APTASENSOR AND METHOD OF DETECTING TARGET MATERIAL
20180275120 ยท 2018-09-27
Inventors
Cpc classification
G01N33/5308
PHYSICS
International classification
G01N33/53
PHYSICS
Abstract
A method detects a target material in a sample, and includes: providing an aptasensor having a first aptamer capable of binding with hemin; a second aptamer capable of binding with the target material; and a nucleotide linker connecting the first aptamer and the second aptamer, adding hemin to the sample, contacting the aptasensor with the sample including hemin to bind the first aptamer with hemin and the second aptamer with the target material; adding a substrate for 1,1-oxalyldiimidazole (ODI) chemiluminescence (CL), and measuring intensity of CL.
Claims
1. A method for detecting a target material in a sample, comprising: providing an aptasensor including a first aptamer capable of binding with hemin; a second aptamer capable of binding with the target material; and a nucleotide linker connecting the first aptamer and the second aptamer, adding hemin to the sample, contacting the aptasensor with the sample including hemin to bind the first aptamer with hemin and the second aptamer with the target material; adding a substrate for 1,1-oxalyldiimidazole (ODI) chemiluminescence (CL), and measuring intensity of CL.
2. The method of claim 1, wherein the contacting is performed less than 30 minutes at room temperature.
3. The method of claim 1, wherein the nucleotide linker is a single strand DNA having 3-30 bases of adenine, cytosine, guanine or thymine.
4. The method of claim 1, wherein the nucleotide linker is a single strand DNA having 5-15 bases of adenine, cytosine, guanine or thymine.
5. The method of claim 1, wherein the first aptamer forms HRP-mimicking G-quadruplex DNAzyme when combined with hemin.
6. The method of claim 1, wherein the second aptamer is at least one selected from the group consisting of carcinoembryonic antigen (CEA) aptamer, prostate specific antigen (PSA) aptamer, and Norovirus specific aptamer.
7. The method of claim 1, wherein the first aptamer is positioned in 3-end of the aptasensor and the second aptamer is positioned in 5-end of the aptasensor.
8. An aptasensor comprising: a first aptamer capable of binding with hemin; a second aptamer capable of binding with a target material; and a nucleotide linker connecting the first aptamer and the second aptamer.
9. The aptasensor according to claim 8, wherein the nucleotide linker is a single strand DNA having 3-30 bases of adenine, cytosine, guanine or thymine.
10. The aptasensor according to claim 9, wherein the nucleotide linker is a single strand DNA having 5-15 bases of adenine, cytosine, guanine or thymine.
11. The aptasensor according to claim 9, wherein the first aptamer forms HRP-mimicking G-quadruplex DNAzyme when combined with hemin.
12. The aptasensor according to claim 9, wherein the second aptamer is at least one selected from the group consisting of carcinoembryonic antigen (CEA) aptamer, prostate specific antigen (PSA) aptamer, and Norovirus specific aptamer.
13. The aptasensor according to claim 9, wherein the first aptamer is positioned in 3-end of the aptasensor and the second aptamer is positioned in 5-end of the aptasensor.
14. A kit for detecting a target material from a sample, comprising: an aptasensor including a first aptamer capable of binding with hemin; a second aptamer capable of binding with the target material; and a nucleotide linker connecting the first aptamer and the second aptamer, and a container.
15. The kit according to claim 14, further comprising: hemin; and a substrate for 1,1-oxalyldiimidazole (ODI) chemiluminescence (CL).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
DETAILED DESCRIPTION
[0027] According to embodiment of the present invention, a method is provided for detecting a target material in a sample by using an aptasensor having a first aptamer capable of binding with hemin; a second aptamer capable of binding with the target material; and a nucleotide linker connecting the first aptamer and the second aptamer. The method may rapidly detect and quantify a target material (e.g., biomarker) in a sample solution including hemin through 1,1-oxalyldiimidazole (ODI) chemiluminescence (CL) detection. The target material and hemin may competitively bind with the aptasensor. When a substrate for CL detection (e.g., Amplex Red and H.sub.2O.sub.2) is added to the sample solution including hemin after the contacting with the aptasensor, the yield of resorufin formed from the reaction with the CL substrate is dependent on the concentration of HRP-mimicking G-quardruplex DNAzyme produced from the binding interaction between hemin and the aptasensor. When ODI and H.sub.2O.sub.2 are added in the sample after the contacting to produce resorufin, bright red light is emitted from the sample. The light emitted in the absence of target material is brighter than that in the presence of the target material. This is because HRP-mimicking G-quardruplex DNAzyme competitively produces a target material-bound aptasensor (dual DNA aptamer) in the second aptamer when the aptasensor and hemin are added in the sample including the target material. Thus, relative CL intensity of the aptasensor is exponentially decreased with the increase of the concentration of the target material in a sample, e.g., human serum.
[0028] The first aptamer may be a hemin aptamer which may bind with hemin to form HRP-mimicking G-quadruplex DNAzyme. The structure of HRP-mimicking G-quadruplex DNAzyme is shown in
[0029] The aptasensor according to an embodiment of the present invention may have the following structure (Formula 1).
##STR00001##
[0030] In the above structure, the second aptamer (X) is linked to the first aptamer (e.g., hemin aptamer). The second aptamer (X), capable of binding with a specific target material, linked to hemin aptamer, may detect the target material in a sample. In other words, a specific target material in a sample may be quantified with X linked to hemin aptamer using the aptasensor with ODI-CL detection. The aptasensor can be used for the early diagnosis and prognosis of human diseases (e.g., cancer, cardiac aliments, diabetes, infectious diseases) and the rapid monitoring of toxic materials (biological and chemical toxins, food-borne pathogens, viruses) in a sample.
[0031] For example, the aptasensor may include CEA aptamer as the second aptamer for the early diagnosis of breast cancer as shown in Formula 2.
##STR00002##
[0032] In addition, the aptasensor including prostate specific antigen (PSA) aptamer as the second aptamer (PH) shown in Formula 3 may be applied to sense prostate specific antigen (PSA) in human serum for the early diagnosis prostate cancer. Also, as shown in Formula 4, the aptasensor including Norovirus specific aptamer as a second aptamer (NH) may be applied to rapidly monitor Norovirus in a sample.
TABLE-US-00001 [Formula3] PH:5-TTTTTAATTAAAGCTCGCCATCAAATAGCTAAAAATAAAGGG TAGGGCGGGTTGGGTAAAT-3 [Formula4] NH:5-GTCTGTAGTAGGGAGGATGGTCCGGGGCCCCGAGACGACGTT ATCAGGCAAAAATAAAGGGTAGGGCGGGTTGGGTAAAT-3
[0033] In addition to the aptamers for human disease biomarkers, the second aptamer may be also aptamers for toxins, foodborne pathogens and viruses. The following TABLEs 1 and 2 shows examples of aptamers that can be used as the second aptamer.
TABLE-US-00002 TABLE1 Biomarkersandaptamersforthediagnosesandprognosesofhumandiseases Biomarker Humandisease Aptamer CEA Breastcancer 5-ATACCAGCTTATTCAATT-3 PSA Prostatecancer 5 -TTTTTAATTAAAGCTCGCCATCAAATAGCT-3 MUC1 Breastcancer 5-GCAGTTGATCCTTTGGATACCCTGG-3 HbA1c Diabetes 5-GGCAGGAAGACAAACACATCGTCGCGGCCTTAGGAG GGGCGGACGGGGGGGGGCGTTGGTCTGTGGTGCTGT-3 Insuline Diabetes 5-GGTGGTGGGGGGGGTTGGTAGGGTGTCTTC-3 BNP Cardiacdisease 5-TACGGGAGCCAACACCACCTCTCACATTATATTGTG AATACTTCGTGCTGTTTAGAGCAGGTGTGACGGAT-3 Myoglobin Carduacdisease 5-CCCTCCTTTCCTTCGACGTAGATCTGCTGCGTTGTTC CGA-3
TABLE-US-00003 TABLE2 Aptamersoftoxins,foodbornepathogens,andviruses Analyte Type Aptamer OchratoxinA Biologicaltoxin 5-GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA- 3 l7-estradio1 Chemicaltoxin 5-GCTTCCAGCTTATTGAATTACACGCAGAGGGTAGCG (E2) GCTCTGCGCATTCAATTGCTGCGCGCTGAAGCGCGGAAG C-3 Vibrio Food-bornepathogen 5-TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGA parahaemolyticus TACT-3 EscherichiaColi Food-bornepathogen 5-CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGT O157:H7 GACGG-3 Norovirus Virus 5-GTCTGTAGTAGGGAGGATGGTCCGGGGCCCCGAGA CGACGTTATCAGGC-3
[0034] The nucleotide linker is a single strand DNA having 3-30 bases of adenine, cytosine, guanine or thymine. More preferably, the nucleotide linker includes 5-15 bases.
[0035] The aptasensor may have a form of single strand DNA, where the first aptamer may be positioned in 3-end of the aptasensor and the second aptamer may be positioned in 5-end of the aptasensor, or vice versa.
[0036] The method and system using the aptasensor may be provided in the form of a kit. In one embodiment of the present invention, the kit includes the above-described aptasensor and a container. The kit may further include hemin and substrate for 1,1-oxalyldiimidazole (ODI) chemiluminescence (CL).
[0037] The kit may also include at least one of the following components:
[0038] 1. Standards (controls) of an analyte.
[0039] 2. 10-Acetyl-10H-phenoxazine-3,7-diol as a substrate capable of interacting DNAzyme.
[0040] 3. 20 mM H.sub.2O.sub.2 in aqueous solution.
[0041] 4. 1,1-Oxalyldiimidazole (ODI) in organic solvent such as ethyl acetate and acetonitrile.
[0042] 5. 100 mM H.sub.2O.sub.2 in organic solvent such as isopropyl alcohol and methyl alcohol.
Examples
[0043] Chemicals and Materials
[0044] Two different types of aptasensors according to one embodiment of the present invention (CEA aptamer linked to hemin aptamer; (CH-1 and CH-2)), as shown below, were prepared. CEA aptamer was linked to a hemin aptamer using a linker composed of 5 adenines (AAAAA).
TABLE-US-00004 CH-1:5-AAAGGTAGGGCGGGTTGGGTAAATAAAAAAGGGGGTGAAGG GATACCC-3 CH-2:5-ATACCAGCTTATTCAATTAAAAATAAAGGGTAGGGCGGGTT GGGTAAAT-3
[0045] Hemin was purchased from Sigma Aldrich. Bis (2,4,6-trichlorophenyl) oxalate (TCPO) and 4-methylimidazole (4MImH) were purchased from TCT America. 3 and 30% H.sub.2O.sub.2 were purchased from VWR. Amplex Red was purchased from Thermofisher. Deionized H.sub.2O (HPLC grade), Ethyl acetate, Iospropyl alcohol, and high concentration of PBS (pH 7.4, 20) were purchased from EMD. CEA diagnostic kit for ELISA and serum diluent (0 calibrator) were purchased from Monobind, Inc. CEA antigen (25 g) was purchased from Lee Biosolutions. 8-well EIA/RIA strip-well plate was purchased from Costar. Coded human serum samples containing various concentrations of CEA were obtained from the Washington County hospital (Alternative name: Meritus Health Service) located in Maryland, United States.
[0046] Interaction Between Hemin and the Aptasensor CH-2 (CEA Aptamer-Linker-Hemin Aptamer)
[0047] In order to confirm whether HRP-mimicking G-quadruplex DNAzyme is formed from the interaction between hemin and hemin aptamer in the aptasensor CH-2(CEA aptamer-linker-hemin aptamer), hemin (300 nM, 50 l) was mixed with a certain concentration of CH-2 (50 l) in PBS (10 mM, pH 7.4) and incubated for 20 min at room temperature. After the incubation, the mixture (100 l) of Amplex Ultra Red (2 M) and H.sub.2O.sub.2 (0.4 mM), a substrate for ODI chemiluminescence detection in the presence of HRP, was added in the strip-well containing hemin and CH-2. The mixture was then incubated for 6 min at room temperature. After the incubation, the mixture (10 l) was injected into a borosilicate test tube (12 mm75 mm). The tube was inserted into the detection area of the luminometer (Lumat LB 9507, Berthold, Inc) with two syringe pumps. 20 mM H.sub.2O.sub.2 (25 l) dissolved in isopropyl alcohol was dispensed through the first syringe pump of the luminometer. Then, strong light immediately emitted with the addition of ODI (25 l) using the second syringe pump was measured for 1 second. The effect of HRP-mimicking G-quadruplex DNAzyme was studied with relative CL intensity measured in the absence or presence of hemin aptamer. The following Scheme 1 shows the brief reaction mechanism of ODI chemiluminescence reaction in the presence of HRP-mimicking G-quadruplex DNAzyme.
[0048] Quantification of CEA in Human Serum Using the Aptasensor CH-2
[0049] In order to quantify CEA in unknown sample, 8 different standards (0, 3,13, 6.25, 12.5, 25, 50, 100, 200 ng/ml) were prepared in human serum diluent (0 calibrator). In order to produce HRP-mimicking G-quadruplex DNAzyme, each standard (40 l) was mixed with CH-2 (250 nM, 40 l) and hemin (740 nM, 20 l) in a polystyrene strip-well. The mixture was incubated for 30 min at room temperature. After the incubation, the mixture of Amplex Red and H.sub.2O.sub.2 was added in the polystyrene strip-well. The final mixture was incubated for 6 min to form resorufin from the reaction of substrate and HRP-mimicking G-quadruplex DNAzyme. The brightness of light (relative CL intensity) emitted in the final mixture with the addition of ODI chemiluminescence reagents (ODI and H.sub.2O.sub.2) was measured using the luminometer using the method described above. Using the linear calibration curve obtained with the relative CL intensity measured in the presence of each standard, CEA in unknown sample was quantified.
[0050] Correlation Between the Aptasensor CH-2 and Conventional ELISA
[0051] In order to study the correlation between the aptasensor CH-2 and the conventional enzyme-linked immunosorbent assay (ELISA) using HRP, 30 human serum samples containing various concentration of CEA were obtained from the Washington County Hospital. All the samples were coded to protect the information of patients. In order to determine the CEA concentration of each sample using conventional ELISA, the ELISA kits purchased from Monobind, Inc. were used. CEA concentration in each sample was determined using the aptasensor CH-2 and conventional ELISA. Then, the CEA concentration of each sample determined with the aptasensor CH-2 was compared with that measured with ELISA.
[0052] Interaction Between Hemin and the Aptasensor CH-2 (CEA Aptamer-Linker-Hemin Aptamer)
[0053] It is well-known that hemin rapidly binds with hemin aptamer. An experiment for checking the relative CL intensity of the aptasensor CH-2 by binding with hemin in PBS (pH 7.4) according to the concentration of the aptasensor CH-2 were conducted. As shown in
[0054]
[0055] Relative CL Intensity in the Absence and Presence of CEA
[0056] As mentioned above, the aptasensor CH-2 (CEA aptamer-linker-hemin aptamer) was designed to bind with hemin as well as CEA. Thus, it was expected that the relative CL intensity in the absence of CEA could be similar to that in the presence of CEA because the brightness of ODI chemiluminescence is only dependent on the concentration of HRP-mimicking G-quadruplex DNAzyme.
[0057]
[0058] Based on the results shown in
[0059] Indirect Determination of Binding Rate Between the Aptasensor CH-2 and CEA
[0060] As shown in
[0061] Determination of Incubation Time
[0062] Based on the results shown in
[0063] Effect of CH-2 Concentration
[0064]
[0065] Quantification of CEA Using the Aptasensor
[0066] The aptasensor optimized based on the preliminary experimental results described above was designed to rapidly quantify trace levels of CEA for the early diagnosis of breast cancer as shown in
[0067]
TABLE-US-00005 TABLE 3 Accuracy, precision, and recovery of the aptasensor CH-2 (N = 3) Sample 1 .sup.a Sample 2 .sup.a Expected .sup.a Measured .sup.a Recovery (%) 3.0 5.0 4.0 4.2 0.2 105.0 5.0 8.0 6.5 6.2 0.3 95.3 8.0 12.0 10.0 9.7 0.4 97.0 12.0 16.0 14.0 14.4 0.3 102.9 .sup.a ng/ml Expected = (sample 1 + sample 2)/2
[0068] As shown in TABLE 3, the aptasensor according to one embodiment of the present invention can quantify trace levels of target material (CEA) with good accuracy and precision within the statistically acceptable error range. Also, the good recovery for the mixture of sample 1 and sample 2 (1:1 volume ratio) shows the possibility that the aptasensor can be applied as a new clinical tool for the early diagnosis of human diseases (e.g., breast cancer).
[0069] As a method to confirm that the aptasensor can be a new diagnostic tool for the early diagnosis of human diseases (e.g., breast cancer), analytical results of 30 human serums obtained using the aptasensor CH-2 were compared with those obtained using conventional ELISA purchased from Monobind, Inc.
[0070] It is to be understood that the above-described method and aptasensor are merely illustrative embodiments of the principles of this disclosure, and that other compositions and methods for using them may be devised by one of ordinary skill in the art, without departing from the spirit and scope of the invention. It is also to be understood that the disclosure is directed to embodiments both comprising and consisting of the disclosed parts.