MODULATION OF SMN EXPRESSION
20180273943 ยท 2018-09-27
Assignee
Inventors
- Frank Rigo (Carlsbad, CA)
- C. Frank Bennett (Carlsbad, CA)
- Constantin Van Outryve D'Ydewalle (Baltimore, MD, US)
- Charlotte J. Sumner (Baltimore, MD, US)
Cpc classification
C12N15/113
CHEMISTRY; METALLURGY
C12N2310/3231
CHEMISTRY; METALLURGY
C12N2310/345
CHEMISTRY; METALLURGY
C12N2310/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Certain embodiments are directed to methods and compounds for inhibiting SMN-NAT, the natural antisense transcript of SMN. Such methods and compounds are useful for increasing expression of SMN in cells and animals
Claims
1. A method of reducing SMN-NAT in a cell, comprising contacting the cell with an antisense compound.
2. A method of increasing expression of SMN in a cell, comprising contacting the cell with an antisense compound targeted to SMN-NAT.
3. The method of claim 2, wherein the SMN is SMN2 mRNA.
4. The method of claim 2, wherein the SMN is SMN2 pre-mRNA.
5. The method of claim 2, wherein the SMN is SMN2 protein.
6. The method of any of claims 1-5, wherein SMN-NAT comprises a nucleic acid sequence at least 85% identical to SEQ ID NO: 1.
7. The method of any of claims 1-5, wherein SMN-NAT comprises a nucleic acid sequence at least 90% identical to SEQ ID NO: 1.
8. The method of any of claims 1-5, wherein SMN-NAT comprises a nucleic acid sequence at least 95% identical to SEQ ID NO: 1.
9. The method of any of claims 1-5, wherein SMN-NAT comprises a nucleic acid sequence 100% identical to SEQ ID NO: 1.
10. The method of any one of claims 1-9, wherein the antisense compound comprises an oligonucleotide consisting of 12 to 30 linked nucleosides, and wherein the oligonucleotide is at least 85% complementary to a SMN-NAT nucleic acid sequence.
11. The method of any of claims 1-9, wherein the oligonucleotide is at least 90% complementary over its entire length to an equal length region of a SMN-NAT nucleic acid sequence.
12. The method of any of claims 1-9, wherein the oligonucleotide is at least 95% complementary over its entire length to an equal length region of a SMN-NAT nucleic acid sequence.
13. The method of any of claims 1-9, wherein the oligonucleotide is 100% complementary over its entire length to an equal length region of a SMN-NAT nucleic acid sequence.
14. The method of any one of claims 1-10, wherein the antisense compound or oligonucleotide is a single-stranded oligonucleotide.
15. The method of any one of claims 10-14, wherein the oligonucleotide is a modified oligonucleotide.
16. The method of any of claims 14-15, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
17. The method of any of claims 14-15, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
18. The method of any of claims 14-15, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
19. The method of any of claims 14-15, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 14 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
20. The method of any of claims 14-15, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 15 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
21. The method of any of claims 14-15, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 16 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
22. The method of any of claims 14-15, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 17 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
23. The method of any of claims 14-15, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 18 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
24. The method of any of claims 14-15, wherein the modified oligonucleotide has a nucleobase sequence selected from any one of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
25. The method of any of claims 15 to 24, wherein the modified oligonucleotide is a gapmer.
26. The method of any of claims 15 to 25, wherein the modified oligonucleotide consists of 20 linked nucleosides having a nucleobase sequence consisting of the sequence recited in SEQ ID NO: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76, wherein the modified oligonucleotide comprises: a gap segment consisting of linked deoxynucleosides; a 5 wing segment consisting of linked nucleosides; and a 3 wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5 wing segment and the 3 wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
27. The method of any of claims 15 to 25, wherein the modified oligonucleotide consists of 20 linked nucleosides having a nucleobase sequence consisting of the sequence recited in SEQ ID NO: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76, wherein the modified oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleosides; a 5 wing segment consisting of five linked nucleosides; and a 3 wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5 wing segment and the 3 wing segment, wherein each nucleoside of each wing segment comprises a 2-O-methoxyethyl sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.
28. The method of any of claims 15-24, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
29. The method of claim 28, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
30. The method of any of claims 15-24, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.
31. The method of claim 30, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
32. The method of any one of claims 12-31, wherein at least one nucleoside comprises a modified sugar.
33. The method of claim 32, wherein the modified sugar is a bicyclic sugar comprising a bridge between the 4 and the 2 positions of the sugar.
34. The method of claim 33, wherein the bridge is selected from 4-CH(CH.sub.3)O-2, 4-CH.sub.2-2, 4-(CH.sub.2).sub.2-2, 4-CH.sub.2O-2, 4-(CH.sub.2).sub.2O-2, 4-CH.sub.2ON(R.sub.1)-2 and 4-CH2-N(R.sub.1)O-2- wherein each R1 is, independently, H, a protecting group or C1-C12 alkyl.
35. The method of claim 34, wherein the bridge is 4-CH(CH.sub.3)O-2.
36. The method of claim 34, wherein the bridge is selected from 4-CH.sub.2O-2 and 4-(CH.sub.2).sub.2O-2.
37. The method of claim 32, wherein the modified sugar comprises a 2-O-methoxyethyl group.
38. The method of any one of claims 12-37, wherein at least one nucleoside comprises a modified nucleobase.
39. The method of any one of claims 12-37, wherein the oligonucleotide comprises a 5-methylcytosine.
40. The method of any one of claims 1-39, wherein the antisense compound or modified oligonucleotide increases expression of SMN by at least 20%.
41. The method of any one of claims 1-39, wherein the antisense compound or modified oligonucleotide increases expression of SMN by at least 30%.
42. The method of any one of claims 1-39, wherein the antisense compound or modified oligonucleotide increases expression of SMN by at least 40%.
43. The method of any one of claims 1-39, wherein the antisense compound or modified oligonucleotide increases expression of SMN by at least 50%.
44. The method of any one of claims 1-39, wherein the antisense compound or modified oligonucleotide increases expression of SMN by at least 60%.
45. The method of any one of claims 1-39, wherein the antisense compound or modified oligonucleotide increases expression of SMN by at least 70%.
46. The method of any one of claims 1-39, wherein the antisense compound or modified oligonucleotide increases expression of SMN by at least 80%.
47. The method of any one of claims 1-39, wherein the antisense compound or modified oligonucleotide increases expression of SMN by at least 90%.
48. The method of any one of claims 1-39, wherein the antisense compound or modified oligonucleotide increases expression of SMN by at least 100%.
49. The method of any one of claims 1-39, wherein the antisense compound or modified oligonucleotide increases expression of SMN by at least 110%.
50. The method of any one of claims 1-39, wherein the antisense compound or modified oligonucleotide increases expression of SMN by at least 120%.
51. The method of any of claims 1-50, wherein the cell is in a subject.
52. The method of claim 51, wherein the subject is a human.
53. The method of claim 51 or 52, wherein the subject has one or more symptoms of SMA.
54. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases 100% complementary to an equal length portion of a SMN-NAT transcript.
55. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases 100% complementary to an equal length portion of SEQ ID NO. 1.
56. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides having a nucleobase sequence comprising any one of SEQ ID NO: SEQ ID NO: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76
57. A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NO: SEQ ID NO: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76
58. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
59. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
60. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
61. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
62. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
63. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 14 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
64. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 15 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
65. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 16 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
66. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 17 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
67. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 18 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
68. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
69. A compound comprising a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76.
70. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising any one of SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76, wherein the modified oligonucleotide comprises: a gap segment consisting of linked deoxynucleosides; a 5 wing segment consisting of linked nucleosides; and a 3 wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5 wing segment and the 3 wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
71. A compound comprising a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence consisting of the sequence recited in SEQ ID NOs: 3, 7, 8, 9, 13, 17, 19, 20, 21, 22, 24, 25, 28, 31, 32, 34, 35, 39, 40, 41, 43, 44, 45, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 71, or 76, wherein the modified oligonucleotide comprises a gap segment consisting of ten linked deoxynucleosides; a 5 wing segment consisting of five linked nucleosides; and a 3 wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5 wing segment and the 3 wing segment, wherein each nucleoside of each wing segment comprises a 2-O-methoxyethyl sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.
72. A compound comprising a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence consisting of the sequence recited in SEQ ID NO: 59, wherein the modified oligonucleotide comprises a gap segment consisting of ten linked deoxynucleosides; a 5 wing segment consisting of five linked nucleosides; and a 3 wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5 wing segment and the 3 wing segment, wherein each nucleoside of each wing segment comprises a 2-O-methoxyethyl sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.
73. A compound comprising a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence consisting of the sequence recited in SEQ ID NO: 64, wherein the modified oligonucleotide comprises a gap segment consisting of ten linked deoxynucleosides; a 5 wing segment consisting of five linked nucleosides; and a 3 wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5 wing segment and the 3 wing segment, wherein each nucleoside of each wing segment comprises a 2-O-methoxyethyl sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.
74. The compound of any one of claims 54-73, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar, or at least one modified nucleobase.
75. The compound of claim 74, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
76. The compound of any one of claims 54-73, wherein each internucleoside linkage of the modified oligonucleotide comprises at least one modified internucleoside linkage.
77. The compound of claim 76, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
78. The compound of any one of claims 54-73, wherein each internucleoside linkage of the modified oligonucleotide is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.
79. The compound of claim 78, wherein the compound has six phosphodiester internucleoside linkages.
80. The compound of any of claims 74-79, wherein the modified sugar is a bicyclic sugar.
81. The compound of claim 80, wherein the bicyclic sugar is selected from the group consisting of: 4-(CH.sub.2)O-2 (LNA); 4-(CH.sub.2).sub.2O-2 (ENA); and 4-CH(CH.sub.3)O-2 (cEt).
82. The compound of any of claims 74-79, wherein the modified sugar is 2-O-methoxyethyl.
83. The compound of any one of claims 54-82, wherein the modified oligonucleotide comprises a 5-methylcytosine.
84. The compound of any one of claims 54-83, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of linked deoxynucleosides; (b) a 5 wing segment consisting of linked nucleosides; and (c) a 3 wing segment consisting of linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5 wing segment and the 3 wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
85. The compound of any one of claims 54-84, wherein the compound is single-stranded.
86. The compound of any one of claims 54-84, wherein the compound is double-stranded.
87. The compound of any one of claims 54-86, wherein the modified oligonucleotide consists of 10 to 30 linked nucleosides.
88. The compound of any one of claims 54-86, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides.
89. The compound of any one of claims 54-86, wherein the modified oligonucleotide consists of 15 to 30 linked nucleosides.
90. A composition comprising the compound of any one of claims 54-89 or salt thereof and a pharmaceutically acceptable carrier.
91. A method of reducing expression of SMN-NAT in a cell, comprising contacting a cell with the compound or composition of any of claims 54-90.
92. The method of claim 91, wherein the cell is in vitro.
93. The method of claim 91, wherein the cell is in an animal.
94. A method of increasing expression of SMN in a cell, comprising contacting a cell with the compound or composition of any of claims 54-90.
95. The method of claim 94, wherein the SMN is mRNA.
96. The method of claim 94, wherein the SMN is pre-mRNA.
97. The method of claim 94, wherein the SMN is protein.
98. The method of any of claims 95-97, wherein the SMN is SMN2.
99. The method of any of claims 94-98, wherein the cell is in vitro.
100. The method of any of claims 94-98, wherein the cell is in an animal.
Description
DETAILED DESCRIPTION
[0133] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of or means and/or unless stated otherwise. Furthermore, the use of the term including as well as other forms, such as includes and included, is not limiting. Also, terms such as element or component encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.
[0134] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.
[0135] It is understood that the sequence set forth in each SEQ ID NO described herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.
[0136] Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Certain such techniques and procedures may be found for example in Carbohydrate Modifications in Antisense Research Edited by Sangvi and Cook, American Chemical Society, Washington D.C., 1994; Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 21.sup.st edition, 2005; and Antisense Drug Technology, Principles, Strategies, and Applications Edited by Stanley T. Crooke, CRC Press, Boca Raton, Fla.; and Sambrook et al., Molecular Cloning, A laboratory Manual, 2.sup.nd Edition, Cold Spring Harbor Laboratory Press, 1989, which are hereby incorporated by reference for any purpose. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety.
[0137] Unless otherwise indicated, the following terms have the following meanings:
[0138] As used herein, SMN-NAT means a natural antisense transcript of SMN. In certain embodiments, SMN-NAT transcript comprises GenBank accession # BC045789.1 (SEQ ID NO. 1).
[0139] As used herein, Survival of Motor Neuron (SMN) means any SMN nucleic acid or protein. SMN nucleic acid means any nucleic acid encoding SMN. For example, in certain embodiments, a SMN nucleic acid includes a DNA sequence encoding SMN, an RNA sequence transcribed from DNA encoding SMN, including a non-protein encoding (i.e. non-coding) RNA sequence, and an mRNA sequence encoding SMN. SMN mRNA means an mRNA encoding a SMN protein.
[0140] As used herein, nucleoside means a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.
[0141] As used herein, chemical modification means a chemical difference in a compound when compared to a naturally occurring counterpart. In reference to an oligonucleotide, chemical modification does not include differences only in nucleobase sequence. Chemical modifications of oligonucleotides include nucleoside modifications (including sugar moiety modifications and nucleobase modifications) and internucleoside linkage modifications.
[0142] As used herein, furanosyl means a structure comprising a 5-membered ring comprising four carbon atoms and one oxygen atom.
[0143] As used herein, naturally occurring sugar moiety means a ribofuranosyl as found in naturally occurring RNA or a deoxyribofuranosyl as found in naturally occurring DNA.
[0144] As used herein, sugar moiety means a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside.
[0145] As used herein, modified sugar moiety means a substituted sugar moiety, a bicyclic or tricyclic sugar moiety, or a sugar surrogate.
[0146] As used herein, substituted sugar moiety means a furanosyl comprising at least one substituent group that differs from that of a naturally occurring sugar moiety. Substituted sugar moieties include, but are not limited to furanosyls comprising substituents at the 2-position, the 3-position, the 5-position and/or the 4-position.
[0147] As used herein, 2-substituted sugar moiety means a furanosyl comprising a substituent at the 2-position other than H or OH. Unless otherwise indicated, a 2-substituted sugar moiety is not a bicyclic sugar moiety (i.e., the 2-substituent of a 2-substituted sugar moiety does not form a bridge to another atom of the furanosyl ring.
[0148] As used herein, MOE means OCH.sub.2CH.sub.2OCH.sub.3.
[0149] As used herein, bicyclic sugar moiety means a modified sugar moiety comprising a 4 to 7 membered ring (including but not limited to a furanosyl) comprising a bridge connecting two atoms of the 4 to 7 membered ring to form a second ring, resulting in a bicyclic structure. In certain embodiments, the 4 to 7 membered ring is a sugar ring. In certain embodiments the 4 to 7 membered ring is a furanosyl. In certain such embodiments, the bridge connects the 2-carbon and the 4-carbon of the furanosyl.
[0150] As used herein the term sugar surrogate means a structure that does not comprise a furanosyl and that is capable of replacing the naturally occurring sugar moiety of a nucleoside, such that the resulting nucleoside is capable of (1) incorporation into an oligonucleotide and (2) hybridization to a complementary nucleoside. Such structures include rings comprising a different number of atoms than furanosyl (e.g., 4, 6, or 7-membered rings); replacement of the oxygen of a furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen); or both a change in the number of atoms and a replacement of the oxygen. Such structures may also comprise substitutions corresponding to those described for substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic sugar surrogates optionally comprising additional substituents). Sugar surrogates also include more complex sugar replacements (e.g., the non-ring systems of peptide nucleic acid). Sugar surrogates include without limitation morpholino, modified morpholinos, cyclohexenyls and cyclohexitols.
[0151] As used herein, nucleotide means a nucleoside further comprising a phosphate linking group. As used herein, linked nucleosides may or may not be linked by phosphate linkages and thus includes, but is not limited to linked nucleotides. As used herein, linked nucleosides are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).
[0152] As used herein, nucleobase means a group of atoms that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the group of atoms is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or may be modified.
[0153] As used herein, heterocyclic base or heterocyclic nucleobase means a nucleobase comprising a heterocyclic structure.
[0154] As used herein the terms, unmodified nucleobase or naturally occurring nucleobase means the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C), and uracil (U).
[0155] As used herein, modified nucleobase means any nucleobase that is not a naturally occurring nucleobase.
[0156] As used herein, modified nucleoside means a nucleoside comprising at least one chemical modification compared to naturally occurring RNA or DNA nucleosides. Modified nucleosides comprise a modified sugar moiety and/or a modified nucleobase.
[0157] As used herein, bicyclic nucleoside or BNA means a nucleoside comprising a bicyclic sugar moiety.
[0158] As used herein, constrained ethyl nucleoside or cEt means a nucleoside comprising a bicyclic sugar moiety comprising a 4-CH(CH.sub.3)O-2bridge.
[0159] As used herein, locked nucleic acid nucleoside or LNA means a nucleoside comprising a bicyclic sugar moiety comprising a 4-CH.sub.2O-2bridge.
[0160] As used herein, 2-substituted nucleoside means a nucleoside comprising a substituent at the 2-position other than H or OH. Unless otherwise indicated, a 2-substituted nucleoside is not a bicyclic nucleoside.
[0161] As used herein, 2-deoxynucleoside means a nucleoside comprising 2-H furanosyl sugar moiety, as found in naturally occurring deoxyribonucleosides (DNA). In certain embodiments, a 2-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (e.g., uracil).
[0162] As used herein, oligonucleotide means a compound comprising a plurality of linked nucleosides. In certain embodiments, an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and/or unmodified deoxyribonucleosides (DNA) and/or one or more modified nucleosides.
[0163] As used herein oligonucleoside means an oligonucleotide in which none of the internucleoside linkages contains a phosphorus atom. As used herein, oligonucleotides include oligonucleosides.
[0164] As used herein, modified oligonucleotide means an oligonucleotide comprising at least one modified nucleoside and/or at least one modified internucleoside linkage.
[0165] As used herein internucleoside linkage means a covalent linkage between adjacent nucleosides in an oligonucleotide.
[0166] As used herein naturally occurring internucleoside linkage means a 3 to 5 phosphodiester linkage.
[0167] As used herein, modified internucleoside linkage means any internucleoside linkage other than a naturally occurring internucleoside linkage.
[0168] As used herein, oligomeric compound means a polymeric structure comprising two or more sub-structures. In certain embodiments, an oligomeric compound comprises an oligonucleotide. In certain embodiments, an oligomeric compound comprises one or more conjugate groups and/or terminal groups. In certain embodiments, an oligomeric compound consists of an oligonucleotide.
[0169] As used herein, terminal group means one or more atom attached to either, or both, the 3 end or the 5 end of an oligonucleotide. In certain embodiments a terminal group is a conjugate group. In certain embodiments, a terminal group comprises one or more terminal group nucleosides.
[0170] As used herein, conjugate means an atom or group of atoms bound to an oligonucleotide or oligomeric compound. In general, conjugate groups modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and/or clearance properties.
[0171] As used herein, conjugate linking group means any atom or group of atoms used to attach a conjugate to an oligonucleotide or oligomeric compound.
[0172] As used herein, antisense compound means a compound comprising or consisting of an oligonucleotide at least a portion of which is complementary to a target nucleic acid to which it is capable of hybridizing, resulting in at least one antisense activity.
[0173] As used herein, antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
[0174] As used herein, detecting or measuring means that a test or assay for detecting or measuring is performed. Such detection and/or measuring may result in a value of zero. Thus, if a test for detection or measuring results in a finding of no activity (activity of zero), the step of detecting or measuring the activity has nevertheless been performed.
[0175] As used herein, detectable and/or measureable activity means a statistically significant activity that is not zero.
[0176] As used herein, essentially unchanged means little or no change in a particular parameter, particularly relative to another parameter which changes much more. In certain embodiments, a parameter is essentially unchanged when it changes less than 5%. In certain embodiments, a parameter is essentially unchanged if it changes less than two-fold while another parameter changes at least ten-fold. For example, in certain embodiments, an antisense activity is a change in the amount of a target nucleic acid. In certain such embodiments, the amount of a non-target nucleic acid is essentially unchanged if it changes much less than the target nucleic acid does, but the change need not be zero.
[0177] As used herein, expression means the process by which a gene ultimately results in a protein. Expression includes, but is not limited to, transcription, post-transcriptional modification (e.g., splicing, polyadenlyation, addition of 5-cap), and translation.
[0178] As used herein, target nucleic acid means a nucleic acid molecule to which an antisense compound hybridizes.
[0179] As used herein, mRNA means an RNA molecule that encodes a protein.
[0180] As used herein, pre-mRNA means an RNA transcript that has not been fully processed into mRNA. Pre-mRNA includes one or more intron.
[0181] As used herein, transcript means an RNA molecule transcribed from DNA. Transcripts include, but are not limited to mRNA, pre-mRNA, and partially processed RNA.
[0182] As used herein, targeting or targeted to means the association of an antisense compound to a particular target nucleic acid molecule or a particular region of a target nucleic acid molecule. An antisense compound targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions.
[0183] As used herein, nucleobase complementarity or complementarity when in reference to nucleobases means a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase means a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair. Nucleobases comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity.
[0184] As used herein, non-complementary in reference to nucleobases means a pair of nucleobases that do not form hydrogen bonds with one another.
[0185] As used herein, complementary in reference to oligomeric compounds (e.g., linked nucleosides, oligonucleotides, or nucleic acids) means the capacity of such oligomeric compounds or regions thereof to hybridize to another oligomeric compound or region thereof through nucleobase complementarity under stringent conditions. Complementary oligomeric compounds need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. In certain embodiments, complementary oligomeric compounds or regions are complementary at 70% of the nucleobases (70% complementary). In certain embodiments, complementary oligomeric compounds or regions are 80% complementary. In certain embodiments, complementary oligomeric compounds or regions are 90% complementary. In certain embodiments, complementary oligomeric compounds or regions are 95% complementary. In certain embodiments, complementary oligomeric compounds or regions are 100% complementary.
[0186] As used herein, hybridization means the pairing of complementary oligomeric compounds (e.g., an antisense compound and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
[0187] As used herein, specifically hybridizes means the ability of an oligomeric compound to hybridize to one nucleic acid site with greater affinity than it hybridizes to another nucleic acid site. In certain embodiments, an antisense oligonucleotide specifically hybridizes to more than one target site.
[0188] As used herein, percent complementarity means the percentage of nucleobases of an oligomeric compound that are complementary to an equal-length portion of a target nucleic acid. Percent complementarity is calculated by dividing the number of nucleobases of the oligomeric compound that are complementary to nucleobases at corresponding positions in the target nucleic acid by the total length of the oligomeric compound.
[0189] As used herein, percent identity means the number of nucleobases in a first nucleic acid that are the same type (independent of chemical modification) as nucleobases at corresponding positions in a second nucleic acid, divided by the total number of nucleobases in the first nucleic acid.
[0190] As used herein, modulation means a change of amount or quality of a molecule, function, or activity when compared to the amount or quality of a molecule, function, or activity prior to modulation. For example, modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression. As a further example, modulation of expression can include a change in splice site selection of pre-mRNA processing, resulting in a change in the absolute or relative amount of a particular splice-variant compared to the amount in the absence of modulation.
[0191] As used herein, motif means a pattern of chemical modifications in an oligomeric compound or a region thereof. Motifs may be defined by modifications at certain nucleosides and/or at certain linking groups of an oligomeric compound.
[0192] As used herein, nucleoside motif means a pattern of nucleoside modifications in an oligomeric compound or a region thereof. The linkages of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only nucleosides are intended to be nucleoside motifs. Thus, in such instances, the linkages are not limited.
[0193] As used herein, sugar motif means a pattern of sugar modifications in an oligomeric compound or a region thereof.
[0194] As used herein, linkage motif means a pattern of linkage modifications in an oligomeric compound or region thereof. The nucleosides of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only linkages are intended to be linkage motifs. Thus, in such instances, the nucleosides are not limited.
[0195] As used herein, nucleobase modification motif means a pattern of modifications to nucleobases along an oligonucleotide. Unless otherwise indicated, a nucleobase modification motif is independent of the nucleobase sequence.
[0196] As used herein, sequence motif means a pattern of nucleobases arranged along an oligonucleotide or portion thereof. Unless otherwise indicated, a sequence motif is independent of chemical modifications and thus may have any combination of chemical modifications, including no chemical modifications.
[0197] As used herein, type of modification in reference to a nucleoside or a nucleoside of a type means the chemical modification of a nucleoside and includes modified and unmodified nucleosides. Accordingly, unless otherwise indicated, a nucleoside having a modification of a first type may be an unmodified nucleoside.
[0198] As used herein, differently modified mean chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are differently modified, even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are differently modified, even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a 2-OMe modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2-OMe modified sugar and an unmodified thymine nucleobase are not differently modified.
[0199] As used herein, the same type of modifications refers to modifications that are the same as one another, including absence of modifications. Thus, for example, two unmodified DNA nucleoside have the same type of modification, even though the DNA nucleoside is unmodified. Such nucleosides having the same type modification may comprise different nucleobases.
[0200] As used herein, pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to an animal. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile saline. In certain embodiments, such sterile saline is pharmaceutical grade saline.
[0201] As used herein, substituent and substituent group, means an atom or group that replaces the atom or group of a named parent compound. For example a substituent of a modified nucleoside is any atom or group that differs from the atom or group found in a naturally occurring nucleoside (e.g., a modified 2-substituent is any atom or group at the 2-position of a nucleoside other than H or OH). Substituent groups can be protected or unprotected. In certain embodiments, compounds of the present invention have substituents at one or at more than one position of the parent compound. Substituents may also be further substituted with other substituent groups and may be attached directly or via a linking group such as an alkyl or hydrocarbyl group to a parent compound.
[0202] Likewise, as used herein, substituent in reference to a chemical functional group means an atom or group of atoms differs from the atom or a group of atoms normally present in the named functional group. In certain embodiments, a substituent replaces a hydrogen atom of the functional group (e.g., in certain embodiments, the substituent of a substituted methyl group is an atom or group other than hydrogen which replaces one of the hydrogen atoms of an unsubstituted methyl group). Unless otherwise indicated, groups amenable for use as substituents include without limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (C(O)R.sub.aa), carboxyl (C(O)OR.sub.aa), aliphatic groups, alicyclic groups, alkoxy, substituted oxy (OR.sub.aa), aryl, aralkyl, heterocyclic radical, heteroaryl, heteroarylalkyl, amino (N(R.sub.bb)(R.sub.cc)), imino(=NR.sub.bb), amido (C(O)N(R.sub.bb)(R.sub.cc) or N(R.sub.bb)C(O)R.sub.aa), azido (N.sub.3), nitro (NO.sub.2), cyano (CN), carbamido (OC(O)N(R.sub.bb)(R.sub.cc) or N(R.sub.bb)C(O)OR.sub.aa), ureido (N(R.sub.bb)C(O)N(R.sub.bb)(R.sub.cc)), thioureido (N(R.sub.bb)C(S)N(R.sub.bb)(R.sub.cc)), guanidinyl (N(R.sub.bb)C(NR.sub.bb)N(R.sub.bb)(R.sub.cc)), amidinyl (C(NR.sub.bb)N(R.sub.bb)(R.sub.cc) or N(R.sub.bb)C(NR.sub.bb)(R.sub.aa)), thiol (SR.sub.bb), sulfinyl (S(O)R.sub.bb), sulfonyl (S(O).sub.2R.sub.bb) and sulfonamidyl (S(O).sub.2N(R.sub.bb)(R.sub.cc) or N(R.sub.bb)S(O).sub.2R.sub.bb). Wherein each R.sub.aa, R.sub.bb and R.sub.cc is, independently, H, an optionally linked chemical functional group or a further substituent group with a preferred list including without limitation, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic and heteroarylalkyl. Selected substituents within the compounds described herein are present to a recursive degree.
[0203] As used herein, alkyl, as used herein, means a saturated straight or branched hydrocarbon radical containing up to twenty four carbon atoms. Examples of alkyl groups include without limitation, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl and the like. Alkyl groups typically include from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms (C.sub.1-C.sub.12 alkyl) with from 1 to about 6 carbon atoms being more preferred.
[0204] As used herein, alkenyl, means a straight or branched hydrocarbon chain radical containing up to twenty four carbon atoms and having at least one carbon-carbon double bond. Examples of alkenyl groups include without limitation, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene and the like. Alkenyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkenyl groups as used herein may optionally include one or more further substituent groups.
[0205] As used herein, alkynyl, means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, without limitation, ethynyl, 1-propynyl, 1-butynyl, and the like. Alkynyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkynyl groups as used herein may optionally include one or more further substituent groups.
[0206] As used herein, acyl, means a radical formed by removal of a hydroxyl group from an organic acid and has the general Formula C(O)X where X is typically aliphatic, alicyclic or aromatic. Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic phosphates and the like. Acyl groups as used herein may optionally include further substituent groups.
[0207] As used herein, alicyclic means a cyclic ring system wherein the ring is aliphatic. The ring system can comprise one or more rings wherein at least one ring is aliphatic. Preferred alicyclics include rings having from about 5 to about 9 carbon atoms in the ring. Alicyclic as used herein may optionally include further substituent groups.
[0208] As used herein, aliphatic means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms wherein the saturation between any two carbon atoms is a single, double or triple bond. An aliphatic group preferably contains from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms with from 1 to about 6 carbon atoms being more preferred. The straight or branched chain of an aliphatic group may be interrupted with one or more heteroatoms that include nitrogen, oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by heteroatoms include without limitation, polyalkoxys, such as polyalkylene glycols, polyamines, and polyimines. Aliphatic groups as used herein may optionally include further substituent groups.
[0209] As used herein, alkoxy means a radical formed between an alkyl group and an oxygen atom wherein the oxygen atom is used to attach the alkoxy group to a parent molecule. Examples of alkoxy groups include without limitation, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may optionally include further substituent groups.
[0210] As used herein, aminoalkyl means an amino substituted C.sub.1-C.sub.12 alkyl radical. The alkyl portion of the radical forms a covalent bond with a parent molecule. The amino group can be located at any position and the aminoalkyl group can be substituted with a further substituent group at the alkyl and/or amino portions.
[0211] As used herein, aralkyl and arylalkyl mean an aromatic group that is covalently linked to a C.sub.1-C.sub.12 alkyl radical. The alkyl radical portion of the resulting aralkyl (or arylalkyl) group forms a covalent bond with a parent molecule. Examples include without limitation, benzyl, phenethyl and the like. Aralkyl groups as used herein may optionally include further substituent groups attached to the alkyl, the aryl or both groups that form the radical group.
[0212] As used herein, aryl and aromatic mean a mono- or polycyclic carbocyclic ring system radicals having one or more aromatic rings. Examples of aryl groups include without limitation, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like. Preferred aryl ring systems have from about 5 to about 20 carbon atoms in one or more rings. Aryl groups as used herein may optionally include further substituent groups.
[0213] As used herein, halo and halogen, mean an atom selected from fluorine, chlorine, bromine and iodine.
[0214] As used herein, heteroaryl, and heteroaromatic, mean a radical comprising a mono- or poly-cyclic aromatic ring, ring system or fused ring system wherein at least one of the rings is aromatic and includes one or more heteroatoms. Heteroaryl is also meant to include fused ring systems including systems where one or more of the fused rings contain no heteroatoms. Heteroaryl groups typically include one ring atom selected from sulfur, nitrogen or oxygen. Examples of heteroaryl groups include without limitation, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl, quinoxalinyl and the like. Heteroaryl radicals can be attached to a parent molecule directly or through a linking moiety such as an aliphatic group or hetero atom. Heteroaryl groups as used herein may optionally include further substituent groups.
Oligomeric Compounds
[0215] In certain embodiments, the present invention provides oligomeric compounds. In certain embodiments, such oligomeric compounds comprise oligonucleotides optionally comprising one or more conjugate and/or terminal groups. In certain embodiments, an oligomeric compound consists of an oligonucleotide. In certain embodiments, oligonucleotides comprise one or more chemical modifications. Such chemical modifications include modifications one or more nucleoside (including modifications to the sugar moiety and/or the nucleobase) and/or modifications to one or more internucleoside linkage.
[0216] Certain Sugar Moieties
[0217] In certain embodiments, oligomeric compounds of the invention comprise one or more modified nucleosides comprising a modified sugar moiety. Such oligomeric compounds comprising one or more sugar-modified nucleosides may have desirable properties, such as enhanced nuclease stability or increased binding affinity with a target nucleic acid relative to oligomeric compounds comprising only nucleosides comprising naturally occurring sugar moieties. In certain embodiments, modified sugar moieties are substituted sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surogates may comprise one or more substitutions corresponding to those of substituted sugar moieties.
[0218] In certain embodiments, modified sugar moieties are substituted sugar moieties comprising one or more substituent, including but not limited to substituents at the 2 and/or 5 positions. Examples of sugar substituents suitable for the 2-position, include, but are not limited to: 2-F, 2-OCH.sub.3 (OMe or O-methyl), and 2-O(CH.sub.2).sub.2OCH.sub.3 (MOE). In certain embodiments, sugar substituents at the 2 position is selected from allyl, amino, azido, thio, O-allyl, OC.sub.1-C.sub.10 alkyl, OC.sub.1-C.sub.10 substituted alkyl; OC.sub.1-C.sub.10 alkoxy; OC.sub.1-C.sub.10 substituted alkoxy, OCF.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(Rm)(Rn), and OCH.sub.2C(O)N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted C.sub.1-C.sub.10 alkyl. Examples of sugar substituents at the 5-position, include, but are not limited to: 5-methyl (R or S); 5-vinyl, and 5-methoxy. In certain embodiments, substituted sugars comprise more than one non-bridging sugar substituent, for example, 2-F-5-methyl sugar moieties (see, e.g., PCT International Application WO 2008/101157, for additional 5, 2-bis substituted sugar moieties and nucleosides).
[0219] Nucleosides comprising 2-substituted sugar moieties are referred to as 2-substituted nucleosides. In certain embodiments, a 2-substituted nucleoside comprises a 2-substituent group selected from halo, allyl, amino, azido, OC.sub.1-C.sub.10 alkoxy; OC.sub.1-C.sub.10 substituted alkoxy, SH, CN, OCN, CF.sub.3, OCF.sub.3, O-alkyl, S-alkyl, N(R.sub.m)-alkyl; O-alkenyl, S-alkenyl, or N(R.sub.m)-alkenyl; O-alkynyl, S-alkynyl, N(R.sub.m)-alkynyl; O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n) or OCH.sub.2C(O)N(R.sub.m)(R.sub.n), where each R.sub.m and R.sub.n is, independently, H, an amino protecting group or substituted or unsubstituted C.sub.1-C.sub.10 alkyl. These 2-substituent groups can be further substituted with one or more substituent groups independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol, thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and alkynyl.
[0220] In certain embodiments, a 2-substituted nucleoside comprises a 2-substituent group selected from F, NH.sub.2, N.sub.3, OCF.sub.3, OCH.sub.3, O(CH.sub.2).sub.3NH.sub.2, CH.sub.2CHCH.sub.2, OCH.sub.2CHCH.sub.2, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n), O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and N-substituted acetamide (OCH.sub.2C(O)N(R.sub.m)(R.sub.n) where each R.sub.m and R.sub.n is, independently, H, an amino protecting group or substituted or unsubstituted C.sub.1-C.sub.10 alkyl.
[0221] In certain embodiments, a 2-substituted nucleoside comprises a sugar moiety comprising a 2-substituent group selected from F, OCF.sub.3, OCH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(CH.sub.3).sub.2, O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and OCH.sub.2C(O)N(H)CH.sub.3.
[0222] In certain embodiments, a 2-substituted nucleoside comprises a sugar moiety comprising a 2-substituent group selected from F, OCH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.
[0223] Certain modified sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4 and the 2 furanose ring atoms. Examples of such 4 to 2 sugar substituents, include, but are not limited to: [C(R.sub.a)(R.sub.b)].sub.n, [C(R.sub.a)(R.sub.b)].sub.nO, C(R.sub.aR.sub.b)N(R)O or, C(R.sub.aR.sub.b)ON(R); 4-CH.sub.2-2, 4-(CH.sub.2).sub.2-2, 4-(CH.sub.2).sub.3-2, 4-(CH.sub.2)O-2 (LNA); 4-(CH.sub.2)S-2; 4-(CH.sub.2).sub.2O-2 (ENA); 4-CH(CH.sub.3)O-2 (cEt) and 4-CH(CH.sub.2OCH.sub.3)O-2, and analogs thereof (see, e.g., U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008); 4-C(CH.sub.3)(CH.sub.3)O-2 and analogs thereof, (see, e.g., WO2009/006478, published Jan. 8, 2009); 4-CH.sub.2N(OCH.sub.3)-2 and analogs thereof (see, e.g., WO2008/150729, published Dec. 11, 2008); 4-CH.sub.2ON(CH.sub.3)-2 (see, e.g., US2004/0171570, published Sep. 2, 2004); 4-CH.sub.2ON(R)-2, and 4-CH.sub.2N(R)O-2-, wherein each R is, independently, H, a protecting group, or C.sub.1-C.sub.12 alkyl; 4-CH.sub.2N(R)O-2, wherein R is H, C.sub.1-C.sub.12 alkyl, or a protecting group (see, U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); 4-CH.sub.2C(H)(CH.sub.3)-2 (see, e.g., Chattopadhyaya, et al., J. Org. Chem., 2009, 74, 118-134); and 4-CH.sub.2C(CH.sub.2)-2 and analogs thereof (see, published PCT International Application WO 2008/154401, published on Dec. 8, 2008).
[0224] In certain embodiments, such 4 to 2 bridges independently comprise from 1 to 4 linked groups independently selected from [C(R.sub.a)(R.sub.b)].sub.n, C(R.sub.a)C(R.sub.b), C(R.sub.a)N, C(NR.sub.a), C(O), C(S), O, Si(R.sub.a).sub.2, S(O).sub.x, and N(R.sub.a);
[0225] wherein:
[0226] x is 0, 1, or 2;
[0227] n is 1, 2, 3, or 4;
[0228] each R.sub.a and R.sub.b is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(O)H), substituted acyl, CN, sulfonyl (S(O).sub.2-J.sub.1), or sulfoxyl (S(O)-J.sub.1); and
[0229] each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(O)H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.
[0230] Nucleosides comprising bicyclic sugar moieties are referred to as bicyclic nucleosides or BNAs. Bicyclic nucleosides include, but are not limited to, (A) -L-Methyleneoxy (4-CH.sub.2O-2) BNA, (B) -D-Methyleneoxy (4-CH.sub.2O-2) BNA (also referred to as locked nucleic acid or LNA), (C) Ethyleneoxy (4-(CH.sub.2).sub.2O-2) BNA, (D) Aminooxy (4-CH.sub.2ON(R)-2) BNA, (E) Oxyamino (4-CH.sub.2N(R)O-2) BNA, (F) Methyl(methyleneoxy) (4-CH(CH.sub.3)O-2) BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4-CH.sub.2S-2) BNA, (H) methylene-amino (4-CH2-N(R)-2) BNA, (I) methyl carbocyclic (4-CH.sub.2CH(CH.sub.3)-2) BNA, and (J) propylene carbocyclic (4-(CH.sub.2).sub.3-2) BNA as depicted below.
##STR00001## ##STR00002##
wherein Bx is a nucleobase moiety and R is, independently, H, a protecting group, or C.sub.1-C.sub.12 alkyl.
[0231] Additional bicyclic sugar moieties are known in the art, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U S. A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Pat. Nos. 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133, 6,525,191, 6,670,461, and 7,399,845; WO 2004/106356, WO 1994/14226, WO 2005/021570, and WO 2007/134181; U.S. Patent Publication Nos. US2004/0171570, US2007/0287831, and US2008/0039618; U.S. patent Ser. Nos. 12/129,154, 60/989,574, 61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and 61/099,844; and PCT International Applications Nos. PCT/US2008/064591, PCT/US2008/066154, and PCT/US2008/068922.
[0232] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, a nucleoside comprising a 4-2 methylene-oxy bridge, may be in the -L configuration or in the -D configuration. Previously, -L-methyleneoxy (4-CH.sub.2O-2) bicyclic nucleosides have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).
[0233] In certain embodiments, substituted sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5-substituted and 4-2 bridged sugars). (see, PCT International Application WO 2007/134181, published on Nov. 22, 2007, wherein LNA is substituted with, for example, a 5-methyl or a 5-vinyl group).
[0234] In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the naturally occurring sugar is substituted, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moiety also comprises bridging and/or non-bridging substituents as described above. For example, certain sugar surogates comprise a 4-sulfur atom and a substitution at the 2-position (see, e.g., published U.S. Patent Application US2005/0130923, published on Jun. 16, 2005) and/or the 5 position. By way of additional example, carbocyclic bicyclic nucleosides having a 4-2 bridge have been described (see, e.g., Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740).
[0235] In certain embodiments, sugar surrogates comprise rings having other than 5-atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, C J. Bioorg. & Med. Chem. (2002) 10:841-854), fluoro HNA (F-HNA), and those compounds having Formula VII:
##STR00003##
wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula VII:
[0236] Bx is a nucleobase moiety;
[0237] T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5 or 3-terminal group; q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each, independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted C.sub.2-C.sub.6 alkynyl; and
[0238] each of R.sub.1 and R.sub.2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(X)J.sub.1, OC(X)NJ.sub.1J.sub.2, NJ.sub.3C(X)NJ.sub.1J.sub.2, and CN, wherein X is O, S or NJ.sub.1, and each J.sub.1, J.sub.2, and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.
[0239] In certain embodiments, the modified THP nucleosides of Formula VII are provided wherein q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of R.sub.1 and R.sub.2 is F. In certain embodiments, R.sub.1 is fluoro and R.sub.2 is H, R.sub.1 is methoxy and R.sub.2 is H, and R.sub.1 is methoxyethoxy and R.sub.2 is H.
[0240] Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used to modify nucleosides (see, e.g., review article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002, 10, 841-854).
[0241] In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Pat. Nos. 5,698,685; 5,166,315; 5,185,444; and 5,034,506). As used here, the term morpholino means a sugar surrogate having the following structure:
##STR00004##
In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as modified morpholinos.
[0242] Combinations of modifications are also provided without limitation, such as 2-F-5-methyl substituted nucleosides (see PCT International Application WO 2008/101157 Published on Aug. 21, 2008 for other disclosed 5, 2-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007/134181, published on Nov. 22, 2007 wherein a 4-CH.sub.2O-2 bicyclic nucleoside is further substituted at the 5 position with a 5-methyl or a 5-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).
[0243] Certain Nucleobases
[0244] In certain embodiments, nucleosides of the present invention comprise one or more unmodified nucleobases. In certain embodiments, nucleosides of the present invention comprise one or more modified nucleobases.
[0245] In certain embodiments, modified nucleobases are selected from: universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyl-adenine, 5-propynyluracil; 5-propynylcytosine; 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (CCCH.sub.3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, 3-deazaguanine and 3-deazaadenine, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine([5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3,2:4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288.
[0246] Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, U.S. Pat. Nos. 3,687,808; 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,645,985; 5,681,941; 5,750,692; 5,763,588; 5,830,653 and 6,005,096, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
[0247] Certain Internucleoside Linkages
[0248] In certain embodiments, the present invention provides oligomeric compounds comprising linked nucleosides. In such embodiments, nucleosides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters (PO), phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates (PS). Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (CH.sub.2N(CH.sub.3)OCH.sub.2), thiodiester (OC(O)S), thionocarbamate (OC(O)(NH)S); siloxane (OSi(H).sub.2O); and N,N-dimethylhydrazine (CH.sub.2N(CH.sub.3)N(CH.sub.3)). Modified linkages, compared to natural phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligomeric compound. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.
[0249] The oligonucleotides described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), or such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the antisense compounds provided herein are all such possible isomers, as well as their racemic and optically pure forms.
[0250] Neutral internucleoside linkages include without limitation, phosphotriesters, methylphosphonates, MMI (3-CH.sub.2N(CH.sub.3)O-5), amide-3 (3-CH.sub.2C(O)N(H)-5), amide-4 (3-CH.sub.2N(H)C(O)-5), formacetal (3-OCH.sub.2O-5), and thioformacetal (3-SCH.sub.2O-5). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH.sub.2 component parts.
[0251] Certain Motifs
[0252] In certain embodiments, the present invention provides oligomeric compounds comprising oligonucleotides. In certain embodiments, such oligonucleotides comprise one or more chemical modification. In certain embodiments, chemically modified oligonucleotides comprise one or more modified nucleosides. In certain embodiments, chemically modified oligonucleotides comprise one or more modified nucleosides comprising modified sugars. In certain embodiments, chemically modified oligonucleotides comprise one or more modified nucleosides comprising one or more modified nucleobases. In certain embodiments, chemically modified oligonucleotides comprise one or more modified internucleoside linkages. In certain embodiments, the chemically modifications (sugar modifications, nucleobase modifications, and/or linkage modifications) define a pattern or motif. In certain embodiments, the patterns of chemical modifications of sugar moieties, internucleoside linkages, and nucleobases are each independent of one another. Thus, an oligonucleotide may be described by its sugar modification motif, internucleoside linkage motif and/or nucleobase modification motif (as used herein, nucleobase modification motif describes the chemical modifications to the nucleobases independent of the sequence of nucleobases).
[0253] Certain Sugar Motifs
[0254] In certain embodiments, oligonucleotides comprise one or more type of modified sugar moieties and/or naturally occurring sugar moieties arranged along an oligonucleotide or region thereof in a defined pattern or sugar modification motif. Such motifs may include any of the sugar modifications discussed herein and/or other known sugar modifications.
[0255] In certain embodiments, the oligonucleotides comprise or consist of a region having a gapmer sugar modification motif, which comprises two external regions or wings and an internal region or gap. The three regions of a gapmer motif (the 5-wing, the gap, and the 3-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3-most nucleoside of the 5-wing and the 5-most nucleoside of the 3-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap. In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar modification motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar modification motifs of the 5-wing differs from the sugar modification motif of the 3-wing (asymmetric gapmer). In certain embodiments, oligonucleotides comprise 2-MOE modified nucleosides in the wings and 2-F modified nucleosides in the gap.
[0256] In certain embodiments, oligonucleotides are fully modified. In certain such embodiments, oligonucleotides are uniformly modified. In certain embodiments, oligonucleotides are uniform 2-MOE. In certain embodiments, oligonucleotides are uniform 2-F. In certain embodiments, oligonucleotides are uniform morpholino. In certain embodiments, oligonucleotides are uniform BNA. In certain embodiments, oligonucleotides are uniform LNA. In certain embodiments, oligonucleotides are uniform cEt.
[0257] In certain embodiments, oligonucleotides comprise a uniformly modified region and additional nucleosides that are unmodified or differently modified. In certain embodiments, the uniformly modified region is at least 5, 10, 15, or 20 nucleosides in length. In certain embodiments, the uniform region is a 2-MOE region. In certain embodiments, the uniform region is a 2-F region. In certain embodiments, the uniform region is a morpholino region. In certain embodiments, the uniform region is a BNA region. In certain embodiments, the uniform region is a LNA region. In certain embodiments, the uniform region is a cEt region.
[0258] In certain embodiments, the oligonucleotide does not comprise more than 4 contiguous unmodified 2-deoxynucleosides. In certain circumstances, antisesense oligonucleotides comprising more than 4 contiguous 2-deoxynucleosides activate RNase H, resulting in cleavage of the target RNA. In certain embodiments, such cleavage is avoided by not having more than 4 contiguous 2-deoxynucleosides, for example, where alteration of splicing and not cleavage of a target RNA is desired.
[0259] Certain Internucleoside Linkage Motifs
[0260] In certain embodiments, oligonucleotides comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif. In certain embodiments, internucleoside linkages are arranged in a gapped motif, as described above for sugar modification motif. In such embodiments, the internucleoside linkages in each of two wing regions are different from the internucleoside linkages in the gap region. In certain embodiments the internucleoside linkages in the wings are phosphodiester and the internucleoside linkages in the gap are phosphorothioate. The sugar modification motif is independently selected, so such oligonucleotides having a gapped internucleoside linkage motif may or may not have a gapped sugar modification motif and if it does have a gapped sugar motif, the wing and gap lengths may or may not be the same.
[0261] In certain embodiments, oligonucleotides comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligonucleotides of the present invention comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.
[0262] In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3 end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3 end of the oligonucleotide.
[0263] Certain Nucleobase Modification Motifs
[0264] In certain embodiments, oligonucleotides comprise chemical modifications to nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or nucleobases modification motif. In certain such embodiments, nucleobase modifications are arranged in a gapped motif. In certain embodiments, nucleobase modifications are arranged in an alternating motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is chemically modified.
[0265] In certain embodiments, oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3-end of the oligonucleotide. In certain embodiments the block is within 3 nucleotides of the 3-end of the oligonucleotide. In certain such embodiments, the block is at the 5-end of the oligonucleotide. In certain embodiments the block is within 3 nucleotides of the 5-end of the oligonucleotide.
[0266] In certain embodiments, nucleobase modifications are a function of the natural base at a particular position of an oligonucleotide. For example, in certain embodiments each purine or each pyrimidine in an oligonucleotide is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each cytosine is modified. In certain embodiments, each uracil is modified.
[0267] In certain embodiments, some, all, or none of the cytosine moieties in an oligonucleotide are 5-methyl cytosine moieties. Herein, 5-methyl cytosine is not a modified nucleobase. Accordingly, unless otherwise indicated, unmodified nucleobases include both cytosine residues having a 5-methyl and those lacking a 5 methyl. In certain embodiments, the methylation state of all or some cytosine nucleobases is specified.
[0268] Certain Overall Lengths
[0269] In certain embodiments, the present invention provides oligomeric compounds including oligonucleotides of any of a variety of ranges of lengths. In certain embodiments, the invention provides oligomeric compounds or oligonucleotides consisting of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that XY. For example, in certain embodiments, the invention provides oligomeric compounds which comprise oligonucleotides consisting of 8 to 9, 8 to 10, 8 to 11, 8 to 12, 8 to 13, 8 to 14, 8 to 15, 8 to 16, 8 to 17, 8 to 18, 8 to 19, 8 to 20, 8 to 21, 8 to 22, 8 to 23, 8 to 24, 8 to 25, 8 to 26, 8 to 27, 8 to 28, 8 to 29, 8 to 30, 9 to 10, 9 to 11, 9 to 12, 9 to 13, 9 to 14, 9 to 15, 9 to 16, 9 to 17, 9 to 18, 9 to 19, 9 to 20, 9 to 21, 9 to 22, 9 to 23, 9 to 24, 9 to 25, 9 to 26, 9 to 27, 9 to 28, 9 to 29, 9 to 30, 10 to 11, 10 to 12, 10 to 13, 10 to 14, 10 to 15, 10 to 16, 10 to 17, 10 to 18, 10 to 19, 10 to 20, 10 to 21, 10 to 22, 10 to 23, 10 to 24, 10 to 25, 10 to 26, 10 to 27, 10 to 28, 10 to 29, 10 to 30, 11 to 12, 11 to 13, 11 to 14, 11 to 15, 11 to 16, 11 to 17, 11 to 18, 11 to 19, 11 to 20, 11 to 21, 11 to 22, 11 to 23, 11 to 24, 11 to 25, 11 to 26, 11 to 27, 11 to 28, 11 to 29, 11 to 30, 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides. In embodiments where the number of nucleosides of an oligomeric compound or oligonucleotide is limited, whether to a range or to a specific number, the oligomeric compound or oligonucleotide may, nonetheless further comprise additional other substituents. For example, an oligonucleotide comprising 8-30 nucleosides excludes oligonucleotides having 31 nucleosides, but, unless otherwise indicated, such an oligonucleotide may further comprise, for example one or more conjugates, terminal groups, or other substituents. In certain embodiments, a gapmer oligonucleotide has any of the above lengths.
[0270] One of skill in the art will appreciate that certain lengths may not be possible for certain motifs. For example: a gapmer having a 5-wing region consisting of four nucleotides, a gap consisting of at least six nucleotides, and a 3-wing region consisting of three nucleotides cannot have an overall length less than 13 nucleotides. Thus, one would understand that the lower length limit is 13 and that the limit of 10 in 10-20 has no effect in that embodiment.
[0271] Further, where an oligonucleotide is described by an overall length range and by regions having specified lengths, and where the sum of specified lengths of the regions is less than the upper limit of the overall length range, the oligonucleotide may have additional nucleosides, beyond those of the specified regions, provided that the total number of nucleosides does not exceed the upper limit of the overall length range. For example, an oligonucleotide consisting of 20-25 linked nucleosides comprising a 5-wing consisting of 5 linked nucleosides; a 3-wing consisting of 5 linked nucleosides and a central gap consisting of 10 linked nucleosides (5+5+10=20) may have up to 5 nucleosides that are not part of the 5-wing, the 3-wing, or the gap (before reaching the overall length limitation of 25). Such additional nucleosides may be 5 of the 5-wing and/or 3 of the 3 wing.
[0272] Certain Oligonucleotides
[0273] In certain embodiments, oligonucleotides of the present invention are characterized by their sugar motif, internucleoside linkage motif, nucleobase modification motif and overall length. In certain embodiments, such parameters are each independent of one another. Thus, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. Thus, the internucleoside linkages within the wing regions of a sugar-gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region. Likewise, such sugar-gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Herein if a description of an oligonucleotide or oligomeric compound is silent with respect to one or more parameter, such parameter is not limited. Thus, an oligomeric compound described only as having a gapmer sugar motif without further description may have any length, internucleoside linkage motif, and nucleobase modification motif. Unless otherwise indicated, all chemical modifications are independent of nucleobase sequence.
[0274] Certain Conjugate Groups
[0275] In certain embodiments, oligomeric compounds are modified by attachment of one or more conjugate groups. In general, conjugate groups modify one or more properties of the attached oligomeric compound including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, charge and clearance. Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional conjugate linking moiety or conjugate linking group to a parent compound such as an oligomeric compound, such as an oligonucleotide. Conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes. Certain conjugate groups have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
[0276] In certain embodiments, a conjugate group comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
[0277] In certain embodiments, conjugate groups are directly attached to oligonucleotides in oligomeric compounds. In certain embodiments, conjugate groups are attached to oligonucleotides by a conjugate linking group. In certain such embodiments, conjugate linking groups, including, but not limited to, bifunctional linking moieties such as those known in the art are amenable to the compounds provided herein. Conjugate linking groups are useful for attachment of conjugate groups, such as chemical stabilizing groups, functional groups, reporter groups and other groups to selective sites in a parent compound such as for example an oligomeric compound. In general a bifunctional linking moiety comprises a hydrocarbyl moiety having two functional groups. One of the functional groups is selected to bind to a parent molecule or compound of interest and the other is selected to bind essentially any selected group such as chemical functional group or a conjugate group. In some embodiments, the conjugate linker comprises a chain structure or an oligomer of repeating units such as ethylene glycol or amino acid units. Examples of functional groups that are routinely used in a bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In some embodiments, bifunctional linking moieties include amino, hydroxyl, carboxylic acid, thiol, unsaturations (e.g., double or triple bonds), and the like.
[0278] Some nonlimiting examples of conjugate linking moieties include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other linking groups include, but are not limited to, substituted C.sub.1-C.sub.10 alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
[0279] Conjugate groups may be attached to either or both ends of an oligonucleotide (terminal conjugate groups) and/or at any internal position.
[0280] In certain embodiments, conjugate groups are at the 3-end of an oligonucleotide of an oligomeric compound. In certain embodiments, conjugate groups are near the 3-end. In certain embodiments, conjugates are attached at the 3end of an oligomeric compound, but before one or more terminal group nucleosides. In certain embodiments, conjugate groups are placed within a terminal group. In certain embodiments, the present invention provides oligomeric compounds. In certain embodiments, oligomeric compounds comprise an oligonucleotide. In certain embodiments, an oligomeric compound comprises an oligonucleotide and one or more conjugate and/or terminal groups. Such conjugate and/or terminal groups may be added to oligonucleotides having any of the chemical motifs discussed above. Thus, for example, an oligomeric compound comprising an oligonucleotide having region of alternating nucleosides may comprise a terminal group.
Antisense Compounds
[0281] In certain embodiments, oligomeric compounds of the present invention are antisense compounds. Such antisense compounds are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, antisense compounds specifically hybridize to one or more target nucleic acid. In certain embodiments, a specifically hybridizing antisense compound has a nucleobase sequence comprising a region having sufficient complementarity to a target nucleic acid to allow hybridization and result in antisense activity and insufficient complementarity to any non-target so as to avoid non-specific hybridization to any non-target nucleic acid sequences under conditions in which specific hybridization is desired (e.g., under physiological conditions for in vivo or therapeutic uses, and under conditions in which assays are performed in the case of in vitro assays).
[0282] In certain embodiments, the present invention provides antisense compounds comprising oligonucleotides that are fully complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are 95% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 90% complementary to the target nucleic acid.
[0283] In certain embodiments, such oligonucleotides are 85% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 80% complementary to the target nucleic acid. In certain embodiments, an antisense compound comprises a region that is fully complementary to a target nucleic acid and is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain such embodiments, the region of full complementarity is from 6 to 14 nucleobases in length.
[0284] In certain embodiments antisense compounds and antisense oligonucleotides comprise single-strand compounds. In certain embodiments antisense compounds and antisense oligonucleotides comprise double-strand compounds.
[0285] Certain Target Nucleic Acids and Mechanisms
[0286] In certain embodiments, antisense compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid is a long non-coding RNA. In certain embodiments, the target nucleic acid is a SMN-NAT transcript. In certain embodiments, the target RNA has the sequence set forth in SEQ ID NO. 1.
[0287] In certain embodiments, natural antisense transcripts (NATs) are RNA transcripts encoded within a cell that have transcript complementarity to other RNA transcripts. In certain embodiments, natural antisense transcripts may play one or more roles in regulating expression of complementary RNA transcripts. For example, in certain embodiments, a natural antisense transcripts may serve to partially silence the expression of its complementary RNA transcript. Therefore, reducing the expression of certain natural antisense transcripts may increase expression of certain complementary RNA transcripts.
[0288] SMA is caused by the loss of both copies of survival motor neuron gene 1 (SMN1), which may also be known as SMN Telomeric, a protein that is part of a multi-protein complex thought to be involved in snRNP biogenesis and recycling. A nearly identical gene, SMN2, which may also be known as SMN Centromeric, exists in a duplicated region on chromosome 5q13 and modulates disease severity. Although SMN1 and SMN2 have the potential to code for the same protein, SMN2 contains a translationally silent mutation at position +6 of exon 7, which results in inefficient inclusion of exon 7 in SMN2 transcripts. In certain embodiments, a natural antisense transcript to SMN exists (e.g. SMN-NAT), and SMN-NAT is complementary to both SMN1 and SMN2. Therefore, in certain embodiments, SMN-NAT reduces expression of SMN1 and SMN2.
[0289] In instances where loss of SMN1 has occurred, SMN-NAT will reduce expression of SMN2, which may exacerbate symptoms associated with Spinal Muscular Atrophy. As discussed above, the severity of Spinal Muscular Atrophy correlates to the amount of function SMN protein produced by SMN2. Therefore, in certain embodiments, it is desirable to increase expression of SMN2. Although SMN2 contains a translationally silent mutation at position +6 of exon 7, which results in inefficient inclusion of exon 7 in SMN2 transcripts, the SMN2 gene will produce copies of functional SMN (e.g. SMN mRNA containing exon 7, which are then translated into full-length SMN protein). In certain embodiments, increased expression of SMN2 results in increased amounts of functional SMN protein containing amino acids encoded by exon 7. In certain embodiments, reduction of SMN-NAT increases expression of SMN2 and increases the amount of functional SMN protein.
[0290] Certain embodiments disclosed herein are drawn to a method of inducing expression of SMN in a cell comprising contacting the cell with an antisense compound targeted to SMN-NAT. In several aspects, SMN-NAT comprises a nucleic acid sequence at least 85% identical to SEQ ID NO:1.
Certain Pharmaceutical Compositions
[0291] In certain embodiments, the present invention provides pharmaceutical compositions comprising one or more antisense compound. In certain embodiments, such pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more antisense compound. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more antisense compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more antisense compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one or more antisense compound and sterile water. In certain embodiments, the sterile saline is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more antisense compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more antisense compound and sterile phosphate-buffered saline (PBS). In certain embodiments, the sterile saline is pharmaceutical grade PBS.
[0292] In certain embodiments, antisense compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
[0293] Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising antisense compounds comprise one or more oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
[0294] A prodrug can include the incorporation of additional nucleosides at one or both ends of an oligomeric compound which are cleaved by endogenous nucleases within the body, to form the active antisense oligomeric compound.
[0295] Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
[0296] In certain embodiments, pharmaceutical compositions provided herein comprise one or more modified oligonucleotides and one or more excipients. In certain such embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
[0297] In certain embodiments, a pharmaceutical composition provided herein comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.
[0298] In certain embodiments, a pharmaceutical composition provided herein comprises one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
[0299] In certain embodiments, a pharmaceutical composition provided herein comprises a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80 and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
[0300] In certain embodiments, a pharmaceutical composition provided herein is prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration.
[0301] In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, such suspensions may also contain suitable stabilizers or agents that increase the solubility of the pharmaceutical agents to allow for the preparation of highly concentrated solutions.
[0302] In certain embodiments, a pharmaceutical composition is prepared for transmucosal administration. In certain of such embodiments penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
[0303] In certain embodiments, a pharmaceutical composition provided herein comprises an oligonucleotide in a therapeutically effective amount. In certain embodiments, the therapeutically effective amount is sufficient to prevent, alleviate or ameliorate symptoms of a disease or to prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art.
[0304] In certain embodiments, one or more modified oligonucleotide provided herein is formulated as a prodrug. In certain embodiments, upon in vivo administration, a prodrug is chemically converted to the biologically, pharmaceutically or therapeutically more active form of an oligonucleotide. In certain embodiments, prodrugs are useful because they are easier to administer than the corresponding active form. For example, in certain instances, a prodrug may be more bioavailable (e.g., through oral administration) than is the corresponding active form. In certain instances, a prodrug may have improved solubility compared to the corresponding active form. In certain embodiments, prodrugs are less water soluble than the corresponding active form. In certain instances, such prodrugs possess superior transmittal across cell membranes, where water solubility is detrimental to mobility. In certain embodiments, a prodrug is an ester. In certain such embodiments, the ester is metabolically hydrolyzed to carboxylic acid upon administration. In certain instances the carboxylic acid containing compound is the corresponding active form. In certain embodiments, a prodrug comprises a short peptide (polyaminoacid) bound to an acid group. In certain of such embodiments, the peptide is cleaved upon administration to form the corresponding active form.
[0305] In certain embodiments, the present invention provides compositions and methods for reducing the amount or activity of a target nucleic acid in a cell. In certain embodiments, the cell is in an animal. In certain embodiments, the animal is a mammal. In certain embodiments, the animal is a rodent. In certain embodiments, the animal is a primate. In certain embodiments, the animal is a non-human primate. In certain embodiments, the animal is a human.
[0306] In certain embodiments, the present invention provides methods of administering a pharmaceutical composition comprising an oligomeric compound of the present invention to an animal. Suitable administration routes include, but are not limited to, oral, rectal, transmucosal, intestinal, enteral, topical, suppository, through inhalation, intrathecal, intracerebroventricular, intraperitoneal, intranasal, intraocular, intratumoral, and parenteral (e.g., intravenous, intramuscular, intramedullary, and subcutaneous). In certain embodiments, pharmaceutical intrathecals are administered to achieve local rather than systemic exposures. For example, pharmaceutical compositions may be injected directly in the area of desired effect (e.g., into the eyes, ears).
Nonlimiting Disclosure and Incorporation by Reference
[0307] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited herein is hereby incorporated by reference in its entirety.
[0308] Although the sequence listing accompanying this filing identifies each sequence as either RNA or DNA as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as RNA or DNA to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2-OH for the natural 2-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) for natural uracil of RNA).
[0309] Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence ATCGATCG encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence AUCGAUCG and those having some DNA bases and some RNA bases such as AUCGATCG and oligomeric compounds having other unmodified bases, such as AT.sup.meCGAUCG, wherein .sup.meC indicates a cytosine base comprising a methyl group at the 5-position.
EXAMPLES
[0310] The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.
Example 1: Effect of Antisense Oligonucleotides Targeting SMN-NAT
[0311] Antisense oligonucleotides were designed targeting the SMN-NAT sequence, described herein as SEQ ID NO: 1 (GenBank accession # BC045789.1) and were tested for their effects on reducing the expression of SMN-NAT in HEK293T cells. As shown in Table 1, antisense oligonucleotides are effective at reducing expression of SMN-NAT.
[0312] The newly designed antisense oligonucleotides in Table 1 were designed as 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2-deoxynucleosides and is flanked by wing segments on the 5 direction and the 3 direction comprising five nucleosides each. Each nucleoside in the 5 wing segment and each nucleoside in the 3 wing segment has a 2-MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (PS) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.
TABLE-US-00001 TABLE1 AntisenseoligonucleotidestargetedtoSMN-NAT % Start Stop Reduction Site Site SEQ ofSMN- Seq Seq ID IsisNo Sequence NAT ID:1 ID:1 NO. 658741 GTACTACACTTTTAATTACT 0.00 1 20 2 658742 TGTATATTGATGTCAGTACT 9.81 16 35 3 658743 TACATTGTCTATTAGTGTAT 0.00 31 50 4 658744 TGACTCTCAATTCTGTTACA 0.00 47 66 5 658745 TCACAGGGCTATTTCTGACT 0.00 62 81 6 658746 AATCAGTCACATATATCACA 70.85 77 96 7 658747 TGTAACTTTAGTTAAAATCA 60.93 92 111 8 658748 CTATTAAACCACATTTGTAA 32.31 107 126 9 658749 ACTACTATGCTTTCTCTATT 0.00 122 141 10 658750 CCACCATTTCTTGAAACTAC 0.00 137 156 11 658751 TTTCCAATAGTTTTACCACC 0.00 152 171 12 658752 GTTTTTGCATAAGGATTTCC 26.89 167 186 13 658753 GTGGAAATTTGGTTTGTTTT 0.00 182 201 14 658754 TGTGGCTCAGTGTAGGTGGA 0.00 197 216 15 658755 GTATTAATTCTTATATGTGG 0.00 212 231 16 658756 TTAGTTTTACACTTAGGTCT 11.16 244 263 17 658757 ACACAGTTTAGAGTTTTAGT 0.00 259 278 18 658758 GATCACAGATTTTTCTCTCT 38.43 290 309 19 658759 TTATAGGCAATCCATGATCA 20.70 305 324 20 658760 CATTTCAGTTTGTTCTTTTG 53.97 325 344 21 658761 CCCAGGCAACAAGGCCATTT 16.58 340 359 22 658762 GAACCTCGGGTGCCACCCCA 0.00 356 375 23 658763 CGTCCTTGATTTCCTCAGCG 25.83 385 404 24 658764 ACACCCTTGGTGTGTCAGCG 35.68 403 422 25 658765 TTCTGCTCTAGCCTCACACC 0.00 418 437 26 658766 GGAGAGAGCTAGTCTCTTTC 0.00 453 472 27 658767 AGGACCTCTCTCTGCAGGAG 74.78 469 488 28 658768 ATGGGAACTCTTTTCAGGAC 0.00 484 503 29 658769 GCATTTCACTGTGGAATGGG 0.00 499 518 30 658770 TTTATAAAAATGCTTGCATT 81.60 514 533 31 658771 CTTCCCATTAGCTCATTTAT 68.30 529 548 32 658772 TAGATAAGCTACCCCCTTCC 0.00 544 563 33 658773 TTTGCTCCCTATGTGTAGAT 34.09 559 578 34 658774 GGTCCTAACTGGTTTTTTGC 55.30 574 593 35 658775 CAGATGGCAACACCTGGTCC 0.00 589 608 36 658776 GATTCACGCTCTGTGCAGAT 0.00 604 623 37 658777 GCCTGCATAATAAAAGGTTG 0.00 641 660 38 658778 TCAGGCCAAGGACCTGCCTG 73.05 656 675 39 658779 TAAGCAATGTGGAGTAGCTC 45.19 674 693 40 658780 ACAATAGGAAAGAGATAAGC 46.19 689 708 41 658781 TTATTTAGCACATGCACAAT 0.00 704 723 42 658782 TGGCTCCACCTCCCCTTATT 4.82 719 738 43 658783 GCATGTCCACCATGGTGGCT 92.56 734 753 44 658784 AGCTGCACGGAGAGAAAGGG 47.38 768 787 45 658785 GCATGTTGTGAGTTGTTGGG 0.00 797 816 46 658786 TCAGATAAGGAAGCTGGAAG 0.00 820 839 47 658787 GACCTTAGTACATACTCAGA 0.00 835 854 48 658788 GAAGTAAACACAGTGGACCT 0.00 850 869 49 658789 GTATGTGAAGTAAACACAGT 0.00 856 875 50 874 893 658790 GTAAACACAGTATGTGAAGT 56.26 865 884 51 658791 AGGTGGGTATGTGAAGTAAA 0.00 880 899 52 658792 ATCAGCAAGCTTCACATACG 20.31 902 921 53 658793 GGAGCTTCCTGGGTAATCAG 0.00 917 936 54 658794 AGCAGCTCTGGCACAGAGGG 0.00 937 956 55 658795 AAACATGTATAAGGAAGCAG 52.59 952 971 56 658796 GGAAGATCGGGCTGTAAACA 54.20 967 986 57 658797 ACTTCTCTTCTAACAAGGAG 73.05 993 1012 58 658798 CAGAGTCCTCGGTAGAACTT 91.02 1043 1062 59 658799 AAGCCGATAGTTAGACAGAG 0.00 1058 1077 60 658800 AAAAAAAGACTAGGTAAGCC 0.00 1073 1092 61 658801 GTTTTGAGAGAGGAGGTAAA 15.76 1090 1109 62 658802 GTTTTTTCTTTGATGGTTTT 66.43 1105 1124 63 658803 GAAATCTAATTTTTCAGTTT 93.98 1121 1140 64 658804 AATCTTAATTTTGCTGAAAT 37.35 1136 1155 65 658805 TTTTTAAGAACAGAAAATCT 57.27 1151 1170 66 658806 ACACTTTGGTTTTTCATTTT 60.18 1183 1202 67 658807 ATTTTCTCCCGGTTTACACT 60.00 1198 1217 68 658808 AGGTAACTTGCATGTATTTT 0.00 1213 1232 69 658809 AATATCTTTATCAGATAGGT 0.00 1229 1248 70 658810 ATGTTTGCTGGGTACAATAT 51.71 1244 1263 71 658811 GTTTGAGAGTTCTTCATGTT 0.00 1259 1278 72 658812 CATCTTTTAATTGAATTTTT 0.00 1290 1309 73 658813 CCCGGCCAACTTACCCATCT 0.00 1305 1324 74 658814 GATTGGGATTGCAAGTATGA 0.00 1334 1353 75 658815 GAGCACACGCCACAATGCCT 0.90 1456 1475 76 658816 AGTCTTCTTGTCTCAGCCTT 0.00 1494 1513 77 658817 CCACCTCCTGCGCTCAGTCT 0.00 1509 1528 78 658818 TCACACAGCCTACTGCAGCC 0.00 1530 1549 79
Example 2: Effect of Antisense Oligonucleotides Targeting SMN-NAT on SMN RNA
[0313] Two antisense oligonucleotides from Example 1 above, Isis Nos. 658803 and 658798 were chosen for further evaluation for effects on increasing SMN transcription in HEK293T cells. A scrambled ASO not complementary to SMN-NAT was used as a control. HEK293T cells were transfected with Lipofectamine-2000 (Life Technologies) according to manufacturer's instructions and RNA was collected 24 hours after transfection. Standard RT-qPCR was used to assess SMN-NAT, SMN pre-mRNA and FL-SMN (full-length SMN) mRNA levels. As shown in Table 2, antisense oligonucleotides designed to reduce expression of SMN-NAT can effectively increase expression of SMN pre-mRNA and full length SMN mRNA in a dose dependent manner.
TABLE-US-00002 TABLE 2 Effect of antisense oligonucleotides targeting SMN-NAT Relative Levels Isis No. Dose SMN-NAT SMN pre-mRNA FL-SMN mRNA 141923 0 nM 1.13 0.85 0.95 62.5 nM 1.10 1.00 1.12 12 5 nM 1.15 0.86 1.23 250 nM 0.99 1.05 0.97 500 nM 1.13 1.03 1.13 658803 0 nM 0.99 1.12 1.00 62.5 nM 0.58 1.05 1.16 125 nM 0.48 1.36 1.39 250 nM 0.31 1.68 1.83 500 nM 0.16 1.63 1.65 658798 0 nM 1.03 0.95 1.03 62.5 nM 0.84 1.10 1.03 125 nM 0.69 1.30 1.29 250 nM 0.52 1.61 1.49 500 nM 0.31 1.58 1.74
Example 3: Effect of Antisense Oligonucleotides Targeting SMN-NAT on SMN RNA in SMA Fibroblasts
[0314] Antisense oligonucleotide Isis No 658803 was used in a SMA fibroblast line (GM03813, Coriell) and in a carrier fibroblast line (GM03814, Coriell). Fibroblasts were transfected with Cytofectin with various concentrations (0 nM to 100 nM) of antisense oligonucleotide. Forty-eight hours after transfection, protein lysates were collected and SMN protein levels were determined by Western blot analysis. Histone H3 was used as a loading control. Signal intensity was determined using ImageJ gel analysis tool (NIH) and SMN levels were normalized to H3 levels. As shown in Table 3, antisense oligonucleotides designed to reduce expression of SMN-NAT increased expression of SMN protein in a dose dependent manner.
TABLE-US-00003 TABLE 3 Antisense oligonucleotides targeting SMN-NAT in SMA Fibroblasts Relative SMN protein Levels (AU) Isis No. Dose (nM) GM03813 SMA GM03814 Carrier Isis No. 658803 0 1.00 1.86 6 1.19 2.09 12 1.19 2.16 25 1.85 1.98 50 1.98 2.12 100 1.18 2.15
Example 4: Effect of Antisense Oligonucleotides Targeting SMN-NAT on SMN RNA in Primary SMA Neurons
[0315] Antisense oligonucleotide Isis No 658803 was used to evaluate levels of SMN pre-mRNA and FL-SMN mRNA in primary cortical neurons isolated from E13.5 embryos of SMA mice (the SMN 7 mouse model, Stock number 005025, The Jackson laboratory). Five M antisense oligonucleotide was added to the growth medium 2 days after plating out and incubated for 4 days. SMN-NAT, SMN pre-mRNA and FL-SMN mRNA levels were measured using RT-qPCR. As shown in Table 4 below, antisense oligonucleotides designed to reduce expression of SMN-NAT increased expression of SMN pre-mRNA and full length SMN mRNA in primary SMA neurons.
TABLE-US-00004 TABLE 4 Effect of antisense oligonucleotides targeting SMN-NAT on SMN RNA in Primary SMA neurons Relative Levels Isis No. SMN-NAT SMN pre-MRNA FL-SMN mRNA Untreated 0.98 1.06 1.13 141923 1.01 1.13 1.11 (scrambled) 658803 0.35 1.94 1.79
Example 5: Dose Response of Antisense Oligonucleotides Targeting SMN-NAT in HeLa Cells
[0316] SMN-NAT targeting antisense oligonucleotides selected from Table 1 were tested for dose response analysis in HeLa cells. Oligonucleotide Scrb1, which does not target SMN-NAT, and Isis Number 387954, which targets SMN pre-mRNA, were used as negative controls. Cells were electroporated with 0, 6, 12, 25, 50, or 100 nM of antisense oligonucleotide, and SMN-NAT mRNA was analyzed as described in Example 2. Results are presented in Table 5 below. The results show that the antisense oligonucleotides targeting SMN-NAT inhibited SMN-NAT mRNA expression in a dose dependent manner.
TABLE-US-00005 TABLE 5 Effect of antisense oligonuclotides targeting SMN-NAT on SMN RNA in HeLa Cells SMN-NAT Isis No. Dose (nM) Relative levels 658761 0 0.99 6 0.89 12 0.67 25 0.45 50 0.37 100 0.22 658764 0 1.09 6 0.67 12 0.54 25 0.44 50 0.43 100 0.32 658765 0 1.09 6 0.88 12 0.79 25 0.63 50 0.51 100 0.44 658792 0 2.02 6 1.06 12 0.83 25 0.52 50 0.36 100 0.25 658798 0 1.05 6 0.83 12 0.74 25 0.52 50 0.35 100 0.22 658802 0 1.02 6 0.95 12 0.66 25 0.49 50 0.41 100 0.17 658803 0 0.98 6 0.86 12 0.70 25 0.47 50 0.41 100 0.25 658815 0 1.05 6 0.83 12 0.55 25 0.45 50 0.36 100 0.32 Scrb1 0 0.94 6 1.09 12 0.89 25 1.00 50 1.12 100 1.07 387954 0 1.12 6 1.23 12 1.30 25 1.19 50 1.21 100 1.07
Example 6: Effect of Antisense Oligonucleotides on SMN-NAT in SMA Mice
[0317] Antisense oligonucleotides targeting the SMN-NAT sequence, described herein as SEQ ID NO: 1 (GenBank accession # BC045789.1) were tested for their effects on SMN-NAT expression in adult SMA mice.
[0318] The antisense oligonucleotides in Table 6 were designed as 5-10-5 MOE gapmers having a mixed backbone (MBB). The gapmers are 20 nucleosides in length, wherein the central gap segment comprises ten 2-deoxynucleosides and is flanked by wing segments on the 5 direction and the 3 direction comprising five nucleosides each. Each nucleoside in the 5 wing segment and each nucleoside in the 3 wing segment has a 2-MOE modification. The internucleoside linkages throughout each gapmer are each independently selected from phosphorothioate (PS) linkages and phosphodiester linkages. A subscript o denotes the location of the phosphodiester internucleoside linkages, all other internucleoside linkages are PS linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.
TABLE-US-00006 TABLE6 Antisenseoligonucleotides targetedtoSMN-NAT Start Stop Site Site SEQ Isis Seq Seq ID No Sequence ID:1 ID:1 NO. 813208 CA.sub.oG.sub.oA.sub.oG.sub.oTCCT 1043 1062 59 CGGTAGA.sub.oA.sub.oCTT 813209 GA.sub.oA.sub.oA.sub.oT.sub.oCTAA 1121 1140 64 TTTTTCA.sub.oG.sub.oTTT
[0319] Adult SMA mice (Jax#005058) received an intracerebroventricular (ICV) injection of 500 g antisense oligonucleotide in PBS or an injection of PBS only. After 15 days, the mice were euthanized and total RNA and protein were isolated from the brain and spinal cord. SMN-NAT RNA levels and FL-SMN2 RNA levels were measured by RT-qPCR as described in example 2. The SMN/GAPDH protein ratio was measured by western blot analysis using antibodies against SMN and GAPDH. Signal intensity was measured with ImageJ gel analysis tool, and SMN values were normalized to GAPDH values. Isis No. 449323, which targets SMN pre-mRNA and corrects splicing was included as a positive control.
TABLE-US-00007 TABLE 7 Effect of antisense oligonucleotides on SMN-NAT expression in adult SMA mice Relative Levels in the Brain Relative Levels FL- in the Spinal Cord SMN- SMN2 SMN/ SMN- FL-SMN2 SMN/ Isis No. NAT mRNA GADPH NAT mRNA GADPH PBS 0.97 1.03 0.91 1.02 1.08 0.21 449323 1.05 3.08 1.38 1.04 3.18 0.58 813208 0.41 1.05 0.65 0.65 0.97 0.18 813209 0.30 0.93 0.64 0.36 0.95 0.21
Example 7: Effect of Systemic Administration of Antisense Oligonucleotides on Neonatal SMA Mice
[0320] Groups of 3 SMA mice (Jax#005025) received a single subcutaneous dose of 300 ug/g of an antisense oligonucleotide (ASO) listed in the table below on post-natal day 1 and a second dose of 300 ug/g ASO on post-natal day 3. Each group of mice received either a scrambled control ASO (Isis No. 141923), an ASO designed to knock down SMN-NAT (Isis No. 813208), or an SMN2 splicing ASO (Isis No. 449323). A group of 3 wild-type mice that did not receive any treatment was also used as a control (WT). After 10 days, the mice were sacrificed and relative levels of SMN-NAT, FL-SMN2 mRNA, and SMN protein relative to GAPDH were measured by RT-qPCR in both the brain and spinal cord.
TABLE-US-00008 TABLE 8 Effect of systemic administration of antisense oligonucleotides on SMN-NAT expression in SMA mice Relative Levels Relative Levels in the Spinal in the Brain Cord Mouse SMN- FL-SMN2 SMN/ SMN- FL-SMN2 SMN/ Isis No. genotype NAT mRNA GADPH NAT mRNA GAPDH N/A WT 1.09 1.06 2.38 0.81 1.15 1.68 141923 SMA 1.11 1.07 0.93 1.00 1.32 0.65 449323 SMA 1.09 1.59 1.90 0.83 1.79 1.51 813208 SMA 0.72 1.32 1.34 0.58 1.99 0.95