OLFACTORY LIGANDS

20180271089 ยท 2018-09-27

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention provides analogues of (S)-germacrene D analogue which have improved insect repellent properties compared to (S)-germacrene D analogue or which have insect attractant properties.

    Claims

    1. A (S)-germacrene D analogue of general formula (I): ##STR00006## wherein R.sup.1 is H, methyl, ethyl, n-propyl, iso-propyl or cyclopropyl; R.sup.2 is H, methyl, ethyl, n-propyl, iso-propyl or cyclopropyl; R.sup.3 is methyl, ethyl, n-propyl, iso-propyl or cyclopropyl; R.sup.4 is H, methyl, ethyl, n-propyl, iso-propyl or cyclopropyl; R.sup.5 is H, methyl, ethyl, n-propyl, iso-propyl or cyclopropyl.

    2. The compound according to claim 1 wherein, independently or in any combination: R.sup.1 is H, methyl or ethyl; R.sup.2 is H, methyl or ethyl; R.sup.3 is methyl or ethyl; R.sup.4 is H, methyl or ethyl; R.sup.5 is H, methyl or ethyl.

    3. The compound according to claim 1 wherein: each of R.sup.1, R.sup.2 and R.sup.4 is H; R.sup.3 is methyl, ethyl, n-propyl, iso-propyl or cyclopropyl; and R.sup.5 is H, methyl, ethyl, n-propyl, iso-propyl or cyclopropyl.

    4. The compound according to claim 3 wherein R.sup.5 is H.

    5. The compound according to claim 4 which is (S)-15-methylgermacrene D.

    6. The compound according to claim 1 wherein each of R.sup.2, R.sup.3 and R.sup.5 is independently methyl, ethyl, n-propyl, iso-propyl or cyclopropyl and each of R.sup.1 and R.sup.4 is H;

    7. The compound according to claim 6 wherein R.sup.5 is H.

    8. The compound according to claim 7 which is ((S)-14,15-dimethylgermacrene D.

    9. The process for the preparation of a compound according to claim 1, the process comprising incubating a farnesyl diphosphate analogue of general formula (II): ##STR00007## wherein R.sup.1, R.sup.2, R.sup.3, R.sup.4 and R.sup.5 are as defined in general formula (I); or a salt thereof; with germacrene D synthase (GDS).

    10. The process according to claim 9 wherein the germacrene D synthase is a recombinant (S)-germacrene D synthase polypeptide.

    11. The process according to claim 10 wherein the recombinant GDS comprises a tag sequence at the N- or C-terminus, in particular a polyhistidine tag.

    12. The process according to claim 11 wherein the GDS comprises a C-terminal polyhistidine tag, for example a hexahistidine tag.

    13. The process according to claim 9 wherein the GDS is native germacrene D synthase from Solidago canadensis SEQ ID NO: 1.

    14. The process according to claim 9 wherein the GDS is native germacrene D synthase from Solidago canadensis SEQ ID NO: 1, which has one or more of the modifications: tyrosine residue at position 406 replaced by phenylalanine, leucine, isoleucine, valine or alanine; tryptophan residue at position 275 replaced by phenylalanine, leucine, isoleucine, valine or alanine, but especially by phenylalanine; tyrosine residue at position 524 replaced by phenylalanine, leucine, isoleucine, valine or alanine, but especially by phenylalanine.

    15. The process according to claim 14 wherein the GDS has one or more of tyrosine at position 406, tryptophan at position 275 tyrosine at position 524 replaced by phenylalanine.

    16. A modified GDS polypeptide comprising a native germacrene D synthase from Solidago canadensis SEQ ID NO: 1, which has one or more of the modifications: tyrosine residue at position 406 replaced by phenylalanine, leucine, isoleucine, valine or alanine; tryptophan residue at position 275 replaced by phenylalanine, leucine, isoleucine, valine or alanine, but especially by phenylalanine; tyrosine residue at position 524 replaced by phenylalanine, leucine, isoleucine, valine or alanine, but especially by phenylalanine.

    17. The modified GDS polypeptide according to claim 16 wherein the GDS has one or more of tyrosine at position 406, tryptophan at position 275 tyrosine at position 524 replaced by phenylalanine.

    18. A nucleic acid sequence encoding the modified GDS polypeptide according to claim 16.

    19. A vector comprising the nucleic acid sequence according to claim 18.

    20. A cell transfected or transformed with the nucleic acid molecule according to claim 18.

    21. An insect repellent composition comprising the compound according to claim 1 and a suitable carrier, provided that the compound of general formula (I) is not (S)-14,15-dimethylgermacrene D.

    22. The insect repellent composition according to claim 21 including the compound of general formula (I) wherein: each of R.sup.1, R.sup.2 and R.sup.4 is H; R.sup.3 is methyl, ethyl, n-propyl, iso-propyl or cyclopropyl; and R.sup.5 is H, methyl, ethyl, n-propyl, iso-propyl or cyclopropyl.

    23. The insect repellent composition according to claim 21 further comprising one or more addition insect repelling compounds selected from the group consisting of allethrins, DEET (N,N-diethyl-m-toluamide), p-menthane-3,8-diol (PMD), picaridin, Bayrepel, KBR 3023, Nepetalactone, Citronella oil, Neem oil, Bog Myrtle, Dimethyl carbate, Tricyclodecenyl allyl ether, IR3535 (3-[N-Butyl-N-acetyl]-aminopropionic acid, ethyl ester) or anthranilate-based insect repellents.

    24. The insect repellent composition according to claim 21 comprising a carrier suitable for application to human or animals.

    25. An insect attractant composition comprising a compound according to claim 1 and a suitable carrier, provided that the compound is not (S)-15-methylgermacrene D.

    26. The insect attractant composition according to claim 25 wherein the compound of general formula (I) is (S)-14,15-dimethylgermacrene D.

    27. The insect attractant composition according to claim 25 further comprising an insecticide.

    28. The insect attractant composition according to claim 25 further comprising a controlled release medium selected from the group consisting of rubber, polythene, hollow fibres, plastic sandwiches, plastic membranes and cellulosic materials, so that the attractant is released over a period of days at a concentration effective to attract insects.

    29. An insect trapping device comprising an insect attractant composition according to claim 25.

    30. (canceled)

    31. A method of repelling insects comprising providing an insect repellent composition according to claim 21 in an area affected by insect infestation.

    32. A method of attracting insects comprising providing an insect attractant composition according to claim 25 in an area affected by insect infestation.

    33. A cell transfected or transformed with the vector according to claim 19.

    Description

    [0081] The invention will now be described in greater detail with reference to the examples and to the drawings in which:

    [0082] FIG. 1 is a gas chromatogram of the pentane extractable products from incubation of 14,15-dimethylfarnesyl diphosphate (compound of general formula (II) where R.sup.1, R.sup.4 and R.sup.5 are H and R.sup.2 and R.sup.3 are methyl) with Y406F-GDS-His.sub.6. (S)-14,15-dimethylgermacrene D (compound of general formula (I) where R.sup.1, R.sup.4 and R.sup.5 are H and where R.sup.2 and R.sup.3 are methyl) eluted at 32.83 min.

    [0083] FIG. 2 is a mass spectrum of the product eluting at 32.83 min from incubation of 14,15-dimethylfarnesyl diphosphate with Y406F-GDS-His6.

    [0084] FIG. 3 is a gas chromatogram of the pentane extractable products from incubation of 15-dimethylfarnesyl diphosphate (compound of general formula (II) where R.sup.1, R.sup.2, R.sup.4 and R.sup.5 are H and R.sup.3 is methyl) with Y406F-GDS-His6. 15-methyl (S)-germacrene D (compound of general formula (I) where R.sup.1, R.sup.2, R.sup.4 and R.sup.5 are H and R.sup.3 is methyl) eluted at 29.54 min.

    [0085] FIG. 4 is a mass spectrum of the product eluting at 29.54 min from incubation of 15-dimethylfarnesyl diphosphate with Y406F-GDS-His6.

    [0086] FIG. 5 is a gas chromatogram of the pentane extractable products from the incubation of 12-methylfarnesyl diphosphate (compound similar to general formula (II) in which R.sup.2, R.sup.3, R.sup.4 and R.sup.5 are H and R.sup.1 is methyl). The germacrene D analogue (compound similar to general formula (I) where R.sup.2, R.sup.3, R.sup.4 and R.sup.5 are H and R.sup.1 is methyl) eluted at 29.35 minutes.

    [0087] FIG. 6 is a coupled gas chromatography-electroantennography (GC-EAG) with the grain aphid, Sitobion avenae. Upper traces=EAG response, lower traces=GC response. A-(S)-germacrene D (comparator compound Ia); B-(R)-germacrene D (III); C-(S)-14-methylgermacrene D (; D-(S)-12-methylgermacrene D; E-(S)-15-methylgermacrene D; F-(S)-14,15-dimethylgermacrene D (compound of general formula (I) where R.sup.2 and R.sup.3 are methyl); G-(S)-1-fluorogermacrene D; H-germacrane (IV).

    MATERIALS AND METHODS

    [0088] All chemicals were purchased from Sigma-Aldrich unless otherwise stated. All were of analytical quality or better and used as received unless otherwise stated.

    [0089] .sup.1H, .sup.31P and .sup.13C NMR spectra were measured on a Bruker Avance III 600 NMR spectrometer, a Bruker Avance 500 NMR spectrometer or a Bruker Avance DPX400 NMR spectrometer and are reported as chemical shifts in parts per million downfield from tetramethylsilane, multiplicity (s=singlet, d=doublet, t=triplet, q=quartet, m=multiplet), coupling constant (to the nearest 0.5 Hz) and assignment, respectively. Assignments are made to the limitations of COSY, DEPT 90/135, gradient HSQC and gradient HMBC spectra. CDCl.sub.3 was filtered through basic alumina prior to use in NMR spectroscopy. EI.sup.+ mass spectra were measured on a Micromass LCT Premier XE mass spectrometer (VVaters Corporation, Milford, Mass., USA). GCMS was performed on a Hewlett Packard Agilent 6890 GC fitted with a J&W Scientific DB-5MS column (30 m0.25 mm internal diameter) and a Micromass GCT Premier detecting in the range m/z 50-800 in EI.sup.+ mode scanning once a second with a scan time of 0.9 s. Injections were performed in split mode (split ratio 5:1) at 50 C. Chromatograms were begun with an oven temperature of 50 C. (unless otherwise stated) rising at 4 C. min.sup.1 for 25 min (up to 150 C.) and then at 20 C. min.sup.1 for 5 min (250 C. final temperature).

    Protein Preparation and Purification

    [0090] Recombinant germacrene D synthase and mutants were overproduced in E. coli (DE3)Star as C-terminal His-tagged fusion proteins and purified by Ni.sup.2+-affinity chromatography as described by Cascn, O. et al. Chemoenzymatic preparation of germacrene analogues. Chem. Commun. 48, 9702-9704 (2012).

    Site Directed Mutagenesis of Recombinant GDS

    [0091] The Quickchange site-directed mutagenesis kit (Stratagene) was used to introduce the desired mutations according to the manufacturer's instructions. The primers used for mutagenesis were as follows:

    TABLE-US-00001 forW275A (SEQIDNo:2) 5 CTGGTAGAGCTGTACTTTGCGGTACTGGGCGTTTATTTC3 and (SEQIDNo:3) 5 GAAATAAACGCCCAGTACCGCAAAGTACAGCTCTACCAG3; forW275L (SEQIDNo:4) 5 CTGGTAGAGCTGTACTTTCTGGTACTGGGCGTTTATTTC3 and (SEQIDNo:5) 5 GAAATAAACGCCCAGTACCAGAAAGTACAGCTCTACCAG3; forW275F (SEQIDNo:6) 5 GGTAGAGCTGTACTTTTTCGTACTGGGCGTTTATTTC3 and (SEQIDNo:7) 5 GAAATAAACGCCCAGTACGAAAAAGTACAGCTCTACC3; forY524A (SEQIDNo:8) 5 CGTGATCGACATGCTGGCGAAGAATGACGACAACC3 and (SEQIDNo:9) 5 GGTTGTCGTCATTCTTCGCCAGCATGTCGATCACG3; forY524L (SEQIDNo:10) 5 GCGTGATCGACATGCTGCTGAAGAATGACGACAACC3 and (SEQIDNo:11) 5 GGTTGTCGTCATTCTTCAGCAGCATGTCGATCACGC3; forY524F (SEQIDNo:12) 5 GTGATCGACATGCTGTTCAAGAATGACGACAAC3 and (SEQIDNo:13) 5 GTTGTCGTCATTCTTGAACAGCATGTCGATCAC3; forY406S (SEQIDNo:14) 5 GAATCTGACGGGTGGCAGCAAAATGCTGACGACG3 and (SEQIDNo:15) 5 CGTCGTCAGCATTTTGCTGCCACCCGTCAGATTC3; forY406G (SEQIDNo:16) GAATCTGACGGGTGGCGGCAAAATGCTGACGACG3 and (SEQIDNo:17) 5 CGTCGTCAGCATTTTGCCGCCACCCGTCAGATTC3; forY406A (SEQIDNo:18) 5 GAATCTGACGGGTGGCGCGAAAATGCTGACGACG3 and (SEQIDNo:19) 5 CGTCGTCAGCATTTTCGCGCCACCCGTCAGATTC3; forY406V (SEQIDNo:20) 5 GAATCTGACGGGTGGCGTGAAAATGCTGACGACG3 and (SEQIDNo:21) 5 CGTCGTCAGCATTTTCACGCCACCCGTCAGATTC3; forY406I (SEQIDNo:22) 5 GAATCTGACGGGTGGCATTAAAATGCTGACGACG3 and (SEQIDNo:23) 5 CGTCGTCAGCATTTTAATGCCACCCGTCAGATTC3; forY406L (SEQIDNo:24) 5 GAATCTGACGGGTGGCCTGAAAATGCTGACGACG3 and (SEQIDNo:25) 5 CGTCGTCAGCATTTTCAGGCCACCCGTCAGATTC3; forY406F (SEQIDNo:26) 5 GAATCTGACGGGTGGCTTTAAAATGCTGACGACG3 and (SEQIDNo:27) 5 CGTCGTCAGCATTTTAAAGCCACCCGTCAGATTC3; forY406W (SEQIDNo:28) 5 CTGACGGGTGGCTGGAAAATGCTGACGAC3 and (SEQIDNo:29) 5 GTCGTCAGCATTTTCCAGCCACCCGTCAG3.

    [0092] Plasmids were purified from overnight cultures (10 mL LB medium containing ampicillin 50 mol/mL) using the QIAGEN miniprep kit as described by the manufacturer. Mutations were confirmed by DNA sequence analysis using the internal Walesbiogrid facilities (School of Bioscience, Cardiff University, UK).

    Example 1: Synthesis of 14,15-Dimethylfarnesyl Diphoshate (IIg)

    [0093] The title compound was prepared from -ketoester V according to the reaction Scheme 1.

    ##STR00003##

    A. Synthesis of (2E,6E) Ethyl 3,7-diethyl-11-methyldodeca-2,6,10-trienoate (VII)

    [0094] To a stirred solution of V (Cascn et al; ChemPlusChem 78, 1334-1337 (2013)), (0.35 g, 1.50 mmol) and lithium trifluoromethanesulfonate (0.78 g, 5.0 mmol) in dry CH.sub.2Cl.sub.2 (38 mL) under argon at 0 C. was added triethylamine (0.7 mL, 5.0 mmol) followed by trifluoromethanesulfonic anhydride (0.32 mL, 1.90 mmol). The mixture was stirred at 0 C. for 2 h before quenching with the addition of saturated NH.sub.4Cl solution (20 mL). This mixture was diluted with CH.sub.2Cl.sub.2 (20 mL) and the separated aqueous phase was extracted with CH.sub.2Cl.sub.2 (210 mL). The pooled organic extracts were washed with water (30 mL) and brine (30 mL) before drying (MgSO.sub.4), filtration and concentration under reduced pressure. This gave the enol triflate VI as dark oil that was used directly without further purification (0.58 g, 83%).

    [0095] To a stirred suspension of CuI (0.95 g, 5.00 mmol) in THF (12 mL) at 0 C. was added drop-wise, ethylmagnesium bromide (3.0 M solution in diethyl ether, 3.33 mL, 10.0 mmol). The solution was stirred for 30 minutes, whereupon an opaque black colour formed. The stirred reaction mixture was then cooled to 78 C. and a solution of VI (0.58 g, 1.25 mmol) in anhydrous THF (4 mL) was added via a needle and the reaction was stirred at this temperature for 2.5 h before quenching by addition of saturated aqueous NH.sub.4Cl solution (20 mL). Resulting emulsions were dissolved by addition of concentrated aqueous NH.sub.4OH solution and stirring overnight. The separated aqueous layer was extracted with ethyl acetate (310 mL) and the combined organic extracts were washed with water (230 mL) and brine (30 mL) before drying (MgSO.sub.4), filtration and concentration under reduced pressure. The residual oil was purified by flash chromatography on silica gel (19:1 hexane; ethyl acetate). The title compound was isolated as colourless oil (185 mg, 52%).

    [0096] HRMS (m/z ES.sup.+): calcd. for C.sub.19H.sub.32O.sub.2 292.2402; found 292.2407;

    [0097] .sub.H (400 MHz, CDCl.sub.3) 0.95 (3H, t, J=7.5 Hz, CCHCH.sub.2CH.sub.3), 1.07 (3H, t, J=7.5 CCHCH.sub.2CH.sub.3), 1.27 (3H, t, J=7.0 Hz, OCH.sub.2CH.sub.3), 1.59 (3H, s, CH.sub.3CCH), 1.67 (3H, s, CH.sub.3CCH), 1.98-2.05 and 2.03-2.04 (12H, m, 2CH.sub.2CH.sub.2 and 2CHCCH.sub.2CH.sub.3), 4.25 (2H, q, J=7.0 Hz, OCH.sub.2CH.sub.3), 5.01-5.20 (2H, m, 2CCH), 5.72 (1H, s, CCHCO.sub.2Et);

    [0098] .sub.C (62.5 MHz, CDCl.sub.3) 12.97, 13.18, 14.29, 17.68 and 23.15 (CH.sub.3), 25.34, 25.67, 25.78, 26.84, 36.43, 38,27 and 59.13 (CH.sub.2), 114.79, 122.51 and 124.31 (3CCH), 131.33 141.91 and 165.53 (3CCH), 166.45 (CO).

    B. Synthesis of (2E,6E) 3,7-Diethyl-11-methyldodeca-2,6,10-trienol (VIII)

    [0099] To a stirred suspension of VII (0.18 mg, 0.60 mmol) in toluene (3.1 mL) at 78 C. was added DIBAL-H (1.5 M in toluene, 1.30 mL, 1.80 mmol), the solution was stirred at this temperature for 2 h. The reaction was quenched by addition of 2 M HCl (10 mL), diluted with CH.sub.2Cl.sub.2 (10 mL) and stirred for 1 h at room temperature. The aqueous layer was extracted with CH.sub.2Cl.sub.2 (210 mL) and the pooled organic layers were washed with aqueous saturated NaHCO.sub.3 solution (310 mL), brine (215 mL), dried over MgSO.sub.4 and then concentrated under reduced pressure. The crude product was purified by flash chromatography on silica gel (eluting with 3:1 hexane-ethyl acetate) to give the title compound as a colourless oil (0.16 mg, 73% yield).

    [0100] HRMS (m/z APCI [M+H.sup.+H.sub.2O]) calcd. for C.sub.17H.sub.29 233.2269; found 233.2275;

    [0101] .sub.H (400 MHz, CDCl.sub.3) 0.94-1.01 (6H, m, 2CH.sub.2CH.sub.3), 1.60 (3H, s, CHCCH.sub.3), 1.68 (3H, s, CHCCH.sub.3) 1.97-2.13 (12H, m, 6CH.sub.2), 4.16 (2H, d, J=7.0 Hz, CH.sub.2O), 5.09 (2H, m, 2CCH), 5.38 (1H, t, J=7.0 Hz, CCHCH.sub.2O).

    [0102] .sub.C (62.5 MHz, CDCl.sub.3) 13.20, 13.65, 17.68 and 23.21 (CH.sub.3), 23.54, 25.65, 26.22, 26.96, 36.51 and 36.75 (CH.sub.2), 59.09 (CH.sub.2OH), 122.89, 123.43 and 124.46 (CCH), 131.26, 141.25 and 145.69 (CCH)

    C. Synthesis of Trisammonium (2E,6E)-3,7-diethyl-11-methyldodeca-2,6,10-trienyl diphosphate (14,15-Dimethylfarnesyl diphosphate) (IIg)

    [0103] A stirred suspension of LiCl (0.27 g, 6.4 mmol) in anhydrous DMF (5.3 mL) was cooled to 0 C. (ice bath) and then S-collidine (0.3 mL, 2.4 mmol) and methanesulfonyl chloride (50 L, 0.64 mmol) were added. The solution was stirred for 15 min during which time a white cloudy precipitate formed. Alcohol VII (100 mg, 0.40 mmol) was added drop-wise as a solution in anhydrous DMF (1 mL) and the reaction was stirred to 0 C. for 3 h. The mixture was diluted with cold pentane (4 mL) then poured onto ice (25 g) and the resulting aqueous layer was extracted with pentane (310 mL). The pooled organic layers were washed with saturated CuSO.sub.4 solution (310 mL), saturated NaHSO.sub.4 solution (210 mL) and brine (210 mL) before drying (MgSO.sub.4) and filtration. The solution was concentrated under reduced pressure and the resulting crude allylic chloride was used directly without further purification.

    [0104] To a solution of the crude allylic chloride in anhydrous CH.sub.3CN (1 mL) was added tris-(tetrabutylammonium) hydrogendiphosphate (0.7 g, 1.8 mmol) and the mixture was stirred at room temperature for 15 h. The solvent was removed under reduced pressure and the residue was dissolved in ion-exchange buffer (25 mM NH.sub.4HCO.sub.3 containing 2% i-PrOH, 1 mL). This solution was slowly passed through a column containing 30 equiv. of DOWEX 50W-X8 (100-200 mesh) cation exchange resin (NH.sub.4.sup.+ form) that had been pre-equilibrated with two column volumes of ion-exchange buffer. The column was eluted with two column volumes of ion-exchange buffer at a flow rate of one column volume per 15 min. Once ion exchange was complete, fractions containing product (as judged by TLC in 6:3:1 i-PrOH:c.NH.sub.3:H.sub.2O, staining with Hanessian's stain) was lyophilized to dryness. The white solid was triturated with MeOH (310 mL) and the organic extracts were concentrated to dryness affording a yellow solid that was cleaned with Et.sub.2O (33 mL) to give the title compound as a white solid (64 mg, 36%). The residue from the trituration was further purified by reverse-phase HPLC (15021.2 mm Phenomenex Luna column, eluting with 10% B for 20 min, then a linear gradient to 60% B over 25 min and finally a linear gradient to 100% B over 5 min.; solvent A: 25 mM NH.sub.4HCO.sub.3 in water, solvent B: CH.sub.3CN, flow rate 5.0 mL/min, detecting at 220 nm, retention time 39.3 min). Once purification was complete the solution was again lyophilized to dryness giving a further batch of the title compound as a fluffy white solid (34 mg, 18.9% yield).

    [0105] HRMS (m/z ES.sup.) calcd. for C.sub.17H.sub.31O.sub.7P.sub.2 409.2545; found 409.2539;

    [0106] .sub.H (400 MHz, D.sub.2O) 0.8-0.91 (6H, m, 2CH.sub.2CH.sub.3), 1.50 (3H, s, CCCH.sub.3), 1.56 (3H, s, CCCH.sub.3) 1.92-2.03 (12H, m, 6CH.sub.2), 4.37 (2H, m, CH.sub.2O), 5.07 (2H, t, J=6.0 Hz, 2CCH), 5.32 (1H, t, J=6.5 Hz, CCHCH.sub.2O);

    [0107] .sub.p (202.5 MHz, .sup.2H.sub.2O) 10.41 (d, J.sub.PP=22.5 Hz), 8.30 (d, J.sub.PP=22.5 Hz).

    [0108] Other compounds of general formula (II) can be synthesised by an analogous method starting from an alternative -ketoester.

    Example 2: Preparation of (S)-germacrene D Analogues

    [0109] Germacrene analogues were produced from the appropriate farnesyl diphosphate according to Scheme 2 by enzymatic coversion using GDP or a modified GDP.

    ##STR00004##

    TABLE-US-00002 Substrate Product IIa Comparator Compound Ia (S)-germacrene D IIb Comparator Compound Ib (S)-12-methylgermacrene D IIc Comparator Compound Ic (S)-14-methylgermacrene D IId Comparator Compound Id (S)-14-fluorogermacrene D IIe Comparator Compound Ie (S)-15-fluorogermacrene D IIf Compound If (S)-15-methylgermacrene D IIg Compound Ig (S)-14,15-dimethylgermacrene D IIh Comparator Compound Ih (S)-1-fluorogermacrene D

    [0110] Incubations of FDP analogues with GDS-His.sub.6 and Y406F GDS-His.sub.6 were optimised to generate maximum conversions as previously described (Cascn et al, in Chem. Commun., 48, 9702-9704 (2012) and Cascn et al; ChemPlusChem 78, 1334-1337 (2013)).

    Results of Enzyme Kinetics Experiments

    [0111] The kinetics parameters for the conversion of farnesyl diphosphate and analogues thereof to (S)-germacrene D and analogues thereof using different variant GDS enzymes are shown in Tables 1 to 3.

    TABLE-US-00003 TABLE 1 Kinetic parameters of Y524F and W275F mutants k.sub.cat/K.sub.M 10.sup.3 K.sub.M (M) k.sub.cat (s.sup.1) (M.sup.1 .Math. s.sup.1) GDS value error value error value error WT 3.60 0.26 0.0094 0.0002 2.612 0.191 Y524F 5.34 0.43 0.0143 0.0004 2.669 0.227 W275F 2.06 0.21 0.0082 0.0002 3.971 0.405

    TABLE-US-00004 TABLE 2 Kinetics parameters of Y406 mutants k.sub.cat/K.sub.M 10.sup.3 K.sub.M (M) k.sub.cat (s.sup.1) (M.sup.1 .Math. s.sup.1) GDS value error value error value error WT (GDS- 3.60 0.26 0.0094 0.0002 2.612 0.191 His.sub.6) Y406W 3.14 0.26 0.0005 0.00001 0.139 0.012 Y406F 12.75 0.81 0.0853 0.0003 6.692 0.426 Y406L 8.13 0.53 0.0543 0.0012 6.679 0.459 Y406I 4.37 0.44 0.0319 0.0010 7.299 0.782 Y406V 4.17 0.57 0.0131 0.0003 4.363 0.394 Y406A 1.46 0.09 0.0132 0.0002 9.043 0.562 Y406S Y406G

    TABLE-US-00005 TABLE 3 Turnover kinetics of IIa, IIg and IIf with GDS-His.sub.6 and Y406F-GDS. GDS-His.sub.6 Y406F-GDS-His.sub.6 k.sub.cat/K.sub.M k.sub.cat/K.sub.M K.sub.M mM k.sub.cat s.sup.1 M.sup.1 s.sup.1 K.sub.M mM k.sub.cat s.sup.1 M.sup.1 s.sup.1 IIa 3.60 0.26 0.0094 0.0002 2600 200 12.75 0.81 0.0853 0.0003 6700 400 IIg 2.63 0.39 0.0043 0.0004 1600 300 12.39 3.85 0.0228 0.0028 1800 600 IIf 5.02 1.62 0.0068 0.0008 1400 500 5.82 1.20 0.0222 0.0011 3800 800

    [0112] For both compounds (If) and (Ig), the conversion was most suitably effected using a modified GDS-Y406F enzyme. However, for native (S)-Germacrene D and the other analogues, the native GDS enzyme was used rather than a modified enzyme.

    A. Preparation of (S)-14,15-Dimethylgermacrene D (Compound Ig)

    [0113] For production of (S)-14,15-dimethylgermacrene D 14,15-dimethyl-FDP (IIg) (19 mg, 0.40 mM final concentration) and Y406F-GDS-His.sub.6 (12 M final concentration) were mixed in incubation buffer (20 mM Tris, 5 mM ME, and 10 mM MgCl.sub.2, pH 7.5, 10% glycerol for GDS, 50 mL final volume) overlaid with pentane (10 mL). The mixture was gently agitated for 5 days at room temperature and then the separated aqueous layer was thoroughly extracted with further portions of pentane until no product could be detected by GCMS. The pooled pentane extracts were concentrated to dryness and the residue was purified by preparative thin layer chromatography on silica gel impregnated with 1% AgNO.sub.3, eluting with 5% acetone in pentane. The title compound was isolated as a colourless oil (14 mg, 73%).

    [0114] HRMS (m/z, EI.sup.+) calcd. for C.sub.17H.sub.28 232.2191; found 232.2191;

    [0115] .sub.H (600 MHz, CDCl.sub.3) 0.79 (3H, d, J=7.0 Hz, (CH.sub.3).sub.2CH), 0.85 (3H, d, J=7.0 Hz, (CH.sub.3).sub.2CH), 0.86-0.90 (2H, m, (CH.sub.3).sub.2CHCHCH.sub.2), 0.94 (3H, t, J=7.5 Hz, CH.sub.3CH.sub.2), 1.37-1.42 (1H, m, (CH.sub.3).sub.2CH), 1.68 (3H, d, J=6.0 Hz, CH.sub.3CHC), 1.70-1.75 (2H, m, CH.sub.2CEt), 1.85-1.90 (1H, m, 1CH.sub.2CHCEt), 1.97-2.02 (1H, m, 1CH.sub.2CHCEt), 2.02-2.09 (1H, m, (CH.sub.3).sub.2CHCH), 2.14-2.20 (1H, m, 1CH.sub.3CHCCH.sub.2), 2.25-2.32 (2H, m, CH.sub.3CH.sub.2), 2.36-2.43 (1H, m, 1CH.sub.2C=CEt), 2.44-2.52 (1H, m, 1CH.sub.3CHCCH.sub.2), 5.03 (1H, dd, J=6 and 11 Hz, CH.sub.3CH.sub.2CCH), 5.08 (1H, dd, J=10 and 16 Hz, CH.sub.3CHCCHCH), 5.38 (1H, q, J=6.0 Hz, CH.sub.3CHC), 5.72 (1H, d, J=6.0 Hz, CH.sub.3CHCCHCH);

    [0116] .sub.C (150 MHz, CDCl.sub.3) 12.66 (CH.sub.3CH.sub.2), 13.18 (CH.sub.3CHC), 14.13 (1(CH.sub.3).sub.2CH), 19.28 (1(CH.sub.3).sub.2CH) 20.75 ((CH.sub.3).sub.2CHCHCH.sub.2) 21.30 (CH.sub.3CH.sub.2), 22.70 (CH.sub.2CEt), 27.09 (CH.sub.2CHCEt), 32.83 ((CH.sub.3).sub.2CH), 36.96 (CH.sub.3CHCCH.sub.2), 52.57 ((CH.sub.3).sub.2CHCH), 120.0 (CH.sub.3CHC), 130.1 (CHCEt), 133.6 (CHCHCHCH(CH.sub.3).sub.2), 136.1 (CHCHCHCH(CH.sub.3).sub.2), 139.4 (CHCEt), 140.2 (CH.sub.3CHC);

    [0117] m/z (EI.sup.+), 232.2 (22%, M.sup.+), 203.2 (8, [M-Et].sup.+), 189.2 (100, [M-(CH.sub.3).sub.2CH].sup.+), 175.2 (2), 161.1 (11), 147.1 (30), 133.1 (31), 119.1 (33), 105.1 (25), 91.1 (29), 79.1 (18), 67.1 (7), 55.1 (4).

    B. Preparation of (S)-15-methylgermacrene D (If)

    [0118] The title compound was produced in similar fashion to Compound (Ig). 15-methyl-FDP (IIf) (19 mg, 0.40 mM final concentration) and Y406F-GDS-His.sub.6 (12 M final concentration) were mixed in incubation buffer (20 mM Tris, 5 mM ME, and 10 mM MgCl.sub.2, pH 7.5, 10% glycerol for GDS, 200 mL final volume) overlaid with pentane (10 mL). The mixture was gently agitated for 5 days at room temperature and then the separated aqueous layer was thoroughly extracted with further portions of pentane until no product could be detected by GCMS. The pooled pentane extracts were concentrated to dryness and the residue was purified by preparative thin layer chromatography on silica gel impregnated with 1% AgNO.sub.3, eluting with 5% acetone in pentane. The title compound was isolated as a colourless oil (8 mg, 45%). HRMS (m/z, EI.sup.+) calcd. for C.sub.17H.sub.28232.2191; found 232.2191;

    [0119] .sub.H (600 MHz, CDCl.sub.3) 0.72-0.80 (3H, m, (CH.sub.3).sub.2CHCHCH.sub.2), 0.83 (3H, d, J=7.0 Hz, (CH.sub.3).sub.2CH), 0.90 (3H, d, J=7.0 Hz, (CH.sub.3).sub.2CH), 1.56 (3H, s, CH.sub.3CCH), 1.71 (3H, d, J=7.0 Hz, CH.sub.3CHC), 1.95-2.05, 2.16-2.18, 2.21-2.25, 2.30-2.37 and 2.52-2.54 (7H, m, allylic CHs), 5.14-5.18 (2H, m, CH.sub.3CHCCHCH and CH.sub.3CCH), 5.42 (1H, q, J=7.0 Hz, CH.sub.3CHC), 5.76 (1H, d, J=6.0 Hz, CH.sub.3CHCCHCH);

    [0120] m/z (EI.sup.+), 218.2 (28%, M.sup.+), 203.2 (10, [M-CH.sub.3].sup.+), 189.2 (9), 175.1 (100), 143.1 (18), 133.1 (20), 119.1 (22), 105.1 (25), 91.1 (20), 79.1 (10), 67.1 (4), 55.1 (3).

    Example 3

    Electrophysiology

    [0121] Electroantennogram (EAG) recordings were made using AgAgCl glass electrodes filled with saline solution [composition as in Maddrell et al, J. Exp. Biol. 51, 71 (1969) but without glucose]. The head of an alate virginoparous grain aphid, Sitobion avenae, was excised and placed within the indifferent electrode and the tips of both antennae were removed before they were inserted into the recording electrode. The signals were passed through a high impedance amplifier (UN-06, Syntech, Hilversum, the Netherlands) and analysed using a customized software package (Syntech).

    [0122] The coupled gas chromatography-electrophysiology system (GC-EAG), in which the effluent from the GC column is simultaneously directed to the antennal preparation and the GC detector, has been described previously (Wadhams, The use of Coupled Gas Chromatography Electrophysiological Techniques in the Identification of Insect Pheromones.

    [0123] Chromatographic Society Symposium, Reading, England, UK, March 21-23.sup.rd 1989, XIV+376P, Plenum Press: New York, U.S.A., pp. 289-298 (1990)). Separation of the required germacrene D analogue and any contaminants present in the sample was achieved on an Agilent 6890 GC equipped with a cool on-column inlet and an FID, using an HP-1 (50 m0.32 mm, O.D.0.52 m, phase thickness) column with helium as carrier gas (flow rate of 2.5 ml/min). The oven temperature was maintained at 30 C. for 2 minutes and then ramped at 15/minute to 250 C.

    [0124] The outputs from the EAG amplifier and the FID were monitored simultaneously and analysed using the Syntech software package. Peaks eluting from the GC column were judged to be active if they elicited EAG activity in three or more coupled runs.

    Behavioural Assay

    [0125] The responses of individual grain aphids, Sitobion avenae, to test compounds were observed using a Perspex four-arm olfactometer (Pettersson, J.; Ent. Scand. 1, 63-73 (1970); Webster, B., et al. Animal Behav. 79, 451-457 (2010)), which was maintained at 23 C. and lit from above. A filter paper disc was laid in the bottom section of the olfactometer to provide traction for the aphid and the middle and top sections were fitted into place very tightly to give a good seal. The four arms, consisting of the barrels of disposable 10 mL syringes (Plastipak), were fitted tightly into the holes of the middle section, and filtered air was drawn through them and into the body of the olfactometer through a tube inserted into a hole in the centre of the top section and attached to a pump. The measured total flow rate was 200 mL/min and it was assumed that the flow rate through each arm was 50 mL/min. The three control arms each contained a filter paper strip to which had been applied 10L hexane which had been allowed to evaporate for 30 s. The treatment arm contained a filter paper strip to which the test compound in 10 L of hexane (20-200 ng L.sup.1) had been applied and left for 30 s for the hexane to evaporate. A single aphid was introduced through the central hole and the suction tube quickly reinserted. The time spent in each arm and in the central zone were recorded, using specialist software (OLFA, Udine, Italy), for the next 16 minutes. The olfactometer was rotated through 90 every 2 min to eliminate any directional bias. Each assay comprised 10 replicates and the mean time spent in treated and control arms were compared using a paired t-test (Genstat).

    Results are shown below in Table 5 for compounds and comparator compounds of formula (I) together with (R)-germacrene D (III) and germacrane (IV).

    ##STR00005##

    TABLE-US-00006 TABLE 5 Behavioural response of cereal aphids, Sitobion avenae, to germacrene D analogues using 4-way olfactometer Time (min.) spent in:- Dose Control arms Treatment Compound (g) (mean of 3) arm Significance () (S)-()-germacrene D (Ia)* 0.2 2.31 (0.26) 1.14 (0.25) 0.005 1.0 2.67 (0.190 1.63 (0.35) 0.007 2.0 2.29 (0.41) 0.50 (0.14) 0.012 (S)-1-fluorogermacrene D (Ih)* 1.0 2.54 (0.27) 2.62 (0.50) 0.447 2.0 2.60 (0.26) 2.46 (0.39) 0.402 (S)-12-methylgermacrene D (Ib)* 0.9 2.21 (0.42) 1.20 (0.24) 0.039 1.2 2.66 (0.17) 2.13 (0.25) 0.075 (S)-14-methylgermacrene D (Ic)* 0.2 2.21 (0.27) 2.41 (0.73) 0.409 1.0 2.61 (0.28) 3.27 (0.68) 0.225 2.0 2.01 (0.23) 1.65 (0.39) 0.209 (S)-15-methylgermacrene D (If)* 0.8 2.61 (0.26) 1.38 (0.38) 0.008 1.0 2.52 (0.23) 1.92 (0.31) 0.094 (S)-14,15-dimethylgermacrene D (Ig)* 0.8 2.60 (0.22) 3.38 (0.38) 0.069 1.0 2.27 (0.11) 2.77 (0.31) 0.052 1.0 2.39 (0.20) 2.97 (0.40) 0.032 1.2 1.96 (0.21) 2.92 (0.23) 0.001 (R)-(+)-germacrene D (III) 1.0 2.57 (0.19) 3.15 (0.53) 0.447 2.0 1.86 (0.29) 2.65 (0.52) 0.108 germacrane (IV) 1.0 2.45 (0.30) 2.04 (0.58) 0.265 2.0 2.39 (0.24) 2.38 (0.50) 0.485 *Analogue prepared from FDP using GDS.

    [0126] Data were recorded as mean (SE) time spent in control (solvent only) or treatment arms and were analysed using Students T-test.

    Example 4: GC-MS Analysis

    [0127] Gas chromatograms for the products isolated from turnover of 14-methylfarnesyl diphosphate, 14-fluorofarnesyl diphosphate, 15-fluorofarnesyl diphosphate and 6-fluorofarnesyl diphosphate were as previously published (Cascn et al, Chem. Commun., 48, 9702-9704 (2012).