Rtx-Wax gas chromatography column (30 m?0.25 mm?0.25 ?m) of RESTEK was used, helium was used as the carrier gas, the injection port temperature was 240? C., the injection volume was 1 ?L, and the split ratio was 10. The temperature of the column oven was started from 150? C. and held for 2 min, then raised to 190? C. at a rate of 10? C./min and held for 5 min, and then raised to 220? C. at a rate of 5? C./min and held for 16 min. The scanning range of the mass spectrometer was 50-550 m/z. The temperatures of the ion source and transmission line port were respectively 220? C. and 250? C.
(58) The distribution patterns and quantitative analysis of total fatty acids in the recombinant strains detected by TLC are shown in
(59) After the sample of the TAG on the TLC plate was scraped and fatty acids were qualitatively and quantitatively analyzed by GC-MS. The results of composition and contents of fatty acids in TAG are shown in
(60) It can be seen from
(61) The contents of four main TAG fatty acids of the INVSc1-pYES2-Madgat1b transformant were compared with those of the control group, and the results are shown in
(62) (6) Determination of Composition and Contents of Total Fatty Acids in Cells
(63) 20 mg of freeze-dried 1NVSc1-pYES2 and INVSc1-pYES2-Madgat1b cells were respectively weighed into a lipid extraction glass bottle. 2 mL of hydrochloric acid with a concentration of 4 mol/L was added. After being in a water bath at 80? C. for 1 h, the mixture was sufficiently shaken and allowed to stand in a ?80? C. refrigerator for 15 min. The above freezing and thawing operations were repeated for 3 times, followed by the addition of 100 ?L of 2.096 mg/mL pentadecanoic acid standard as an internal standard. Lipids were extracted with 1 mL of chloroform and 1 mL of methanol. After rotation shaking for 1 h, centrifugation was carried out at 2000 rpm, the lower chloroform layer was pipetted into a new bottle, 1 mL of chloroform was added, and the mixture was sufficiently shaken. The same operations were repeated for one more time. The two chloroform layers were combined and blow-dried with nitrogen. Subsequent methyl esterification and determination methods were the same as described in (5).
(64) The total fatty acid contents in the recombinant yeast strains are shown in
(65) It can be seen from Table 4 that the contents of fatty acids in the INVSc1-pYES2-Madgat1b are all greatly increased. The C14:0 increased the most, which was 5.79 times of the control group, but the proportion of C14:0 in total fatty acids was relatively low, and thus has less effect on the total fatty acid content. The contents of the C16:0, C16:1, C18:0 and C18:1 are respectively increased by 2.40, 1.61, 2.91 and 1.63 times, respectively, accounting for 25.33%, 31.55%, 13.50% and 23.58% of the total fatty acids. Therefore, they are the main fatty acid components causing the increase of the total fatty acid content.
(66) It can be seen that the expression of Madgat1b can significantly increase the total fatty acid content, indicating that the DGAT1 protein from Mortierella alpina can lead to more lipid production and accumulation and has good application values.
(67) TABLE-US-00003 TABLE3 Primersequences PrimerName PrimerSequence(5-3) Uses T7 SEQIDNo.5: Toverifyrecombinant TAATACGACTCACTATAGGG plasmidsconstructedusing T7terminator SEQIDNo.6: apYES2/NTCvector TCGGTTAGAGCGGATGTG
(68) TABLE-US-00004 TABLE 4 Composition and contents of total fatty acids in Saccharomyces cerevisiae Contents of Various Fatty Acids (%, w/w, dry cell weight) Strain C12:0 C14:0 C14:1 C16:0 C16:1 C18:0 C18:1 C26:0 C 0.04 ? 0.06 ? 0.02 ? 1.60 ? 2.97 ? 0.70 ? 2.19 ? 0.20 ? 0.00 0.00 0.00 0.02 0.04 0.02 0.03 0.15 1 0.12 ? 0.36 ? 0.07 ? 3.84 ? 4.77 ? 2.05 ? 3.57 ? 0.36 ? 0.00 0.00 0.00 0.16 0.02 0.14 0.08 0.11 Note: C is INVSc1-pYES2 Saccharomyces cerevisiae, and 1 is INVSc1-pYES2-Madgat1b Saccharomyces cerevisiae.
(69) Although the invention has been disclosed above in some specific embodiments, it is not intended to limit the scope of the invention. One skilled in the art can make various changes and modifications without departing from the spirit and scope of the invention. Therefore, the scope of the invention should be defined in the claims.