MICROORGANISMS FOR PRODUCING DIAMINE AND PROCESS FOR PRODUCING DIAMINE USING THEM

20180273992 ยท 2018-09-27

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a microorganism for producing diamine, in which activity of a protein having an amino acid sequence of SEQ ID NO: 6 or an amino acid sequence having 42% or higher sequence homology with SEQ ID NO: 6 is introduced or enhanced, and a method of producing diamine using the same.

Claims

1. A microorganism for producing cadaverine, wherein an activity of a protein comprising an amino acid sequence having at least 95% identity to SEQ ID NO: 6, SEQ ID NO:23, and SEQ ID NO:26 is introduced or enhanced compared to the endogenous activity.

2. The microorganism according to claim 1, wherein an activity of diamine acetyltransferase is further weakened compared to the endogenous activity.

3. The microorganism according to claim 2, wherein the diamine acetyltransferase has the amino acid sequence selected from the group consisting of SEQ ID NOS: 12, 13, and 14.

4. The microorganism according to claim 1, wherein the microorganism is a microorganism belonging to genus Corynebacterium or genus Escherichia.

5. The microorganism according to claim 4, wherein the microorganism is a microorganism belonging to genus Corynebacterium to which an activity of lysine decarboxylase is further introduced.

6. A method of producing cadaverine, comprising: (i) culturing the microorganism of claim 1 to obtain a cell culture; and (ii) recovering cadaverine from the cultured microorganism or the cell culture.

7. The method according to claim 6, wherein in the microorganism, an activity of diamine acetyltransferase is further weakened compared to the endogenous activity.

8. The method according to claim 7, wherein the diamine acetyltransferase has the amino acid sequence selected from the group consisting of SEQ ID NOS: 12, 13, and 14.

9. The method according to claim 6, wherein the microorganism is a microorganism belonging to genus Corynebacterium or genus Escherichia.

10. The method according to claim 9, wherein the microorganism is a microorganism belonging to genus Corynebacterium to which an activity of lysine decarboxylase is further introduced.

Description

REFERENCE EXAMPLE 1

Preparation of Corynebacterium sp. Microorganism Having Putrescine Productivity

[0061] It was confirmed that putrescine production was reduced when NCgl2522, a permease belonging to major facilitator superfamily (MFS), was deleted in a Corynebacterium glutamicum ATCC13032-based putrescine-producing strain KCCM11240P (Korean Patent Publication NO. 2013-0082478) and a Corynebacterium glutamicum ATCC13869-based putrescine-producing strain DAB12-a NCgl1469 (argF deletion, NCgl1221 deletion, E. coli speC introduction, arg operon promoter substitution, NCgl1469 deletion; designated as DAB12-b, Korean Patent Publication NO. 2013-0082478) as Corynebacterium sp. microorganisms having putrescine productivity.

[0062] It was also confirmed that putrescine was produced in a high yield in Corynebacterium glutamicum strains prepared by additional introduction of NCgl2522 gene into the transposon in KCCM11240P or DAB12-b, or by substitution of NCgl2522 promoter on the chromosome with cj7 promoter to enhance NCgl2522 activity. Further, the intracellular amount of putrescine was measured in the strain in which NCgl2522 expression was enhanced, and as a result, a smaller amount of putrescine was observed, compared to that of a control group. It is indicating that NCgl2522 has an ability to export putrescine.

[0063] In detail, based on the nucleotide sequence of the gene encoding NCgl2522 of Corynebacterium glutamicum ATCC13032, a pair of primers of SEQ ID NOS: 1 and 2 for obtaining a homologous recombination fragment of the N-terminal region of NCgl2522 and a pair of primers of SEQ ID NOS: 3 and 4 for obtaining a homologous recombination fragment of the C-terminal region of NCgl2522 were used as in the following Table 1.

TABLE-US-00001 TABLE1 Primer Sequence(5.fwdarw.3) NCg12522-del-F1_ CGGGATCCCACGCCTGTCTGGTCGC BamHI (SEQIDNO:1) NCg12522-del-R1_ ACGCGTCGACGGATCGTAACTGTAACGAATGG SalI (SEQIDNO:2) NCg12522-del-F2_ ACGCGTCGACCGCGTGCATCTTTGGACAC SalI (SEQIDNO:3) NCg12522-del-R2_ CTAGTCTAGAGAGCTGCACCAGGTAGACG XbaI (SEQIDNO:4)

[0064] PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and two pairs of primers so as to amplify PCR fragments of the N-terminal and C-terminal regions, respectively. These PCR fragments were electrophoresed to obtain the desired fragments. At this time, PCR reaction was carried out for 30 cycles of denaturation for 30 seconds at 95 C., annealing for 30 seconds at 55 C., and extension for 30 seconds at 72 C. The fragment of the N-terminal region thus obtained was treated with restriction enzymes, BamHI and SalI, and the fragment of the C-terminal region thus obtained was treated with restriction enzymes. SalI and XbaI. The fragments thus treated were cloned into the pDZ vector treated with restriction enzymes, BamHI and XbaI, so as to construct a plasmid pDZ-1NCgl2522 (K/O).

[0065] The plasmid pDZ-1NCgl2522 (K/O) was introduced into Corynebacterium glutamicum KCCM11240P by electroporation, so as to obtain a transformant. Then, the transformant was plated and cultured on BHIS plate (37 g/l of Braine heart infusion, 91 g/l of sorbitol, and 2% agar) containing kanamycin (25 g/ml) and X-gal (5-bromo-4-chloro-3-indolin-D-galactoside) for colony formation. From the colonies thus formed, blue-colored colonies were selected as the strain introduced with the plasmid pDZ-1NCgl2522 (K/O).

[0066] The selected strains were cultured with shaking in CM medium (10 g/l of glucose, 10 g/l of polypeptone, 5 g/l of yeast extract, 5 g/l of beef extract, 2.5 g/l of NaCl, and 2 g/l of urea, pH 6.6) at 30 C. for 8 hours. Subsequently, each cell culture was serially diluted from 10.sup.4 to 10.sup.10. Then, the diluted samples were plated and cultured on an X-gal-containing solid medium for colony formation. From the colonies thus formed, the white colonies which appeared at relatively low frequency were selected to finally obtain a Corynebacterium glutamicum strain in which the gene encoding NCgl2522 was deleted and putrescine productivity was weakened. The Corynebacterium glutamicum strain in which putrescine export activity was weakened was designated as KCCM11240P NCgl2522.

[0067] In the same manner, PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13669 as a template and two pairs of primers given in Table 1 so as to construct a plasmid pDZ-2NCgl2522(K/O) by the above described method. A Corynebacterium glutamicum strain, in which the gene encoding NCgl2522 of DAB12-b strain was deleted using the vector according to the above described method to weaken putrescine productivity, was constructed. This Corynebacterium glutamicum strain having weakened putrescine export activity was designated as DAB12-D NCgl2522.

EXAMPLE 1

Selection of Arcanobacterium haemolyticum ARCH_0271

[0068] As confirmed in Reference Example 1, the NCgl2522 membrane protein was found to function to export putrescine. Therefore, based on the amino acid sequence of NCgl2522, the present inventors examine genes having homology therewith other than genes of Corynebacterium sp. using BlastP program of National Center for Biotechnology Information (NCBI, www.ncbi.nlm.nih.gov), and as a result, they acquired a nucleotide sequence (SEQ ID NO: 5) and an amino acid sequence (SEQ ID NO: 6) of ARCH_0271 of Arcanobacterium haemolyticum DSM 20595, which has 56% homology therewith. Among the membrane proteins having a homology with the amino acid sequence of NCgl2522, which are found in other species than Corynebacterium sp., the amino acid sequence of ARCH_0271 is phylogenetically closest to the amino acid sequence of NCgl2522.

[0069] In the same manner, the nucleotide sequence (SEQ ID NO: 22) and amino acid sequence (SEQ ID NO: 23) of QWA_00075 derived from Alcaligenes faecalis subsp. faecalis NCIB 9687, which shows 41% homology with the amino acid sequence of NCgl2522, and the nucleotide sequence (SEQ ID NO: 25) and amino acid sequence (SEQ ID NO: 26) of SMD_2351 derived from Stenotrophomonas maltophilia D457, which shows 52% homology with the amino acid sequence of NCgl2522, were obtained. The amino acid sequence of QWA_00075and the amino acid sequence of SMD_2351 show 42% and 47% homology with the amino acid sequence of ARCH_0271, respectively, as shown in the following Table 2.

TABLE-US-00002 TABLE 2 Comparison of amino acid sequence homology ARCH_0271 QWA_00075 SMD_2351 NCgl2522 56% 41% 52% ARCH_0271 42% 47%

[0070] Meanwhile, microorganisms having genes showing homology with NCgl2522, and homology thereof are given in the following Table 3.

TABLE-US-00003 TABLE 3 Species Homology Acidovorax citrulli AAC00-1 47% Actinomyces sp. oral taxon 181 53% Actinomyces sp. ph3 54% Actinomyces sp. S6-Spd3 53% Actinosynnema mirum 53% Actinosynnema mirum DSM 43827 53% Alcaligenes faecalis subsp. faecalis 41% NCIB 8687 alpha proteobacterium LLX12A 52% Arcanobacterium haemolyticum 56% Arcanobacterium haemolyticum DSM 20595 56% Arsenophonus nasoniae 44% Brachybacterium paraconglomeratum 52% Brachybacterium paraconglomeratum LC44 52% Bradyrhizobium sp. BTAi1 43% Citricoccus sp. CH26A 50% Citrobacter freundii 4_7_47CFAA 53% Dermabacter hominis 1368 50% Dermabacter sp. HFH0086 51% Dietzia sp. UCD-THP 52% Enterobacteriaceae bacterium 9_2_54FAA 41% Erwinia amylovora ATCC 49946 47% Granulicoccus phenolivorans 55% Hafnia alvei ATCC 51873 41% Klebsiella pneumoniae 53% Micrococcus luteus 52% Micromonospora sp. ATCC 39149 53% Mycobacterium chubuense 39% Mycobacterium gilvum 38% Mycobacterium neoaurum 39% Mycobacterium rufum 39% Nesterenkonia alba 48% Nesterenkonia sp. F 51% Nocardia rhamnosiphila 40% Nocardiopsis dassonvillei 58% Nocardiopsis dassonvillei subsp. 57% dassonvillei DSM 43111 Nocardiopsis kunsanensis 52% Nocardiopsis sp. CNS639 57% Nocardiopsis synnemataformans 57% Ochrobactrum anthropi ATCC 49188 46% Pectobacterium atrosepticum SCRI1043 46% Providencia alcalifaciens DSM 30120 40% Pseudomonas aeruginosa 53% Pseudomonas aeruginosa C3719 46% Pseudomonas geniculata 53% Rahnella aquatilis HX2 40% Rhodococcus 40% Rhodococcus fascians 55% Rhodococcus sp. AW25M09 42% Rhodococcus sp. JVH1 40% Rhodococcus triatomae 37% Rhodococcus wratislaviensis NBRC 100605 40% Salinispora 52% Salinispora arenicola 52% Salinispora pacifica 53% Salinispora tropica CNB-440 51% Sanguibacter keddieii DSM 10542 52% Serratia marcescens 44% Sphingobium chinhatense 53% Stenotrophomonas maltophilia 54% Stenotrophomonas maltophilia D457 52% Stenotrophomonas sp. RIT309 52% Stenotrophomonas sp. SKA14 53% Streptococcus anginosus 52% Streptococcus anginosus CCUG 39159 51% Streptomyces 52% Streptomyces albidoflavus 54% Streptomyces alboviridis 52% Streptomyces albus 55% Streptomyces albus J1074] 57% Streptomyces atroolivaceus 53% Streptomyces baarnensis 51% Streptomyces californicus 52% Streptomyces cyaneofuscatus 53% Streptomyces floridae 52% Streptomyces fulvissimus 51% Streptomyces globisporus 52% Streptomyces griseus 57% Streptomyces mediolani 55% Streptomyces sp. AA0539 48% Streptomyces sp. CcalMP-8W 52% Streptomyces sp. CNB091 55% Streptomyces sp. NRRL B-1381 52% Streptomyces sp. NRRL B-3253 57% Streptomyces sp. NRRL F-2890 49% Streptomyces sp. NRRL F-5527 52% Streptomyces sp. NRRL F-5702 52% Streptomyces sp. NRRL S-623 52% Streptomyces sp. PVA 94-07 57% Streptomyces sp. S4 54% Streptomyces sp. ScaeMP-e10 51% Streptomyces sp. SM8 54% Streptomyces sp. W007 54% Streptomyces wadayamensis 54% Tsukamurella paurometabola 38% Turicella otitidis 56% Turicella otitidis ATCC 51513 56% Xenorhabdus nematophila ATCC 19061 42% Yaniella halotolerans 61% Yersinia enterocolitica 41%

EXAMPLE 2

Fermentation of Putrescine by Introduction of Protein Having Putrescine Export Activity into Putrescin-Producing Strain Derived from Corynebacterium sp.

<2-1> Introduction of ARCH_0271, QWA_00075, or SMD_2351 Into Transposon Gene in Chromosome of ATCC13032-Based Putrescine-Producing Strain

[0071] In order to examine whether chromosomal insertion of ARCH_0271, QWA_00075 or SMD_2351 gene affects putrescine export in KCCM11240P NCgl2522 having reduced putrescine export activity which was prepared in Reference Example 1, ARCH_0271, QWA_00075, or SMD_2351 was introduced into a transposon gene by the following method.

[0072] As a vector for transformation, which allows a gene insertion into the chromosome using a transposon gene of Corynebacterium sp. microorganism, pDZTn (WO 2009/125992) was used, and cj7 (WO 2006/65095) was used as a promoter.

[0073] Based on the nucleotide sequence of Arcanobacterium haemolyticum DSM 20595, ARCH_0271 gene was synthesized by optimizing the nucleotide sequence (SEQ ID NO: 7) for codon usage of Corynebacterium glutamicum. In the same manner, QWA_00075 derived from Alcaligenes faecalis subsp. faecalis NCIB 8687 and SMD_2351 derived from Stenotrophomonas maltophilia D457 were also synthesized by optimizing the nucleotide sequences (SEQ ID NO: 24, and SEQ ID NO: 27) for codon usage of Corynebacterium glutamicum, respectively. The genes synthesized were obtained as genes cloned into pGEM B1.

[0074] The plasmids thus obtained were designated as pGEM B1-ARCH_0271, pGEM B1-QWA_00075, and pGEM B1-SMD_2351, respectively.

[0075] A gene fragment of about 1.51 kb, 1.53 kb, or 1.53 kb was amplified using pGEM B1-ARCH_0271, pGEM B1-QWA_00075, or pGEM B1-SMD_2351 plasmid as a template and a pair of primers of SEQ ID NOs. 10 and 11, SEQ ID NOs. 28 and 29, or SEQ ID NOs. 30 and 31 (See Table 4), respectively. At this time, PCR reaction was carried out for 30 cycles of denaturation for 30 seconds at 95 C., annealing for 30 seconds at 55 C., and extension for 1 minute and 30 seconds at 72 C. Next, these PCR products were electrophoresed on a 0.8% agarose gel to elute and purify each band of the desired size.

[0076] Further, the cj7 promoter region was obtained by carrying out PCR for 30 cycles of denaturation for 30 seconds at 95 C., annealing for 30 seconds at 55 C., and extension for 30 seconds at 72 C. using p117-Pcj7-gfp as a template and a pair of primers of SEQ ID NOs. 8 and 9 (See Table 4). A fragment of the cj7 promoter gene was electrophoresed on a 0.8% agarose gel to elute and purify a band of the desired size.

TABLE-US-00004 Primer Sequence(5.fwdarw.3) CJ7-F TGTCGGGCCCACTAGT (SEQIDNO:8) AGAAACATCCCAGCGCTACTAATA CJ7-R AGTGTTTCCTTTCGTTGGGTACG (SEQIDNO:9) ARCH_0271-F CAACGAAAGGAAACACT (SEQIDNO:10) ATGCCAGACGTGTCCTCC ARCH_0271-R GAATGAGTTCCTCGAG (SEQIDNO:11) TTATTCGTGTGCATATGC QWA_00075-F CAACGAAAGGAAACACT (SEQIDNO:28) ATGTTGCACTCCCCCACCC QWA_00075-R GAATGAGTTCCTCGAG (SEQIDNO:29) TTAATCAGCATGGGAGCGGCC SMD_2351-F CAACGAAAGGAAACACT (SEQIDNO:30) ATGCCAGCAGCGCATTCAAATAG SMD_2351-R GAATGAGTTCCTCGAG (SEQIDNO:31) TTAGTGCTGAGTTGGATAGGCAG

[0077] pDZTn vector was digested with XboI, and fusion cloning of each PCR product obtained above was performed. In-FusionHD Cloning Kit (Clontech) was used in the fusion cloning. The resulting plasmids were designated as pDZTn-P(cj7)-ARCH_0271, pDZTn-P(cj7)-QWA_00075, and pDZTn-P(cj7)-SMD_2351, respectively.

[0078] Each of the three plasmids pDZTn-P(cj7)-ARCH_0271, pDZTn-P(cj7)-QWA_00075, and pDZTn-P(cj7)-SMD_2351 was introduced into Corynebacterium glutamicum KCCM11240P NCgl2522 having reduced putrescine export activity described in Reference Example 1 by electroporation to obtain transformants. The transformants were cultured with shaking in CM medium (10 g/l of glucose, 10 g/l of polypeptone, 5 g/l of yeast extract, 5 g/l of beef extract, 2.5 g/l of NaCl, and 2 g/l of uxea, pH 6.8) (30 C. for 8 hours). Subsequently, each cell culture was serially diluted from 10.sup.4 to 10.sup.10. Then, the diluted samples were plated and cultured on an X-gal-containing solid medium for colony formation.

[0079] From the colonies formed, the white colonies which appeared at relatively low frequency were selected to finally obtain strains in which the gene encoding ARCH_0271, QWA_00075 or SMD_2351 was introduced by secondary crossover. The strains finally selected were subjected to PCR using a pair of primers of SEQ ID NOs. 8 and 11, SEQ ID NOs. 8 and 29, or SEQ ID NOs. 8 and 31 to confirm introduction of the gene encoding ARCH_0271, QWA_00075 or SMD_2351. These Corynebacterium glutamicum mutant strain were designated as KCCM11240P NCgl2522 Tn:P(cj7)-ARCH_0271, KCCM11240P NCgl2522 Tn:P(cj7)-QWA_00075, and KCCM11240P NCgl2522 Tn:P(cj7)-SMD_2351, respectively.

<2-2> Introduction of ARCH_0271, QWA_00075, or SMD_2351 into Transposon Gene in Chromosome of ATCC13869-Based Putrescine-Producing Strain

[0080] In order to examine whether the chromosomal insertion of ARCH_0271 gene affects putrescine export in DAB12-b NCgl2522 having reduced putrescine export activity which was prepared in Reference Example 1, pDZTn-P(cj7)-ARCH_0271, pDZTn-P(cj7)-QWA_00075, or pDZTn-P(cj7)-SMD_2351 prepared above was introduced into Corynebacterium glutamicum DAB12-b NCgl2522 and strains are confirmed introduction of ARCH_0271, QWA_00075 or SMD_2351 into the transposon gene in the same manner as in Example <2-1>.

[0081] Corynebacterium glutamicum mutant strains thus selected were designated as DAB12-b NCgl2522 Tn:P(cj7)-ARCH_0271, DAB12-b NCgl2522 Tn:P(cj7)-QWA_00075, and DAB12-b NCgl2522 Tn:P(cj7)-SMD_2351, respectively.

<2-3> Evaluation of Putrescine Productivity of Corynebacterium sp.-Derived Putrescine-Producing Strain Introduced with ARCH_0271, QWA_00075 or SMD_2351

[0082] In order to confirm the effect of ARCH_0271 introduction on putrescine productivity in the putrescine-producing strain, putrescine productivities of the Corynebacterium glutamicum mutant strains prepared in Examples <2-1> and <2-2> were compared.

[0083] In detail, 10 types of Corynebacterium glutamicum mutants (KCCM11240P; KCCM11240P NCgl2522; KCCM11240P NCgl2522 Tn:P(cj7)-ARCH_0271; KCCM11240P NCgl2522 Tn:P(cj7)-QWA_00075; KCCM11240P NCgl2522 Tn:P(cj7)-SMD_2351; DAB12-b; DAB12-b NCgl2522; DAB12-b NCgl2522 Tn:P(cj7)-ARCH_0271; DAB12-b NCgl2522 Tn:P(cj7)-QWA_00075, and DAB12-b NCgl2522 Tn:P(cj7)-SMD_2351) were plated on 1 mM arginine-containing CM plate media (1% glucose, 1% polypeptone, 0.5% yeast extract, 0.5% beef extract, 0.25% NaCl, 0.2% urea, 100 l of 50% NaOH, and 2% agar, pH 6.8, based on 1 L), and cultured at 30 C. for 24 hours, respectively. 1 platinum loop of each strain thus cultured was inoculated in 25 ml of titer medium (8% Glucose, 0.25% soybean protein, 0.50% corn steep solids, 4% (NH.sub.4).sub.2SO.sub.4, 0.1% KH.sub.2PO.sub.4, 0.05% MgSO.sub.4.7H.sub.2O, 0.15% urea, 100 g of biotin, 3 mg of thiamine hydrochloride, 3 mg of calcium-pantothenic acid, 3 mg of nicotinamide, and 5% CaCO.sub.3, pH 7.0, based on 1 L), and then cultured with shaking at 30 C. and 200 rpm for 98 hours. 1 mM arginine was added to all media for culturing the strains. The putrescine concentration in each cell culture was measured, and the results are shown in the following Table 5.

TABLE-US-00005 TABLE 5 Putrescine Strain (g/L) KCCM 11240P 12.4 KCCM 11240P NCgl2522 1.9 KCCM 11240P NCgl2522 Tn:P(cj7)- ARCH_0271 17.7 KCCM 11240P NCgl2522 Tn:P(cj7)- QWA_00075 4.1 KCCM 11240P NCgl2522 Tn:P(cj7)- SMD_2351 3.5 DAB12-b 13.1 DAB12-b NCgl2522 0.5 DAB12-b NCgl2522 Tn:P(cj7)- ARCH_0271 17.5 DAB12-b NCgl2522 Tn:P(cj7)- QWA_00075 5 DAB12-b NCgl2522 Tn:P(cj7)- SMD_2351 4.1

[0084] As shown in Table 5, putrescine production was found to be increased in both 2 types of the ARCH_0271-introduced Corynebacterium glutamicum mutant strains. Further, putrescine production was found to be increased in the QWA_00075 or SMD_2351-introduced strain, compared to the parent strain, KCCM 11240P NCgl2522 or DAB12-b NCgl2522. It is indicating that QWA_00075 or SMD_2351 has putrescine export activity.

EXAMPLE 3

Fermentation of Cadaverine by ARCH_0271 Introduction and Lysine Decarboxylase Expression in Corynebacterium sp.-Derived Lysine-Producing Strain

<3-1> Introduction of ARCH_0271 into Transposon Gene in Chromosome of L-lysine-Producing Corynebacterium glutamicum KCCM11016P

[0085] In order to confirm cadaverine export activity of ARCH_0271 protein, ARCH_0271 gene was introduced into the chromosome of a lysine-producing strain KCCM11016P (this microorganism was deposited at the Korean Culture Center of Microorganisms on Dec. 18, 1995 with Accession Mo. KFCC10881, and then deposited at the International Depository Authority under Budapest Treaty with Accession Mo. KCCM11016P, Korean Patent No. 10-0159812). pDZTn-P(cj7)-ARCH_0271 prepared above was introduced into Corynebacterium glutamicum KCCM11016P and strain is confirmed introduction of ARCH_0271 into transposon in the same manner as in Example <2-1>.

[0086] A Corynebacterium glutamicum mutant strain thus selected was designated as KCCM11016P Tn:P(cj7)-ARCH_0271.

<3-2> Introduction of E. coli-Derived Lysine Decarboxylase Gene into L-lysine-Producing Strain Introduced ARCH_0271

[0087] The L-lysine-producing strain introduced ARCH_0271, KCCM11016P Tn:P(cj7)-ARCH_0271 which was prepared in Example <3-1> was introduced with E. coli-derived lysine decarboxylase gene in a plasmid form for cadaverine production. The nucleotide sequence (SEQ ID MO: 32) and amino acid sequence (SEQ ID NO: 33) of lysine decarboxylase ldcC from E. coli were obtained from NCBI data base.

[0088] An ldcC gene fragment of about 2.1 kb was obtained by carrying out PCR for 30 cycles of denaturation for 30 seconds at 95 C., annealing for 30 seconds at 52 C., and extension for 2 minutes at 72 C. using the chromosome of E. coli W3110 strain as a template and a pair of primers of SEQ ID NOS: 36 and 37 (See Table 6). This product was treated with HindIII and XbaI, and then electrophoresed in a 0.8% agarose gel to elute and purify a band of the desired size.

[0089] Further, the cj7 promoter region was obtained by carrying out PCR for 30 cycles of denaturation for 30 seconds at 95 C., annealing for 30 seconds at 55 C., and extension for 30 seconds at 72 C. using p117-Pcj7-gfp as a template and a pair of primers Of SEQ ID NOs. 34 and 35 (See Table 6). A gene fragment of the cj7 promoter gene was treated with KpnI and HindII, and then electrophoresed on a 0.8% agarose gel to elute and purify a band of the desired size.

TABLE-US-00006 TABLE6 Primerforpromotercj7gene CJ7-F_KpnI CGGGGTACC (SEQIDNO:34) AGAAACATCCCAGCGCTACTAATA CJ7-R-HindIII CCCAAGCTT (SEQIDNO:35) AGTGTTTCCTTTCGTTGGGTACG PrimerforE.colildcCgene ldcC-F_HindIII CCCAAGCTTAAGCTT (SEQIDNO:36) ATGAACATCATTGCCATTATGGG(52) ldcC-R_XbaI TGCTCTAGA (SEQIDNO:37) TTATCCCGCCATTTTTAGGACTC(53)

[0090] A gene fragment which was obtained by performing electrophoresis of KpnI and XbaI-treated pECCG117 (Biotechnology letters vol 13, No. 10, p. 721-726 (1991)) vector in a 0.8% agarose gel and then eluting and purifying a band of the desired size, the cj7 promoter gene fragment treated with KpnI and HindIII, and the lysine decarboxylase ldcC gene fragment treated with HindIII and XbaI were cloned using T4 DNA ligase (NEB). The E. coli ldcC-encoding plasmid obtained by the above experiment was designated as pECCG117-Pcj7-ldcC.

[0091] The prepared pECCG117-Pcj7-ldcC vector or pECCG117 vector was introduced into KCCM11016P and KCCM11016P Tn:P(cj7)-ARCH_0271 by electroporation, respectively. The transformants were plated on BHIS plate containing 25 g/ml kanamycin for selection. The selected strains were designated as KCCM11016P pECCG117, KCCM11016P pECCG117-Pcj7-ldcC, KCCM11016P Tn:P(cj7)-ARCH_0271 pECCG117, and KCCM11016P Tn:P(cj7)-ARCH_0271 pECCG117-Pcj7-ldcC, respectively.

<3-3> Evaluation of Cadaverine Productivity of Corynebacterium sp.-Derived Lysine-Producing Strain Having Chromosomal Insertion of ARCH_0271 and Lysine Decarboxylase Gene as Plasmid

[0092] In order to examine whether introduction of ARCH_0271 into the cadaverine-producing strain affects cadaverine production, cadaverine productivity was compared between Corynebacterium glutamicum mutant strains prepared in Example <3-2>.

[0093] In detail, 4 types of Corynebacterium glutamicum mutant strains (KCCM11016P pECCG117; KCCM11016P pECCG117-Pcj7-ldcC; KCCM11016P Tn:P(cj7)-ARCH_0271 pECCG117; and KCCM11016P Tn:P(cj7)-ARCH_0271 pECCG117-Pcj7-ldcC) were cultured by the following method, and cadaverine productivity was compared therebetween.

[0094] The respective mutant strains were plated on CM plate media (1% glucose, 1% polypeptone, 0.5% yeast extract, 0.5% beef extract, 0.25% NaCl, 0.2% urea, 100 l of 50% NaOH, and 2% agar, pH 6.8, based on 1 L), and cultured at 30 C. for 24 hours. Each of the strains cultured was inoculated to a 250 ml corner-baffled flask containing 25 ml of seed medium (2% glucose, 1% peptone. 0.5% yeast extract, 0.15% urea, 0.4% KH.sub.2PO.sub.4, 0.8% K.sub.2HPO.sub.4, 0.05% MgSO.sub.4 7H.sub.2O, 100 g of blotin, 1000 g of thiamine HCl, 2000 g of calcium-pantothenic acid, and 2000 g of nicotinamide, pH 7.0, based on 1 L), and cultured with shaking at 30 C. and 200 rpm for 20 hours.

[0095] Then, 1 ml of the seed culture was inoculated to a 250 ml corner-baffled flask containing 24 ml of production medium (4% Glucose, 2% (NH.sub.4).sub.2SO.sub.4, 2.5% soybean protein, 5% corn steep solids 0.3% urea, 0.1% KH.sub.2PO.sub.4, 0.05% MgSO.sub.4 7H.sub.2O, 100 g of biotin, 1000 g of thiamine hydrochloride, 2000 g of calcium-pantothenic acid, 3000 g of nicotinamide, 0.2 g of leucine, 0.1 g of threonine, 0.1 g of methionine, and 5% CaCO.sub.3, pH 7.0, based on 1 L), and then cultured with shaking at 30 C. and 200 rpm for 72 hours.

[0096] After culture, cadaverine productivities were measured by HPLC. The concentrations of cadaverine in the cell culture of each strain are given in the following Table 7.

TABLE-US-00007 TABLE 7 Cadaverine Strain Plasmid (g/L) KCCM11016P pECCG117 0 pECCG117-Pcj7-ldcC 2.3 KCCM11016P pECCG117 0 Tn:P(cj7)-ARCH_0271 pECCG117-Pcj7-ldcC 2.7

[0097] As shown in Table 7, cadaverine production was increased in the ARCH_0271-introduced Corynebacterium glutamicum mutant strains by more than 17%.

EXAMPLE 4

Fermentation of Diamine by Introduction of Protein Having Diamine Export Activity into E. coli

<4-1> Preparation of Strain by Introduction of ARCH_0271, QWA_00075, or SMD_2351 into W3110

[0098] In order to examine whether expression of Arcanobacterium haemolyticum DSM 20595-derived ARCH_0271, Alcaligenes faecalis-derived QWA_00075, or Stenotrophomonas maltophilia-derived SMD_2351 increases putrescine and cadaverine productions in wild-type E. coli strain W3110 having biosynthetic pathway of putrescine and cadaverine, Corynebacterium and E. coli shuttle vector-based pDZTn-P(cj7)-ARCH_0271, pDZTn-P(cj7)-QWA_00075, or pDZTn-P(cj7)-SMD_2351 was introduced into W3110, respectively.

[0099] A 2TSS solution (Epicentre) was used for transformation into E. coli, and the transformant was plated and cultured on LB plate (10 g of Tryptone, 5 g of Yeast extract, 10 g of NaCl, and 2% agar, based on 1 L) containing kanamycin (50 g/ml) for colony formation. The colonies thus formed were designated as W3110 pDZTn-P(cj7)-ARCH_0271, W3110 pDZTn-P(cj7)-QWA_00075, and W3110 pDZTn-P(cj7)-SMD_2351, respectively.

<4-2> Comparison of Diamine Productivity of E. coli Introduced with ARCH_0271, QWA_00075, or SMD_2351

[0100] Putrescine and cadaverine productivities of the strains obtained above were examined.

[0101] In detail, W3110 and W3110 pDZTn-P(cj7)-ARCH_0271, W3110 pDZTn-P(cj7)-QWA_00075, or W3110 pDZTn-P(cj7)-SMD_2351 were cultured on LB solid media at 37 C. for 24 hours.

[0102] Then, each of them was cultured in 25 ml of titration medium (2 g of (NH.sub.4).sub.2PO.sub.4, 6.75 g of KH.sub.2PO.sub.4, 0.85 g of citric acid, 0.7 g of MgSO.sub.4.7H.sub.2O, 0.5% (v/v) trace element, 10 g of glucose, 3 g of AMS, and 30 g of CaCO.sub.3, based on 1 L) at 37 C. for 24 hours. A trace metal solution contained 5 M HCl: 10 g of FeSO.sub.4.7H.sub.2O, 2.25 g of ZnSO.sub.4.7H.sub.2O, 1 g of CuSO.sub.4.5H.sub.2O, 0.5 g of MnSO.sub.4. 5H.sub.2O, 0.23 g of Na.sub.2B.sub.4O.sub.7. 10H.sub.2O, 2 g of CaCl.sub.2.2H.sub.2O, and 0.1 g of (NH.sub.4).sub.6Mo.sub.7O.sub.2.4H.sub.2O per 1 liter.

[0103] The concentrations of putrescine and cadaverine produced from each cell culture were measured, and the results are given in the following Table 8.

TABLE-US-00008 TABLE 8 Parent Putrescine Cadaverine strain Plasmid (mg/L) (mg/L) W3110 () 13 5 pDZTn-P(cj7)- 51 23 ARCH_0271 pDZTn-P(cj7)- 72 30 QWA_00075 pDZTn-P(cj7)- 37 15 SMD_2351

[0104] As shown in Table 8, compared to the parent strain W3110, putrescine and cadaverine productions were remarkably increased in W3110 pDZTn-P(cj7)-ARCH_0271, W3110 pDZTn-P(cj7)-QWA_00075, or W3110 pDZTn-P(cj7)-SMD_2351 strain which was introduced with ARCH_0271, QWA_00075 or SMD_2351, respectively.

[0105] That is, it was confirmed that the amount of diamine produced in cell culture was remarkably increased by enhancing activity of the ARCH_0271, QWA_00075 or SMD_2351 protein having 56%, 41%, or 52% sequence homology with the amino acid sequence of NCgl2522, suggesting that the ability to export diamine such as putrescine and cadaverine can be improved by enhancing activity of CE2495 or the protein having 42% or higher sequence homology therewith.

[0106] As such, the present inventors demonstrated that Corynebacterium glutamicum having enhanced ARCH_0271 activity prepared by introducing ARCH_0271 into transposon of Corynebacterium sp. microorganism KCCM11240P NCgl2522 which has a putrescine synthetic pathway, but a reduced putrescine export activity has enhanced putrescine export activity, thereby producing putrescine in a high yield.

[0107] Accordingly, this strain KCCM11240P NCgl2522 Tn:P(cj7)-ARCH_0271 was designated as CC01-0758, and deposited under the Budapest Treaty to the Korean Culture Center of Microorganisms (KCCM) on Nov. 15, 2013, under Accession No. KCCM11476P.