PLANT PROMOTER FROM COTTON AND USES THEREOF
20180273969 ยท 2018-09-27
Inventors
- Vaishali Praveen Khanale (Aurangabad, IN)
- Anjanabha Bhattacharya (Kolkata, IN)
- Anindya Bandyopadhyay (Metro Manila, PH)
Cpc classification
C12N15/8216
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure provides a cotton promoter, designated p2, which exhibits promoter activity. Interestingly, the promoter is also influenced by water or salt stress. Deletion analysis reveals upstream elements/motifs in the promoter which influence promoter activity, and sequences that are potentially responsive to salt or water stress.
Claims
1-15. (canceled)
16. A DNA construct comprising a promoter capable of driving expression of an operably linked heterologous gene of interest, said promoter selected from the group consisting of: a. a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof; b. a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1; and c. a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, wherein said promoter is operably linked to a heterologous gene fragment.
17. A DNA vector comprising the DNA construct as claimed in claim 16.
18. A recombinant host cell comprising the DNA construct as claimed in claim 16, wherein said host cell is of bacterial, fungal, or plant origin.
19. A recombinant host cell comprising the DNA vector as claimed in claim 17, wherein said host cell is of bacterial or fungal origin.
20. A transgenic plant or part thereof, including seeds, comprising within its genome, a DNA construct comprising a promoter capable of driving expression of an operably linked heterologous gene of interest, said promoter selected from the group consisting of: a) a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof; b) a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1; and c) DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, wherein said promoter is operably linked to a heterologous gene fragment.
21. The transgenic plant as claimed in claim 20, wherein said plant is a monocot, or a dicot.
22. A method of producing a transgenic plant, said method comprising: a) obtaining plant cell(s); b) obtaining a DNA construct comprising a promoter operably linked to an heterologous gene of interest, said promoter selected from the group consisting of: (i) a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof; (ii) a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1; and (iii) a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, (c) transforming said plant cell(s) with DNA construct of step (b), to obtain transformed plant cell(s); and (d) selecting transformed plant cell(s) expressing said gene of interest.
23. The method as claimed in claim 22, wherein said gene of interest expression is constitutive.
24. The method as claimed in claim 22, wherein said gene of interest expression is regulated in response to salt or water stress.
25. The method as claimed in claim 22, wherein said gene of interest expression is root specific under conditions of water stress.
26. The method as claimed in claim 22, wherein said transformation is carried out by a method selected from the group consisting of particle gun bombardment method, microinjection method, and macroinjection method.
27. A method of generating a transgenic plant, said method comprising: (a) obtaining plant cell(s); (b) obtaining a DNA construct comprising a promoter operably linked to an heterologous gene of interest, said promoter selected from the group consisting of: (i) a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof; (ii) a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1; and (iii) a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, (c) transforming a host cell with the DNA construct of step (b) to obtain recombinant host cell; (d) transforming said plant cell(s) with said recombinant host cell of step (c) to obtain transformed plant cell(s); and (e) selecting transformed plant cell(s) expressing said gene of interest.
28. The method as claimed in claim 27, wherein said gene of interest expression is constitutive.
29. The method as claimed in claim 27, wherein said gene of interest expression is regulated in response to salt or water stress.
30. The method as claimed in claim 27, wherein said gene of interest expression is root specific under conditions of water stress.
31. The method as claimed in claim 27, wherein said transformation is carried out by a method selected from the group consisting of Agrobacterium mediated transformation method, in-planta transformation method, liposome mediated transformation method and protoplast transformation method.
Description
BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS
[0022] The following drawings form part of the present specification and are included to further illustrate aspects of the present disclosure. The disclosure may be better understood by reference to the drawings in combination with the detailed description of the specific embodiments presented herein.
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
DETAILED DESCRIPTION OF THE INVENTION
[0039] Those skilled in the art will be aware that the disclosure described herein is subject to variations and modifications other than those specifically described. It is to be understood that the disclosure described herein includes all such variations and modifications. The disclosure also includes all such steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any or more of such steps or features.
Definitions
[0040] For convenience, before further description of the present disclosure, certain terms employed in the specification, example and appended claims are collected here. These definitions should be read in the light of the remainder of the disclosure and understood as by a person of skill in the art. The terms used herein have the meanings recognized and known to those of skill in the art, however, for convenience and completeness, particular terms and their meanings are set forth below.
[0041] The articles a, an and the are used to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article.
[0042] The term plurality means more than one.
[0043] The terms at least two, more than one and plurality are used interchangeably.
[0044] The terms comprise and comprising are used in the inclusive, open sense, meaning that additional elements may be included. It is not intended to be construed as consists of only.
[0045] Throughout this specification, unless the context requires otherwise the word comprise, and variations such as comprises and comprising, will be understood to imply the inclusion of a stated element or step or group of element or steps but not the exclusion of any other element or step or group of element or steps. The term including is used to mean including but not limited to. Including and including but not limited to are used interchangeably.
[0046] The term nucleotide sequence means the order in which nucleotides are situated in a chain relative to one another.
[0047] The term heterologous gene/DNA refers to DNA sequence of foreign origin inserted into the plant genome.
[0048] The term polynucleotide or polynucleotide molecule or polynucleotide sequence used herein refers to the single or double stranded DNA or RNA of genomic or synthetic origin, i.e., a polymer of deoxyribonucleotide or ribonucleotide bases, respectively, read from the 5 (upstream) end to the 3 (downstream) end.
[0049] The term nucleotide sequence as used herein refers to the sequence of a polynucleotide molecule.
[0050] The term promoter as used herein, refers to a polynucleotide molecule that is in its native or non native state located upstream or 5 to a translational start codon of an open reading frame (or protein-coding region) and that is involved in recognition and binding of RNA polymerase II and other proteins (trans-acting transcription factors) to initiate transcription.
[0051] A plant promoter is a native or non-native promoter that is functional in plant cells. Constitutive plant promoters are functional in most or all tissues of a plant throughout plant development. Any plant promoter can be used as a 5 regulatory element for modulating expression of a particular gene or genes operably associated thereto. When operably linked to a polynucleotide molecule, a promoter typically causes the polynucleotide molecule to be transcribed in a manner that is similar to that of which the promoter is normally associated.
[0052] The terms encoding and coding refer to the process by which a polynucleotide, through the mechanisms of transcription and translation, provides information to a cell from which a series of amino acids can be assembled into a specific polypeptide. Because of the degeneracy of the genetic code, certain base changes in DNA sequence do not change the amino acid sequence of a protein.
[0053] The term expression with respect to a gene sequence refers to transcription of the gene and, as appropriate, translation of the resulting mRNA transcript to a protein. Thus, as will be clear from the context, expression of a protein results from transcription and translation of the open reading frame sequence.
[0054] The phrase altered expression in reference to a polynucleotide indicates that the pattern of expression in, e.g., a transgenic plant or plant tissue, is different from the expression pattern in a wild-type plant of the same species. Thus, the polynucleotide of interest is expressed in a cell or tissue type other than a cell or tissue type in which the sequence is expressed in the wild type plant, or by expression at a time other than at the time the sequence is expressed in the wild type plant, or by a response to different inducible agents, such as hormones or environmental signals, or at different expression levels, compared with those found in a wild type plant. The resulting expression pattern can be transient or stable, constitutive or inducible. With reference to a polypeptide, altered expression further may relate to altered activity levels resulting either from altered protein levels or from interactions of the polypeptides with exogenous or endogenous modulators, or from interactions with factors or as a result of the chemical modification of the polypeptides.
[0055] The terms exogenous nucleic acid and heterologous nucleic acid are used interchangeably and refer to a nucleic acid, DNA or RNA, which has been introduced into a cell (or the cell's ancestor) through the efforts of humans. Such exogenous nucleic acid may be a copy of a sequence which is naturally found in the cell into which it was introduced, or fragments thereof.
[0056] The term endogenous nucleic acid refers to a nucleic acid, gene, polynucleotide, DNA, RNA, mRNA, or cDNA molecule that is present in a plant or organism that is to be genetically engineered. An endogenous sequence is native to, i.e., indigenous to, the plant or organism that is to be genetically engineered.
[0057] The phrase homologous sequences refers to polynucleotide or polypeptide sequences that are similar due to common ancestry and sequence conservation. Homologous sequences may be orthologous, if they were separated by a speciation event, or paralogous, if they were separated by a gene duplication event. The phrase functional homolog refers to a polynucleotide or polypeptide sequences that are similar due to common ancestry and sequence conservation and have identical or similar function at the catalytic, cellular, or organismal levels.
[0058] The term recombinant DNA construct means a molecule that is constructed outside living cells by joining natural or synthetic DNA to a DNA molecule that can replicate in a living cell.
[0059] A vector is any means by which a nucleic acid can be propagated and/or transferred between organisms, cells or cellular components. Vectors include viruses, bacteriophage, pro-viruses, plasmids, phagemids, transposons and artificial chromosomes such as YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes), and PLACs (plant artificial chromosomes), and the like, that are episomes, that is, that replicate autonomously or can integrate into a chromosome of a host cell. A vector can also be a naked RNA polynucleotide, a polynucleotide composed of both DNA and RNA within the same strand, a poly-lysine-conjugated DNA or RNA, a peptide conjugated DNA or RNA, a liposome-conjugated DNA, or the like, that are not episomal in nature, or it can be an organism which comprises one or more of the above polynucleotide constructs such as Agrobacterium or a bacterium.
[0060] The term recombinant vector means a vector carrying a foreign DNA fragment.
[0061] Transformation refers to the process by which a recombinant DNA molecule is introduced into a host cell. Transformation (or transduction, or transfection), can be achieved by any one of a number of means including electroporation, microinjection, biolistics (or particle bombardment-mediated delivery), or Agrobacterium-mediated transformation.
[0062] The term recombinant host cell means a host cell carrying a recombinant vector.
[0063] The term transgenic plant means plants that have been genetically engineered to artificially introduce a gene or set of gene sequences in the plant genome.
[0064] The term p2 is designated to a nucleotide fragment having sequence as set forth in SEQ ID NO: 1 that shows promoter like activity.
[0065] The term p2?1 is designated to a nucleotide fragment having sequence as set forth in SEQ ID NO: 9 that shows promoter like activity.
[0066] The term p2?2 is designated to a nucleotide fragment having sequence as set forth in SEQ ID NO: 10 that shows promoter like activity.
Description of Sequences:
[0067] SEQ ID NO: 1 depicts 1956 bp long nucleotide sequence of constitutive plant promoter (p2) from cotton.
TABLE-US-00001 TGACCAACTTTCCCCTAAGGTACGAGACTTTCTAAAGTCTCTCATTTC CAGACCCTCTAAAGCCAATTTTGACCTATTGCTTTGACTCTTCATTTT TCTTGAAATACTAATGTCTGATACACTCATGTCTAATATAGGTATAGG GATATAACCTTCCCAGAATCCTCCAAATATATAGGAAAATATAGAAAA AAATTTGAACATCCCCTTGTCAGATACTATGCTCCTTGGACCTGGGTG TAGTGTAGTGTAAGGTATGGGTATAGTTAGATATTTCTTTTAAGTTTT TTCATGTATTTGGAGAATCTTTTGATGTCAGATATCCATATCCATGTC TCAGACACAAGTGGTGAACATGGTATTTCAACAAAAATGAAGTGTCGC AACAACATTGGTCGGATATATATTGGTATCTGACACTCATGGATGAGT TAGAGTTGACATGTTTTAAAGATTATGGGTTTCACATTACAGACGGAG CTTTGCTCTCTTTTCTTGGTTGATGCTAAATTGGTATTGTGGTTATTG CGCTAAAGTTAAGATGGTCGGTTTGAATGATGTACAGGCATGTGATAT TAAAGACCCAAAGCAAAACATAGAGTGGACAGTGCCAGAAGGAGGAGG TGGCCCAGGCTATTCAGTCATGTAGAATATATAAGCTAATCCCCTTTC TTATCATTGCTCGTTGCAAATATAGTTCTACTTTTGTACTTTACAACA AATACATTATCTTTGAAATAATTGGTAAGTCCCATCTTAATTGCTACA AAAATTTAACTTTTTACTATACCAAATGAAAAGAAAGCTTTAAGGAGT TCATGAAAGTTCATAATCTTGAGTCTTACCCCTGGATTTGCCTTCAAT CTCAAGTAATCAAGGTTTTCCATTTAAATAACTGATTGTTAACGAGTC AATATGACATAGAAGTCTAGCTAGTTTCTCAAGGCAATCCAGAATGGT AAGCAGCTGTTAGAAATGTTTCGAATCAAGCGGTGGCCTCCAACAGGA CTAAGGTTAAAGGTTTATACCAGAAAACCTCAAAATCCAACATCCTCC CTCTTATCTGCGGATTGTGGATAAAGATGGGTCACCTGCTCTACGCTA TTTTATTGATGAATATACTTTGTTTTCTTCTGCTTTTATGTTAATCAT AGTTGTTTACTTTGTTAGTGAATAAACTGGTTATCATGCAGAGGAACA AAAAAGAAAAGGATAATTATATAGCTGAAACCTAATGACGTGTAGTCT GTTAATAGACCACTAATAATTAATATTTTCAATCTTTGATAACATCAA ATAAAAATACCATTTATTCCTTATCTATAAAAAAGGACACATTATCAT TATCACTTACATGTGAAATTATAATAAACTTTTTTACGTAATATTTTA GCAAATCTTACAGCATTTTTGATTGGATTTATTTAAGTATGGTATATA TTAATAAATATTTAACCGATAATTATAAAATTTTAAATATTAATTTAC TTTAAATTTGACATGTATTATCTATATTAATGTACCATAAAATAGGAT GCTAAAATATTAATAGTATAAATTATAAAGCGTATTTTACATCAATAT AACTAGATATTTACTTAAATAATTATTTGATTAAAATTTAACAACGTA TCCATTATATATGGTCATAATTGTAGAAAGAATAAATAACCATTGCAA TTGAATATTGCAAAAGATGATTGAAAATGTATGTGGTGTCATAGTGAT GAGATACGTTGATAATGGGATTGGATTAGGACATCCAAAAGAAAAGCT TCTTTGATTTGCCACAAGTTCACATCCCGTGAGACTACAGTTTGGTTG AACAATAATCTCAACACCCGACAGGACCCAAAGCAAATTCAGGGTTCA CGGACTACTCTCCACCAAACTTTTCTCCATTCATTCCTCTATAAATAA CAATCTCTGGGTAGCTTGCCACATCATAAAAAAAGT
[0068] SEQ ID NO: 2 depicts forward primer with PstI site and CACC site for generating SEQ ID NO: 1.
TABLE-US-00002 CACCTGCAGTGACCAACTTTCCCCTAAGGTACGAGACTT
[0069] SEQ ID NO: 3 depicts reverse primer with SacI site for generating SEQ ID NO: 1.
TABLE-US-00003 GAGCTCACTTTTTTTATGATGTGGCAAGCTACCCAG
[0070] SEQ ID NO: 5 depicts nucleotide sequence of CARGNCAT motif identified in p2 promoter.
TABLE-US-00004 CCATAAAATAGG
[0071] nucleotide sequence of CARGCW8GAT motif identified in p2 promoter.
TABLE-US-00005 ATAAAATAG
[0072] SEQ ID NO: 7 depicts nucleotide sequence of CIACADIANLELHC motif identified in p2 promoter.
TABLE-US-00006 CAAGGCAATC
[0073] SEQ ID NO: 8 depicts nucleotide sequence of PRECONSCRHSP70A motif identified in p2 promoter.
TABLE-US-00007 CCGATAATTATAAAATTTTAAATA
[0074] SEQ ID NO: 9 depicts deletion fragment p2?1 of p2 promoter.
TABLE-US-00008 TCCCGTGAGACTACAGTTTGGTTGAACAATAATCTCAACACCCGACAG GACCCAAAGCAAATTCAGGGTTCACGGACTACTCTCCACCAAACTTTT CTCCATTCATTCCTCTATAAATAACAATCTCTGGGTAGCTTGCCACAT CATAAAAAAAGT
[0075] SEQ ID NO: 10 depicts deletion fragment p2?2 of p2 promoter.
TABLE-US-00009 TGGTTATCATGCAGAGGAACAAAAAAGAAAAGGATAATTATATAGCTG AAACCTAATGACGTGTAGTCTGTTAATAGACCACTAATAATTAATATT TTCAATCTTTGATAACATCAAATAAAAATACCATTTATTCCTTATCTA TAAAAAAGGACACATTATCATTATCACTTACATGTGAAATTATAATAA ACTTTTTTACGTAATATTTTAGCAAATCTTACAGCATTTTTGATTGGA TTTATTTAAGTATGGTATATATTAATAAATATTTAACCGATAATTATA AAATTTTAAATATTAATTTACTTTAAATTTGACATGTATTATCTATAT TAATGTACCATAAAATAGGATGCTAAAATATTAATAGTATAAATTATA AAGCGTATTTTACATCAATATAACTAGATATTTACTTAAATAATTATT TGATTAAAATTTAACAACGTATCCATTATATATGGTCATAATTGTAGA AAGAATAAATAACCATTGCAATTGAATATTGCAAAAGATGATTGAAAA TGTATGTGGTGTCATAGTGATGAGATACGTTGATAATGGGATTGGATT AGGACATCCAAAAGAAAAGCTTCTTTGATTTGCCACAAGTTCACATCC CGTGAGACTACAGTTTGGTTGAACAATAATCTCAACACCCGACAGGAC CCAAAGCAAATTCAGGGTTCACGGACTACTCTCCACCAAACTTTTCTC CATTCATTCCTCTATAAATAACAATCTCTGGGTAGCTTGCCACATCAT AAAAAAAGT
[0076] SEQ ID NO: 11 depicts forward primer sequence to amplify SEQ ID NO: 9.
TABLE-US-00010 TCCCGTGAGACTACAGTTTGG
[0077] SEQ ID NO: 12 depicts reverse primer sequence to amplify SEQ ID NO: 9 or SEQ ID NO: 10.
TABLE-US-00011 GGTAGCTTGCCACATCATAAAAAAAGT
[0078] SEQ ID NO: 13 depicts forward primer sequence to amplify SEQ ID NO: 10.
TABLE-US-00012 TGGTTATCATGCAGAGGAA
[0079] In an embodiment of the present disclosure, there is provided a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive or stress inducible manner, comprising: (a) a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof; or (b) a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1; or (c) a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1.
[0080] In an embodiment of the present disclosure, there is provided a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive or stress inducible manner, comprising a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof.
[0081] In an embodiment of the present disclosure, there is provided a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, comprising a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof.
[0082] In an embodiment of the present disclosure, there is provided a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof.
[0083] In an embodiment of the present disclosure, there is provided a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive or stress inducible manner, comprising a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1.
[0084] In an embodiment of the present disclosure, there is provided a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1.
[0085] In an embodiment of the present disclosure, there is provided a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, comprising a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1.
[0086] In an embodiment of the present disclosure, there is provided a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive or stress inducible manner, comprising a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1.
[0087] In an embodiment of the present disclosure, there is provided a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1.
[0088] In an embodiment of the present disclosure, there is provided a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, comprising a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1.
[0089] In an embodiment of the present disclosure, there is provided a promoter as described herein, wherein said stress is water stress.
[0090] In an embodiment of the present disclosure, there is provided a promoter as described herein, wherein said stress is salt stress.
[0091] In an embodiment of the present disclosure, there is provided a promoter as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 1.
[0092] In an embodiment of the present disclosure, there is provided a promoter as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 9.
[0093] In an embodiment of the present disclosure, there is provided a promoter as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 10.
[0094] In an embodiment of the present disclosure, there is provided a DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive or stress inducible manner, comprising: (a) a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof; or (b) a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1; or (c) a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0095] In an embodiment of the present disclosure, there is provided a DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, said promoter operably linked to a heterologous nucleic acid sequence.
[0096] In an embodiment of the present disclosure, there is provided a DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, said promoter comprising a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0097] In an embodiment of the present disclosure, there is provided a DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, said promoter comprising a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0098] In an embodiment of the present disclosure, there is provided a DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, said promoter comprising a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0099] In an embodiment of the present disclosure, there is provided a DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, said promoter comprising a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0100] In an embodiment of the present disclosure, there is provided a DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, said promoter comprising a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0101] In an embodiment of the present disclosure, there is provided a DNA construct as described herein, wherein said stress is salt stress.
[0102] In an embodiment of the present disclosure, there is provided a DNA construct as described herein, wherein said stress is water stress.
[0103] In an embodiment of the present disclosure, there is provided a DNA construct as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 1.
[0104] In an embodiment of the present disclosure, there is provided a DNA construct as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 9.
[0105] In an embodiment of the present disclosure, there is provided a DNA construct as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 10.
[0106] In an embodiment of the present disclosure, there is provided a DNA vector comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive or stress inducible manner, comprising: (a) a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof; or (b) a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1; or (c) a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0107] In an embodiment of the present disclosure, there is provided a DNA vector comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising: (a) a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0108] In an embodiment of the present disclosure, there is provided a DNA vector comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, comprising: (a) a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0109] In an embodiment of the present disclosure, there is provided a DNA vector comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0110] In an embodiment of the present disclosure, there is provided a DNA vector comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in stress inducible manner, comprising a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0111] In an embodiment of the present disclosure, there is provided a DNA vector comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0112] In an embodiment of the present disclosure, there is provided a DNA vector comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, comprising a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0113] In an embodiment of the present disclosure, there is provided a DNA vector as described herein, wherein said stress is salt stress.
[0114] In an embodiment of the present disclosure, there is provided a DNA vector as described herein, wherein said stress is water stress.
[0115] In an embodiment of the present disclosure, there is provided a DNA vector as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 1.
[0116] In an embodiment of the present disclosure, there is provided a DNA vector as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 9.
[0117] In an embodiment of the present disclosure, there is provided a DNA vector as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 10.
[0118] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive or stress inducible manner, comprising: (a) a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof; or (b) a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1; or (c) a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0119] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0120] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, comprising a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0121] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising: a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0122] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, comprising: a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0123] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0124] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, comprising a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0125] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct as described herein, wherein said stress is salt stress.
[0126] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct as described herein, wherein said stress is water stress.
[0127] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 1.
[0128] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 9.
[0129] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 10.
[0130] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct as described herein, wherein said recombinant host cell is of bacterial origin.
[0131] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct as described herein, wherein said recombinant host cell is Agrobacterium tumefaciens.
[0132] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct as described herein, wherein said recombinant host cell is E. coli.
[0133] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct as described herein, wherein said recombinant host cell is of fungal origin.
[0134] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct as described herein, wherein said recombinant host cell is of plant origin.
[0135] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct as described herein, wherein said recombinant host cell is a monocot.
[0136] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct as described herein, wherein said recombinant host cell is a dicot.
[0137] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA construct as described herein, wherein said recombinant host cell is rice.
[0138] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive or stress inducible manner, comprising: (a) a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof; or (b) a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1; or (c) a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0139] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising: (a) a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0140] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, comprising: (a) a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0141] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0142] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, comprising a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0143] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0144] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector comprising a DNA construct, said DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, comprising a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0145] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector as described herein, wherein said stress is salt stress.
[0146] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector as described herein, wherein said stress is water stress.
[0147] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 1.
[0148] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 9.
[0149] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 10.
[0150] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector as described herein, wherein said recombinant cell is of bacterial origin.
[0151] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector as described herein, wherein said recombinant cell is E. coli.
[0152] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector as described herein, wherein said recombinant cell is Agrobacterium tumefaciens.
[0153] In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector as described herein, wherein said recombinant cell is of fungal origin.
[0154] In an embodiment of the present disclosure, there is provided a transgenic plant or part thereof, including seeds, comprising within its genome, a DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive or stress inducible manner, comprising: (a) a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof; or (b) a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1; or (c) a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0155] In an embodiment of the present disclosure, there is provided a transgenic plant or part thereof, including seeds, comprising within its genome, a DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising: (a) a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0156] In an embodiment of the present disclosure, there is provided a transgenic plant or part thereof, including seeds, comprising within its genome, a DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, comprising: (a) a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0157] In an embodiment of the present disclosure, there is provided a transgenic plant or part thereof, including seeds, comprising within its genome, a DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0158] In an embodiment of the present disclosure, there is provided a transgenic plant or part thereof, including seeds, comprising within its genome, a DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, comprising a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0159] In an embodiment of the present disclosure, there is provided a transgenic plant or part thereof, including seeds, comprising within its genome, a DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0160] In an embodiment of the present disclosure, there is provided a transgenic plant or part thereof, including seeds, comprising within its genome, a DNA construct comprising a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, comprising a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1, wherein said DNA fragment is operably linked to a heterologous nucleic acid sequence.
[0161] In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds, capable of expression of a gene of interest driven heterologously by a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive or stress inducible manner, comprising: (a) a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof; or (b) a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1; or (c) a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1.
[0162] In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds, capable of expression of a gene of interest driven heterologously by a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof.
[0163] In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds, capable of expression of a gene of interest driven heterologously by a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, comprising a DNA fragment as set forth in SEQ ID NO: 1 or complement thereof.
[0164] In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds, capable of expression of a gene of interest driven heterologously by a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1.
[0165] In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds, capable of expression of a gene of interest driven heterologously by a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, comprising a DNA fragment having at least 90% sequence identity to any contiguous stretch of DNA sequence as set forth in SEQ ID NO: 1.
[0166] In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds, capable of expression of a gene of interest driven heterologously by a promoter capable of driving or regulating expression of an operably linked gene of interest in a constitutive manner, comprising a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1.
[0167] In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds, capable of expression of a gene of interest driven heterologously by a promoter capable of driving or regulating expression of an operably linked gene of interest in a stress inducible manner, comprising a DNA fragment capable of hybridizing under stringent conditions with any contiguous stretch of DNA sequence as set in SEQ ID NO: 1.
[0168] In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds as described herein, wherein said stress is water stress.
[0169] In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds as described herein, wherein said stress is salt stress.
[0170] In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 1.
[0171] In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 9.
[0172] In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 10.
[0173] In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds as described herein, wherein said transgenic plants or parts thereof, including seeds is a monocot.
[0174] In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds as described herein, wherein said transgenic plants or parts thereof, including seeds is a dicot.
[0175] In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds as described herein, wherein said transgenic plants or parts thereof, including seeds is rice.
[0176] In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds as described herein, wherein said transgenic plants or parts thereof, including seeds is Arabidopsis thaliana.
[0177] In an embodiment of the present disclosure, there is provided a method of generating a transgenic plant as described herein, said method comprising the steps: (a) obtaining plant cell(s); (b) obtaining a DNA construct as described herein; or a recombinant host cell comprising a DNA vector as described herein; (c) transforming said plant cell(s) with said DNA construct; or said recombinant host cell; and (d) selecting transformed plant cell(s) expressing said gene of interest.
[0178] In an embodiment of the present disclosure, there is provided a method of generating a transgenic plant as described herein, said method comprising the steps: (a) obtaining plant cell(s); (b) obtaining a DNA construct as described herein; (c) transforming said plant cell(s) with said DNA construct and (d) selecting transformed plant cell(s) expressing said gene of interest.
[0179] In an embodiment of the present disclosure, there is provided a method of generating a transgenic plant as described herein, said method comprising the steps: (a) obtaining plant cell(s); (b) obtaining a recombinant host cell comprising a DNA vector as described herein; (c) transforming said plant cell(s) with said recombinant host cell; and (d) selecting transformed plant cell(s) expressing said gene of interest.
[0180] In an embodiment of the present disclosure, there is provided a method of generating a transgenic plant as described herein, wherein said plant cell(s) is monocot.
[0181] In an embodiment of the present disclosure, there is provided a method of generating a transgenic plant as described herein, wherein said plant cell(s) is dicot.
[0182] In an embodiment of the present disclosure, there is provided a method of generating a transgenic plant as described herein, wherein said plant cell(s) is rice.
[0183] In an embodiment of the present disclosure, there is provided a method of generating a transgenic plant as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 1.
[0184] In an embodiment of the present disclosure, there is provided a method of generating a transgenic plant as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 9.
[0185] In an embodiment of the present disclosure, there is provided a method of generating a transgenic plant as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 10.
[0186] In an embodiment of the present disclosure, there is provided a method of generating a transgenic plant as described herein, wherein said gene of interest expression is root specific.
[0187] In an embodiment of the present disclosure, there is provided a method of generating a transgenic plant as described herein, wherein said gene of interest expression is constitutive.
[0188] In an embodiment of the present disclosure, there is provided a method of generating a transgenic plant as described herein, wherein said gene of interest expression is regulated in response to salt or water stress.
[0189] In an embodiment of the present disclosure, there is provided a method of generating a transgenic plant as described herein, wherein said gene of interest expression is regulated in response to salt stress.
[0190] In an embodiment of the present disclosure, there is provided a method of generating a transgenic plant as described herein, wherein said gene of interest expression is regulated in response to water stress.
[0191] In an embodiment of the present disclosure, there is provided a method of generating a transgenic plant as described herein, wherein said gene of interest expression is regulated in response to salt and water stress.
[0192] In an embodiment of the present disclosure, there is provided a method of generating a transgenic plant as described herein, wherein said transformation is carried out by a method selected from the group consisting of Agrobacterium mediated transformation method, particle gun bombardment method, in-planta transformation method, liposome mediated transformation method, protoplast transformation method, microinjection method, and macroinjection method.
[0193] In an embodiment of the present disclosure, there is provided a method of generating a transgenic plant as described herein, wherein said transformation is Agorbacterium mediated transformation method.
[0194] In an embodiment of the present disclosure, there is provided a method of heterologous expression of a gene of interest driven by a promoter as described herein, said method comprising the steps: (a) obtaining a DNA construct as described herein; or a recombinant host cell as described herein; (b) transforming plant cell(s) with said DNA construct, or said recombinant host cell to obtain transformed plant cell(s); and (c) selecting transformed plant cell(s) heterologously expressing said gene of interest.
[0195] In an embodiment of the present disclosure, there is provided a method of heterologous expression of a gene of interest driven by a promoter as described herein, said method comprising the steps: (a) obtaining a DNA construct as described herein; (b) transforming plant cell(s) with said DNA construct; and (c) selecting transformed plant cell(s) heterologously expressing said gene of interest.
[0196] In an embodiment of the present disclosure, there is provided a method of heterologous expression of a gene of interest driven by a promoter as described herein, said method comprising the steps: (a) a recombinant host cell as described herein; (b) transforming plant cell(s) with said recombinant host cell to obtain transformed plant cell(s); and (c) selecting transformed plant cell(s) heterologously expressing said gene of interest.
[0197] In an embodiment of the present disclosure, there is provided a method of heterologous expression of a gene of interest driven by a promoter as described herein, wherein said plant cell(s) is monocot.
[0198] In an embodiment of the present disclosure, there is provided a method of heterologous expression of a gene of interest driven by a promoter as described herein, wherein said plant cell(s) is dicot.
[0199] In an embodiment of the present disclosure, there is provided a method of heterologous expression of a gene of interest driven by a promoter as described herein, wherein said plant cell(s) is rice.
[0200] In an embodiment of the present disclosure, there is provided a method of heterologous expression of a gene of interest driven by a promoter as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 1.
[0201] In an embodiment of the present disclosure, there is provided a method of heterologous expression of a gene of interest driven by a promoter as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 9.
[0202] In an embodiment of the present disclosure, there is provided a method of heterologous expression of a gene of interest driven by a promoter as described herein, wherein said promoter sequence is as set forth in SEQ ID NO: 10.
[0203] In an embodiment of the present disclosure, there is provided a method of heterologous expression of a gene of interest driven by a promoter as described herein, wherein said gene of interest expression is constitutive.
[0204] In an embodiment of the present disclosure, there is provided a method of heterologous expression of a gene of interest driven by a promoter as described herein, wherein said gene of interest expression is regulated by water stress.
[0205] In an embodiment of the present disclosure, there is provided a method of heterologous expression of a gene of interest driven by a promoter as described herein, wherein said gene of interest expression is regulated by salt stress.
[0206] In an embodiment of the present disclosure, there is provided a method of heterologous expression of a gene of interest driven by a promoter as described herein, wherein said gene of interest expression is regulated by water and salt stress.
[0207] In an embodiment of the present disclosure, there is provided a method of heterologous expression of a gene of interest driven by a promoter as described herein, wherein said transformation is carried out by a method selected from the group consisting of Agrobacterium mediated transformation method, particle gun bombardment method, in-planta transformation method, liposome mediated transformation method, protoplast transformation method, microinjection method, and macroinjection method.
[0208] In an embodiment of the present disclosure, there is provided a method of heterologous expression of a gene of interest driven by a promoter as described herein, wherein said transformation is Agrobacterium mediated transformation method.
[0209] In an embodiment of the present disclosure, there is provided a promoter as described herein, wherein said promoter is useful in heterologous expression of a gene of interest in a transgenic plant in a constitutive manner.
[0210] In an embodiment of the present disclosure, there is provided a promoter as described herein, wherein said promoter is useful in heterologous expression of a gene of interest in a transgenic plant in response to salt stress.
[0211] In an embodiment of the present disclosure, there is provided a promoter as described herein, wherein said promoter is useful in heterologous expression of a gene of interest in a transgenic plant in response to water stress.
[0212] In an embodiment of the present disclosure, there is provided a promoter as described herein, wherein said promoter is useful in heterologous expression of a gene of interest in a transgenic plant in response to water and salt stress.
[0213] In an embodiment of the present disclosure, there is provided a promoter as described herein, wherein said promoter activity is root specific in response to water stress.
[0214] In an embodiment of the present disclosure, there is provided a promoter as described herein for use in generating transgenic plants which heterologously express a gene of interest driven by said promoter.
[0215] In an embodiment of the present disclosure, there is provided DNA construct as described herein for use in generating transgenic plants which heterologously express a gene of interest driven by said promoter.
[0216] In an embodiment of the present disclosure, there is provided a DNA vector as described herein for use in generating transgenic plants which heterologously express a gene of interest driven by said promoter.
[0217] In an embodiment of the present disclosure, there is provided a recombinant host cell as described herein for use in generating transgenic plants which heterologously express a gene of interest driven by said promoter.
[0218] Although the subject matter has been described in considerable detail with reference to certain preferred embodiments thereof, other embodiments are possible.
EXAMPLES
[0219] The disclosure will now be illustrated with working examples, which is intended to illustrate the working of disclosure and not intended to take restrictively to imply any limitations on the scope of the present disclosure.
Example 1
Plant Material and Growth Conditions
[0220] Mahyco parental line rice variety namely IR 58025 B was used and the seeds were stored at 28? C. It is an IIRI line and is publically available since 1990. The present invention can also be conducted with other publically available rice strains.
[0221] Arabidopsis thaliana, Ecotype: Columbia (col-0) seeds were used to generate plants. The seeds were stored at 25? C. The seeds are obtained in-house and the geographical origin of the seeds is in USA/Columbia.
Example 2
Isolation of DNA
[0222] Gossypium hirsutum probeset sequence ID Ghi.10553.1.S1_s_atgb|DN760229 was retrieved from PLEXdb (PLEXdbplant expression database) experiment in search of stress induced genes for promoter isolation. Predicted mRNA sequence and putative promoter sequence of the above gene bank ID gb|DN760229 was retrieved from cottongen.org/gb/gbrowse/JGI_221_Dgenome and www.cottongen.org/data/download/genome_JGI through CLC Genomics Workbench.
[0223] 5 untranslated region (UTR) was isolated from the Gossypium hirsutum LTP (Lipid-transfer protein)/SSP (Seed storage protein) gene and coded as p2 (SEQ ID NO: 1). The forward primer having a nucleotide sequence as set forth in SEQ ID NO: 2 and reverse primer having a nucleotide sequence as set forth in SEQ ID NO: 3 were designed for amplification of the p2 promoter from cotton. PCR conditions used for amplification are given below in Table 1.
TABLE-US-00013 TABLE 1 PCR step Temperature (? C.) Time (sec) No. of cycles Initial denaturation 95 300 1 Denaturation 94 30 35 Annealing 55 30 Elongation 72 120 Final elongation 72 600
Example 3
Construction of Vectors for Plant Transformation
[0224] Gateway cloning technology for directional cloning was used to clone p2 promoter. pENTR?/D-TOPO entry vector from Invitrogen? was used to obtain p2 promoter entry clone. (Catalog number: K2400-20 pENTR?/D-TOPO? Cloning Kit, with One Shot? TOP10 Chemically Competent E. coli).
[0225] The amplified PCR product (SEQ ID NO: 1, 9 or 10) was cloned in a gateway entry vector PENTR/D-TOPO and recombined in pMDC164 gateway expression vector.
[0226] The TOPO? cloning reaction conditions used are provided below:
[0227] p2 PCR elute: 2 ?l (20 ng/?l)
[0228] Salt solution: 0.5 ?l
[0229] pENTR/D-TOPO: 0.5 ?l (15-20 ng/?L linearized plasmid)
[0230] Total: 3 ?l
[0231] Transformation in Top10 one Shot? chemically competent E. Coli cells was performed as per the user guide.
[0232] LR recombination reaction was performed using pENTR p2 entry clone and pMDC164 gateway destination/expression vector. (pMDC 164 source: ABRC-abrc.osu.edu and Catalog number: 11791-020 for Gateway? LR Clonase? II Enzyme mix).
[0233] LR recombination reaction:
[0234] pENTR p2: 1 ?l (50 ng/?l)
[0235] LR clonase: 1 ?l
[0236] PMDC 164: 1.5 ?l (350 ng/?l)
[0237] Total: 3.5 ?l
[0238] Expression vector pMDC p2 (
Example 4
[0239] Transformation into Agrobacterium
[0240] Arabidopsis Transformation:
[0241] Agrobacterium-mediated transformation of Arabidopsis thaliana (Columbia-0) was performed using floral dip method as described in Das et al., 2011 with few modifications (Das et al., 2011, Advances in Bioscience and Biotechnology, 2, 59-67).
[0242] Growing of Arabidopsis Plants:
[0243] Arabidopsis seeds were kept for 3 days at 4? C. to break dormancy Vernalized seeds were layered on soilrite, in plastic cups. Cups were watered periodically and incubated in growth chamber or in culture room at 25? C. for 16 hr light/8 hr dark condition up to inflorescence or floral stage comes up. Primary inflorescence was cut to obtain secondary buds.
[0244] Agrobacterium Culture Preparation:
[0245] Two days before the initiation of culture preparation, the floral dip Agrobacterium strain EHA 105 carrying pMDC164 p2-GUS was streaked on LB agar with antibiotic selection and incubated at 28? C. (chloramphenicol 10 mg/L and kanamycin 50 mg/L). Just before floral dip grown Agrobacterium culture scrapped from the plate, it was suspended in inoculum 3 media and ?1.0 OD at 600 nm (stationary phase) was used for infection.
[0246] Floral Dip:
[0247] Plants in the stage of budding were taken and dipped in the Agrobacterium culture by upturning for 40 to 50 seconds and by shaking in between. After floral dip plants were kept horizontally in tray cover with polythene bag for overnight at 25? C. in dark. Next day infected plants were kept upright and incubated at 25? C. for 16 hr. light/8 hr. dark in culture room up to seed harvesting.
[0248] Screening of Positive Transformants:
[0249] Arabidopsis T.sub.0 seeds were kept for 3 days at 4? C. to break dormancy. Vernalized seeds were sterilized by 1.5% sodium hypochlrite for 1 minute then washed by D/W for 5 times and layered on 0.5?MS without sucrose and with 10 mg/L Hygromycin, incubated at 25? C. for 16 hr. light/8 hr dark in culture room.
[0250] Transformation efficiency was approximately 1% (not concentrated on transformation efficiency)
[0251] Media composition used are provided below:
[0252] 1] Inoculum 3MS salt: 0.5?, B5 vitamins: 1?, Glucose: 5%, BAP: 0.004M, Tween-20: 0.075% pH 5.7; 2] LB medium10 g tryptone, 5 g yeast extract, 10 g NaCl per litre, Agar: 0.8% pH 7.0.
[0253] Rice Transformation:
[0254] Agrobacterium-mediated transformation of rice was performed by method as described in Hiei et al., 2006, Plant Cell, Tissue and Organ Culture. The transformation was performed with some modification in the method. For Agrobacterium-mediated transformation of rice PMS34-25B Mahyco parental line were used.
[0255] Freshly isolated immature embryos from plants grown in a green house, after 10-12 days post anthesis were inoculated with A. tumefaciens EHA105 pMDC164 p2. Three days before infection Agrobacterium strain EHA 105 carrying pMDC164 p2::GUS was streaked on LB agar with antibiotic selection and incubated at 28? C. (Chloramphenicol 10 mg/L and Kanamycin 50 mg/L). Just before infection grown Agrobacterium culture scrapped from plate, it was suspended in AA infection medium and ?1.0 OD at 600 nm (stationary phage) used for infection.
[0256] Seed Sterilization:
[0257] The seeds were de-husked by hand and sterilized in 70% ethanol for 30 seconds and in 1.5% sodium hypochlorite solution for 5 minutes. The immature seeds were rinsed several times in sterile water, and immature embryos of between 1.0 and 1.5 mm in length were collected under a stereoscopic dissection microscope. 5 ?l of suspended Agrobacteriumculture dropped on scutellum of freshly isolated immature embryo incubated for 15 minutes then co-cultivated on NBAs medium for 4-6 days in dark at 25? C.
[0258] Resting Step:
[0259] After the co-cultivation, elongated shoots were removed from the immature embryos by a scalpel and the immature embryos were cultured on NBM medium that contained 250 mg/L cefotaxime and 100 mg/L carbenicillin with the scutellum-side up for 5 days.
[0260] Selection Step:
[0261] After resting step immature embryos were transferred on selection medium NBM with 250 mg/L cefotaxime and 50 mg 1/L hygromycin for 2 weeks followed by second selection of two weeks on the fresh NBM with 250 mg/L cefotaxime and 50 mg 1/L hygromycin medium.
[0262] Pre-Regeneration Step:
[0263] Callus clearly resistant to hygromycin derived from the scutella were transferred to a pre-regeneration medium NBPR that contained 40 mg/L hygromycin and 250 mg/L and cefotaxime and cultured for 10 days.
[0264] Regeneration Step:
[0265] Proliferating callus with green spots were cultured on an RNM regeneration medium that contained 30 mg/L hygromycin and 250 mg/L cefotaxime.
[0266] Rooting:
[0267] Regenerated plantlets were cultured on an MSN1.5 rooting medium that contained 30 mg/L hygromycin.
[0268] In all of the following steps, cultures were incubated at 28? C. under 16 hr. light and 8 hr. dark. The plants were hardened to soil in pots and grown to maturity in a greenhouse.
Media Composition
[0269] AA-infection: AA salts and amino acids (Toriyama and Hinata, 1985), B5 vitamins, 0.5 g/L, vitamin assay casamino acids, 20 g/l sucrose, 10 g/l D-glucose, 0.1 mM acetosyringone, pH 5.2.
[0270] NBM: N6 major salts, B5 minor salts and vitamins, 0.5 g/l vitamin assay casamino acids, 0.5 g/l L-proline, 0.3 g/1 L-glutamine, 20 g/l D-maltose, 36 g/1 D-mannitol, 2 mg/l 2,4-D, 1 mg/l NAA, 0.2 mg/1 BA, 5 g/l Gelrite, pH 5.8.
[0271] NBPR: N6 major salts, B5 minor salts and vitamins, 0.5 g/L vitamin assay casamino acids, 0.5 g/L L-proline, 0.3 g/L L-glutamine, 30 g/L D-maltose, 2 mg/L 2,4-D, 1 mg/L 1 NAA, 1 mg/L BA, 7 g/L Gelrite, pH 5.8.
[0272] RNM: N6 major salts, B5 minor salts and vitamins, 0.3 g/L vitamin assay casamino acids, 0.3 g/L L-proline, 0.3 g/L L-glutamine, 30 g/L D-maltose, 1 mg/L NAA, 3 mg/L BA, 4 g/L agarose Type I, pH 5.8.
[0273] MSN1.5: Full strength of MS major salts, MS minor salts, MS vitamins and 100 mg/L myo-inocitol, MS Cacl.sub.2, MS iron, (Murashige and Skoog, 1962), 30 g/L sucrose, 1.5 mg/L NAA, 3 g/L phytagel, pH 5.8
[0274] Eight independent events were regenerated and three were selected for analysis. Transformation efficiency was 30%.
[0275] Cotton Transformation
[0276] Cotton cultivar used for transformation Coker 310FR ((Gossypium hirsutum). Cotton transformation protocol: Agrobacterium-mediated transformation of cotton was performed by method as described by Chaudhary et al. 2003 and Kumar et al. 1998 with some modification.
[0277] Seed Surface Sterilization:
[0278] Mature delinted seeds were sterilized by 100% ethanol for 2 minutes followed by 0.1% mercuric chloride treatment for 5 minutes.
[0279] Seed Inoculation:
[0280] Mature surface sterilized seeds blotted well and inoculated on SIM culture medium in bottles and incubated at 28? C. in three tube lights for 5 days.
[0281] SIM Culture Medium:
[0282] MS salts and vitamins, 3% sucrose, pH 5.8, 0.8% agar.
[0283] Agrobacterium Culture Preparation:
[0284] Agrobacterium strain EHA105 pMDCp2 was streaked from glycerol stock on solid LB medium supplemented with 10 mg/l of chloramphenicol and 50 mg/l of kanamycin and allowed to grow for 48 hrs. at 28? C. The suspension was prepared in liquid LB medium supplemented with 10 mg/l of chloramphenicol and 50 mg/l of kanamycine and allowed to grow for overnight at 28? C. The obtained O.D. (approximately 2.0 at 600 nm of wavelength) was diluted 20 times in liquid CTM1 culture medium (so that final O.D. reached to approximately 0.1). This diluted Agrobacterium suspension was used for transformation.
[0285] Infection:
[0286] 0.5 cm long hypocotyl segments from 5 days old seedlings were used as explants for infection. Explants were soaked in Agrobacterium suspension for 20 minutes, blotted well and co-cultivated for 3 days at 22? C. on CTM1 culture medium supplemented with 10004 of acetosyringone and covered with a layer of Whatman filter paper #1 to reduce the overgrowth of Agrobacterium.
[0287] After co-cultivation explants were washed in liquid CTM1 culture medium supplemented with 250 mg/l of carbenicillin, blotted well and transferred 5 explants in each glass petri-dish containing 70-80 ml of CTM1 culture medium supplemented with 10 mg/l of hygromycin and 250 mg/l of augmentin, MES 500 mg/L. Incubated for 5-6 wk at 28? C. in single tube light.
[0288] Friable callus from 3 individual explants was mulched in each glass petri-dish containing 70-80 ml of CTM2 culture medium supplemented with 7.5 mg/l of hygromycin and 100 mg/l of augmentin. Incubated at 28? C. in single tube light for 7-8 wk.
[0289] Well developed embryogenic calli were sub-cultured on 50 ml of CTM2 culture medium supplimented with 7.5 mg/l of hygromycin and 250 mg/l of carbenicillin, incubated for 2 wk at 28? C. in single tube light.
[0290] Regular subcultures of embryogenic calli (15 days each) on 50 ml of CTM3 culture medium incubated at 28? C. in three tube lights, last sub-cultured plates will be maintained for another 15 days as a back up and also to pick up the elongated embryos. Embryos were also sub-cultured on same medium (germinated embryos to ? MSB solid culture medium).
[0291] Culture Media
[0292] CTM1 (liquid): MS salts and B.sub.5 vitamins, glucose 3% (wt/vol), 0.1 mg/l of 2,4 D (sigma) and 0.5 mg/l of kinetin (Sigma), pH 5.9 (in this medium glucose was not filter sterilized).
[0293] CTM1: MS salts and B.sub.5 vitamins, glucose 3% (wt/vol), 0.1 mg/l of 2,4 D (sigma) and 0.5 mg/l of kinetin (Sigma), 0.2% phytagel (Sigma), pH 5.9.
[0294] CTM2: MS salts and B.sub.5 vitamins, glucose 3% (wt/vol), 0.2% phytagel (Sigma), pH 5.9.
[0295] CTM3: MS salts (1.9 g/1 of KNO.sub.3 additional) and B.sub.5 vitamins, glucose 3% (wt/vol), 0.2% phytagel (Sigma), pH 5.9.
[0296] ? MSB (solid): ? MS salts, B.sub.5 vitamins, 1.5% (wt/vol)sucrose, pH 5.9, 0.2% (wt/vol) phytagel (sigma),
[0297] ? MSB (liquid): ? MS salts, B.sub.5 vitamins, 1.5% (wt/vol)sucrose, pH 5.9
[0298] In CTM1, CTM2 and CTM3 culture media, final volume of one litre culture medium without glucose was adjusted to 880 ml and autoclaved. Glucose (30 g) was dissolved in 100 ml of distilled water, so that the final volume reached to 120 ml was filter sterilized and added to the autoclaved warm culture media.
[0299] Wherever augmentin was used in culture medium, it was mixed in required concentration with glucose solution, pH was adjusted to 5.9, it was filter sterilized and then added to the autoclaved warm culture medium.
[0300] From cotton transformation one independent event was generated and selected. Very less explants were used for transformation.
Example 5
GUS Assay
[0301] Stable GUS expression of p2 promoter (SEQ ID NO: 1) was performed in rice and cotton. Tissues were put in GUS buffer for over night then bleached in alcohol and checked for expression.
[0302] The GUS buffer composition for 100 ml is provided below; [0303] Potassium phosphate buffer (0.2M): 50 ml [0304] Triton X-100 (0.1%): 10 ml [0305] Potassium ferricyanide (50 mM): 2 ml [0306] Potassium ferrocyanide (50 mM): 2 ml [0307] Methanol: 20 ml [0308] X-Gluc (50 mg/ml): 1 ml [0309] D/W: 15 ml
[0310]
[0311]
[0312] As seen in
[0313] Plant Tissue Extract:
[0314] 100 mg leaf tissues were ground in 200 ?l of extraction buffer in micro-centrifuge tube. The leaf tissue was then centrifuged at 12000 rpm for 15 minutes at 40C to remove cell debris. Supernatant was transferred to a fresh tube.
[0315] Mug Assay:
[0316] 20 ?l of homogenates (approximately ?g of protein) were mixed with 80 ?l of GUS assay buffer. The mixture was vortex and incubated at 370C for 30 minutes and 60 minutes water bath. 2 ?l of each reaction mixture and of each MU standard were mixed with 475 ?l of stop buffer. 200 ?l from above step were loaded by duplicated manner in a micro-titer plate and florescence were determined, excitation at 365 nm and emission at 444 nm).
Calculation of GUS Activity:
[0317] pmoles MU/?g of protein/min=(pmoles of MU/well)/0.5 ?g protein?minute of the assay
Composition of Buffers:
[0318] Extraction buffer: 50 mM NaPO4 pH 7.0, 10 mM EDTA, 0.1% Triton X-100, 0.1% sodium lauryl sarcosine, 10 mM ?-mercaptoethanol. Store at 40? C.
[0319] GUS buffer assay: 2 mM MUG extraction buffer (10 ml assay solution mix MUG 8.8 mg in extraction buffer) was prepared freshly just before use.
[0320] Concentrated MU calibration stock solution: Mixed 9.9 mg in 50 ml D/W to prepare 1 mM MU stock. 1:10 dilution was prepared to obtain 100 ?M MU stock and 1:50 dilution to obtain 20 ?l M stock solution.
[0321] For standard curve following dilutions were used: 0, 4, 8, 12, 20, 40, 100, 250, and 500 pmol MU.
[0322] Stop buffer: 200 mM Na2CO3 pH 11.2 (21.2 gm/L).
[0323] The assay was performed on transgenic leaf tissues. Table 2 shows rice p2-8A event (leaf tissue) GUS MU quantification results.
TABLE-US-00014 TABLE 2 Concentrations pmoles MU/?g Standard S. No. Sample pmoles/well protein/min Error 1 Wild Type 0.26184 1.7456 0.2635 2 Empty GUS 3.1583 21.0553 4.57 3 p2::GUS 452.28 3015.2 120.01 4 35S::GUS 750 5000 117.87
[0324] Along with 2 clones of p2-8 event (p2-8A and p2-8B) p2-4 and p2-6 events from rice and one event from cotton CT/pMDC p2-1B (which are PCR positive for presence of p2 promoter and qualitative histochemical GUS positive) are screened for quantitative GUS expression.
[0325] Among three events of rice p2-8 showed the best expression and cotton event also showed the GUS quantification value near to the p2-8 event.
[0326] Quantification values in pMoles MU/?g protein/min: Wild Type (1.7456), Empty GUS (21.0553), Rice eventsp2-8A (3015.2), p2-4B (185.33), p2-6B (61.97), Cotton eventp2-1B (2484.5) and 35S::GUS (5000).
[0327]
Example 6
Analysis of Promoter by Plant Cis-Acting Regulatory DNA Elements (PLACE) Database
[0328] PLACE analysis provides information on Cis-regulatory element present in p2 promoter. Motifs involved in abiotic stress response, transcription factor binding sites, tissue specificity are present in the p2 promoter were studied through deletion analysis to get desired activity of the promoter.
[0329] Analysis of the p2 promoter fragment (SEQ ID NO: 1) using PLACE database identified various stress responsive and tissue specific motifs in the p2 promoter sequence. [Higo K et al., 1999, Nucleic Acids Res.; 27(1):297-300; Omodele et al., 2010, Computational Biology and Chemistry 34, 268-283.] Table 3 below provides a list of motifs identified in the p2 promoter.
TABLE-US-00015 TABLE3 Listofmotifsidentifiedinthep2promoter. Table3 S.No. Motifs Sequence Function 1. ?300ELEMENT TGCAAAAG Seedstorageproteindeposition- endospermexpression 2. ABRELATERD1 ACGTG Confersdehydration 3. ACGTABOX TACGTA BindingofbZIPTF 4. ACGTATERD1 ACGT Confersdehydration 5. AMYBOX2 TATCCAT alpha-amylaseAmy3Dexpression duringsugarstarvation 6. ANAERO2CONSENSUS AGCAGC Fermentativepathway 7. ARFAT TGTCTC Bindingsiteforauxinresponse factor 8. ARR1AT AGATT ARR1-bindingelementoperateas transcriptionalactivators 9. ASF1MOTIFCAMV TGACG Defenseresponseelement 10. BIHD1OS TGTCA Transcriptionalfactorinvolvedin diseaseresistanceresponses 11. BOXIINTPATPB ATAGAA Transcriptioninitiation 12. BOXLCOREDCPAL ACCTTCC Transcriptionalactivatorofthe phenylalanineammonia-lyasegene 13. CAATBOX1 CAAT Conferstissuespecificity 14. CACTFTPPCA1 TACT,CACT Mesophyll-specificgene expressionintheC4plant 15. CARGNCAT SEQIDNO:5 Regulatesexpressionofagene encodinganenzymeinvolvedin gibberellinmetabolism. 16. CARGCW8GAT SEQIDNO:6 Bindingsiteselectionfortheplant MADSdomainproteinAGL15 17. CCA1ATLHCB1 AACAATCT Amyb-relatedtranscriptionfactor isinvolvedinthephytochrome regulationofanArabidopsisLhcb gene 18. CCAATBOX1 CCAAT Conferstissuespecificity 19. CIACADIANLELHC SEQIDNO:7 Circadianexpression 20. CURECORECR GTAC CoreofaCuRE(copper-response element)involvedinoxygen- response 21. DOFCOREZM AAAG Transcriptionfactorsareinvolved incarbonmetabolism 22. DPBFCOREDCDC3 ACACAAG/ Tissuespecificity ACACCCG 23. EBOXBNNAPA CAAGTG/ Tissuespecificity CATGTG/ CAAATG/ CAGCTG/ CACCTG/ CAATTG 24. EECCRCAH1 GACTTTC/ BindingsiteofMybtranscription GATTTGC/ factor GATTTGC 25. ELRECOREPCRP1 TTGACC ElicitorResponsiveElement 26. GATABOX GATA Tissuespecificity 27. GT1CONSENSUS GATAAT/ Salt GAAAAT/ toleranceandpathogenesis GATAAA/ interaction GAAAAA 28. GT1CORE GGTTAA Salt toleranceandpathogenesis interaction 29. GT1GMSCAM4 GAAAAA Salt toleranceandpathogenesis interaction 30. GTGANTG10 GTGA Pollenspecificexpression 31. HDZIP2ATATHB2 TAATAATTA Transcriptionfactorsignalsin Plantmorphogenesis 32. IBOXCORE GATAA Conservedsequenceupstreamof light-regulated genes 33. INRNTPSADB CTCATTTC Initiatorelements 34. LECPLEACS2 TAAAATAT Defenseresponse 35. MYBST1, TAACCA Dehydrationresponsiveelement 36. MYCATERD1 CATGTG Conferstissuespecificity 37. MYCCONSENSUSAT CAAGTG/ Conferstissuespecificity CATGTG/ CAGCTG 38. NODCON1GM AAAGAT Nodulespecific 39. NODCON2GM CTCTT Nodulespecific 40. NTBBF1ARROLB, ACTTTA Tissuespecificity 41 OSE1ROOTNODULE AAAGAT Organspecificelement 42. P1BS GAATATAC Phosphatestarvationresponse 43. POLASIG1 AATAAA Plantspecificpoly(A)signals 44. POLLEN1LELAT52, AGAAA Pollenspecificactivation 45. PREATPRODH ACTCAT Hypoosmolarity-responsive element 46. PRECONSCRHSP70A SEQIDNO:8 Plastidresponseelementthatacts asanenhancer 47. RAV1AAT CAACA Tissuespecificity 48. RBCSCONSENSUS AATCCAA Expressionofgenesencoding ribulose-1,5-bisphosphate carboxylase 49. ROOTMOTIFTAPOX1 ATATT Tissuespecificity 50. RYREPEATBNNAPA CATGCA Seedspecificexpression 51. S1FBOXSORPS1L21 ATGGTA Encodingribosomalprotein 52. S1FSORPL21 ATGGTATT Encodingplastidribosomalprotein 53. SEF4MOTIFGM7S ATTTTTG Seedstorageprotein 54. SORLIP1AT GCCAC Tissuespecificity 55. SURE2STPAT21 AATACTAAT Directmetabolicand developmentalregulationof storageproteingene 56. SURECOREATSULTR11 GAGAC Sulfurdeficiencyresponse 57. TAAAGSTKST1 TAAAG Guardcell-specificgene expression 58. TATABOX2 TATAAAT Accurateinitiation 59. TATABOX3 TATTAAT Accurateinitiation 60. TATABOX5 TTATTT Accurateinitiation 61. TATABOXOSPAL TATTTAA DNAbindingelement 62. TATCCAOSAMY TATCCA Sugarandhormoneregulation 63. TATCCAYMOTIFOSRAMY3D TATCCAT Sugar repression 64. TBOXATGAPB ACTTTG Modulatorsoflight-activated transcription 65. TGACGTVMAMY TGACGT Seedspecificexpression 66. WBOXATNPR1 TTTGACC Transcriptionalfactorinvolvedin environmentalstresses 67. WBOXHVISO1 TGACT Sugar-responsiveelements 68. WBOXNTERF3 TGACC/ Defenseresponse TGACT 69. WRKY71OS TGAC Salt toleranceandpathogenesis interaction
Example 7
Deletion Analysis of Promoter p2
[0330] In order to further characterize the promoter p2 activity, deletion analysis was carried out. 2 different deletion constructs were prepared, namely, p2?1 (SEQ ID NO: 9), and p2?2 (SEQ ID NO: 10). Two deletion promoters have been cloned in pMDC expression vector, mobilized in EHA 105 Agrobacterium strain (EHA pMDC p2 ?1 And EHA pMDC p2 ?2) for plant transformation. The promoter sequences were earlier confirmed by sequencing.
[0331] The PCR conditions used to produce the fragment of p2?1 are as given below in Table 4. The forward and reverse primer set used to amplify SEQ ID NO: 9 are as set forth in SEQ ID NO: 11, and SEQ ID NO: 12 respectively.
TABLE-US-00016 TABLE 4 PCR step Temperature (? C.) Time (sec) No. of cycles Initial denaturation 95 300 1 Denaturation 94 30 40 Annealing 51 30 Elongation 72 20 Final elongation 72 600
[0332] The PCR conditions used to produce the fragment of p2?2 are as given below in Table 5. The forward and reverse primer set used to amplify SEQ ID NO: 10 are as set forth in SEQ ID NO: 13, and SEQ ID NO: 14 respectively.
TABLE-US-00017 TABLE 5 PCR step Temperature (? C.) Time (sec) No. of cycles Initial denaturation 95 300 1 Denaturation 94 30 40 Annealing 50 30 Elongation 72 60 Final elongation 72 600
[0333] Table 6 below depicts the cis-regulatory motif analysis (PLACE) of p2?1 deletion fragment.
TABLE-US-00018 TABLE6 Sr. Factoror Signal No. SiteName Loc. Sequence Function 1 GTGANTG10 5 GTGA Pollenspecific (+) 2 SURECOREATS 7 GAGAC Coreofsulfur-responsiveelement ULTR11 (+) 3 CAATBOX1 27 CAAT Sequencesresponsibleforthetissue (+) specificpromoteractivityofapea legumingeneintobacco 4 POLASIG3 28 AATAAT PlantpolyAsignal (+) 5 RAV1AAT 36 CAACA Bindingconsensussequenceof (+) Arabidopsistranscriptionfactor, RAV1/Theexpressionlevelof RAV1wererelativelyhighinrosette leavesandroots 6 DPBFCOREDCD 38 ACACNNG AnovelclassofbZIPtranscription C3 (+) factors,DPBF-1and2(Dc3 promoter-bindingfactor-1and2) bindingcoresequence;Foundinthe carrot(D.c.)Dc3genepromoter; Dc3expressionisnormallyembryo- specific,andalsocanbeinducedby ABA 7 LTRECOREATC 42 CCGAC Coreoflowtemperatureresponsive OR15 (+) element(LTRE)ofcor15agenein Arabidopsis/Aportionofrepeat-C (C-repeat),TGGCCGAC,whichis repeatedtwiceincor15apromoter. 8 PRECONSCRHSP 42 SCGAYNR ConsensussequenceofPRE(plastid 70A (+) NNNNNNN responseelement)inthepromoters NNNNNNN ofHSP70AinChlamydomonas; NHD InvolvedininductionofHSP70A genebybothMgProtoandlight. 9 DOFCOREZM 54 AAAG CoresiterequiredforbindingofDof (+) proteinsinmaize/FourcDNAs encodingDof proteins,Dof1,Dof2,Dof3and PBF,havebeenisolatedfrommaize; PBFisanendospermspecificDof proteinthatbindstoprolaminbox 10 CACTFTPPCA1 78 YACT Mesophyllexpressionmodule1/ (+) foundinthecis-regulatoryelement inthedistalregionofthe phosphoenolpyruvatecarboxylase (ppcA1)oftheC4dicot 11 MYBPLANT 85 MACCWA PlantMYBbindingsite (+) MC 12 INRNTPSADB 102 YTCANTY Inr(initiator) elementsfoundin (+) Y thetobaccopsaDbgenepromoter withoutTATAboxes;Light- responsivetranscriptionofpsaDb dependsonInr,butnotTATAbox; 13 TATABOX2 112 TATAAAT TATAbox;TATAboxfoundin (+) the5upstreamregionofpealegA gene;sporaminAofsweetpotato; TATAboxfoundinbeta-phaseolin promoter(Graceetal.);sequence andspacingof TATAboxelementsarecriticalfor accurateinitiation. 14 CCA1ATLHCB1 119 AAMAATC CCA1bindingsite;CCA1protein (+) T (myb-relatedtranscriptionfactor) interactwithtwoimperfectrepeats ofAAMAATCTinLhcb1*3geneof ArabidopsisthalianaRelatedto regulationbyphytochrome. 15 CAATBOX1 121 CAAT CAATpromoterconsensus (+) sequence foundinlegAgeneof pea;CAAT;legA;seed;pea(Pisum sativum)ShirsatA,WilfordN,Croy R,BoulterD Sequencesresponsibleforthetissue specificpromoteractivityofapea legumingeneintobacco 16 SORLIP1AT 138 GCCAC oneofSequencesOver- (+) RepresentedinLight-Induced Promoters(SORLIPs)in Arabidopsis 17 DOFCOREZM 152 AAAG CoresiterequiredforbindingofDof (+) proteinsinmaize(Z.m.);Dof proteinsareDNAbindingproteins, withpresumablyonlyonezinc finger,andareuniquetoplants
[0334] Table 7 below depicts the cis-regulatory motif analysis (PLACE) of p2?2 deletion fragment.
TABLE-US-00019 TABLE7 Sr. Factoror Signal No. SiteName Loc. Sequence Function 1 RYREPEATBN 8(+) CATGCA RYrepeat foundinRY/Gbox(the NAPA complexcontainingthetwoRY repeatsandtheG-box)ofnapAgene inBrassicanapus(B.n.);Found between-78and-50;Requiredfor seedspecificexpression; 2 DOFCOREZM 24(+), AAAG CoresiterequiredforbindingofDof 29(+), proteinsinmaize/FourcDNAs 149(+), encodingDof 384(+), proteins,Dof1,Dof2,Dof3and 480(+), PBF,havebeenisolatedfrommaize; 514(+), PBFisanendospermspecificDof 587(+), proteinthatbindstoprolaminbox 592(+), 626(+), 675(+), 773(+) 3 POLLEN1LEL 26(+), AGAAA Oneoftwoco-dependentregulatory AT52 478(+), elementsresponsibleforpollen 589(+) specificactivationoftomato(L.e.) lat52gene 4 MYBST1 32(+) GGATA CoremotifofMybSt1(apotato MYBhomolog)bindingsite; MybSt1cDNAclonewasisolated byusingCaMV35Spromoter domainAasaprobe(Baranowskij etal.1994) 5 GATABOX 33(+), GATA GATAbox;GATAmotifin 107(+), CaMV35Spromoter;Bindingwith 279(+), ASF-2; 411(+), ThreeGATAboxrepeatswere 552(+) foundinthepromoterofPetunia 560(+) (P.h.)chlorophylla/bbinding protein,Cab22gene;Requiredfor highlevel,lightregulated,andtissue specificexpression;Conservedin thepromoterofallLHCIItypeICab genes; 6 GT1CONSENSUS 33(+), GRWAAW ConsensusGT-1bindingsitein 279(+), manylight-regulatedgenes, 524(+), e.g.,RBCSfrommanyspecies, 560(+) PHYAfromoatandrice,spinach RCAandPETA,andbeanCHS15; R= A/G;W= A/T;Foracompilation ofrelatedGTelementsandfactors, seeVillainetal.(1996);GT-1can stabilizetheTFIIA-TBP-DNA (TATAbox)complex;The activationmechanismofGT-1may beachievedthroughdirect interactionbetweenTFIIAandGT- 1;BindingofGT-1-likefactorsto thePR-1a PromoterinfluencesthelevelofSA- induciblegeneexpression. 7 IBOXCORE 33(+), GATAA Ibox;I-box;Conserved 107(+), sequenceupstreamoflight-regulated 279(+), genesofbothmonocotsanddicots; 560(+) 8 ASF1MOTIFC 57(+) TGACG ASF-1bindingsiteinCaMV35S AMV promoter;ASF-1bindstotwo TGACGmotifs;(AS1);Foundin HBP-1bindingsiteofwheathistone H3gene;TGACGmotifsarefound inmanypromotersandareinvolved intranscriptionalactivationof severalgenesbyauxinand/or salicylicacid 9 TGACGTVMA 57(+) TGACGT TGACGTmotiffoundinthe MY Vignamungo(V.m.)alpha-Amylase (Amy)genepromoter;Located between-128and-123;Requiredfor highlevelexpressionofalpha- Amylaseinthecotyledonsofthe germinatedseeds; 10 WRKY71OS 57(+), TGAC AcoreofTGAC-containingW- 318(+) boxof,e.g.,Amy32bpromoter; BindingsiteofriceWRKY71,a transcriptionalrepressorofthe gibberellinssignalingpathway; ParsleyWRKYproteinsbind specificallytoTGAC-containingW boxelementswithinthe Pathogenesis-RelatedClass10(PR- 10)genes(Eulgemetal.,1999) 11 ABRELATERD1 59(+) ACGTG ABRE-likesequence(from-199to -195)requiredforetiolation-induced expressionoferd1(earlyresponsive todehydration)inArabidopsis; 12 ACGTATERD1 59(+), ACGT ACGTsequence(from-155to-152) 201(+), requiredforetiolation-induced 449(+), expressionoferd1(earlyresponsive 555(+) todehydration)inArabidopsis 13 MYBCORE 68(+) CNGTTR BindingsiteforallanimalMYBand atleasttwoplantMYBproteins ATMYB1andATMYB2,both isolatedfromArabidopsis; ATMYB2isinvolvedinregulation ofgenesthatareresponsivetowater stressinArabidopsis;Apetunia MYBprotein(MYB.Ph3)is involvedinregulationofflavonoid biosynthesis(Solanoetal.) 14 CACTFTPPCA1 80(+), YACT Mesophyllexpressionmodule1/ 169(+), foundinthecis-regulatoryelement 307(+), inthedistalregionofthe 417(+), phosphoenolpyruvatecarboxylase 699(+) (ppcA1)oftheC4dicot 15 HDZIP2ATAT 83(+) TAATMA BindingsiteoftheArabidopsis HB2 TTA (A.T.)homeoboxgene(ATHB-2) foundinitsownpromoter;Located between-72and-80;Similartothe HD-ZIP-2bindingconsensus sequence;ATHB-2isregulated bylightsignalswhichfunctionasa negativeautoregulatorofitsown gene;M= C/A; 16 POLASIG3 84(+), AATAAT PlantpolyAsignal;Consensus 423(+), sequenceforplant 649(+) 17 ROOTMOTIFT 92(+), ATATT Motiffoundbothinpromotersof APOX1 206(+), rolD;ElmayanT,TepferM 259(+), Evaluationintobaccooftheorgan 269(+), specificityandstrengthoftherolD 298(+), promoter,domainAofthe35S 333(+), promoterandthe35S{circumflex over ()}2promoter 364(+), TransgenicRes4:388-396(1995) 412(+), 506(+) 18 INRNTPSADB 97(+), YTCANT Inr(initiator)elementsfoundinthe 723(+) YY tobaccopsaDbgenepromoter withoutTATAboxes;Light- responsivetranscriptionofpsaDb dependsonInr,butnotTATAbox. 19 CAATBOX1 99(+), CAAT Sequencesresponsibleforthetissue 400(+), specificpromoteractivityofapea 499(+), legumingeneintobacco 648(+), 742(+) 20 POLASIG1 117(+), AATAAA PolyAsignal;polyAsignalfound 188(+), inlegAgeneofpea,ricealpha- 264(+), amylase;-10to-30inthecaseof 484(+) animalgenes.Nearupstream elements(NUE)inArabidopsis (Lokeetal.2005) 21 EBOXBNNAP 175(+), CANNTG E-boxofnapAstorage-proteingene A 499(+) ofBrassicanapus 22 MYCCONSEN 175(+), CANNTG MYCrecognitionsitefoundinthe SUSAT 499(+) promotersofthedehydration- responsivegenerd22andmany othergenesinArabidopsis;Binding siteofATMYC2/MYCrecognition sequenceinCBF3promoter; BindingsiteofICE1(inducerof CBFexpression1)thatregulatesthe transcriptionofCBF/DREB1genes inthecoldinArabidopsis;ICE1 (Chinnusamyetal.,2004);) 23 GTGANTG10 178(+), GTGA GTGAmotiffoundinthe 545(+) promoterofthetobacco(N.t.)late pollengeneg10whichshows homologytopectatelyaseandisthe putativehomologueofthetomato genelat56;Locatedbetween-96and -93 24 ACGTABOX 200(+) TACGTA A-boxaccordingtothe nomenclatureofACGTelementsby Fosteretal.(FASEBJ8:192-200 (1994));OneofACGTelements; Foundinocsgene;RITA-1binding site(Izawaetal.1994);Gmotif byToyofukuetal.(1998);Gmotif andTATCCAYmotif(aGATA motifasitsantisensesequence;are responsibleforsugarrepression (Toyofukuetal.1998) 25 SEF4MOTIFG 228(+) SEF4bindingsite;Soybean M75 (G.m.)consensussequencefoundin 5upstreamregion(-199)ofbeta- conglycinin(7Sglobulin)gene (Gmg17.1);BindingwithSEF4 (soybeanembryofactor4);R= A/G; soybean;seed;storageprotein;7S; globulin;beta-conglycinin; 26 ARR1AT 233(+), NGATT ARR1-bindingelementfoundin 238(+), Arabidopsis;ARR1isaresponse 433(+), regulator;N= G/A/C/T;AGATTis 519(+), foundinthepromoterofricenon- 567(+), symbiotichaemoglobin-2(NSHB) 572(+), gene(Rossetal.,2004) 602(+) 27 TATABOX5 242(+), TTATTT TATAbox;TATAboxfoundin 428(+) the5upstreamregionofpea(Pisum sativum)glutaminesynthetasegene; afunctionalTATAelementbyin vivoanalysis 28 TATABOXOSP 243(+), TATTTAA BindingsiteforOsTBP2,foundin AL 270(+) thepromoterofricepalgene encodingphenylalanineammonia- lyase;OsTFIIBstimulatedtheDNA bindingandbendingactivitiesof OsTBP2andsynergistically enhancedOsTBP2-mediated transcriptionfromthepalpromoter 29 S1FBOXSORP 252(+) ATGGTA S1Fboxconservedbothinspinach S1L21 (S.o.)RPS1andRPL21genes encodingtheplastidribosomal proteinS1andL21,respectively; Negativeelement;Mightplayarole indownregulatingRPS1and RPL21promoteractivity(Lagrange etal.,1993); 30 TATABOX3 260(+), TATTAAT TATAbox;TATAboxfoundin 299(+), the5upstreamregionofsweet 334(+), potatosporaminAgene 365(+) 31 PRECONSCRH 2779+), SCGAYN ConsensussequenceofPRE(plastid SP70A 663(+) RNNNNN responseelement)inthepromoters NNNNNN ofHSP70AinChlamydomonas; NNNNHD InvolvedininductionofHSP70A genebybothMgProtoandlight. 32 NTBBF1ARRO 308(+) ACTTTA NtBBF1(Dofproteinfromtobacco) LB bindingsiteinAgrobacterium rhizogenes(A.r.)rolBgene;Found inregulatorydomainB(-341to -306);Requiredfortissue-specific expressionandauxininduction; rolB;Dof;auxin;domainB;root; shoot;meristem;vascular; 33 WBOXATNPR 317(+) TTGAC W-boxfoundinpromoterof 1 Arabidopsisthaliana(A.t.)NPR1 gene;Locatedbetween+70and+79 intandem;Theywererecognized specificallybysalicylicacid(SA)- inducedWRKYDNAbinding proteins; 34 CURECORECR 341(+) GTAC GTACisthecoreofaCuRE (copper-responseelement)foundin Cyc6andCpx1genesin Chlamydomonas;Alsoinvolvedin oxygen-responseofthesegenes; 35 CARGNCAT 344(+) CCWWW NoncanonicalCArGmotif(CC- WWWWW Wx8-GG)foundinthepromoter GG regionofDTA1(AtGA2ox6);A relevantciselementfortheresponse toAGL15(AGAMOUS-like15)in vivo/TheembryoMADSdomain proteinAGAMOUS-Like15 directlyregulatesexpressionofa geneencodinganenzymeinvolved ingibberellinmetabolism. PlantCell16:1206-1219(2004 36 CARGCW8GA 345(+) CWWWW AvariantofCArGmotifwitha T WWWWG longerA/T-richcore;Bindingsite forAGL15(AGAMOUS-like15); W= A/T;CArG;AGL15; AGAMOUS;MADS;Arabidopsis thalianaTangW,PerrySE.Binding siteselectionfortheplantMADS domainproteinAGL15:aninvitro andinvivostudy.JBiol Chem.278:28154-28159(2003) 37 LECPLEACS2 360(+) TAAAAT CoreelementinLeCp(tomatoCys AT protease)bindingcis-element(from -715to-675)inLeAcs2gene; cysteineprotease;ethylene; xylanase;ACS;Lycopersicon esculentum(tomato)MatarassoN, SchusterS,AvniA. Anovelplantcysteineproteasehas adualfunctionasaregulatorof1- aminocyclopropane-1-carboxylic Acidsynthasegeneexpression. PlantCell.17:1205-1216.(2005) 38 TATABOX2 374(+), TATAAAT TATAbox;TATAboxfoundin 733(+) the5upstreamregionofpealegA gene;sporaminAofsweetpotato; TATAboxfoundinbeta-phaseolin promoter(Graceetal.);sequence andspacingof TATAboxelementsarecriticalfor accurateinitiation 39 TAAAGSTKST 383(+) TAAAG TAAAGmotiffoundinpromoterof 1 Solanumtuberosum(S.t.)KST1 gene;Targetsitefortrans-acting StDof1proteincontrollingguard cell-specificgeneexpression;KST1 geneencodesaK+ influxchannelof guardcells 40 AMYBOX2 452(+) TATCCAT amylasebox;amylaseelement; Conservedsequencefoundin 5upstreamregionofalpha-amylase geneofrice,wheat,barley;amylase box(Huangetal.1990);amylase element(Hwanget al.,1998);Threecis-elements requiredforricealpha-amylase Amy3Dexpressionduringsugar starvationPlantMolBiol36:331- 341(1998) 41 TATCCAYMO 452(+) TATCCAY TATCCAYmotiffoundinrice TIFOSRAMY3 (O.s.)RAmy3Dalpha-amylasegene D promoter;Y= T/C;aGATAmotifas itsantisensesequence;TATCCAY motifandGmotifareresponsible forsugar repression(Toyofukuetal.1998); 42 TATCCAOSA 452(+) TATCCA TATCCAelementfoundinalpha- MY amylasepromotersofrice(O.s.)at positionsca.90to150bpupstreamof thetranscriptionstartsites;Binding sitesofOsMYBS1,OsMYBS2and OsMYBS3whichmediatesugarand hormoneregulationofalpha- amylasegeneexpression; 43 MYB1AT 490(+) WAACCA MYBrecognitionsitefoundinthe promotersofthedehydration- responsivegenerd22andmany othergenesinArabidopsis;W= A/T; 44 -300ELEMENT 510(+) TGHAAA Presentupstreamofthepromoter RK fromtheB-hordeingeneofbarley andthealpha-gliadin,gamma- gliadin,andlowmolecularweight gluteningenesofwheat 45 NODCON1GM 514(+) AAAGAT Oneoftwoputativenodulin consensussequences; (NODCON2GM);nodulinGlycine max(soybean)SandalNN,BojsenK, MarckerKA.Asmallfamilyof nodulespecificgenesfrom soybean.NucleicAcidsRes. 15:1507-1519(1987). 46 OSE1ROOT 514(+) AAAGAT Oneoftheconsensussequence NODULE motifsoforgan-specificelements (OSE)characteristicofthe promotersactivatedininfectedcells ofrootnodules 47 BIHD1OS 538(+) TGTCA BindingsiteofOsBIHD1,arice BELLhomeo-domaintranscription factor;HD;homeodomain;Oryza sativa(rice)LuoH, SongF,GoodmanRM,ZhengZ. Up-regulationofOsBIHD1,arice geneencodingBELLhomeodomain transcriptionalfactor,indisease resistanceresponses.PlantBiol (Stuttg).7:459-468(2005). 48 EECCRCAH1 603(+) GANTTN EEC;Consensusmotifofthetwo C enhancerelements,EE-1andEE-2, bothfoundinthepromoterregionof theChlamydomonasCah1 (encodingaperiplasmiccarbonic anhydrase);BindingsiteofMyb transcriptionfactorLCR1(see Yoshiokaetal,2004);N= A/G/C/T; 49 SORLIP1AT 608(+) GCCAC oneofSequencesOver- 759(+) RepresentedinLight-Induced Promoters(SORLIPs)in Arabidopsis 50 SURECOREAT 628(+) GAGAC Coreofsulfur-responsiveelement SULTR11 (SURE)foundinthepromoterof SULTR1;1high-affinitysulfate transportergeneinArabidopsis 51 RAV1AAT 657(+) CAACA Bindingconsensussequenceof Arabidopsistranscriptionfactor, RAV1/Theexpressionlevelof RAV1wererelativelyhighinrosette leavesandroots. 52 DPBFCOREDC 659(+) ACACNN AnovelclassofbZIPtranscription DC3 G factors,DPBF-1and2(Dc3 promoter-bindingfactor-1and2) bindingcoresequence;Foundinthe carrot(D.c.)Dc3genepromoter; Dc3expressionisnormallyembryo- specific,andalsocanbeinducedby ABA. 53 LTRECOREAT 663(+) CCGAC Coreoflowtemperatureresponsive COR15 element(LTRE)ofcor15agenein Arabidopsis/Aportionofrepeat-C (C-repeat),TGGCCGAC,whichis repeatedtwiceincor15apromoter. 54 MYBPLANT 706(+) MACCWA PlantMYBbindingsite MC 55 CCA1ATLHCB 740(+) AAMAAT CCA1bindingsite;CCA1protein 1 CT (myb-relatedtranscriptionfactor. interactwithtwoimperfectrepeats ofAAMAATCTinLhcb1*3geneof ArabidopsisthalianaRelatedto regulationbyphytochrome.
Example 8
Deletion Construct Transformation in Model Crops
[0335] In order to ascertain the activity of the two deletion constructs, pMDC?1, and pMDC?2, as described in detail elsewhere in the instant disclosure, pMDC p2?1-1, pMDC p2?2-1 positive transformants were obtained and confirmed by PCR as well as histochemical GUS assays in both Arabidopsis (
[0336] Quantification of GUS activity in transformed rice leaf samples (
TABLE-US-00020 TABLE 8 MUG Assay result pMOI pMOI MU/?g MU/?g protein/ protein/ Plant code min min Average SE EP control 1.69 3.9 2.795 1.105 CaMV35S 25153.37 30980.18 28066.775 2913.405 p2?1- 987.76 1310.55 1149.155 161.395 Exp.2-8B p2?1- 694.69 948.23 821.46 126.77 Exp.1-7B p2?2- 581.49 790.14 685.815 104.325 Exp.1-5A p2?2- 3159.02 4307.244783 3733.132392 574.1123915 Exp.1-6B p2-8B-7-4 1607.4 2147.694913 1877.547456 270.1474565 p2-8A- 3279.52 4287.926852 3783.723426 504.203426 15-9
TABLE-US-00021 TABLE 9 MUG assay result pMOI MU/?g pMOI MU/?g Plant code protein/min protein/min Average SE EP control 1324.06 2251.2 1787.63 463.57 CaMV35S-T1 63433.07 82376.78 72904.925 9471.855 plant p2?1-Exp.2-8B 5772.9 8100.87 6936.885 1163.985 p2?1-Exp.1-7B 21325.24 29711.92 25518.58 4193.34 p2?2-Exp.1-5A 8335 10869.04 9602.02 1267.02 p2?2-Exp.1-6B 5848.89 7890.37 6869.63 1020.74 p2-8B-7-4 3577.43 4915.02 4246.225 668.795 p2-8A-15-9 59131.81 81472.72 70302.265 11170.455
[0337] These data as discussed above suggest that the full promoter p2 likely comprises sequences upstream of the deletion constructs, which aid in expression of a gene of interest operably linked to the said promoter.
Example 9
Promoter p2 Activity Under Stress Conditions
[0338] Once it was determined that the p2 promoter, and deletion constructs can drive expression of a gene of interest, GUS in this case, it was examined if the promoter exhibits any differential activity in the presence of stressors such as salt, water, or temperature (heat/cold).
[0339] In two different transgenic Arabidopsis plants harbouring the p2 promoter operably linked to GUS, flowering stage plants (48 days old), or rice transgenics were subjected to 150 mM salt (NaCl) stress for 2 hours and 5 hours respectively. As seen in
[0340] Transgenic Arabidopsis harbouring the p2 promoter were also subjected to water stress by withholding 45 day old plants from water. Contrary to the results obtained in salt stress, it was observed that water stress leads to reduction in GUS levels in leaves sampled after 3, and 11 days (
[0341] Transgenic rice plants harbouring the p2 promoter were exposed to cold temperature stress (4? C. for 2 hours). No change in GUS expression was observed. The plants were separately also exposed to heat stress (42? C. for 4 hours). Similar to cold stress, even in heat stress, no change in GUS expression levels were observed.
[0342] Overall, these data provide a novel promoter from cotton, which shows constitutive activity across various tissue types. Further, this promoter is functional in other plants also, such as rice, and Arabidopsis. Further, the promoter also shows differential response to salt stress, and water stress, but is not affected by temperature. Deletion analysis of the construct reveals that there are elements in the promoter which are involved in enhancing the promoter activity. Characterization of the said promoter allows for use of the promoter for generating transgenic plants with heterologous expression of any operably linked gene of interest, whose expression may be in a pan tissue matter, or particularly in roots in response to water stress.